epigenetic regulation of angiogenesis by jarid1b...

1645

A healthy vascular endothelium is antiatherosclerotic, pro-motes vasodilatation, provides an anticoagulatory sur-

face, and is able to perform angiogenesis. During endothelial dysfunction, these properties are lost and endothelial cells (ECs) promote vascular disease development.1,2 Understanding the fundamental mechanisms governing endothelial pheno-type switching offers novel approaches to prevent and alter the course of vascular disease. Epigenetic mechanisms con-serve the cellular identity and give rise to developmental pro-cesses. Changing epigenetic marks therefore is an innovative approach to promote changes of the cellular phenotype. The epigenetic control of EC biology, however, is incompletely understood.2–4

Histone methylation is an important mechanism of epi-genetic regulation. Trimethylation at histone 3 lysine 4 (H3K4me3), located in promoter regions, is associated with gene expression.5,6 Modifiers of H3K4me3, methyltransfer-ases and demethylases, have fundamental roles in biological processes, such as embryonic development, stem cell biol-ogy,6 and cancer development.7

Multiple enzymes are involved in the demethylation of H3K4, among them enzymes of the JARID1 family (JARID1A to JARID1D). Up to now, the mechanisms rendering gene-spe-cific H3K4-demethylation are not understood and the function of several of the H3K4 demethylases in the cardiovascular sys-tem has not been studied in detail. The demethylase LSD1 has

© 2015 American Heart Association, Inc.

Arterioscler Thromb Vasc Biol is available at http://atvb.ahajournals.org DOI: 10.1161/ATVBAHA.115.305561

Objective—Altering endothelial biology through epigenetic modifiers is an attractive novel concept, which is, however, just in its beginnings. We therefore set out to identify chromatin modifiers important for endothelial gene expression and contributing to angiogenesis.

Approach and Results—To identify chromatin modifying enzymes in endothelial cells, histone demethylases were screened by microarray and polymerase chain reaction. The histone 3 lysine 4 demethylase JARID1B was identified as a highly expressed enzyme at the mRNA and protein levels. Knockdown of JARID1B by shRNA in human umbilical vein endothelial cells attenuated cell migration, angiogenic sprouting, and tube formation. Similarly, pharmacological inhibition and overexpression of a catalytic inactive JARID1B mutant reduced the angiogenic capacity of human umbilical vein endothelial cells. To identify the in vivo relevance of JARID1B in the vascular system, Jarid1b knockout mice were studied. As global knockout results in increased mortality and developmental defects, tamoxifen-inducible and endothelial-specific knockout mice were generated. Acute knockout of Jarid1b attenuated retinal angiogenesis and endothelial sprout outgrowth from aortic segments. To identify the underlying mechanism, a microarray experiment was performed, which led to the identification of the antiangiogenic transcription factor HOXA5 to be suppressed by JARID1B. Importantly, downregulation or inhibition of JARID1B, but not of JARID1A and JARID1C, induced HOXA5 expression in human umbilical vein endothelial cells. Consistently, chromatin immunoprecipitation revealed that JARID1B occupies and reduces the histone 3 lysine 4 methylation levels at the HOXA5 promoter, demonstrating a direct function of JARID1B in endothelial HOXA5 gene regulation.

Conclusions—JARID1B, by suppressing HOXA5, maintains the endothelial angiogenic capacity in a demethylase-dependent manner. (Arterioscler Thromb Vasc Biol. 2015;35:1645-1652. DOI: 10.1161/ATVBAHA.115.305561.)

Key Words: angiogenesis ◼ epigenetics ◼ growth and development ◼ Kdm5b protein, mouse ◼ promoter regions, genetic

Received on: March 2, 2015; final version accepted on: May 17, 2015.From the Institute for Cardiovascular Physiology, Medical Faculty (C.F., L.G., J.H., I.J., M.S.W., M.S.L., R.P.B.), Institutes of Vascular Signalling (J.H.,

I.F.) and Cardiovascular Regeneration (Y.P., S.U.), Centre for Molecular Medicine, and Institute of Pharmaceutical Chemistry/ZAFES (D.S.), Goethe-University Frankfurt, Frankfurt am Main, Germany; Biotech Research and Innovation Centre (BRIC) (M.A., S.U.S., K.H.), Centre for Epigenetics (M.A., S.U.S., K.H.), University of Copenhagen, Copenhagen, Denmark; and German Center for Cardiovascular Research (DZHK), Partner site RheinMain, Frankfurt, Germany (C.F., L.G., J.H., I.J., M.S.W., Y.P., S.U., I.F., M.S.L., R.P.B.).

The online-only Data Supplement is available with this article at http://atvb.ahajournals.org/lookup/suppl/doi:10.1161/ATVBAHA.115.305561/-/DC1.Correspondence to Christian Fork, PhD, Institut für Kardiovaskuläre Physiologie, Fachbereich Medizin der Goethe-Universität, Theodor Stern Kai 7,

60590 Frankfurt, Germany. E-mail [email protected]

Epigenetic Regulation of Angiogenesis by JARID1B-Induced Repression of HOXA5

Christian Fork, Lunda Gu, Juliane Hitzel, Ivana Josipovic, Jiong Hu, Michael SzeKa Wong, Yuliya Ponomareva, Mareike Albert, Sandra U. Schmitz, Shizuka Uchida, Ingrid Fleming,

Kristian Helin, Dieter Steinhilber, Matthias S. Leisegang, Ralf P. Brandes

by guest on June 27, 2018http://atvb.ahajournals.org/

Dow

nloaded from


Dow

nloaded from


Dow

nloaded from


Dow

nloaded from


Dow

nloaded from


Dow

nloaded from


Dow

nloaded from


Dow

nloaded from


Dow

nloaded from

http://atvb.ahajournals.org/lookup/suppl/doi:10.1161/ATVBAHA.115.305561/-/DC1

mailto:[email protected]

http://atvb.ahajournals.org/









1646 Arterioscler Thromb Vasc Biol July 2015

been shown to maintain endothelium-dependent relaxation.8 For JARID2, an important role of endocardial-driven cardiac development has been reported.9,10 The function of the other JARID enzymes in the cardiovascular system has not been studied. In this study, we found the enzyme JARID1B, which has been implicated in cell fate decision, cancer progression, and stem cell self-renewal,5,11–13 to be highly expressed in ECs. By its JmjC domain, JARID1B catalyzes the demethyl-ation of H3K4me2 and H3K4me3.14,15 Through this function, JARID1B is involved in the repression of transcription during embryonic development and in embryonic and hematopoietic stem cells.5,8,11,12,16,17 Therefore, genetic deletion of JARID1B impairs mouse and porcine embryonic development.18–21

Considering its effect on gene regulation, we hypothesized that JARID1B affects the expression of endothelial genes and examined the consequences on angiogenesis in human umbili-cal vein ECs (HUVECs), tamoxifen-inducible conditional, and in the endothelial-specific Jarid1b knockout mouse.

Materials and MethodsMaterials and Methods are available in the online-only Data Supplement.

ResultsJARID1B Is Highly Expressed in HUVECsTo study whether JARID1B has a role in the endothe-lium, we used HUVECs. Microarray expression analysis of

several histone-modifying enzymes particularly demethylases revealed that JARID1B was of the studied genes the second most highly expressed, after LSD1, histone-modifying enzyme in ECs (Figure 1A). Quantitative reverse transcription poly-merase chain reaction validation of the array data, however, indicated that JARID1B was expressed at higher levels than all other histone demethylase, including LSD1 (Figure 1B). Western blot analysis confirmed the expression of JARID1B protein in HUVECs, whereas expression in smooth muscle cells and blood-derived angiogenic myeloid cells were much lower (Figure 1C). The expression level of JARID1B in angio-genic myeloid cells was also lower than that in HUVECs (Figure 1D).

Catalytic Activity of JARID1B Is Essential for Endothelial Angiogenic Capacity in CultureTo identify a functional role for JARID1B in ECs, the expression of the enzyme was decreased using a lentivi-ral JARID1B shRNA approach (Figure I in the online-only Data Supplement). Depletion of JARID1B had no effect on endothelial proliferation or apoptosis (data not shown). The downregulation of JARID1B, however, attenuated EC sprout-ing and tube forming capacity (Figure 2A and 2B). To deter-mine whether this feature of JARID1B requires its enzymatic activity, experiments were repeated with a catalytically dead mutant (H499A/E501A) with an inactive JmjC domain.14,15 Compared with overexpression of the wild-type JARID1B plasmid, overexpression of the mutant JARID1B reduced EC sprouting (Figure 2C). In line with this, 2–4(4-methylphenyl)-1,2-benzisothiazol-3-(2H)-one, a pharmacological inhibitor of the JARID family,18 diminished the angiogenic potential of ECs (Figure 2D and 2E). Vessel outgrowth also depends on cell migration. Consistently, the knockdown of JARID1B, as well as the inhibition of the JARID family, attenuated the migration of HUVECs in the scratch wound as well as in the

Nonstandard Abbreviations and Acronyms

EC endothelial cell

H3K4me3 histone 3 lysine 4

HUVEC human umbilical vein endothelial cell

Figure 1. JARID1B is highly expressed in human umbilical vein endothelial cells (HUVECs). A and B, Expression of the indicated histone-modifying enzymes in HUVECs as determined by gene array (A) and quantitative reverse transcription polymerase chain reaction (qRT-PCR; B). C, Representative Western blot for JARID1B, endothelial nitric oxide syn-thase (eNOS), and β-actin in THP-1, aor-tic smooth muscle cells (ASMC), HEK293, HUVEC, angiogenic myeloid cells (AMC), and fibroblast (Fibro). D, qRT-PCR for JARID1B in HUVECs and AMCs. *P<0.05; n>3.


Dow

nloaded from


Fork et al JARID1B and Angiogenesis 1647

Boyden chamber assay (Figure 2F–2I). Collectively, these findings suggest that JARID1B and its enzymatic activity are required for the angiogenic capacity of HUVECs in culture.

JARID1B Contributes to Angiogenesis In VivoTo corroborate these findings in a physiological system, we generated tamoxifen-inducible global knockout mice, in which depletion of exon 6 results in a frameshift and a premature stop codon. As global Jarid1b knockout mice are born at sub-Men-delian ratio and frequently die around birth with complex devel-opmental problems, a tamoxifen-induced knockout mouse was breed. Activation of Cre-recombinase by tamoxifen resulted in a significant loss of Jarid1b protein, whereas the expres-sion of an unspecific, closely located cross-reacting band was

unchanged. As determined by quantitative reverse transcrip-tion polymerase chain reaction, Cre-recombinase activation reduced Jarid1b level by ≈80% (Figure 3A and 3B).11,19 Ten-week old mice with induced conditional deletion of JARID1B were vital and showed no obvious phenotype. However, EC sprouting, detected by the number of CD31-positive cells, was abnormal in explanted aortic rings: both the sprout number and the total sprout length were markedly reduced in aortic rings from knockout mice (Figure 3C). Also EC migration in vivo was reduced after deletion of Jarid1b as observed in the carotid artery electro injury model (Figure 3D). Importantly, JARID1B also contributed to physiological angiogenesis as its knock-down delayed the rate of retinal vascularization, as well as the density of the developed vascular plexus (Figure 3E).

Figure 2. Catalytic activity of JARID1B is essential for endothelial angiogenic capacity. Spheroid outgrowth assay (A, C, and D), tube for-mation assay (B and E), Boyden chamber assay (F and G), and scratch wound assay for migration (H and I) of human umbilical vein endo-thelial cells (HUVECs) transduced with 2 different control shRNAs shScrambled (shCtl-1) and shGFP (shCtl-2) or Jarid1B shRNAs (shJ1B; A, B, F, and H) or after overexpression of plasmids coding for JARID1B wild-type (WT) or the H449A/E501A mutant (C) or in the presence (JARID1 inhib.) or absence (Solvent) of the JARID1 inhibitor 2 to 4(4-methylphenyl)-1,2-benzisothiazol-3-(2H)-one (D, E, G, and I). If not indicated otherwise, HUVECs were pretreated for 12 h with 10 μmol/L of JARID1 inhibitor in 1% FCS with EBM medium. Spheroid out-growth was assessed in the presence of vascular endothelial growth factor A 10 ng/mL. *P<0.05; n≥3.


Dow

nloaded from



Interpreting the results of studies performed after the global downregulation of JARID1B is complicated by the fact that the enzyme is a reportedly important regulator of hema-topoietic stem cell activity.8,12 Given the contribution of bone marrow–derived cells in angiogenesis, studies were repeated using a tamoxifen-inducible endothelial-specific JARID1B knockout mouse. In these animals, tamoxifen significantly attenuated EC JARID1B levels (Figure 3F and 3G) and repro-duced the delayed retina vascular growth and the decreased vascular plexus density (Figure 3H).

JARID1B Represses HOXA5 in ECsTo determine how JARID1B contributes to angiogenesis, microarray experiments were carried out in HUVECs to identify genes regulated by this enzyme. In keeping with the proposed inhibitory effect of JARID1B on the promoter activ-ity, downregulation of the histone demethylase increased the

expressions of a larger number of genes (256 genes, >20%; P<0.05) than it downregulated expression (26 genes, <20%; P<0.05; Figure II in the online-only Data Supplement). These findings confirm that JARID1B acts as a transcriptional repres-sor.16,22 Gene ontology analyses of the arrays revealed that JARID1B regulates genes involved in embryogenesis, vision/eye, liver/biliary systems, respiratory system, and hematopoi-etic system (Table I in the online-only Data Supplement). One of the genes derepressed by the downregulation of JARID1B in HUVECs was the homeobox gene HOXA5 (Figure II in the online-only Data Supplement). A comparison of the JARID1B microarray with HOXA5 Chip-Seq revealed that 20% of the induced genes consistent with the peaks of HOXA5 Chip-Seq (Figure III and Table II in the online-only Data Supplement). We validated several genes (AP1S3, BTF3L4, CCNE2, and LGR4) for being induced by HOXA5 overexpression and by depletion of JARID1B (Figure IV in the online-only Data

Figure 3. Endothelial-specific knockout of JARID1B decreases retina angiogenesis in mice. Western blot for JARID1B and tubulin (A and F), quantitative reverse transcription polymerase chain reaction for JARID1B (B and G; n=3) from mouse lung tissue and isolated lung endothelial cells, aortic outgrowth assay (C; n=5), carotid artery injury assay (D; n=6), and retina vascularization (E and H; n=6) of JARID1BFlox/Flox (WT) and JARID1BFlox/Flox-Cre-ERT2+/0 (KO; A–E) and endothelial specific JARID1BFlox/Flox-CDH5-Cre-ERT2+/0 mice (F–H). Tamoxifen was applied to all animals. Adult mice were injected (IP) for 3 days with tamoxifen followed by 3 weeks of washout (A–H), pubs received tamoxifen by intragastric injections from P1–P5. *P<0.05. TSS indicates transcription start site.


Dow

nloaded from



Supplement). HOXA5 is important for tumorigenesis but has also been attributed antiangiogenic effects.23–25 In agreement with the microarray data, both HOXA5 protein and mRNA were upregulated in lung ECs isolated from Jarid1b knock-out when compared with wild-type mice (Figure 4A and 4B). Importantly, HOXA5 was specifically suppressed by JARID1B as silencing of JARID1A and JARID1C had no effect on HOXA5 expression (Figure 4C). In line with this, overexpression of JARID1B reduced HOXA5 transcription (Figure 4D). Similar to the effects of JARID1B on cell func-tion, the suppression of HOXA5 was dependent on demethyl-ase activity, as the overexpression of the catalytically inactive mutant or the addition of the JARID inhibitor both increased HOXA5 expression in HUVECs (Figure 4E and 4F).

If HOXA5 was epigenetically regulated by JARID1B in ECs, the activating H3K4me3 modification of the HOXA5 promoter should be increased in cells lacking JARID1B. Indeed, chromatin immunoprecipitation assays revealed that the depletion of JARID1B resulted in an increase in H3K4me3 marks at 900 bp upstream of the HOXA5 tran-scription start site and this was accompanied by a reduced binding of JARID1B. The effect was specific for the

promoter of HOXA5 where JARID1B binding was observed, whereas the H3K4 histone modifications around the tran-scription start site of HOXA5 or in the promoter of GAPDH did not show enrichment for JARID1B (Figure 4G). Thus, JARID1B suppresses the HOXA5 gene expression in HUVECs through a mechanism requiring enzymatic activ-ity of this demethylase.

HOXA5 Inhibits Endothelial Angiogenic CapacityThe link between JARID1B and HOXA5 implied that HOXA5 could affect the angiogenic capacity of ECs. Indeed, when HOXA5 was overexpressed in HUVECs (Figure 5A), their tube forming capacity and sprouting from EC spheroids were significantly attenuated (Figure 5B and 5C). To determine whether induction of HOXA5 mediated the inhibitory effect of JARID1B shRNA on angiogenic capacity, HOXA5 was downregulated. Silencing of HOXA5 expression in JARID1B-depleted cells increased the sprouting and tube formation (Figure 5D and 5E).

Thus, the role of JARID1B in angiogenesis can be attrib-uted in part to the repression of HOXA5 gene transcription.

Figure 4. JARID1B represses HOXA5 in endothelial cells. Representative Western blot and statistics of densitometry for JARID1B, HOXA5, and GAPDH (A; n=4) and quantitative reverse transcription polymerase chain reaction (qRT-PCR; B; n=5) for HOXA5 in lung endothelial cells cultured from JARID1BFlox/Flox (WT) and JARID1BFlox/Flox-Cre-ERT2+/0 (KO) mice after tamoxifen treatment. C–F, HOXA5 expression as determined by qRT-PCR in human umbilical vein endothelial cells (HUVECs) transduced with shRNA against JARID1B (shJ1B), JARID1A (shJ1A), JARID1C (shJ1C), or control shRNA (shCtl). C, shRNA validation shows the expression of the respective JARID mRNA. Overexpression of a plasmid coding for WT JARID1B (J1B WT) or GFP (D) or H449A/E501A mutant (J1B Mut; E) and pretreatment with the JARID1 inhibitor 2 to 4(4-methylphenyl)-1,2-benzisothiazol-3-(2H)-one (12 h, 10 μmol/L) or solvent (F). n≥3; *P<0.05. G, Chro-matin immunoprecipitation of HUVECs transduced with control shRNA (shCtl) or JARID1B shRNA (shJ1B) with the antibodies indicated followed by PCR for GAPDH or HOXA5 using primers binding at the transcription start site (TSS) or 900 and 650 base pairs, respectively, upstream of the TSS. n=3; *P<0.05.


Dow

nloaded from



DiscussionIn this study, we identified JARID1B as the most highly expressed histone demethylase in cultured HUVECs. Knockout or inhibi-tion of JARID1B attenuated the angiogenic capacity of human ECs in vitro and exerted similar effects on murine ECs in vivo. We propose that this is at least partially because of an inhibitory effect of JARID1B on the expression of HOXA5, an antiangio-genic factor. JARID1B was found to occupy the promoter region of HOXA5 and to reduce the H3K4me3 levels there. The effect was specific to JARID1B because knockdown of the isoforms JARID1A or JARID1C did not lead to upregulation of HOXA5.

There is growing evidence from embryonic and hemato-poietic stem cells that JARID1B is a central regulator of key developmental genes.8,11,19,26 It regulates the differentiation of stem cells and embryonic development. During neural dif-ferentiation, JARID1B binds predominantly at transcription start sites of genes and regulates H3K4 methylation level and subsequently represses lineage-inappropriate genes.11,19 It seems that JARID1B has a similar function in the mature endothelium as our microarray analysis revealed that deple-tion of JARID1B induced the expression of numerous genes and suppressed the expression of only a few genes.

Of the regulated genes, HOXA5 was the focus of fur-ther investigation as the HOX genes are indispensable for embryogenesis, and during this process, they also regulate vascularization and angiogenesis.25,27 Moreover, HOXA5 drives ECs into a resting state and thus inhibits basal angio-genesis, as well as responsiveness to angiogenic stimuli, such as vascular endothelial growth factor.23–25 Our find-ing that HOXA5 is repressed by JARID1B could account for the downregulation of the gene under quiescent condi-tions. Moreover, chromatin immunoprecipitation analysis established a direct link between the epigenetic activity of JARID1B and HOXA5 suppression. It is, however, unclear how chromatin-modifying enzymes are recruited to a spe-cific site. DNA binding of JARID1B depends on the ARID site,28,29 whereas the demethylase activity is located in the JmjC-domain, a structure similar to the hypoxia-inducible factor hydroxylation prolyl hydroxylases.30 In fact, demeth-ylation by JARID1B is a 2-step mechanism: the nitrogen is first hydroxylated and subsequently, the methyl group cleaved of.31 The present data using an inactive mutant and a JARID1B inhibitor show that the data presented here depend on this enzymatic activity.

Figure 5. HOXA5 inhibits angiogenesis. A, HOXA5 mRNA expression, n=3. Spheroid outgrowth assay assessed in the presence of 10 ng/µL of vascular endothelial growth factor A (B) and tube formation assay (C and E), n=3 to 5 of human umbilical vein endothelial cells transfected with plasmids coding for HOXA5 (pCMV6-HOXA5) or a control plasmid (pCMV6-DDK) or transduced with shRNA against JARID1B (shJ1b) or control shRNA (shCtl) or treated with siRNA against HOXA5 or control siRNA (siCtl); *P<0.05.


Dow

nloaded from



As mentioned above, many genes were repressed by JARID1B, and it was interesting to note that several of them were occupied by HOXA5. Our decision to focus the further analysis on HOXA5 was based on its known role in develop-mental function. This rational, obviously, is somewhat arbi-trary, and in fact, HOXA5 was not the most strongly repressed gene by JARID1B—this was tetraspanin-8. Gene ontology term analysis, however, indicated that JARID1B acts on numerous cellular functions, and for most of these genes, a link to angiogenesis still needs to be established. This aspect, however, is beyond the scope of this study.

Consistent with our in vitro data, inducible JARID1B knockout mice exhibit an impaired endothelial sprout out-growth from aortic rings. Recently, it was shown that JARID1B regulates hematopoetic stem cell activity and acute but not constitutive genetic deletion of JARID1B increased periph-eral blood T cells.8,12 To exclude that bone marrow–derived cells mediate the effects on angiogenesis, endothelial-specific knockout mice were generated. These clearly demonstrate the importance of JARID1B in ECs for vessel growth.

In summary, we established JARID1B as an important mediator of endothelial angiogenesis. Loss or inhibition of JARID1B attenuates tube formation, spheroid outgrowth cell migration, vascular repair, and vessel growth. JARID1B maintains angiogenesis presumably by repression of antian-giogenic transcriptional regulators, such as HOXA5.

AcknowledgmentsWe are grateful for excellent technical assistance of Susanne Schütz, Tanja Lüneburg, Cindy Höper, and Katalin Palfi.

Sources of FundingThe study was supported by the Deutsche Forschungsgemeinschaft Excellence Cluster Cardiopulmonary System—Excellence Cluster Cardio Pulmonary System, SFB1039 (TPA1 to R.P. Brandes, and TPA06 to I. Fleming), the SFB 834 (TPA2 to R.P. Brandes, TP A9N to I. Fleming, and Z4 to S. Uchida), the Faculty of Medicine, Goethe-Universität, Frankfurt am Main, Germany. This work was also supported by an EMBO long-term postdoctoral fellowship to M. Albert and grant from the Danish Medical Research Council and the Excellence program of the University of Copenhagen to K. Helin.

DisclosuresNone.

References 1. Donato AJ, Morgan RG, Walker AE, Lesniewski LA. Cellular and molec-

ular biology of aging endothelial cells [published online ahead of print February 2, 2015]. J Mol Cell Cardiol. pii: S0022-2828(15)00034-6. doi: 10.1016/j.yjmcc.2015.01.021. http://www.jmmc-online.com/article/S0022-2828(15)00034-6/abstract.

2. Turgeon PJ, Sukumar AN, Marsden PA. Epigenetics of cardiovascular dis-ease - a new “beat” in coronary artery disease. Med Epigenet. 2014;2:37–52. doi: 10.1159/000360766.

3. Fraineau S, Palii CG, Allan DS, Brand M. Epigenetic regulation of endo-thelial-cell-mediated vascular repair. FEBS J. 2015;282:1605–1629. doi: 10.1111/febs.13183.

4. Webster AL, Yan MS, Marsden PA. Epigenetics and cardiovascular dis-ease. Can J Cardiol. 2013;29:46–57. doi: 10.1016/j.cjca.2012.10.023.

5. Kidder BL, Hu G, Zhao K. KDM5B focuses H3K4 methylation near pro-moters and enhancers during embryonic stem cell self-renewal and dif-ferentiation. Genome Biol. 2014;15:R32. doi: 10.1186/gb-2014-15-2-r32.

6. Benayoun BA, Pollina EA, Ucar D, et al. H3K4me3 breadth is linked to cell identity and transcriptional consistency. Cell. 2014;158:673–688. doi: 10.1016/j.cell.2014.06.027.

7. Shilatifard A. The COMPASS family of histone H3K4 methylases: mech-anisms of regulation in development and disease pathogenesis. Annu Rev Biochem. 2012;81:65–95. doi: 10.1146/annurev-biochem-051710-134100.

8. Cellot S, Hope KJ, Chagraoui J, Sauvageau M, Deneault É, MacRae T, Mayotte N, Wilhelm BT, Landry JR, Ting SB, Krosl J, Humphries K, Thompson A, Sauvageau G. RNAi screen identifies Jarid1b as a major reg-ulator of mouse HSC activity. Blood. 2013;122:1545–1555. doi: 10.1182/blood-2013-04-496281.

9. Mysliwiec MR, Bresnick EH, Lee Y. Endothelial Jarid2/Jumonji is required for normal cardiac development and proper Notch1 expression. J Biol Chem. 2011;286:17193–17204. doi: 10.1074/jbc.M110.205146.

10. Mysliwiec MR, Carlson CD, Tietjen J, Hung H, Ansari AZ, Lee Y. Jarid2 (Jumonji, AT rich interactive domain 2) regulates NOTCH1 expression via histone modification in the developing heart. J Biol Chem. 2012;287:1235–1241. doi: 10.1074/jbc.M111.315945.

11. Schmitz SU, Albert M, Malatesta M, Morey L, Johansen JV, Bak M, Tommerup N, Abarrategui I, Helin K. Jarid1b targets genes regulat-ing development and is involved in neural differentiation. EMBO J. 2011;30:4586–4600. doi: 10.1038/emboj.2011.383.

12. Stewart MH, Albert M, Sroczynska P, Cruickshank VA, Guo Y, Rossi DJ, Helin K, Enver T. The histone demethylase Jarid1b is required for hema-topoietic stem cell self-renewal in mice. Blood. 2015;125:2075–2078. doi: 10.1182/blood-2014-08-596734.

13. Rasmussen PB, Staller P. The KDM5 family of histone demethylases as targets in oncology drug discovery. Epigenomics. 2014;6:277–286. doi: 10.2217/epi.14.14.

14. Xiang Y, Zhu Z, Han G, Ye X, Xu B, Peng Z, Ma Y, Yu Y, Lin H, Chen AP, Chen CD. JARID1B is a histone H3 lysine 4 demethylase up-regulated in prostate cancer. Proc Natl Acad Sci U S A. 2007;104:19226–19231. doi: 10.1073/pnas.0700735104.

15. Seward DJ, Cubberley G, Kim S, Schonewald M, Zhang L, Tripet B, Bentley DL. Demethylation of trimethylated histone H3 Lys4 in vivo by JARID1 JmjC proteins. Nat Struct Mol Biol. 2007;14:240–242. doi: 10.1038/nsmb1200.

16. Yamane K, Tateishi K, Klose RJ, Fang J, Fabrizio LA, Erdjument-Bromage H, Taylor-Papadimitriou J, Tempst P, Zhang Y. PLU-1 is an H3K4 demeth-ylase involved in transcriptional repression and breast cancer cell prolif-eration. Mol Cell. 2007;25:801–812. doi: 10.1016/j.molcel.2007.03.001.

17. Barrett A, Santangelo S, Tan K, Catchpole S, Roberts K, Spencer-Dene B, Hall D, Scibetta A, Burchell J, Verdin E, Freemont P, Taylor-Papadimitriou J. Breast cancer associated transcriptional repressor PLU-1/JARID1B interacts directly with histone deacetylases. Int J Cancer. 2007;121:265–275. doi: 10.1002/ijc.22673.

18. Sayegh J, Cao J, Zou MR, Morales A, Blair LP, Norcia M, Hoyer D, Tackett AJ, Merkel JS, Yan Q. Identification of small molecule inhibitors of Jumonji AT-rich interactive domain 1B (JARID1B) histone demethylase by a sensitive high throughput screen. J Biol Chem. 2013;288:9408–9417. doi: 10.1074/jbc.M112.419861.

19. Albert M, Schmitz SU, Kooistra SM, Malatesta M, Morales Torres C, Rekling JC, Johansen JV, Abarrategui I, Helin K. The histone demethylase Jarid1b ensures faithful mouse development by protecting developmen-tal genes from aberrant H3K4me3. PLoS Genet. 2013;9:e1003461. doi: 10.1371/journal.pgen.1003461.

20. Zou MR, Cao J, Liu Z, Huh SJ, Polyak K, Yan Q. Histone demethylase jumonji AT-rich interactive domain 1B (JARID1B) controls mammary gland development by regulating key developmental and lineage speci-fication genes. J Biol Chem. 2014;289:17620–17633. doi: 10.1074/jbc.M114.570853.

21. Catchpole S, Spencer-Dene B, Hall D, Santangelo S, Rosewell I, Guenatri M, Beatson R, Scibetta AG, Burchell JM, Taylor-Papadimitriou J. PLU-1/JARID1B/KDM5B is required for embryonic survival and contributes to cell proliferation in the mammary gland and in ER+ breast cancer cells. Int J Oncol. 2011;38:1267–1277. doi: 10.3892/ijo.2011.956.

22. Tan K, Shaw AL, Madsen B, Jensen K, Taylor-Papadimitriou J, Freemont PS. Human PLU-1 Has transcriptional repression properties and interacts with the developmental transcription factors BF-1 and PAX9. J Biol Chem. 2003;278:20507–20513. doi: 10.1074/jbc.M301994200.

23. Chen Y, Gorski DH. Regulation of angiogenesis through a microRNA (miR-130a) that down-regulates antiangiogenic homeobox genes GAX and HOXA5. Blood. 2008;111:1217–1226. doi: 10.1182/blood-2007-07-104133.


Dow

nloaded from

http://www.jmmc-online.com/article/S0022-2828(15)00034-6/abstract

http://www.jmmc-online.com/article/S0022-2828(15)00034-6/abstract



24. Rhoads K, Arderiu G, Charboneau A, Hansen SL, Hoffman W, Boudreau N. A role for Hox A5 in regulating angiogenesis and vas-cular patterning. Lymphat Res Biol. 2005;3:240–252. doi: 10.1089/lrb.2005.3.240.

25. Kachgal S, Mace KA, Boudreau NJ. The dual roles of homeobox genes in vascularization and wound healing. Cell Adh Migr. 2012;6:457–470. doi: 10.4161/cam.22164.

26. Huang J, Zhang H, Wang X, Dobbs KB, Yao J, Qin G, Whitworth K, Walters EM, Prather RS, Zhao J. Impairment of preimplantation por-cine embryo development by histone demethylase KDM5B knockdown through disturbance of bivalent H3K4me3-H3K27me3 modifications. Biol Reprod. 2015;92:72. doi: 10.1095/biolreprod.114.122762.

27. Stoll SJ, Kroll J. HOXC9: a key regulator of endothelial cell quiescence and vascular morphogenesis. Trends Cardiovasc Med. 2012;22:7–11. doi: 10.1016/j.tcm.2012.06.002.

28. Kim J, Shin S, Subramaniam M, Bruinsma E, Kim TD, Hawse JR, Spelsberg TC, Janknecht R. Histone demethylase JARID1B/KDM5B is a corepressor of TIEG1/KLF10. Biochem Biophys Res Commun. 2010;401:412–416. doi: 10.1016/j.bbrc.2010.09.068.

29. Iwahara J, Iwahara M, Daughdrill GW, Ford J, Clubb RT. The structure of the Dead ringer-DNA complex reveals how AT-rich interaction domains (ARIDs) recognize DNA. EMBO J. 2002;21:1197–1209. doi: 10.1093/emboj/21.5.1197.

30. Thinnes CC, England KS, Kawamura A, Chowdhury R, Schofield CJ, Hopkinson RJ. Targeting histone lysine demethylases - progress, chal-lenges, and the future. Biochim Biophys Acta. 2014;1839:1416–1432. doi: 10.1016/j.bbagrm.2014.05.009.

31. Kooistra SM, Helin K. Molecular mechanisms and potential functions of histone demethylases. Nat Rev Mol Cell Biol. 2012;13:297–311. doi: 10.1038/nrm3327.

Here, we demonstrate that the histone demethylase JARID1B is essential for angiogenesis. Downregulation or inactivation of JARID1B at-tenuated endothelial migration and angiogenesis in a demethylase-depended manner. This could be attributed to the induction of the anti-angiogenic factor HOXA5. In endothelial cells, JARID1B binds to the HOXA5 promoter and removes histone 3 lysine 4 methylation associated with active transcription. Thus, JARID1B represses HOXA5 expression and thereby maintains the angiogenic capacity of endothelial cells. Inhibition of JARID1B could be a novel antiangiogenic strategy.

Significance


Dow

nloaded from


Kristian Helin, Dieter Steinhilber, Matthias S. Leisegang and Ralf P. BrandesYuliya Ponomareva, Mareike Albert, Sandra U. Schmitz, Shizuka Uchida, Ingrid Fleming,

Christian Fork, Lunda Gu, Juliane Hitzel, Ivana Josipovic, Jiong Hu, Michael SzeKa Wong,Epigenetic Regulation of Angiogenesis by JARID1B-Induced Repression of HOXA5

Print ISSN: 1079-5642. Online ISSN: 1524-4636 Copyright © 2015 American Heart Association, Inc. All rights reserved.

Greenville Avenue, Dallas, TX 75231is published by the American Heart Association, 7272Arteriosclerosis, Thrombosis, and Vascular Biology

doi: 10.1161/ATVBAHA.115.3055612015;35:1645-1652; originally published online May 28, 2015;Arterioscler Thromb Vasc Biol.

http://atvb.ahajournals.org/content/35/7/1645World Wide Web at:

The online version of this article, along with updated information and services, is located on the

http://atvb.ahajournals.org/content/suppl/2015/05/28/ATVBAHA.115.305561.DC1Data Supplement (unedited) at:

http://atvb.ahajournals.org//subscriptions/

at: is onlineArteriosclerosis, Thrombosis, and Vascular Biology Information about subscribing to Subscriptions:

http://www.lww.com/reprints

Information about reprints can be found online at: Reprints:

document. Question and AnswerPermissions and Rightspage under Services. Further information about this process is available in the

which permission is being requested is located, click Request Permissions in the middle column of the WebCopyright Clearance Center, not the Editorial Office. Once the online version of the published article for

can be obtained via RightsLink, a service of theArteriosclerosis, Thrombosis, and Vascular Biologyin Requests for permissions to reproduce figures, tables, or portions of articles originally publishedPermissions:


Dow

nloaded from

http://atvb.ahajournals.org/content/35/7/1645

http://atvb.ahajournals.org/content/suppl/2015/05/28/ATVBAHA.115.305561.DC1

http://www.ahajournals.org/site/rights/

http://www.ahajournals.org/site/rights/

http://www.lww.com/reprints

http://atvb.ahajournals.org//subscriptions/


Fork et al.: JARID1B in angiogenesis Supplemental Material

1

Supplemental Material

Epigenetic regulation of angiogenesis by JARID1B-induced repression of HOXA5 Christian Fork

1,7, Lunda Gu

1,7,

Juliane Hitzel

1,7, Ivana Josipovic

1,7, Jiong Hu

2,7, Michael SzeKa Wong

1,7, Yuliya

Ponomareva3,7

, Mareike Albert4,5

, Sandra U. Schmitz4,5

, Shizuka Uchida3,7

, Ingrid Fleming2,7

, Kristian Helin4,6

,

Dieter Steinhilber6,

Matthias S. Leisegang

1,7, and Ralf P. Brandes

1,7,*

Supplemental Materials and Methods

Materials

Anti-JARID1B antibodies were from Sigma

(#HPA027179) and Bethyl (#A301-813A), anti-

HOXA5 from Santa Cruz (#sc-28599), anti-eNOS

from Invitrogen (#334600), anti-beta-actin (#A1978),

anti-GAPDH from sigma (#G8795), anti-tubulin beta

(#sc-9104) was acquired from Santa Cruz. The

JARID1 inhbitor 2-4(4-methylphenyl)-1,2-

benzisothiazol-3-(2H)-one (PBIT) described in 1 was

from Sigma (#PH009215).

Experimental animals and animal procedures

All experimental procedures were approved by the

local governmental authorities (approval numbers:

FU28/40) and were performed in accordance with the

animal protection guidelines. Only male mice, age 8 to

12 weeks were used. JARID1B flox/flox mice were

provided by one of the co-authors. 2;3

Targeted ES cell

lines were initially generated by the European Gene

Trap Consortium (see www.mousephenotype.org).

Cdh5-CreERT24 mice were kindly provided by Ralf

Adams, MPI Münster, CMV-CreERT25 mice were

from Harald von Melchner, Goethe-University,

Frankfurt. Activation of CreERT2 was achieved by

intraperitoneal injection (i.p) of tamoxifen in

sunflower oilon 3consecutive days followed by a

“wash-out” phase of 3 weeks. For retina angiogenesis,

tamoxifen was administered by intragastric injection

as reported previously by others.6 In all experiments

Cre positive (denoted as Cre+/0) as well as the Cre

negative (denoted as Cre0/0) control animals received

tamoxifen to exclude direct effects of this anti-

estrogen. Breeding of the Cre-lines was carried out by

crossing Cre +/0 and Cre 0/0 animals so that Cre +/0

and Cre 0/0 littermates could always be compared side

by side. Mice were housed in a specified pathogen-

free facility with 12/12 hours day/night cycle and free

access to chow and water.

Carotid artery injury model

Electric-injury was performed under general

anesthesia by ketamin/rompun as described 9. Briefly,

the carotid artery was exposed to electric injury using

a hemostatic electric coagulation forceps (ERBOTOM

ICC 50 HF, ERBE, Tübingen, Germany) twice

juxtapose for 3 seconds to induce a 3 mm wide

denudation. Wounds were closed by staples and

animals were allowed to recover for 3 days followed

by Evans blue staining for determination of the

denuded area. Evans blue solution (2%, 200 μL) was

injected via the tail vein and allowed to circulate for

10 minutes. Subsequently, animals were perfused

transcardially with NaCl 0.9% to remove the

excessive dye. Carotid arteries were isolated and

imaged by an infrared-based laser fluorescence

scanner (Odyssey, Licor, Bad Homburg, Germany) or

photographed on a macro stage.

Retina angiogenesis

For whole-mount immunohistochemistry, retinas were

fixed in 4% PFA for 2 h at room temperature, or

overnight at 4°C. After fixation, retinas were blocked

and permeabilized in 1% BSA and 0.5% Triton X-100

overnight at 4°C. Then retinas were washed three

times in Pblec buffer (0.5% Triton X-100, 1 mM

CaCl2, 1 mM MgCl2, and 1 mM MnCl2 in PBS, pH

6.8) and incubated overnight in Pblec containing FITC

labeled Isolectin B4 (1:100; Sigma-Aldrich).

Subsequently, the retina were flat-mounted in

mounting medium (Dako). All quantifications were

done with high-resolution images taken using a laser

scanning confocal microscope (LSM-510; Carl Zeiss).

Aortic ring assay, tube formation and spheroid

sprouting assay

These assays were performed as described in 7.

Cell Migration

Scratch wound-healing assays were performed in 24-

well plates. Cells were cultured in endothelial basal

medium (EBM) containing FCS (1%). Endothelial cell

migration was monitored by live cell imaging (Zeiss

TIRF System LASOS77). The distance migrated was

calculated using ImageJ software.

Endothelial cell migration in Boyden chamber assays

were investigated in a modified transwell chamber

system. 2x10^5 cells were seeded on membrane

inserts (FluoroBlok, 3 µm pore size, BD Bioscience,

Heidelberg, Germany) in the presence of EBM. The

lower chamber contained EBM supplemented with 2%

FCS. After 20 hours, the cells on the upper surface of

the filter were removed mechanically. Then cells that

had migrated into the lower compartment were fixed

(4% paraformaldehyde in PBS), stained with DAPI

and counted (8 images per well, x200 magnification).

Cell Culture

Human umbilical vein endothelial cells (HUVECs)

were purchased from Lonza (#CC-2519, Lot

No.186864; 191772; 192485; 76524; 76921, 7F3111,

Walkersville, MD, USA) and PELOBiotech (#PB-CH-

190-8013, Lot No. QC-18P13F11, Planegg,

Germany). Cells were cultured on fibronectin-coated

(#356009, Corning Incorporated, Tewksbury, MA,

http://www.mousephenotype.org/


2

USA) dishes in endothelial growth medium (EGM),

consisting of endothelial basal medium (EBM)

supplemented with human recombinant epidermal

growth factor (EGF), EndoCGS-Heparin,

(PELOBiotech, Planegg, Germany), 8% fetal calf

serum (FCS) (#S0113, Biochrom, Berlin, Germany),

penicillin (50 U/ml) and streptomycin (50 µg/ml)

(#15140-122, Gibco (lifetechnologies, Carlsbad, CA,

USA) in a humidified atmosphere of 5% CO2 at 37

°C. For each experiment at least three different

batches of HUVEC from passage 3 were used.

Human embryonic kidney (HEK) 293T/17 cells

(#CRL-11268) were purchased from ATCC

(Manassas, VA, USA). Cells were cultured in

Dulbecco's Modified Eagle's Medium (DMEM), high

glucose, GlutaMAX from Gibco, Lifetechnologies

(Carlsbad, CA, USA), supplemented with 8% fetal

calf serum (FCS), penicillin (50 U/ml), and

streptomycin (50 µg/ml) in a humidified atmosphere

of 5% CO2 at 37 °C.

Human aortic smooth muscle cells (HAoSMC)(#354-

05a) were purchased from PELOBiotech (Planegg,

Germany). Cells were cultured in Smooth Muscle Cell

Medium (#PB-MH-200-2190) supplemented with 8%

fetal calf serum (FCS), penicillin (50 U/ml),

streptomycin (50 µg/ml), EGF, FGF, glutamin, and

insulin from singlequots (PELOBiotech, Planegg,

Germany). Cells were cultured in a humidified

atmosphere of 5% CO2 at 37 °C.

Human foreskin fibroblasts were cultured in

DMEM/F12 (#11039-021) from Gibco

(Lifetechnologies, Carlsbad, CA, USA) supplemented

with 8% fetal calf serum (FCS), penicillin (50 U/ml),

and streptomycin (50 µg/ml) in a humidified

atmosphere of 5% CO2 at 37 °C THP1 cells were

cultured in RPMI medium 1640 + GlutaMAX from

Gibco supplemented with 8% fetal calf serum (FCS),

10 mM HEPES,1 mM sodium pyruvate (sigma) and

streptomycin (50 µg/ml) in a humidified atmosphere

of 5% CO2 at 37 °C

Human angiogenic myeloid cells (AMC) were isolated

according to 8 and murine lung endothelial cells were

isolated and cultured as described in 9.

shRNA, siRNA and plasmid transfection

For shRNA treatment, endothelial cells were infected

with lentiviral particles according to Addgene

“plKO.1 Protocol”

(http://www.addgene.org/tools/protocols/plko/). Cells

were selected with puromycin (0.5 µg/ml). The

shJARID1B-1 target sequence was: 5’-

CCTGAGGAAGAGGAGTATCTT-3’, for

shJARID1B-1 5’-

CGAGATGGAATTAACAGTCTT-3’ Control

shRNA against green fluorescent protein (shGFP) and

shScrambled (shScr) were purchased from Addgene.

For siRNA treatment, endothelial cells (80–90%

confluent) were transfected with GeneTrans II

according to the instructions provided by MoBiTec

(Göttingen,Germany). All siRNAs (Stealth RNAi)

were from Invitrogen (#HSS173871 JARID1B,

#HSS179327 HOXA5). siCtl was used as a negative

control: scrambled Stealth RNAi™ Med GC (#12935-

300) from lifetechnologies (Carlsbad, CA, USA,).

Plasmid overexpression was achieved with the Neon

electroporation system (Invitrogen). The plasmids

JARID1B-WT (vector pCMV-HA) and JARID1B-

Mut (H499A, E501A, vector pCMV-HA) were

provided by one of the co-authors (K.H.), pCMV6-

HOXA5 and pCMV6-DDK were purchased from

Origene (#RC502156, # PS100001).

Quantitative RT-PCR

Total RNA was extracted with the RNA Mini Kit

(Bio&Sell). cDNA was prepared with SuperScript III

reverse transcriptase (Invitrogen) and random hexamer

together with oligo(dT) primers (Sigma #O4387).

Quantitative real-time PCR was performed with Eva

Green Master Mix and ROX as reference dye

(Bio&Sell #76.580.5000) in a Mx3005 cycler

(Stratagene). Relative expression of target genes were

normalized to (RNA)II (DNA-directed) polypeptide A

(POLR2A) or ß-Actin and analyzed by the delta-delta

Ct method with the MxPro software (Agilent

Technologies, Santa Clara, CA, USA).

Protein isolation and western blot analysis

Cells were lysed with Triton X-100 lysis buffer

(20 mM TRIS/Cl pH 7.5, 150 mM NaCl, 10 mM

NaPPi, 20 mM NaF, 1% Triton, 2 mM orthovanadate

(OV), 10 nM okadaic Acid, protein-inhibitor mix

(PIM), 40 µg/ml phenylmethylsulfonylfluorid). Cells

were centrifuged for 10 min at 16,000 g. Supernatant

and pellet were used and after determination of protein

concentration by the Bradford assay, equal amounts of

proteins were boiled in Laemmli buffer and separated

by SDS-PAGE gel electrophoresis. Infrared-

fluorescent-dye-conjugated secondary antibodies were

purchased from Licor (Bad Homburg, Germany) and

detected with an infrared-based laser scanning

detection system (Odyssey Classic, Licor, Bad

Homburg, Germany).

Chromatin immuno-precipitation (ChIP)

Cell preparation, crosslinking and nuclei isolation

were performed with the truCHIP™ Chromatin

Shearing Kit (Covaris, Woburn, USA) according to

the manufacturers protocol. Afterwards, the lysates

were sonified with the Bioruptur Plus (9 cycles, 30

seconds on, 90 seconds off; Diagenode, Seraing,

Belgium) at 4°C. Cell debris was removed by

centrifugation and the lysates were diluted 1:3 in

dilution buffer (20 mmol/L Tris/HCl pH 7.4, 100

mmol/L NaCl, 2 mmol/L EDTA, 0.5% Triton X-100

and protease inhibitors). After preclearing with 20 µL

DiaMag protein A coated magnetic beads (Diagenode,

Seraing, Belgium) for 30 minutes at 4°C, samples

were incubated over night at 4°C with 3-5 µg of anti-

JARID1B (Sigma #HPA027179), anti-H3K4me3 and

anti-H3 (diagenode #pAb-003-050 #C15310135). 5%

of the samples served as input. The antibody

complexes were collected with 35 µL DiaMag protein

A coated magnetic beads (Diagenode, Seraing,

Belgium) for 3 hours at 4°C, subsequently washed

twice for 5 minutes with each of the wash buffers 1-3


3

(Wash Buffer 1: 20 mmol/L Tris/HCl pH 7.4, 150

mmol/L NaCl, 0.1% SDS, 2 mmol/L EDTA, 1%

Triton X-100; Wash Buffer 2: 20 mmol/L Tris/HCl

pH 7.4, 500 mmol/L NaCl, 2 mmol/L EDTA, 1%

Triton X-100; Wash Buffer 3: 10 mmol/L Tris/HCl

pH 7.4, 250 mmol/L lithium chloride, 1% Nonidet,

1% sodium deoxycholate, 1 mmol/L EDTA) and

finally washed with TE-buffer pH 8.0. Elution of the

beads was done with elution buffer (0.1 M NaHCO3,

1% SDS) containing 1x proteinase K (Diagenode,

Seraing, Belgium) and shaking at 600 rpm for 1 hour

at 55°C, 1 hour at 62°C and 10 minutes at 95°C. After

removal of the beads, the eluate was purified with the

QiaQuick PCR purification kit (Qiagen, Hilden,

Germany) and subjected to qPCR analysis.

Microarray

HUVECs were transfected with control or JARID1B

siRNA. RNA was isolated 48 hours after transfection

with the miRNeasy Mini Kit (QIAGEN). GeneChip

Human Exon 1.0 ST array (Affymetrix) was used and

data were analyzed by using the noncoder web

interface10

and the RMA normalization method

GO terms were determined by using GO-Elite

pathway analysis (version 1.2)

HOXA5 ChIP-Sequencing

HOXA5 ChIP-Seq data was obtained from Gene

Expression Omnibus:

http://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=

GSM1239461

Statistics

Unless otherwise indicated, data are given as means ±

standard error of mean (SEM). Calculations were

performed with Prims 5.0 or BiAS.10.12. The latter

was also used to test for normal distribution and

similarity of variance. In case of multiple testing,

Bonferroni correction was applied. For multiple group

comparisons ANOVA followed by post hoc testing

was performed. Individual statistics of unpaired

samples was performed by T-test and if not normally

distributed by Mann-Whitney test. P values of <0.05

was considered as significant. Unless otherwise

indicated, N indicates the number of individual

experiments.

Reference List

1. Sayegh J, Cao J, Zou MR, Morales A, Blair LP,

Norcia M, Hoyer D, Tackett AJ, Merkel JS,

Yan Q. Identification of small molecule

inhibitors of Jumonji AT-rich interactive

domain 1B (JARID1B) histone demethylase by

a sensitive high throughput screen. J Biol

Chem. 2013;288:9408-9417.

2. Albert M, Schmitz SU, Kooistra SM, Malatesta

M, Morales TC, Rekling JC, Johansen JV,

Abarrategui I, Helin K. The histone

demethylase Jarid1b ensures faithful mouse

development by protecting developmental

genes from aberrant H3K4me3. PLoS Genet.

2013;9:e1003461.

3. Schmitz SU, Albert M, Malatesta M, Morey L,

Johansen JV, Bak M, Tommerup N,

Abarrategui I, Helin K. Jarid1b targets genes

regulating development and is involved in

neural differentiation. EMBO J. 2011;30:4586-

4600.

4. Wang Y, Nakayama M, Pitulescu ME, Schmidt

TS, Bochenek ML, Sakakibara A, Adams S,

Davy A, Deutsch U, Luthi U, Barberis A,

Benjamin LE, Makinen T, Nobes CD, Adams

RH. Ephrin-B2 controls VEGF-induced

angiogenesis and lymphangiogenesis. Nature.

2010;465:483-486.

5. Indra AK, Warot X, Brocard J, Bornert JM,

Xiao JH, Chambon P, Metzger D. Temporally-

controlled site-specific mutagenesis in the basal

layer of the epidermis: comparison of the

recombinase activity of the tamoxifen-inducible

Cre-ER(T) and Cre-ER(T2) recombinases.

Nucleic Acids Res. 1999;27:4324-4327.

6. Pitulescu ME, Schmidt I, Benedito R, Adams

RH. Inducible gene targeting in the neonatal

vasculature and analysis of retinal angiogenesis

in mice. Nat Protoc. 2010;5:1518-1534.

7. Zippel N, Malik RA, Fromel T, Popp R, Bess

E, Strilic B, Wettschureck N, Fleming I,

Fisslthaler B. Transforming growth factor-beta-

activated kinase 1 regulates angiogenesis via

AMP-activated protein kinase-alpha1 and redox

balance in endothelial cells. Arterioscler

Thromb Vasc Biol. 2013;33:2792-2799.

8. Wong MS, Leisegang MS, Kruse C, Vogel J,

Schurmann C, Dehne N, Weigert A, Herrmann

E, Brune B, Shah AM, Steinhilber D,

Offermanns S, Carmeliet G, Badenhoop K,

Schroder K, Brandes RP. Vitamin D promotes

vascular regeneration. Circulation.

2014;130:976-986.

9. Schroder K, Zhang M, Benkhoff S, Mieth A,

Pliquett R, Kosowski J, Kruse C, Luedike P,

Michaelis UR, Weissmann N, Dimmeler S,

Shah AM, Brandes RP. Nox4 is a protective

reactive oxygen species generating vascular

NADPH oxidase. Circ Res. 2012;110:1217-

1225.

10. Gellert P, Ponomareva Y, Braun T, Uchida S.

Noncoder: a web interface for exon array-based

detection of long non-coding RNAs. Nucleic

Acids Res. 2013;41:e20.


4

Primer

Gene Forward Reverse hHOXA5 TGC ACA TAA GTC ATG ACA ACA TAG ACT TCA TTC TCC GGT TTT GGA ACC hJARID1A TATCATGGAGGATGACAGCATG CAGCTCCTTTGATTTGTCTGC hJARID1B TGAGGATGAAGATGCCATCTGCC ACAGCGCACACAGATGTAGTCTTC hJARID1C CAGGTAAGAGAGATCTGGAGC CCATATGCTGTGGTTCTCATC hJMJD1A GAGCTCCACATCAGGTTCATAAC CCTGTAATTTATCTTCGTGATTGG hJMJD2A CAAATGTACCAGGTGGAGTTTG CTCGTTGCCGTTTCTTTTCTTG hJMJD2B CCTGAGAGCATCACGAGTAG TCAAACTCCACCTGGTAGATG hJMJD2C ATATCGTGAGCCGAGACTGTC TCTTGGGTAACTCTTCATCTAAAG hJMJD2D AGCCCAGGGTACCAGCCAGC TAGCAGTGCCACTAACTGCAGATCG hJMJD3 CCAGGGCTTTGGGAACAGCTTG GGCATCTCCATGCAGGGTACTC hJMJD4 CTTCTCCTACGCCGACTTTGTG CACATCCAGTGCATCCCAGAAC hJMJD6 TTCGTCAGACTCCGACTCAGAG TAATCCTGGAGGAGCTGCGCTC hLSD1 ATTTAATGGCTCAGCCAATCACTC TGGCGAGGCAGCGTATACATG

hPol II GCACCACGTCCAATGACAT GTGCGGCTGCTTCCATAA

hß-Actin AAAGACCTGTACGCCAACAC GTCATACTCCTGCTTGCTGAT

hAP1S3 TGATACATTTCATATTGCTCTTC TAAACTAGCATACCTTTTATAAAC

hBTF3L4 TTGAAGAGGTGAACATGATTAAAG TGCTTTACTGTCCAAGACTTGC

hCCNE2 TAAGAAAGCCTCAGGTTTGGAGTG GTTTATGTAATTTACTTCCTCCAG

hLGR4 TATCTCTAAGGATTCTGATCTGAG ATATGGTACTGATAAAGACCTGAG

mHOXA5 TGC ACA TTA GTC ACG ACA ATA TAG TTC ATC CTC CTG TTT TGG AAC CAG

mhPol II CTCGAAACCAGGATGATCTGACTC CACACCCACTTGGTCAATGGATAG

mJarid1b GGC TAT GAA TAT TAA AAT TGA GC CAT TTT CCC ATT TTG GAG TTG

mß-Actin TGACAGGATGCAGAAGGAGA GCTGGAAGGTGGACAGTGAG

Primers for ChIP-PCR

Gene region Forward Reverse hHOXA5 900 bp from TSS TCA TAC AGC TCG GAC GCA ATC CAC AGA GCA GAC TCT CTC TAC TAG AGG

hHOXA5 TSS TAG TGC ACG AGT TTA CCT CTA GAG ATG ACT GGG ACA TGT ACT CGG TTC

GAPDH 650 bp from TSS TGG TGT CAG GTT ATG CTG GGC CAG GTG GGA TGG GAG GGT GCT GAA CAC

-2 2Log2 fold change

siCtl siJ1B

1 2 3 1 2 3HUVEC:

siCtl siJ1B

1 2 3 1 2 3HUVEC:

siCtl siJ1B

1 2 3 1 2 3HUVEC:

Supplemental Table I

Supplemental Figure II: Impact of JARID1B down-regulation on gene expressionHeatmap (A) of microarrays (Affymetrix GeneChip Human Exon 1.0 ST ) of 3 different HUVEC batches treated withJARID1B siRNA or control siRNA (siCtl). Only genes are indicated, whose expression were at least 20 % changed byknockdown of JARID1B and with a p-value <0.05. Gene ontology analysis (Tab. S1) calculated by GO-Elite pathwayanalysis.

Gene ontology terms p-value

embryogenesis 0.041

vision/eye 0.025

liver/biliary system 0.001

respiratory system 0.048

tumorigenesis 0.014

hematopoietic system 0.018

muscle 0.032

JARID1B

β-Actin

Supplemental Figure I: Effect of shRNA againstJARID1B on protein abundance. HUVECs weretransduced with lenti virus coding for two differentJARID1B shRNAs (shJ1B-1 & shJ1B-2) or two differentcontrols (shCtl-1 (shScr) and shCtl-2 (shGFP)). Cells werekept in selection medium (0.5 µg/ml puromycin) andJARID1B and β-Actin protein expression were deteminedby Western blot 5 days later. (p<0.05, n>3)sh

Ctl-1

shJ1

b-1

shCtl-

2

shJ1

b-20.0

0.3

0.6

0.9

1.2

**

JAR

ID1B

/

-Act

in

Fork et al., JARID1B and angiogenesis Supplemental data

1

0.0

0.5

1.0

1.5

2.0

* shCtlshJ1b

LGR4

0.0

0.2

0.4

0.6

0.8

1.0

*

J1b

Re

l. m

RN

A le

vel

0

2

4

6

8 *

AP1S3

0.0

0.5

1.0

1.5*

CCNE2

0

1

2

3 *

BTF3L4

0

50

100

150 *HOXA5

Re

l. m

RN

A le

vel

0.0

0.5

1.0

1.5 n.s

CCNE2

0.0

0.5

1.0

1.5 *pCMV6-DDKpCMV6-HOXA5

LGR4

0.0

0.5

1.0

1.5*

BTF3L4

0.0

0.5

1.0

1.5

2.0

2.5*

AP1S3

Supplemental Figure III: Venn diagram for genes recovered by HOXA5 Chip-Seq and genes induced by Jarid1B shRNAdetermined by microarray in HUVEC. HOXA5 ChIP data were obtained from Gene Expression Omnibus

Supplemental Figure IV: Gene validation of matched genes between HOXA5 ChIP-seq and JARID1B microarray . HUVECswere transfected with plasmids coding for HOXA5 (pCMV6-HOXA5) or a control plasmid (pCMV6-DDK) or transduced with shRNAagainst JARID1B (shJ1b) or control shRNA (shCtl). AP1S3 (adaptor-related protein complex 1, sigma 3 subunit), BTF3L4 (basictranscription factor 3-like 4), CCNE2 (cyclin E2), LGR4 (leucine-rich repeat containing G protein-coupled receptor 4). n=4. *p<0.05.

JARID1B shRNA induced

HOXA5 ChIP-Seq

Supplemental Table II: Matched genes between HOXA5 ChIP-seq and JARID1B microarray.Gene Symbol:AP1S3, ARSJ, AXL, BTF3L4, CALML4, CCND1, CCNE2, CDC42SE2 ,CISD1, CLIC4, CSNK1G1, DDX21, DERL1,DLG1, EXT1,GLS, GNG2, GOLIM4, HDDC2, HMGA2, IARS, INSIG1, LGR4, MAML2, MAN1A2, MICAL2, NCEH1,, NTM, PHF19, PHF2,PICALM, PIGW, PLXNA2, POMGNT1, PTP4A2, RAB11FIP2, RBMS3, RPRD1A, SH3YL1, SLC12A2, SMC5, SMCHD1,TMEM123, TMEM62, TRPC1, TSPAN8 ,UAP1, UGCG, ZNF254, ZNF92

Fork et al., JARID1B and angiogenesis Supplemental data

2

epigenetic regulation of angiogenesis by jarid1b...

Documents