CHEMOTAXIS AND FORAGING BEHAVIOR IN OCTOPUS RUBESCENS

Anna Fabrizio University of Washington

School of Aquatic and Fisheries Sciences Seattle, Washington, USA

March 2009

Assignment for FISH 494

ABSTRACT Octopuses are one of the most complex invertebrates and have a well-developed sensory system.

Part of that sensory system is their ability to sense chemical cues and “taste” things in their

environment through their suckers. Limited studies have studied the ability of octopuses to orient

themselves to chemical cues over distance. Previous studies have only explored the potential of

octopuses to respond to direct chemical cues or extracts from crustaceans. The purpose of this

study was to explore distance chemotaxis abilities of octopuses when exposed to live prey.

Octopus rubescens were put through behavioral trials in a Y-maze to determine if they could find

prey in the maze based on “taste” alone. Both blind and visual trials were done to observe

differences between hunting with vision and hunting by chemotaxis. The octopuses were most

responsive during visual trials and were able to successfully find the crab during 54% of the

visual trials. The octopuses were less responsive during blind trials and only found the crab one

time. Additionally, gene expression and protein analysis was done on the prey of the octopuses

during the trials: the shore crab Hemigrapsus oregonensis. Analysis was done to determine if

there is a significant difference in stressed organisms and that it would cause octopuses to find

stressed organisms easier. No conclusions were drawn from the gene expression analysis. The

protein analysis appeared to show that two proteins (an arginine kinase and superoxide

dismutase) were expressed more frequently in stressed crabs compared to unstressed crabs.

Further research is needed to determine whether or not octopuses can find live prey using

distance chemotaxis.

INTRODUCTION

Over 300 octopus species are distributed in just about every habitat throughout the world’s

oceans. As one of the most advanced invertebrates, octopuses have been a point of interest for

behavioral study in a wide variety of capacities. Their neurological network is particularly

complex in that they have a developed brain but lack a spinal column. Their arm functions are

also partially independent from the brain, meaning that each individual arm can perform a

separate task from the other arms (Sumbre et al. 2001). This is especially useful when hunting

for food. Their well-developed vision is also used frequently in hunting (Lee 1992).

Octopus diets vary depending on habitat, prey availability and life stage (Rodhouse and

Nigmatullin 1996). Octopuses feed on live prey and are opportunistic predators. Through

observation and stomach content studies, octopuses have been shown to feed on practically

anything they come across while they are foraging. Adult octopuses will feed primarily on a

variety of different crustaceans and mollusks. Some octopuses will also feed on fish or other

cephalopods.

While a variety of foraging behaviors have been defined they are generally categorized into two

main behaviors: “poke” (also known as probing or groping) and web-over (also known as web-

casting or pouncing) (Mather 1991a). Poke hunting is generally described as when octopuses

extend one or more arms or arm tips into crevices, holes, between rocks or in any hidden

environment location where food may be located (Mather 1991a). Web-over hunting is described

as when an octopus covers part of its environment by arranging the arms in such a way that the

membranes between the bases of the arms forms an encompassing web so that any organisms

inside the web are trapped (see Figure 6) (Mather 1991a; Yarnall 1969; Forsythe and Hanlon

1997).

Although these behaviors are primarily tactile in nature, they are also dependent on the visual

ability of an octopus in its environment (Forsythe and Hanlon 1997). More complex

environments provide less visual range for octopuses to distinguish specific prey. In these

environments, such as coral reefs and rocky bed, octopuses are more likely to use poke

behaviors. In less complex environments, where hiding places of prey can be more easily

identified, then they are more likely to use the web-over technique.

Most octopuses are nocturnal feeders and many live in deeper waters where vision is

compromised. Therefore, their chemoreceptive abilities are assumed to be highly developed.

Octopuses have chemoreceptors in their suckers (Graziadei 1962). Each is individually

controlled by nerves and is connected to the brain through complex nerves in the arm. The

chemoreceptors in their suckers are quite sensitive. Octopuses have been shown to be able to

identify between identical objects based on the solution that they have been soaked in (Wells

1963).

Lab tests have shown that octopuses can follow chemical cues over distance through Y-mazes,

suggesting a distance chemotaxis that does not rely on visual cues (Chase and Wells 1986; Lee

1992). However, these test procedures have not mimicked natural prey encounters well.

Therefore, distance chemoreception in octopuses may not be as developed as these tests would

seem to indicate. It is more likely, and more often observed, that octopuses rely on visual cues to

orient themselves to their environment, including when they are foraging (Mather 1991a; Mather

1991b; Yarnall 1969; Mather and O’Dor 1991). This sort of visual connection and learning is

indicative of the octopus’ well-developed brain and can even be suggestive of consciousness

(Mather 2008).

The purpose of this research is to expand on previous distance chemotaxis studies by addressing

the issue of using live prey during Y-maze experiments. Since previous experiments had not

directly used live prey in their studies, the question of whether or not octopuses use distance

chemotaxis in natural circumstances has not been answered. Furthermore, Octopus rubescens has

not been used in any previous chemotaxis studies.

MATERIALS AND METHODS Animals

Four wild-caught Octopus rubescens were collected from Puget Sound and brought to the Seattle

Aquarium where the behavioral experiments took place. The octopuses were kept in separate

holding containers in tanks of re-circulating, filtered seawater from Puget Sound. Two octopuses

were used for Y-maze experiments. Prior to the start of experimentation, all octopuses were put

on a fasting regimen consisting of feeding one live Hemigrapsus oregonensis once every three

days. Tests were conducted on feeding days once experimentation commenced.

H. oregonensis specimens were collected by the researcher during low tides at local beaches. A

total of 101 individuals were collected from the Golden Gardens beach in Seattle, WA and the

Des Moines Marina beach in Des Moines, WA. They were size-selected for individuals with

carapace length between 3 and 5 cm. They were kept in a container in a separate holding tank

from the octopuses.

Y-maze behavior experiments

Set-up

A 0.61 x 0.305 x 0.305-m (2 x 1 x 1-ft) tank was retrofitted to form a Y-maze. Water in-flow

came in from the aquarium’s filtered seawater supply, through plastic tubing to a tube splitter

and into two valves that lead into the tank. Water flowed at the same rate through both in-flow

valves. Water flowed out of the tank through a standpipe at the opposite end of the tank. The

tank also had a two-piece lid made of clear plexiglass.

To form a Y-maze within the tank, plexiglass dividers were constructed and placed within the

tank. The half of the tank containing the standpipe was separated from the other half using a

clear, plexiglass wall with a hole near the bottom for the octopuses to crawl through. A plastic

grating was placed in front of the hole and secured in place using a plastic clamp during

acclimation periods. The half of the tank containing the in-flow pipes was divided using a T-

shaped plexiglass structure that was either black (opaque) or clear. The black T was used during

blind trials and the clear T was used during visual trials. Water flow through the tank was tested

using green food dye. No mixing was shown between the arms of the Y-maze. Dye flowed

directly through the arm, through the hole in the dividing wall and to the standpipe without

contaminating the water flowing out of the other arm. It took about 1-2 minutes for the dye to

reach the holding compartment and thoroughly mix.

Boxes were constructed to hold the crabs at the ends of the Y-maze arms. Clear boxes were

constructed that minimized water leakage from the inside of the box to the water in the tank.

Opaque boxes were constructed out of black plastic grating with < 2-cm holes. These boxes were

also modified to clip onto the piping coming into the tank from the water in-flow valves. This

was so the water flowing into the Y-maze arms would flow directly past the crabs before

entering the tank.

The tank was blacked out using plastic black sheeting to eliminate light and movement

distractions. The sides and bottom of the tank were covered. For the first half of testing, only the

Y-maze half of the tank was blacked out. For the second half of testing, due to space issues at the

aquarium, the tank was moved and the remainder of the tank was blacked out. The top of the

tank was left clear for observation. (Fig 1)

Figure 1. Test tank diagram. Arrows indicate direction of water flow. Components: a) standpipe, b) barrier wall, c) hole in barrier wall, d) plastic grating (to cover hole during acclimation), e) T-wall, f) crab boxes, g) in-flow valves Testing procedure

Octopuses were moved from their home tanks to the testing tank by removing the individual

containers from the home tank and putting them in the testing tank and allowing the octopuses to

swim out. The octopuses were then allowed to acclimate to the tank for 5-10 minutes (based on

preliminary trials and previous studies) with the grating in place on the divider to prevent the

octopus from entering the maze. Then a crab was moved from the holding container into one of

the boxes. A number randomizer was used to determine which arm the crab would be put in

during each test. The number randomizer was also used to determine which trial was to be done

on which days. This was done to prevent the octopuses from exhibiting learned behavior. After

the crab was placed in the box, 1-2 minutes was allowed for any crab “smell” to reach the

holding compartment of the tank. Then the grating was removed from the middle barrier and the

octopus was observed for about 40 minutes. After 40 minutes, the trial would stop, regardless of

whether or not the octopus made a choice. Data was collected regarding time of day and size of

crab, and when a choice was made, the time elapsed for the octopus to go through the barrier and

the time elapsed for the octopus to make a choice. The octopus was determined to have crossed

the barrier when its head passed through the hole. A choice was determined to be made when the

octopus’ head passed around the barrier into the Y-maze arm.

Crab analysis

H. oregonensis specimens were subjected to stress tests to analyze any differences between

stressed and non-stressed crabs through gene expression and protein analysis. To induce

mechanical stress on the crabs, 6 individuals were placed in a salad spinner and spun rapidly for

2.5 minutes. After being spun, the 6 experimental crabs were each placed in 13 mL of filtered

seawater in individual beakers. In addition, 6 control crabs were also placed in 13 mL of filtered

seawater in individual beakers. The crabs were allowed to remain in the water baths for 1 hour,

to give them time to excrete any stress-related compounds. At the end of an hour, the water

samples were collected into 15 mL conical tubes and placed in a -20 C freezer for future

analysis. The crabs were then quickly sacrificed and dissected. The gills were removed from

each individual. One gill from removed for RNA analysis and the other gill was used for protein

analysis.

Protein analysis

Each gill was placed in 0.5 mL of CelLytic MT solution in 1.5 mL Eppendorf microcentrifuge

tubes and was then homogenized thoroughly. The solution was spun in a microfuge for 10

minutes and the supernatant, containing the extracted protein, was transferred to a new tube then

stored at -20C. The protein was quantified using a Bradford assay but not normalized. Then an

SDS-PAGE was run for 30 minutes at 150 V. The gel was soaked in Coomassie stain for 5

minutes and then rinsed in acetic acid. This was repeated twice, then allowed to rinse in acetic

acid overnight.

Protein identification was accomplished by comparing the protein bands to brachyuran protein sizes in the Swiss Institute of Bioinformatics ExPASy Proteomics TagIdent tool. Gene expression

RNA was extracted from each gill using the Tri-Reagent method. The extracted RNA was

reverse transcribed to cDNA using AMV RTranscriptase. The cDNA was amplified, with

designed primers, using standard PCR protocol at annealing temperatures of either 50C or 55C.

Amplified cDNA was then run through an agarose gel at 105-110V for 30-40 minutes.

Primers were designed, using NCBI, for three stress-related genes identified in Carcinus maenas,

a closely related crab species. (Table 1, Table 2) The three genes were for: crustacean

hyperglycemic hormone (2 primers: CHH and CHH6), metallothionein (Mt), and Na+/K+-

ATPase (Na/K).

Gene Abbrev. Accession # mRNA for crustacean hyperglycemic hormone (CHH) CHH X17596

CHH (PO-type) variant 6 precursor, mRNA, complete cds CHH6 AF286086

mRNA for metallothionein (Mt gene)

Mt AM743086

Na+/K+-ATPase alpha subunit mRNA, partial cds

Na/K AY035550

Table 1. Carcinus maenas genes and accession numbers Gene Primer sequence

Forward CCTCGCCAATGGAGCCCAGC CHH Reverse CCTGGAGGCACGCGAGGAGA Forward CACGCTCCACGCCAGGCTAC CHH6 Reverse CCTGCAGGCCGAGGCAACAT Forward AAGTGCACCTCCTGCCGCTG Mt Reverse AGCGTCCATCAGCATCCCGC Forward TCCAGGGACCCCAGACGCAG Na/K Reverse TAGTCTCCGCCACGGCTGCT

Table 2. Primer sequences for C. maenas genes Water samples

Water samples were analyzed using a commercial saltwater aquarium testing kit (Aquarium

Pharmaceuticals Saltwater Master Test Kit) for pH, ammonia, nitrite, and nitrate. Two trials were

done per test per sample for 10 different water samples (5 control and 5 stressed), except for

nitrate where only one trial was done per sample. Filtered seawater was also tested as a control.

RESULTS

Behavior experiments

19 total trials were performed: 12 with Octopus 1 (O1) and 7 with Octopus 2 (O2). (Table 3) Out

of the 19 trials, 8 resulted in a choice. During 7 of the choice trials, the octopus chose the arm

containing the crab. Out of the 8 choice trials, 2 were blind trials. One blind choice trial resulted

in the octopus choosing the non-crab arm.

OCTOPUS 1 Trial

# Type Arm Time

through hole Time

to choice Total time

Choice

1 Visual L 709 31 740 crab 2 Visual R - - - - 3 Blind R - - - - 4 Visual L 583 12 595 crab 5 Blind L - - - - 6 Visual R 1249 6 1255 crab 7 Blind R - - - - 8 Visual L - - - - 9 Visual R 691 2 693 crab 10 Visual R 584 22 606 crab 11 blind L 315 30 345 crab 12 blind R - - - - OCTOPUS 2 Trial

# Type Arm Time

through hole Time

to choice Total time

Choice

1 Visual L - - - - 2 Visual R 1760 124 1884 crab 3 Blind R - - - - 4 Visual L - - - - 5 Blind L - - - - 6 Visual R - - - - 7 Blind R 1914 11 1925 Non-

crab Table 3. Behavioral trial results showing the type of trial, the arm the crab was placed in, the amount of time through the hole in the barrier wall and time to choice once past the barrier (if choice was made). All time is in seconds.

VISUAL BLIND Figure 2. Choice data for visual and blind trials.

Behaviorally, octopuses exhibited more frequent active behavior during visual trials. They would

“stand” by raising their body with their arms, change color, and/or use their arms to reach away

from themselves in an explorative nature. These behaviors were expressed 100% of the time

during visual trials and 63% of the time during blind trials. Octopuses were also more likely to

interact with the researcher during blind trials.

Figure 3. Amount of active behavior shown during visual and blind trials.

VISUAL BLIND

Water sample analysis

No significant differences between stressed

and non-stressed water samples were seen.

(Table 4) However, for the nitrate tests, the

stressed crab water samples had lower

average nitrate than the non-stressed crabs.

Protein analysis The protein gel showed bands in all samples.

(Figure 2) From the gel, 11 proteins of

interest were identified and compared to

sizes on the public database. Out of the 11, 2

proteins were unidentifiable, 5 proteins were

identified as arginine kinase, 1 protein was identified as hemocyanin subunit 2, 1 protein was

identified as superoxide dismustase, and 2 cuticle proteins were also identified.

Figure 2. SDS-PAGE. On the left is the unmodified gel showing bands. On the right is the modified gel, showing the 11 proteins of interest. From top to bottom: hemocyanin subunit 2, unidentified, 3-7: arginine kinase, unidentified, superoxide dismutase, 10-11: cuticle proteins.

Sample pH Ammonia (mg/L)

Nitrite (ppm)

Nitrate (ppm)

Filtered seawater

7.4 0.0 0.0 120

C1 8.4 0.25 0 10 C2 8.4 0.375 0.125 20 C3 8.8 0.25 0 10 C4 8.8 0.25 0 10 C5 7.8 0.25 0 20 S1 8.4 0.25 0 5 S2 8.4 0.25 0 5 S3 8.6 0.25 0 5 S4 8.4 0.5 0 10 S5 8.4 0.25 0 5

Table 4. Water sample testing results for filtered seawater (control), C1-C5 (unstressed crabs), and S1-S5 (stressed crabs)

Gene expression

Genes were able to be amplified onto PCR gels. The CHH and Na/K primers seemed to work the

best out of the four primers. However, due to unidentifiable contamination and/or issues with the

primers, the PCR gels did not provide any quality banding or conclusive results.

DISCUSSION O. rubescens was shown to have the ability to adapt to the testing conditions of Y-maze

experiments, as other octopus species have been shown in the past. The individuals showed that

there is the possibility for limited chemotaxis in the species. In addition, specific proteins were

identified in H. oregonensis that could potentially be involved with predator identification of the

crabs.

Behavior trials

Although no definitive conclusions can be reached due to the results, the trials do seem to

indicate that the octopuses do respond to this type of testing procedure. Even though the majority

of the trials in which an animal made a choice were visual trials, the two blind trials are still

important.

The blind trial in which the octopus did find the crab (O1 - #11) is particularly important. It

suggests that there was some cue that the octopus responded to and it is likely that that it was a

chemical cue. This trial did happen after several choice trials were completed with O1, which

could mean that the octopus did learn how to go through the maze to find food. However, this

trial was done more than two weeks after the previous trial, which had been shown during this

process to be a significant enough amount of time for the octopuses to “forget” about the testing

procedure. (The octopuses would react negatively to the researcher when time between trials was

greater than 1 week.)

The second blind trial in which the octopus made a choice (O2 - #7) is also significant as is the

only trial where an octopus chose to go down the arm not containing the crab. This animal had

been showing increasingly aggressive behavior as the trials had progressed and it is possible that

the choice was merely made because the octopus wanted to move around. However, she did

quickly make a choice once it went through the barrier, suggesting that she knew where she

wanted to go based on a cue of some kind. During the one prior trial with O2 where she made a

choice (O2 - #2), the crab had been in the right arm. During this trial, the arm with the crab was

on the left. It is possible, but not probable, that the octopus remembered that the crab was in the

right arm during the previous trial. However, almost 3 weeks had passed between the two trials.

All the visual trials were fairly consistent regarding the behavior of the octopuses. Their direct

behavioral response to visual identification of the crab was apparent and much more frequent

than the blind trials. This suggests that the octopuses respond more readily to visual cues than

chemical cues. The importance of their vision was also indicated during blind trials when the

octopuses would interact with the researcher. The interaction increased once the entirety of the

tank was blacked out on all sides during the second half of testing. This resulted in frequent

behavior termed “peek-a-boo behavior” by O1. O1 would position herself near the surface of the

water in such a way that she could have visual contact with the researcher during observation

periods if visual contact was obstructed. O2 developed a more aggressive tendency during the

second half of testing. She would frequently try to escape down the standpipe but also directly

interacted with the researcher during transportation between tanks as well as during observation

periods. This generally manifested itself as excessive squirting of water through the siphon at the

researcher and attempts to grab onto and bite the researcher’s hands. This happened more

frequently during blind trials than during visual trials. The increased interactive behavior of the

octopuses during blind trials suggests that when the octopuses were placed in an environment

with no visual complexity, they will show more interest in things outside of their immediate

environment.

Further behavioral tests are needed for definitive results on the ability of octopuses to orient

themselves over distance to chemical cues in live prey. Future studies should involve longer time

periods as well as a larger number of test animals, to further reduce personality and behavioral

biases. The excretions of crabs (or other prey items) should also be measured to determine the

concentration of chemical signals that could potentially be detected by octopuses. Prey choices

could also include other taxa, such as bivalves.

Water sample analysis

The water samples were stored at -20C for over two months before they were tested. It is

probable that the length of storage resulted in an inaccurate measurement of any of the tests run.

The nitrate control (filtered seawater) was at an abnormally high level (120 ppm). For control

purposes, the ideal amount of nitrate in the filtered seawater should have been between 0-2 ppm.

The original filtered seawater was unlikely to have such a high level of nitrate since the nitrate

levels for the water samples was much lower than this.

Water sample test results from stressed crabs, compared to non-stressed crabs, should show

higher ammonia levels (due to increased ammonia excretion), higher pH (due to increased

respiration), higher nitrite (due to increased ammonia excretion), and higher nitrate (due to

increased waste production). Future tests on the excretions of stressed crabs should be done

immediately after gathering water samples.

Protein analysis

The superoxide dismutase protein as well as one arginine kinase protein seemed to be expressed

more in stressed crabs than non-stressed crabs. This is expected because superoxide dismutase

and arginine kinase are expressed during stress. Superoxide dismutase is used in anti-oxidant

defense by breaking down reactive oxygen species that can be created in excess during stress.

Arginine kinase increases the production of ATP, which is needed at various levels during times

of stress. However, since 4 other arginine kinase proteins were expressed in varying patterns.

The cuticle proteins expressed were most likely seen due to contamination during the dissection

of the crabs. The hemocyanin subunit 2 protein was most highly expressed due to the fact that

the tissue sampled was gill tissue.

Further tests of the effect of mechanical stress on crabs may need to include more intensive stress

on the crabs. It is possible that more definitive effects of stress could have been seen in the

protein gel if the crabs had been exposed to a longer period of time in the salad spinner. Other

tissues may also be tested to look for different stress-related proteins. The gill tissue had low

amounts of protein in them originally and it may be more beneficial to look at a tissue that would

contain a higher concentration of proteins.

Gene expression

The RNA extraction protocol was done over the span of several weeks, rather than being finished

immediately. In addition, the amount of RNA extracted was unable to be quantified or

normalized due to unknown contamination. Due to time constraints, and limited resources for

crab specimens, these procedures were unable to be re-done. The primers, however, seemed to be

a good choice for analyzing gene expression in the gills. Future trials could include these primers

to analyze the gene expression in gill tissues. Future trials could also analyze different tissues,

particularly if different tissues were analyzed for protein expression.

Conclusion

Although this study does not conclusively prove that octopuses cannot use distance chemotaxis

when searching for live prey, it does bring more questions into play. Further studies, particularly

behavioral studies, with octopuses and live prey in maze situations or other directional choice

trials are required to determine the distance chemotaxis abilities of octopuses. Another aspect to

analyze could be the difference in chemotaxis abilities for octopuses when prey animals are

stressed. It is possible that stress can increase the excretion of compounds that octopuses can

taste in the water, thereby making it easier to find prey that are stressed than prey that are not.

The sensitivity of octopus’ chemoreceptive capability is something that is still being explored.

Recent research is also continuing to explore octopus foraging behavior in the wild. The question

of distance chemotaxis in octopuses is something that can help identify the overall abilities of

octopuses to hunt as well as help explore the overall complexity of the octopus nervous system.

Their ability to find live prey over distance through chemotaxis is something that must be

addressed to understand the full capacity of octopus sensory systems.

REFERENCES

Chase, R., and Wells, M.J. 1986. CHEMOTACTIC BEHAVIOR IN OCTOPUS. Journal of Comparative Physiology a-Sensory Neural and Behavioral Physiology 158(3): 375-381.

Forsythe, J.W., and Hanlon, R.T. 1997. Foraging and associated behavior by Octopus cyanea Gray, 1849 on a coral atoll, French Polynesia. Journal of Experimental Marine Biology and Ecology 209(1-2): 15-31.

Graziadei, P. 1962. RECEPTORS IN SUCKERS OF OCTOPUS. Nature 195(4836): 57-&.

Lee, P.G. 1992. CHEMOTAXIS BY OCTOPUS-MAYA VOSS ET SOLIS IN A Y-MAZE. Journal of Experimental Marine Biology and Ecology 156(1): 53-67.

Mather, J.A. 1991a. FORAGING, FEEDING AND PREY REMAINS IN MIDDENS OF JUVENILE OCTOPUS-VULGARIS (MOLLUSCA, CEPHALOPODA). Journal of Zoology 224: 27-39.

Mather, J.A. 1991b. NAVIGATION BY SPATIAL MEMORY AND USE OF VISUAL LANDMARKS IN OCTOPUSES. Journal of Comparative Physiology a-Sensory Neural and Behavioral Physiology 168(4): 491-497.

Mather, J.A. 2008. Cephalopod consciousness: Behavioural evidence. Consciousness and Cognition 17(1): 37-48.

Mather, J.A., and Odor, R.K. 1991. FORAGING STRATEGIES AND PREDATION RISK SHAPE THE NATURAL-HISTORY OF JUVENILE OCTOPUS-VULGARIS. Bulletin of Marine Science 49(1-2): 256-269.

Rodhouse, P.G., and Nigmatullin, C.M. 1996. Role as consumers. Philosophical Transactions of the Royal Society of London Series B-Biological Sciences 351(1343): 1003-1022.

Sumbre, G., Gutfreund, Y., Fiorito, G., Flash, T., and Hochner, B. 2001. Control of octopus arm extension by a peripheral motor program. Science 293(5536): 1845-1848.

Wells, M.J. 1963. TASTE BY TOUCH - SOME EXPERIMENTS WITH OCTOPUS. Journal of Experimental Biology 40(1): 187-&.

Yarnall, J.L. 1969. ASPECTS OF BEHAVIOUR OF OCTOPUS-CYANEA GRAY. Animal Behaviour 17: 747-&.