Effect of Gossypol on Bovine Ovarian Physiology

ウシ卵巣生理におよぼすゴシポールの影響

THET SU MYAT

テッスミャッ

2016

DOCTOR OF PHILOSOPHY PROGRAM BIOPRODUCTION SCIENCE

THE UNITED GRADUATE SCHOOL OF AGRICULTURAL SCIENCES

IWATE UNIVERSITY JAPAN

i

LIST OF CONTENTS

Page

TITLE PAGE

LIST OF CONTENTS

i

CHAPTER 1

GENERAL INTRODUCTION

1

CHAPTER 2

MATERIALS AND METHODS

13

CHAPTER 3

GOSSYPOL INHIBITS LH-INDUCED STEROIDOGENESIS IN BOVINE

THECA CELLS

Introduction

18

Materials and methods

20

Results

23

Discussion

25

Tables and Figures

30

ii

CHAPTER 4

GOSSYPOL INHIBITS BOVINE THECA CELLS STEROIDEGENESIS VIA

cAMP DEPENDENT PATHWAY

Introduction

37

Materials and methods

39

Results

42 Discussion

44

Tables and Figures

47

CHAPTER 5

EFFECT OF GOSSYPOL ON BOVINE THECA CELLS CARBODYDRATE

METABOLSIM

Introduction

50

Materials and methods

52 Results

55

Discussion

56

Tables and Figures

61

iii

CHAPTER 6

GENERAL DISCUSSION

66

ACKNOWLEDGEMENTS

71

REFERENCES

73

1

CHAPTER 1 1

GENERAL INTRODUCTION 2

What is gossypol? 3

Gossypol is a yellowish polyphenolic compound found in the seeds, stems and roots 4

of the cotton plant genus Gossypium. Gossypol was first isolated in 1899. The name is 5

derived from the plant genus scientific name (Gossypium) combined with the ending “ol” 6

from phenol. Gossypol has a 518.55 Dalton molecular weight, has a yellow pigment, is 7

crystalline, insoluble in water and hexane, soluble in acetone, chloroform, ether, and methyl 8

ethyl ketone (butanone), and is partly soluble in crude vegetable oils. Gossypol is 9

composed of three tautomeric forms that account for the numerous chemical and 10

physiological reactions often associated with this compound (Berardi & Goldblatt 1969; 11

Randel et al. 1992). Gossypol has an ultraviolet (UV) absorption maximum at about 385 12

nm (ε 18,000) (solvent dependent). It melts at temperatures around 200°C depending on its 13

polymorphic form. Many polymorphic forms and crystalline solvates of gossypol exist 14

depending on the solvent of crystallization. 15

Gossypol in cottonseed 16

There are some 20 species of the genus Gossypium, but only four are cultivated for 17

fiber production worldwide: Gossypium hirsutum L., Gossypium barbadense L., Gossypium 18

arboreum L., and Gossypium herbaceum L. (Stephens 1958; Berardi & Goldblatt 1969). 19

The two most economically important cotton species are G. hirsutum (Upland cotton, white 20

2

or fuzzy cottonseed with attached short fibers), which is grown to produce 90% of the 21

world’s cotton and Gossypium barbadense (Pima cotton, bare, black seed without attached 22

short fibers). Gossypol is found in all Gossypium species. Gossypol pigment is located 23

almost exclusively in pigment gland structures appearing as dark dots in the plant tissue. In 24

the plant, gossypol serves as a natural insecticide making the plant less palatable to animals. 25

Non-processed whole cottonseeds, as well as processed cottonseed meal may therefore 26

contain large amounts of free gossypol, which may cause adverse and toxic effects if used 27

as a feeding stuff. The high levels of gossypol in cottonseed and cottonseed products have 28

restricted their use as feed for ruminants and have prevented the use of cottonseed products 29

for feeding non-ruminants (Randel et al. 1992). Cottonseed may contain concentrations 30

greater than 14,000 mg/kg of total gossypol and 7,000 mg/kg of free gossypol. Cottonseed 31

(kernels) can contain several percent (up to 10 %, 0.1-100 g/kg) of gossypol (Alexdaner et 32

al. 2008). Total gossypol production is influenced by several factors, including weather 33

conditions and cotton species; gossypol production is positively correlated with the rainfall 34

rate and negatively correlated with temperature (Pons et al. 1953). Pima cottonseed 35

contains higher amount of gossypol and that is why Pima is more toxic than upland 36

cottonseed (Wang et al. 1987b). Storage, steam and heat, and extrusion of oil, reduce free 37

gossypol concentrations in cottonseed and its products. 38

Toxicokinetics of gossypol 39

In cottonseed, gossypol exists as a mixture of two stereoisomers, (+) and (-), with 40

the negative isomer appearing to have the greatest biological activity, slowly eliminated 41

3

and is the isomer responsible for negative effects. Two gossypol forms have been observed; 42

free and bound. The free form is toxic whereas the bound form is non-toxic because it is 43

bound to proteins. When gossypol is bound to proteins in the stomach it becomes 44

chemically inactive. Therefore, when fed in low levels that the body can detoxify gossypol 45

in this way it is not harmful to animals and people as a feed source (Randel et al. 1992). It 46

is the level of free gossypol in the body after consumption that determines how toxic the 47

product will be. The gossypol absorption rate is inversely proportional to the amount of 48

iron in the diet (Barraza et al. 1991), and dietary supplementation with ferrous sulfate 49

inactivates free gossypol (Schneider et al. 2002). The absorbed gossypol accumulates in the 50

liver and kidneys. The primary gossypol excretion route is through bile; it is then 51

eliminated through feces after conjugation with glucuronides and sulfates. Small amounts 52

of gossypol are also excreted in urine, and in expired air. Little to no gossypol is excreted in 53

the milk. The half-lives of total (+) and (−) gossypol in rats following a single intravenous 54

dose were estimated as 25.26 hours and 10.53 hours, respectively (Chen et al. 1987). 55

Usage of cottonseed as an animal feedstuff 56

Cottonseed and cottonseed meal is known as an excellent and economically 57

available source of feed for ruminant animals. Cottonseed meal is a prominent additive in 58

cattle diets and is the large source of supplemental protein for cattle (Risco et al. 1993). 59

Cottonseed meal contains 44.9 % of crude protein (NRC 2001) whereas upland and Pima 60

cottonseeds contain 23.0 and 24.6% crude protein respectively (Calhoun et al. 1995; 61

Robinson et al. 2001). Coppock et al. (1985) stated that cottonseed has an unusual feature 62

4

of having both high energy and high fiber. This makes cottonseed a very attractive source 63

of supplementation to the cattle industry. It has been reported that adding the desired level 64

of cottonseed in the dairy ration can increase lactation performance (Santos et al. 2003). 65

However its unlimited usage as animal feed in both ruminants and non-ruminants is 66

restricted because of high levels of gossypol in cottonseed and cottonseed products. 67

Recommended feeding rates for ruminants (in USA) suggested a maximum of 20 % of the 68

concentrate mix for growing beef cattle, with lower inclusion rates for younger or milk-69

producing livestock or not more than 0.5 % of body weight per day for mature cows and 70

0.33 % of body weight for weaned calves (Lonsdale 1989; Ewing 1997). 71

Gossypol toxicity in animals 72

There are two types of gossypol poisoning; acute and chronic or cumulative 73

poisoning. Acute gossypol intoxication of non-ruminant animals causes circulatory failure. 74

Acute toxicity has been shown in the heart, lung, liver, and blood cells, resulting in 75

increased erythrocyte fragility. Sub-acute toxicity causes pulmonary edema and symptoms 76

of malnutrition (Alexander et al. 2008). 77

General signs of acute toxicity are similar among animal species and include 78

respiratory distress, impaired body weight gain, anorexia, anemia, weakness, pneumonia, 79

apathy, gastro-enteritis, listlessness, hypoprothrombinemia, depressed hemoglobin levels, 80

lowered hematocrit and death after several days. Heart failure was reported in calves, lambs, 81

and dogs. Feeding of male calves with a diet containing 400 mg free gossypol/kg can cause 82

lethal effects (Velasquez-Pereira et al. 1999). 83

5

Post mortem findings include generalized edema with fluid-filled thoracic and 84

peritoneal cavities, congestion of lungs and liver, myocardial degeneration, centrilobular 85

liver necrosis, and hypertrophic cardiac fiber degeneration. In calves, the major pathologic 86

findings are ascites, visceral edema, acute centrilobular hepatocyte necrosis, kidney damage, 87

and cardiovascular lesions (Alexander et al. 2008). 88

Different species react differently to being fed gossypol in cottonseed and 89

cottonseed products. Gossypol is particularly toxic to swine, while poultry and horses seem 90

to be relatively unaffected (Berardi & Goldblatt 1969). It is however, even less toxic to 91

adult ruminant animals because their fully functional rumens have the ability to bind large 92

amount of free gossypol with soluble proteins (Haschek et al. 1989). However, young 93

calves are highly susceptible to gossypol toxicity before the rumen is fully functional 94

(Berardi & Goldblatt 1969). In comparison with (+)-gossypol, the (–)-enantiomer generally 95

exhibits more pronounced effects. 96

Effect of gossypol on reproductive physiology 97

Male reproduction 98

First interest in gossypol was taken in 1960s in Chinese men. In 1957, Liu reported 99

that a village in the Jiangsu province in China did not have any childbirth between the 100

1930s and 1940s. Later it was realized that this infertility incident was due to a large-scale 101

contamination of cotton oil for human consumption with gossypol. More than 8000 102

Chinese males on the use of gossypol pill as an anti-contraceptive have been carried out 103

using 20 mg (±)-gossypol/day and the study revealed that the drug was efficient and well 104

6

tolerated, and did not cause changes in blood pressure or biochemical parameters. However, 105

the study was discontinued because hypokalemia affected around 10 % of gossypol-taken 106

males (Liu 1985; Coutinho 2002). 107

The main target organ of gossypol toxicity following repeated exposure is the testis. 108

Gossypol inhibits spermatogenesis, which decreases the sperm count and spermatozoid 109

motility and viability (Randel et al. 1992). The lowest oral doses inhibiting 110

spermatogenesis in humans and monkeys were 0.1 and 0.35 mg/kg body weight, 111

respectively. The effects are dose and time dependent. Suppressed spermatogenesis in 112

human is irreversible, particularly in males with varicocele (Alexander et al. 2008). 113

Chronic administration of gossypol leads to mitochondrial and flagella damage in testicular 114

and epididymal spermatozoa (Hoffer 1982; Oko & Hrudka 1982) and to decrease of sperm 115

ATP content with a concomitant loss of motility (Ke & Tso 1982). 116

The gossypol-mediated spermatozoid disturbance mechanism includes the 117

inhibition of release and utilization of ATP by the sperm cells (Ueno et al. 1988). Another 118

effect of gossypol is the reduction of cellular and microtubular-tubular content in 119

spermatocytes and spermatids (Teng et al. 1997). Furthermore, gossypol inhibits calcium 120

influx (Breitbart et al. 1984, 1989) and Mg-ATPase and Ca-Mg-ATPase activity in 121

spermatozoid plasmatic membranes (Breitbart et al. 1984). Abnormal spermatozoids are 122

produced because gossypol produces ultrastructural alterations in the nuclear membrane, 123

endoplasmic reticulum, and mitochondria (Chenoweth et al. 2000; Hoffer 1982; Arshami 124

1988). In cultured sertoli cells from piglets, gossypol also decreases cellular oxidase 125

7

activity and damages the DNA (Zhang et al. 2011). Reduced nuclear expression of 126

androgen receptors was observed in leydig cells, sertoli cells, and myoid cells from rats fed 127

gossypol-rich cottonseed flour (Timurkaan et al. 2011). 128

Although ruminants with a well-developed rumen are able to detoxify gossypol by 129

converting free to bound gossypol within rumen, rumen protein-binding detoxifying 130

mechanism can be overwhelmed if the total gossypol content is excessive, or when protein 131

content is low in the rumen (Adams et al. 1998). In bulls, feeding cottonseed high in 132

gossypol content has been associated with reduced sperm production, increased sperm 133

abnormalities, decreased sperm motility, and decreased thickness of the germinal 134

epithelium of the testis, showing similar effects as in human (Brocas et al. 1997). 135

Female reproduction 136

In China, women ingesting cottonseed oil suffered from burning fever, developed 137

amenorrhoea and uterus atrophy (Wu 1989). Human trials have been performed using doses 138

of 20 mg/day of racemic gossypol for 2-3 months followed by a maintenance dose of 40 139

mg/week for 4-5 months. Endometriosis, uterine myoma and functional uterine bleeding 140

were occurred in the women and these resulted in amenomania and atrophy of the 141

endometrium. Examination of uterine biopsies showed a local cytotoxic effect on the uterus 142

together with a systemic effect on the ovarian function (Wu 1989; Randel et al. 1992). 143

Gossypol has been shown to exert antifertile effects in female animals, such as 144

disturbing estrous cycle, decreasing conception rate and increasing incidence of abortion 145

(Lagerlöf & Tone 1985; Santos et al. 2003). These irregular cycles appear to be caused by 146

8

gossypol’s ability to suppress ovary secretion of progesterone (P4) and estradiol-17β (Lin 147

et al. 1985). Gossypol also seems to disrupt pregnancy and early embryo development, 148

particularly in the monogastric species (Abou-Donia 1976; Berardi & Goldblatt 1969; 149

Randel et al. 1992; Dodou 2005). The early pregnancy loss promoted by gossypol is not 150

due exclusively to direct damage to embryos but also to interference with implantation of 151

the embryo (Lin et al. 1991). Gossypol also affects bovine oocyte cumulus expansion and 152

nuclear maturation (Lin et al. 1994). Gossypol-mediated embryotoxic effect has also been 153

observed in vitro (Brocas et al. 1997; Zirkle et al. 1988, Hernández et al. 2005; Villaseñor 154

et al. 2008; Lin et al. 1994) and in vivo (Lagerlöf & Tone 1985; Lin et al. 1991; Li et al. 155

1989) studies. Villaseñor et al (2008) stated that gossypol may reach the uterine fluids 156

through the maternal circulation. 157

The ruminant female appears to have relatively resistance to antifertility effects of 158

gossypol. However, many in vitro studies indicated gossypol inhibited embryonic 159

development and ovarian steroidogenesis. 160

Effects of gossypol on steroidogenesis 161

The ovary possesses two primary steroidogenic cell types, theca cells and granulosa 162

cells. Both theca cells and granulosa cells are required for ovarian follicles for the 163

regulation of the estrus cycle and follicular development for producing estrogen and 164

progesterone. The steroidogenic activity of theca cells is regulated by luteinizing hormone 165

(LH) and local factors. The key enzymes required for thecal androgen biosynthesis are 166

steroidogenic acute regulatory protein (StAR), cytochrome P450 cholesterol side-chain 167

9

cleavage enzyme (P450scc, CYP11A1), 17β-hydroxylase/17,20-lyase (CYP17A1) and 3β-168

hydroxysteroid dehydrogenase (HSD3B). Cholesterol is a major substrate for progesterone 169

synthesis. StAR transports cholesterol into mitochondria. It is then first converted to 170

pregnenolone by CYP11A1. Pregnenolone is later converted to dehydroepiandrosterone 171

(DHEA) by CYP17A1. DHEA is finally converted to androstenedione (A4) by HSD3B. 172

HSD3B also converts pregnenolone to progesterone (P4). P4 is also able to be converted to 173

A4 by HSD3B. Androgens synthesized in the theca cells are transported to the granulosa 174

cells where P450 aromatase converts them to estrone and 17β-estradiol. Although the 175

mechanisms behind the gossypol actions have not been fully clarified, it is likely that it 176

exerts the antifertility effects through inhibiting ovarian steroidogenesis. Gossypol has been 177

shown to affect production of estrogen (E2) and P4 in granulosa and luteal cells in rats, pigs 178

and cattle (Gu et al. 1990a, b, 1991; Akira et al. 1994; Lin et al. 1994; Ohmura 1996; 179

Vranová et al. 1999; Basini et al. 2009). Gossypol inhibits the activities of some enzymes 180

involved in steroidogenesis such as side-chain cleavage enzyme complex (cytochrome 181

P450scc/CYP11A1) (Gu et al. 1991) and 3βhydroxysteroid dehydrogenase-isomerase 182

complex (3βHSD/HSD3B) (Gu et al. 1990a).The antisteroidogenic effect of gossypol is 183

also reported due to inhibiting adenylate cyclase or cAMP production in in cultured 184

granulosa (Lin et al. 1994) and luteal cells in cattle (Gu et al. 1990a), luteal cells in rats 185

(Wang et al. 1987), in bovine luteal cells (Gu et al. 1990a) and mouse leydig cells (Pearce 186

et al. 1986a, b). As gossypol inhibits cAMP production, it is highly likely that gossypol 187

inhibition of steroidogenesis is related to cAMP dependent enzymes (protein kinase A or 188

PKA). Other possible pathway of gossypol inhibition is PKC (protein kinase C) pathway. 189

10

However, the effect of gossypol on these mechanisms has never studied yet. In male, 190

gossypol has been shown to inhibit leydig cell androgen production (Lin et al. 1981; 191

Donaldson et al. 1985; Sufi et al. 1985; Pearce et al. 1986a). Since gossypol has been 192

shown to inhibit androgen production in leydig cells (Lin et al. 1981; Donaldson et al. 193

1985; Sufi et al. 1985; Pearce et al. 1986a), the male equivalent of theca cells, it is possible 194

that gossypol also inhibits androgen synthesis in theca cells. However, little is known about 195

the effect of gossypol on androgen production in theca cells. 196

Effects of gossypol on energy metabolism 197

Glucose is the principal substrate for the production of energy and the synthesis of 198

key biological materials. The glycolysis, a metabolic pathway that converts glucose to 199

pyruvate, is the central metabolic pathway necessary to produce (adenosine triphosphate) 200

ATP and cofactor reduced nicotinamide adenine dinucleotide (NADP). In the bovine ovary 201

the predominant energy substrate appears to be glucose (Rabiee et al. 1997). Glucose is 202

transported into cell by glucose transporters such as GLUT across the cell membrane. The 203

rate of glucose utilization is regulated by GLUT, which limits cellular glucose uptake, and 204

glycolytic enzymes that set the rate of glucose metabolism. There are 10 steps of glycolysis 205

and 10 enzymes involved in glycolysis, namely hexokinase (HK), glucose phosphate 206

isomerase (GPI), phosphofructokinase (PFK), aldolase (Aldo), triphosphate isomerase 207

(TPI), glyceraldehyde phosphate dehydrogenase (GAPDH), phosphoglycerate kinase 208

(PGK), phosphoglycerate mutase (PGM), enolase (ENO) and pyruvate kinase (PK) or 209

lactate dehydrogenase (LDH) in case of anaerobic glycolysis. Of these 10 enzymes, HK, 210

11

PFK, PK and LDH are considered as rate limiting enzymes of the glycolysis. At the final 211

stage of anaerobic glycolysis, lactate dehydrogenase enzyme (LDH) catalyzes the 212

conversion of pyruvate to lactate and back, as it converts NADH to NAD+ and back (Li 213

1990). 214

Inhibition of LDH activity by gossypol was reported in mouse kidney, liver and 215

testis (Lee et al. 1981), in rat testis (Giridharan et al. 1982) and in bull spermatozoa (Rovan 216

et al. 1984). Disturbances of sperm energy metabolism in spermatozoa by inhibiting 217

glucose and fructose utilization in the presence of gossypol is also reported by Wichmann 218

et al. (1983). However, little is known about the effect of gossypol on carbohydrate 219

metabolism in theca cells. 220

Effects of gossypol on incidence of apoptosis 221

Gossypol has been known to have apoptotic property. In recent years, gossypol has 222

been used as an anticancer drug in clinical researches. Previously, gossypol’s proapoptotic 223

activity has been demonstrated on various cell types including human breast cancer cells 224

(Gilbert et al. 1995), human prostate cancer cells (Jiang et al. 2004) and human colon 225

carcinoma cells (Zhang et al. 2003). Several investigators demonstrated various kinds of 226

molecular mechanisms including death receptor pathways, mitochondrial pathways and 227

DNA breaks or DNA fragmentation for gossypol-induced antiproliferative activity in 228

various cancer cells (Chang et al. 2004; Hu et al. 1993; Jarvis et al. 1994; Shelley et al. 229

2000; Zhang et al. 2003). 230

12

Mitochondrial involvement is also implicated by studies suggesting that gossypol 231

may act as an uncoupler of mitochondrial oxidative phosphorylation (Abou-Donia & 232

Dieckert 1974) and inhibit LDH as it participates in a shuttle system transferring H+ from 233

cystol to mitochondria (Burgos et al. 1978). 234

Objectives of the present study 235

Taken the above studies together, it should be concluded that gossypol act through 236

several different pathways to inhibit cell functions. Although many investigators have 237

reported several pathways of gossypol induced-apoptotic mechanism in various cell types, 238

no study on the molecular mechanisms of gossypol on LH-induced theca cell viability, 239

steroidogenesis and carbohydrate metabolism has yet come into our knowledge. Therefore, 240

the present study was undertaken to investigate 1) the effect of gossypol on the production 241

of steroids and the expression of genes encoding steroidogenic enzymes (Chapter 3), 2) 242

mechanism of gossypol action in intracellular signaling pathways (Chapter 4), and 3) the 243

effect of gossypol on anaerobic glycolysis (Chapter 5) in cultured bovine theca cells. 244

245

246

247

248

249

250

251

13

252

253

254

CHAPTER 2 255

MATERIALS AND METHODS 256

This study was conducted entirely in vitro using abattoir-derived materials. All 257

chemicals and reagents were obtained from Sigma-Aldrich (St. Louis, MO, USA), unless 258

indicated otherwise. 259

Isolation and culture of theca cells 260

Bovine ovaries were obtained from the local abattoir and were kept in Dulbecco’s 261

phosphate buffered saline (DPBS) supplemented with 17.5 mM glucose and 15mM 262

MgCl2.6H2O at 20℃ overnight. The ovaries were transported to the laboratory in the next 263

morning. Ovaries were washed for several times with 70% ethanol and sterilized saline. 264

Large follicles, 10-15 mm in diameter were used in this study. Healthy follicles were 265

selected and follicular fluid was aspirated using 22 gauge needle. Follicles were then cut 266

open and granulosa cells were scraped gently by using a small spatula. Follicular walls 267

were peeled off and washed in DPBS for several times to remove as much remaining 268

granulosa cells as possible. Only follicular walls from apparently healthy developing 269

follicles with vascularized theca layers and transparent follicular fluid were used in the 270

study. The follicular walls were dissected into small pieces and digested in 5ml DPBS in 271

15mL conical tubes (for approximately 5 follicles) containing 1 mg/mL collagenase, 1 272

14

mg/mL hyaluronidase, 1 mg/mL protease and 0.4% BSA for 1h at 37℃ in a water bath 273

with rocking platform shaker. After the digestion, 10 mL of serum free culture medium 274

(DMEM:F/12) supplemented with 0.1% BSA, 100 IU/mL penicillin, 100 µg/mL 275

streptomycin, 2.5 g/mL amphotericin, L-glutamine 3 mM, 10 ng/mL insulin, 2.5 µg/mL 276

transferrin, 4 ng/mL sodium selenite was added to the cell preparation. Dispersed cells were 277

pelleted by centrifugation at 800g for 10 min. Cells were resuspended and washed in DPBS 278

and washed twice with serum free medium. Contaminated red blood cells were removed by 279

incubating cells in tris-HCL buffer (pH 8.0) at 37℃ for 1min. The cell pellet was then 280

resuspended in serum free culture medium. The number and viability of the theca cells 281

were counted using trypan blue exclusion method. Cell viability was more than 90%. 282

Approximately 7x104 viable cells were seeded in 96 well culture plates (Nunclon Delta 283

surface; Thermo Fisher Scientific, Rochester, NY, USA) in 200 µL culture medium and 284

cultured at 37℃ and 5% CO₂ in air. 285

Steroid assays 286

Concentration of A4 and P4 in the culture medium was determined by using 287

commercial kits (Androstenedione Human ELISA kit; Immunospec Corporation, Canoga 288

Park, CA, USA and Progesterone EIA kit; Cayman Chemical Co., Ann Arbor, MI, USA) 289

following the procedures provided by the manufacturers. Range of the standard curve for 290

A4 was 0-10 ng/mL. Range of the standard curve for P4 was 0-1000 pg/mL. Intra- and 291

inter-assay coefficients of variation were less than 10% for all assays. 292

Glucose and lactate assays 293

15

Glucose concentration in the spent medium and follicular fluid was measured using 294

a commercial glucose assay kit (Wako Pure Chemical Industries, Osaka, Japan) following 295

the procedures provided by the supplier. Lactate production in the medium was measured 296

by using a commercial assay kit (Determiner LA, Kyowa Medex Co., Tokyo). Ranges of 297

the standard curves were 0-200 mg/dL for glucose and 0-10 mg/dL for lactate. The intra- 298

and inter assay coefficient of variations for both assays were less than 10%. 299

cAMP assay 300

cAMP concentration in the spent media was measured by cAMP complete elisa kit 301

(Enzo Life Sciences, Farmingdale, New York, USA) following the procedures provided by 302

the supplier. The range of standard curve was 0.078-20 pmol/mL (acetylated format). The 303

intra- and inter assay coefficient of variations were less than 10%. 304

RNA extraction, reverse transcription (RT), quantitative polymerase chain reaction 305

(qPCR) 306

RNA extraction 307

Total RNA was extracted from theca cells by using TRIzol Reagent (Life 308

technologies, Carlsbad, CA, USA) and reverse-transcribed using Ominiscript Reverse 309

Transcription kit (QIAGEN, GmbH, Hilden, Germany) following the procedures provided 310

by the manufacturers. 311

RT-PCR 312

16

The abundance of mRNAs encoding target genes were quantified by a real-time 313

quantitative PCR using LightCycler Nano (Roche, Basel, Swizerland) using FastStart 314

Essential DNA Green Master (Roche). Specific primers for target genes were designed by 315

using National Centre for Bilotechnoligical Information (NCBI) primer designing tool 316

(http://www.ncbi.nlm.nih.gov/tools/primer-blast/) based on reported bovine sequences 317

(Table. 3.1). The amplification program consisted of an initial activation at 95℃ for 10 min 318

followed by 45cycles of the PCR steps (denaturation at 94℃ for 10sec, annealing at 60℃ 319

for 10sec and extension at 72℃ for 15sec). All cDNA samples were amplified in 320

duplication and each transcript level was normalized to the geometric mean of 3 reference 321

genes selected by geNorm as mentioned in the following section. The intra- and inter-assay 322

coefficient of variations was less than 10% for all measurements. 323

Selection of stable internal control genes by geNorm analysis 324

The three most stable reference genes were selected from 8 candidate genes 325

(glyceraldehyde-3-phosphate dehydrogenase; GAPDH, β-actin; ACTB, 18S ribosomal 326

RNA; 18S rRNA, β2-microglobulin; B2M, large ribosomal protein P0; RPLP0, ribosomal 327

protein L4; RPL4, TATA box binding protein; TBP and heat shock protein 90-kDα, class B 328

member 1; HSPCB) by using the geNorm Visual Basic application for Microsoft Excel 329

(Accurate normalization of real-time quantitative RT-PCR data by geometric averaging of 330

multiple internal control genes (Vandesompele et al. 2002). Accordingly TBP, RPL4 and 331

HSPCB were selected as the reference genes. 332

Statistical analysis 333

17

All data were presented as mean ± SEM. Data were subjected to either one-way or 334

two-way analysis of variance (ANOVA) with Tukey multiple comparison test. Levels of 335

gene expression were analyzed using one-way repeated measures ANOVA. P < 0.05 was 336

considered to be statistically significant. 337

338

339

340

341

342

343

344

345

346

347

348

349

350

351

352

353

354

355

356

18

357

358

CHAPTER 3 359

GOSSYPOL INHIBITS LH-INDUCED BOVINE THECA CELL 360

STEROIDOGENESIS 361

Introduction 362

Cottonseed and cottonseed meal are popular protein sources for livestock especially 363

in cotton growing developing countries. High content of gossypol, a polyphenolic aldehyde 364

found in the pigment glands of the seed, however, has restricted the usage of it as a 365

valuable feedstuff. Gossypol is known to inhibit spermatogenesis and testicular 366

steroidogenesis in many species (Lin et al. 1981; Donaldson et al. 1985; Pearce et al. 367

1986a) and has been used as a contraceptive agent in humans (Coutinho et al. 2000; 368

Coutinho 2002). Although less appreciated, gossypol has been shown to exert antifertility 369

effects in female animals, such as disturbing estrous cycle, decreasing conception rate and 370

increasing incidence of abortion (Lagerlöf & Tone 1985; Santos et al. 2003). 371

Although the mechanisms behind the gossypol actions have not been fully clarified, 372

it is likely that it exerts the antifertility effects through inhibiting ovarian steroidogenesis. 373

Gossypol has been shown to affect production of estrogen (E2) and progesterone (P4) in 374

granulosa and luteal cells in rats, pigs and cattle (Gu et al. 1990a, b, 1991; Akira et al. 375

1994; Lin et al. 1994; Ohmura 1996; Vranová et al. 1999; Basini et al. 2009). However, 376

little is known about the effect of gossypol on androgen production in theca cells. 377

19

It is well known that theca cells play a crucial role in follicular development by 378

supplying androgen for estradiol synthesis in the adjacent granulosa cells. Since gossypol 379

has been shown to inhibit androgen production in leydig cells (Lin et al. 1981; Donaldson 380

et al. 1985; Sufi et al. 1985; Pearce et al. 1986a), the male equivalent of theca cells, it is 381

likely that gossypol also inhibits androgen synthesis in theca cells. 382

Therefore, the present study was undertaken to investigate the effect of gossypol on 383

the production of androstenedione (A4), the major androgen produced in the ovarian 384

follicle, as well as P4 and expression of genes responsible for androgen production in 385

cultured bovine theca cells. 386

387

20

Materials and methods 388

Isolation and culture of theca cells 389

Bovine ovaries were obtained from the local abattoir. Theca cells were prepared as 390

mentioned in Chapter 2. Approximately 7x104 viable cells were seeded in 96 well culture 391

plates in 200 µL culture medium and cultured at 37ºC in 5% CO₂ in air. 392

Experimental design 393

Two cell models were set up to examine the effect of gossypol on theca cell 394

functions during the preovulatory period (non-luteinized theca cell: Fig. 3.1, NL) and the 395

luteal phase (luteinized theca cell: Fig. 3.1, L). For the non-luteinized cell model, theca 396

cells were cultured in 200 µL medium supplemented with 5% fetal calf serum (FCS: Fetal 397

clone III, Hyclone laboratories, Logan, Utah, USA), 1 ng/mL LH (bovine LH, AFP-398

11118B, National Institute of Diabetes and Digestive and Kidney Disease, Baltimore, MD, 399

USA) and various concentration of gossypol (0, 0.2, 1, 5 and 25 µg/mL) for 24h (Fig. 3.1, 400

NL). During this period theca cells produce twice as much A4 as P4 (Fig. 3.1, NL). For the 401

luteinized cell model, theca cells were initially cultured as for the non-luteinized cells but 402

without gossypol for 24h. At day 2, theca cells were treated with a high dose of LH (100 403

ng/mL) for 24 h to induce luteinization. After the treatment, theca cells were further 404

cultured for 4 days with 1% FCS and 1 ng/mL LH with medium being changed every 24 h. 405

During this period, P4 production in theca cells steadily increased whereas A4 production 406

became minimal (Fig. 3.1). At day 7, theca cells were treated with gossypol (0, 0.2, 1, 5 and 407

21

25 µg/mL) for 24 h as for the non-luteinized cell model (Fig. 3.1, L). At the end of the 408

experimental periods, the spent medium was collected and stored at -20ºC for steroid assays. 409

Theca cells were collected and live and dead theca cells were counted using trypan blue 410

exclusion method. 411

Steroid assay 412

Concentration of A4 in the culture medium was measured by using a commercial kit 413

(Androstenedione Human ELISA kit; Immunospec Corporation, Canoga Park, CA, USA). 414

Concentration of P4 was measured by using a commercial kit (Progesterone EIA kit; 415

Cayman Chemical Co., Ann Arbor, MI, USA). Intra- and inter-assay coefficients of 416

variation were less than 10% for all assays. 417

RNA extraction, reverse transcription (RT) and quantitative polymerase chain 418

reaction (qPCR) 419

Total RNA was extracted from theca cells by using phenol-chloroform method and 420

reverse-transcribed using a commercial kit (Ominiscript Reverse Transcription kit; 421

QIAGEN, GmbH, Hilden, Germany) following the procedures provided by the 422

manufacturers. The abundance of mRNAs encoding LH receptor (LHR), steroidogenic 423

acute regulatory protein (StAR), cholesterol side-chain cleavage enzyme (CYP11A1), 3-β-424

hydroxysteroid dehydrogenase/Δ-5-4 isomerase (HSD3B), and 17α-hydroxylase/17,20 425

lyase (CYP17A1) were quantified by a real-time quantitative PCR (LightCycler Nano; 426

Roche, Basel, Swizerland) using a commercial real-time PCR kit (FastStart Essential DNA 427

Green Master; Roche). Specific primers for target genes were designed by using National 428

22

Center for Biotechnological Information (NCBI) primer designing tool 429

(http://www.ncbi.nlm.nih.gov/tools/primer-blast/) based on reported bovine sequences 430

(Table. 3.1). All cDNA samples were amplified in duplication and the resultant data were 431

normalized to the geometric means of 3 stably expressed reference genes, TATA box 432

binding protein (TBP), ribosomal protein L4 (RPL4) and heat shock protein 90-kDα, class 433

B member 1 (HSPCB), following the procedures reported by Vandesompele et al. (2002). 434

The intra- and inter-assay coefficient of variations was less than 10% for all measurements. 435

Statistical analysis 436

Number of cells, cell viability and levels of steroids were compared by one-way 437

analysis of variance (ANOVA) with Tukey multiple comparison test. Two sets of data were 438

compared with t-test. Levels of gene expression were analyzed using one-way repeated 439

measures ANOVA. P < 0.05 was considered to be statistically significant. All data were 440

presented as mean ± SEM. 441

442

443

444

445

446

447

23

448

Results 449

Effect of gossypol on viability of non-luteinized and luteinized bovine theca cells 450

After the 24-h experimental periods, cultured theca cells were collected and number 451

of live and dead cells was counted. The treatment with LH (1 ng/mL) increased cellular 452

viability both in non-luteinized (P<0.01) and luteinized cells (P<0.1) whereas the treatment 453

with gossypol did not affect cellular viability of LH-treated theca cells regardless of the 454

doses used in both cell types (Fig. 3.2A, B). 455

Effect of gossypol on production of androstenedione and progesterone in non-456

luteinized and luteinized bovine theca cells 457

Treatment with LH (1 ng/mL) significantly increased A4 and P4 production both in 458

non-luteinized (P<0.05; Figs. 3.3A, B) and luteinized theca cells (P<0.05; Figs. 3.4A, B). 459

Production of A4 was more than four fold higher than that of P4 in non-luteinized theca 460

cells not treated with gossypol (Fig. 3.3C). In luteinized theca cells, production of P4 far 461

exceeded that of A4 (Fig. 3.4C). Treatment with gossypol dose-dependently decreased LH-462

induced theca cell androgen production both in non-luteinized and luteinized cells (P<0.05; 463

Figs. 3.3A, 3.4A). LH-induced P4 production was not affected or even increased by 464

gossypol at doses 5 µg/mL and less but decreased at 25 µg/mL (Figs. 3.3B, 3.4B). 465

Consequently the ratio of A4 to P4 decreased dose-dependently in both cell types (Figs. 466

3.3C, 3.4C). 467

24

468

Effect of gossypol on gene expression of LHR, StAR, CYP11A1, HSD3B and 469

CYP17A1 in non-luteinized and luteinized bovine theca cells 470

Treatment with LH tended to increase the gene expression of StAR, CYP11A1, 471

HSD3B and CYP17A1 in non-luteinized theca cells. Treatment with gossypol blocked the 472

LH effect and further down-regulated gene expression of CYP11A1, CYP17A1 and StAR 473

below control level at concentrations of 0.2-5 µg/mL (P<0.05; Fig. 3.5B, C, E). The 474

expression of LHR was not affected by gossypol at any doses tested (Fig. 3.5A). In 475

luteinized theca cells, the effect of LH was largely lost except for the expression of 476

CYP11A1 (Fig. 3.6C). Treatment with gossypol did not affect the expression of these genes 477

except HSD3B where the expression was significantly increased by gossypol at 25 µg/mL 478

(P<0.05; Fig. 3.6D). 479

480

481

482

25

Discussion 483

This study demonstrated that the treatment with gossypol inhibited steroidogenesis 484

in cultured bovine theca cells without affecting cell viability. To our knowledge, this is the 485

first report that demonstrates direct effects of gossypol on the theca cell functions in any 486

species. 487

Antifertility effects of gossypol have been reported in many species. It is well 488

known that gossypol exerts inhibitory effects on spermatogenesis and testicular functions in 489

human, livestock and laboratory animals (Randel et al. 1992; Akinola et al. 2006; Taha et 490

al. 2006). Although less appreciated, gossypol also disrupts reproductive functions in 491

female animals. Gossypol has been reported to disrupt the estrus cycle and decrease 492

fertility in rats and cattle (Lagerlöf & Tone 1985; Santos et al. 2003). 493

These Antifertility effects of gossypol appear to be at least partially mediated by 494

impairment of gonadal steroidogenesis. In male, gossypol has been shown to inhibit leydig 495

cell androgen production (Lin et al. 1981; Donaldson et al. 1985; Sufi et al. 1985; Pearce et 496

al. 1986a). In female, gossypol has been shown to decrease production of E2 and P4 in 497

cultured granulosa cells in cattle (Lin et al. 1994), pigs (Akira et al. 1994; Ohmura et al. 498

1996; Vranová et al. 1999; Basini et al. 2009) and rats (Lin et al. 1985), and luteal cells in 499

cattle (Gu et al. 1990a, b, 1991). Gossypol was also shown to inhibit FSH-stimulated 500

progesterone production in porcine cumulus cells (Kolena et al. 2001). 501

The results of the present study demonstrated that gossypol as low as 5 µg/mL or 502

less can suppress A4 production in cultured bovine theca cells. These doses are comparable 503

26

to, or even lower than the doses reported to suppress P4 or E2 production in cultured 504

granulosa cells in pigs (Vranová et al. 1999; Basini et al. 2009) and cattle (Lin et al. 1994), 505

and luteal cells in cattle (Gu et al. 1990a, b). 506

Production of A4 appears to be more easily affected by gossypol than that of P4 in 507

bovine theca cells. In the present study, gossypol started to decrease A4 production at 1 to 5 508

µg/mL while it was only effective to suppress P4 at 25 µg/mL. In the consequence the 509

treatment with gossypol shifted theca cell steroidogenesis from A4 to P4 production in a 510

dose-dependent manner. These results imply that the androgen production in theca cells 511

may be the prime target of gossypol action. In addition to this, well vascularized theca layer 512

is more likely to be affected by circulating gossypol compared to avascular granulosa layer. 513

Sensitivity to gossypol appears to vary among species (Randel et al. 1992). 514

Ruminants are more resistant to gossypol compared to non-ruminants due to their ability to 515

detoxify gossypol in the rumen (Reiser & Fu 1962). It was reported that beef heifers and 516

cows fed high levels of dietary gossypol (20 g/animal/day and 20 mg/kg BW/day, 517

respectively) for extended periods (62 days and 33 weeks, respectively) showed no adverse 518

effect on reproductive performance (Gray et al. 1993). Nevertheless, feeding with excessive 519

levels of gossypol was shown to cause reproductive disorders such as decreased conception 520

rate and increased incidence of abortion in dairy cattle (Santos et al. 2003). In these animals, 521

plasma levels of gossypol reached more than 5 µg/mL (Santos et al. 2003), the level that 522

effectively suppress theca cell androgen production in vitro. Comparable levels of gossypol 523

were also reported by other authors in lactating Holstein cows fed large amounts of 524

27

cottonseed meal (Lindsey et al. 1980) and Brown Swiss cows given a bolus of gossypol 525

(Lin et al. 1991). The safe upper limit of plasma gossypol concentration was estimated as 4 526

μg/mL (Noftsger et al. 2000). The present results demonstrated that theca cell 527

steroidogenesis could be affected by gossypol at lower concentrations. The terminal 528

elimination half-lives of gossypol from the circulation was estimated to be 2-3 days (Lin et 529

al. 1991). Thus, continuous feeding with cottonseed meal may result in a gradual built up 530

of gossypol in the circulation to the level hazardous to reproduction. 531

Estradiol produced in the preovulatory follicle and P4 produced in the corpus 532

luteum are both crucial for induction of estrus, ovulation and subsequent embryo 533

development. It has been reported that gossypol inhibits E2 production in porcine granulosa 534

cells (Akira et al. 1994; Ohmura 1996; Basini et al. 2009). Gossypol appears to inhibit E2 535

production by suppressing conversion of androgen to estrogen by aromatase in granulosa 536

cells (Akira et al. 1994). In cattle, supply of androgen from theca cells is absolutely 537

necessary for E2 production in the adjacent granulosa cells. Production of androgen in 538

theca cells, in turn, is also supported by pregnenolone and P4 supplied by the granulosa 539

cells (Fortune 1986). Our results indicate that E2 production is also inhibited by gossypol at 540

the level of thecal androgen production. 541

Gossypol appears to suppress gonadal steroidogenesis through various mechanisms. 542

Since gossypol is known to exert cell toxicity in variety of cell types, it may suppress 543

gonadal steroidogenesis through inducing cell death among follicular and luteal cell 544

populations (Qiu et al. 2002). Indeed, gossypol has been shown to increase the incidence 545

28

of follicular atresia among follicles in various developmental stages in rats (Gadelha et al. 546

2014). However, in vitro studies utilizing isolated granulosa and luteal cells do not support 547

this view: gossypol did not affect viability of cultured leydig cells (Pearce et al. 1985), 548

cultured granulosa cells (Akira et al. 1994), or it even increased number of cultured 549

granulosa cells in pigs (Basini et al. 2009). Similarly, it was reported that gossypol as high 550

as 170 µM did not affect viability of cultured bovine luteal cells (Gu et al. 1990b). Our 551

results also demonstrated that the treatment with gossypol up to 25 µg/mL (approx. 50 µM) 552

did not affect viability of cultured bovine non-luteinized and luteinized theca cells. Taken 553

together these results indicate that anti-steroidogenic effect of gossypol on ovarian cells is 554

not caused by decrease in cell viability. 555

Gossypol has been shown to inhibit gonadotropin-stimulated cAMP production in 556

cultured granulosa (Lin et al. 1994) and luteal cells in cattle (Gu et al. 1990a), and luteal 557

cells in rats (Wang et al. 1987). Gossypol appears to inhibit cAMP production at the level 558

of adenylate cyclase since cAMP production stimulated by forskolin, an activator of 559

adenylate cyclase, was shown to be inhibited by gossypol in bovine luteal cells (Gu et al. 560

1990a) and mouse leydig cells (Pearce et al. 1986 a, b). On the other hand, hCG binding to 561

LH receptor was not altered by gossypol in rat luteal cells (Wang et al. 1987) and mouse 562

leydig cells (Pearce et al. 1986b). Our result, that gossypol does not affect expression of 563

LHR, is in accordance with these results. Gossypol appears to suppress steroidogenesis also 564

at a distal to the cAMP production for it was shown to suppress dibutyryl cAMP stimulated 565

activities of CYP11A1 and HSD3B in bovine luteal cells (Gu et al. 1990b). In the present 566

study, the treatment with gossypol as low as 0.2 µg/mL blocked LH-stimulated expression 567

29

of CYP11A1, HSD3B and CYP17A1 in non-luteinized bovine theca cells. These results 568

indicate that gossypol suppresses thecal steroidogenesis at multiple sites distal to LHR 569

leading to down-regulation of genes encoding steroidogenic enzymes. 570

In conclusion, these results imply that gossypol inhibits ovarian steroidogenesis 571

through disturbing LH-stimulated thecal androgen production in cattle. The effect of 572

gossypol is at least partially exerted through down-regulation of genes encoding 573

steroidogenic enzymes responsible for P4 and A4 production. Effective doses of gossypol 574

to suppress steroidogenesis appears to be within the range reported in cattle fed large 575

amount of cottonseed meal. Since antifertility effects of gossypol were potentiated by 576

Trypanosoma brucei infection especially in protein-malnourished animals (Akingbemi et al. 577

1996), a special attention should be given to gossypol toxicity especially in countries where 578

cottonseed meal is used widely as an important protein source for livestock feed. 579

580

30

Table 3.1 Primers used for quantitative RT-PCR 581

Gene (size: bp) Primer Sequence (5’-3’) GeneBank No. Positiona

TBP (200) Sense gccttgtgcttacccaccaacagttc NM_001075742.1 1133 - 1158

Anti-Sense tgtcttcctgaaacccttcagaataggg 1332 - 1305

RPL4 (116) Sense actccgagcaccacgcaaga NM_001014894.1 945 - 964

Anti-Sense tggtgttcctgcgcatggtct 1060 - 1040

HSPCB (126) Sense cgaggacgcctctcgcatgg NM_001079637.1 2229 – 2248

Anti-Sense agaggaaaccatgtgggcca 2354 - 2333

LHR (202) Sense aggaaaatgcacgcctggag AF491303.1 620 - 639

Anti-Sense gtggcatccaggaggttggt 821 - 802

StAR (121) Sense cagcagaagggtgtcatcagag NM_174189.2 767 - 788

Anti-Sense gccatcccttgaggtcaatgct 887 - 866

CYP11A1 (118) Sense ccctgaaagtgacttggttcttca NM_176644.2 1209 - 1232

Anti-Sense gtcaaacttgtccggactggag 1326 - 1305

HSD3B (118) Sense ccttgtacacttgtgccctgag X17614.1 640 - 661

Anti-Sense aacttgcagtgattggtcagga 757 - 736

CYP17A1 (60) Sense ccaccctctcccaccatt

NM_174304.2 1622 - 1639

Anti-Sense gcaggctgggaaagaagg 1681 - 1664

aNucleotide position in the reported sequence. 582

583

584

31

585

Figure 3.1 Experimental schemes of gossypol treatments in non-luteinized theca cells and 586

luteinized theca cells. Bovine theca cells were harvested from healthy preovulatory follicles 587

and cultured with a low dose of LH (1 ng/mL) for the first 24 h, followed by a treatment 588

with a high dose of LH (100 ng/mL) for 24 h, and subsequently cultured with a low dose of 589

LH (1 ng/mL) for 7 days. Theca cells were treated with gossypol for 24 h at day 1 (non-590

luteinized theca cells: NL) or at day 7 (luteinized theca cells: L). A representative data 591

show changes in androstenedione (A4) and progesterone (P4) production by theca cells 592

during 9 days culture period. Data were expressed as mean ± SEM (n=4). 593

594

595

32

596

Figure 3.2 Effect of gossypol on the viability of non-luteinized and luteinized bovine theca 597

cells. Non-luteinized (A) and luteinized (B) bovine theca cells were cultured without or 598

with LH (1 ng/mL) and gossypol (0.2-25 µg/mL) for 24 h as mentioned in the materials and 599

methods and Figure 1. After the experimental periods, cells were collected and viability 600

(percentage of live cells) was determined. Data were expressed as mean ± SEM (n=4). 601

33

602

Figure 3.3 Effect of gossypol on the production of androstenedione and progesterone in 603

non-luteinized bovine theca cells. Non-luteinized bovine theca cells were cultured 604

with/without LH (1 ng/mL) and gossypol (0.2-25 µg/mL) for 24h as mentioned above. 605

After the culture, culture media were collected and production of A4 (A) and P4 (B), and a 606

ratio of A4 to P4 (C) were determined. Results of a representative experiment out of three 607

repeated trials were presented as mean ± SEM (n=4). Different letters (a,b,c) indicate 608

significant differences; P<0.05. 609

34

610

Figure 3.4 Effect of gossypol on the production of androstenedione (A4) and progesterone 611

(P4) in luteinized bovine theca cells. Luteinized bovine theca cells were cultured 612

with/without LH (1 ng/mL) and gossypol (0.2-25 µg/mL) for 24 h as mentioned above. 613

After the culture, culture media were collected and production of A4 (A) and P4 (B), and a 614

ratio of A4 to P4 (C) were determined. Results of a representative experiment out of three 615

repeated trials were presented as mean ± SEM (n=4). Different letters (a,b,c) indicate 616

significant differences; P<0.05. 617

35

618

Figure 3.5 Effect of gossypol on the gene expression of LHR, StAR, CYP11A1, HSD3B and 619

CYP17A1 in non-luteinized bovine theca cells. Non-luteinized bovine theca cells were 620

cultured with/without LH (1 ng/mL) and gossypol (0.2-25 µg/mL) for 24 h as mentioned 621

above. After the culture, theca cells were collected and mRNA was extracted. Levels of 622

gene expression were quantified by a real-time PCR and normalized to the geometric 623

means of three reference genes, TBP, RPL4 and HSPCB for LHR (A), StAR (B), CYP11A1 624

(C), HSD3B (D) and CYP17A1 (E). Data were expressed as mean ± SEM of three repeated 625

experiments. Different letters (a,b) indicate significant differences; P<0.05. 626

36

627

Figure 3.6 Effect of gossypol on the gene expression of LHR, StAR, CYP11A1, HSD3B and 628

CYP17A1 in luteinized bovine theca cells. Luteinized bovine theca cells were cultured 629

with/without LH (1 ng/mL) and gossypol (0.2-25 µg/mL) for 24 h as mentioned above. 630

After the culture, theca cells were collected and mRNA was extracted. Levels of gene 631

expression were quantified by a real-time PCR and normalized to the geometric means of 632

three reference genes, TBP, RPL4 and HSPCB for LHR (A), StAR (B), CYP11A1 (C), 633

HSD3B (D) and CYP17A1 (E). Data were expressed as mean ± SEM of three repeated 634

experiments. Different letters (a,b,c) indicate significant differences; P<0.05. 635

37

CHAPTER 4 636

GOSSYPOL INHIBITS LH-INDUCED BOVINE THECA CELLS 637

STEROIDEGENESIS VIA cAMP DEPENDENT PATHWAY 638

Introduction 639

In the chapter 3, we demonstrated that gossypol inhibits LH-induced steroid 640

production in bovine theca cells. LH-stimulated steroid production is known to be mediated 641

by the cAMP- and diacylglycerol (DAG)/inositol triphosphate (IP3)-dependent signaling 642

pathways (Davis 1994). Gossypol has been shown to suppress steroidogenesis through 643

inhibiting the former pathway: In cultured granulosa and luteal cells of rat and cattle, 644

gossypol inhibited intracellular cAMP production stimulated by hCG and forskolin, an 645

activator of adenylate cyclase (Gu et al. 1990a; Lin et al. 1994; Pearce et al. 1986b, Wang 646

et al. 1987). Gossypol also inhibited cAMP analog-stimulated steroidogenesis in rat and 647

bovine luteal cells (Wang et al. 1987; Gu et al. 1990b). Similar inhibitory effect of 648

gossypol on LH-stimulated cAMP production and dbcAMP-stimulated steroidogenesis was 649

also reported in leydig cells of mouse and rat (Pearce et al. 1986a; Olgiati et al. 1984). 650

These results indicate that gossypol inhibits cAMP-dependent signaling pathway at 651

adenylate cyclase led cAMP production as well as a step distal to cAMP production. 652

Gossypol also affects DAG/IP3-dependent signaling pathway. It was demonstrated 653

that high levels of gossypol (100-300 µM, approx. 50-150 µg/mL) inhibited activity of 654

protein kinase C (PKC) in rat spermatocyte (Teng 1995). 655

38

Taken together, these results imply that gossypol may suppress theca cell 656

steroidogenesis by inhibiting these signaling pathways. However, the mechanism how 657

gossypol inhibits LH-induced steroid production in bovine theca cells is still unknown. 658

Therefore, in this study, we investigated the effect of gossypol on cAMP- and DAG/ IP3-659

dependent signaling pathways in cultured bovine theca cells. 660

661

662

663

664

665

666

667

668

669

670

671

672

673

674

675

39

Materials and methods 676

Theca cell preparation and culture 677

Ovaries were obtained from the local abattoir. Theca cells were prepared as 678

mentioned in Chapter 2. In brief, follicular walls were harvested from apparently healthy, 679

well-vascularized follicles 10-15 mm in diameter with clear amber follicular fluid and theca 680

cells were enzymatically isolated. Approximately 7x104 viable theca cells were seeded in 681

96 well culture plates (Nunclon: Life Technologies, Paisley, UK) in 200 µL of culture 682

medium with 5% fetal calf serum (FCS: Fetal clone III, Hyclone laboratories, Logan, Utah, 683

USA) at 37℃ in 5% CO₂ in air.. 684

Experimental design 685

To examine the time dependent effect of gossypol, theca cells were cultured in 686

above culture medium without or with1 ng/mL LH (bovine LH, AFP-11118B, National 687

Institute of Diabetes and Digestive and Kidney Disease, Baltimore, MD, USA), without or 688

with 5 µg/mL of gossypol for 6h, 12h and 24h, respectively. Since significance inhibitory 689

effect of gossypol was seen at 6h, it is used as experimental model. 690

Effect of gossypol on PKA pathway 691

Theca cells were cultured in above culture medium with 3-isobutyl-1-692

methylxanthine (IBMX), 0.5 mM (Wako Pure Chemical Industries, Osaka, Japan), without 693

or with 5 µg/mL of gossypol, without or with 1ng/mL LH or without or with forskolin 10 694

µM (Wako) or without or with 0.5 mM dibutyryl-cAMP (dbcAMP) for 6h, respectively. 695

40

After 6h culture periods, the spent medium was collected and stored at -20℃ for A4 and 696

cAMP assays. 697

Effect of gossypol on PKC pathway 698

Theca cells were cultured in above culture medium without or with 5 µg/mL of 699

gossypol, without or with 1 ng/mL LH, without or with 100 nM phorbol 12-myristate 13-700

acetate (PMA) for 6h. After 6h culture periods, the spent medium was collected and stored 701

at -20℃ for A4 assay. 702

Androstenedione assay 703

Concentration of A4 in the culture medium was determined by using a commercial kit 704

(Androstenedione Human ELISA kit; Immunospec Corporation, Canoga Park, CA, USA) 705

following the procedures provided by the manufacturer. Intra- and inter-assay coefficients 706

of variation were less than 10%. 707

cAMP assay 708

cAMP concentration in the spent medium was measured by cAMP complete elisa 709

kit (Enzo Life Sciences, Farmingdale, New York, USA) following the procedures provided 710

by the supplier. The intra- and inter assay coefficient of variations were less than 10%. 711

712

713

714

41

Statistical analysis 715

All data were presented as mean ± SEM. Data were subjected to one-way or two 716

way analysis of variance (ANOVA) with Tukey multiple comparison test. P < 0.05 was 717

considered to be statistically significant. 718

719

720

721

722

723

724

725

726

727

728

729

730

731

732

733

734

735

42

Results 736

Time dependent effect of gossypol on theca cell steroid production 737

A4 production in the spent media were measured after the 6, 12 and 24-h 738

experimental periods. The treatment with LH (1 ng/mL) increased theca cell A4 production 739

in time-dependent manner (P<0.01). The treatment with gossypol (5 µg/mL) inhibited LH-740

induced A4 production (P<0.01). Significant inhibitory effect of gossypol was able to be 741

seen starting from the end of 6h culture period (Fig. 4.1). 742

Effect of gossypol on cAMP dependent/ PKA pathway 743

A4 production in the spent media were measured after the 6h experimental period. 744

Treatments with LH (1 ng/mL), forskolin (10 µM) and dbcAMP (0.5 mM) significantly 745

increased (P<0.01) A4 production about 3 fold, 4 fold and 3 fold, respectively, in theca 746

cells. Gossypol significantly inhibited (P<0.01) LH-, forskolin- and dbcAMP-induced A4 747

productions (Fig. 4.2A). 748

Effect of gossypol on LH and forskolin mediated cAMP production 749

cAMP production in the spent media were measured after the 6h experimental 750

periods. Treatments with LH (1 ng/mL) had no significant effect on cAMP production 751

whereas forskolin (10 µM) significantly increased (P<0.01) A4 production about 20 fold 752

higher than basal level in theca cells. Gossypol did not alter forskolin-stimulated cAMP 753

production (Fig. 4.2B). 754

43

Effect of gossypol on DAG/IP3-dependent signaling pathway 755

A4 production in the spent media were measured after the 6h experimental period. 756

Treatments with LH (1 ng/mL) significantly increased (P<0.01) theca cell A4 production 757

more than 2 fold higher than basal level. Treatment with PMA (100 nM) had no significant 758

effect on theca cells A4 production. Gossypol significantly inhibited (P<0.01) only LH-759

induced A4 production in this experiment (Fig. 4.3). 760

761

762

763

764

765

766

767

768

769

770

771

44

Discussion 772

In the chapter 3, we have demonstrated that gossypol suppressed LH-induced 773

bovine theca cell steroid production without affecting cellular viability. In this chapter, we 774

further investigated the mechanism of gossypol action to inhibit theca cell steroidogenesis. 775

LH stimulates steroidogenesis mainly through two intracellular signaling pathways, 776

cAMP- and DAG/IP3-dependent signaling pathways (Davis 1994). Upon binding to its 777

receptor, LH initiates a chain of intracellular events by activating the receptor coupled G-778

proteins, leading to activation of effector proteins: In cAMP-dependent signaling pathway, 779

production of cAMP by adenylate cyclase and subsequent activation of cAMP-dependent 780

protein kinase (PKA) take place, which in turn initiates cellular response such as increase in 781

steroid production (Wood & Strauss 2002). In DAG/IP3-dependent signaling pathway, 782

phospholipase C (PLC) cleaves phosphatidylinositol 4,5-bisphosphate (PIP2) to DAG and 783

IP3 and they act as second messengers to activate PKC (Davis 1994). 784

In the present study, we investigated mechanism of gossypol action in cultured 785

bovine theca cells by examining its effect on steroid and cAMP production stimulated by 786

activators of these signaling pathways. 787

In this study, treatment with low level of gossypol (5 µg/mL) significantly 788

decreased steroid production stimulated by LH, forskolin (an adenylate cyclase activator), 789

and dbcAMP (a permeable cAMP analog). These results are in accord with the results 790

previously reported in bovine granulosa and luteal cells (Gu et al. 1990a, b; Wang et al. 791

45

1987; Lin et al. 1994) and indicate that gossypol suppresses theca cell steroidogenesis 792

through cAMP-dependent signaling pathway. 793

Gossypol appears to suppress A4 production at a step distal to cAMP production. 794

In this study, forskolin and LH stimulated cAMP production was not attenuated by the 795

treatment with gossypol. Our results are in contrast with the previous results obtained in 796

rats and cattle where gossypol was shown to inhibit cAMP production in cultured granulosa 797

and luteal cells (Gu et al. 1990a, b; Pearce et al. 1986b; Lin et al. 1994; Wang et al. 1987). 798

The reason for this discrepancy is not clear but probably due to the difference in gossypol 799

doses used in these studies. The doses they used (more than 10 µg/mL) were much higher 800

than the dose used in this study. The level of gossypol we used in the present study (5 801

µg/mL) is the level that can be occurred in cattle fed cottonseed products as we discussed in 802

the Chapter 3. These results imply that gossypol suppress theca cell steroid production by 803

inhibiting PKA or downstream enzymes directly involved in the steroidogenesis. In 804

cultured mouse leydig cells, Pearce et al. (1986a) reached a similar conclusion that 805

gossypol exerts its major inhibitory effect somewhere between activation of PKA and 806

increased availability of cholesterol for side chain cleavage enzyme. Gossypol may exert its 807

inhibitory action through other cAMP dependent effecters, such as tyrosine kinase for 808

cAMP-dependent, but PKA-independent steroidogenesis was shown to occur in luteinized 809

human granulosa cells (Chin & Abayasekara 2004) and rat luteal cells (Needle et al. 2006). 810

However, a further study is necessary to elucidate this possibility. 811

46

Although PKA mediated signaling pathway is the predominant signaling cascade 812

involved in tropic hormone-stimulated StAR expression and steroid biosynthesis (Stocco & 813

Clark 1996; Jo et al. 2005; Manna & Stocco 2005), PKC mediated signaling pathway is 814

also likely to be involved in steroid biosynthesis (Manna & Stocco 2005). To investigate 815

gossypol effect on PKC mediated steroid production we treated theca cells with gossypol 816

and PMA, an activator of PKC. In the present study, PMA has no effect on bovine theca 817

cells A4 production. These results indicate that PKC is not involved in LH-stimulated A4 818

production in bovine theca cells. These results are in accord with results obtained by 819

Kaminski (2004) and Tilly & Johnson (1988, 1989), where no effect of PMA on basal 820

steroidogenesis was reported in porcine theca cells and hen granulosa cells. Nevertheless, 821

inhibitory effect of gossypol on PKC activity was reported in rat spermatocytes and liver 822

cells by Teng (1995) and Xiao et al. (1993), respectively. 823

In conclusion, the present study clearly demonstrated that inhibition of LH-824

induced steroidogenesis by gossypol is not through PKC-mediated signaling pathway but 825

through cAMP-dependent signaling pathway in bovine theca cells. Gossypol appears to 826

exert its effect at a step distal to cAMP production. 827

828

829

830

831

47

832

Figure 4.1 Time dependent effect of gossypol (5 μg/mL) on steroid production of bovine 833

theca cells. Bovine theca cells were harvested from healthy preovulatory follicles and 834

cultured without or with LH (1 ng/mL) and without or with gossypol (5 μg/mL) for 6, 12 835

and 24h, respectively. After the culture, culture media were collected and steroid 836

production (A4) was determined. Data were expressed as mean ± SEM (n=4). Different 837

letters (a,b,c,d) indicate significant differences; P<0.05. 838

839

840

841

842

843

48

844

Figure 4.2 Effect of gossypol on the cAMP dependent pathway. Bovine theca cells were 845

cultured without or with gossypol (5 μg/mL), without/with LH (1 ng/mL) or without/with 846

forskolin 10 µM or without/with dibutyryl-cAMP (dbcAMP) 0.5 mM for 6h as mentioned 847

above. After the experimental periods, spent media were collected and production of A4 848

(A) and cAMP production (B) were measured. Data were expressed as mean ± SEM (n=4). 849

Different letters (a,b,c,d,e) indicate significant differences; P<0.05. Superscripts *** 850

indicate P<0.001 between gossypol and no gossypol treatments. 851

852

49

853

Figure 4.3 Effect of gossypol on the PKC pathway in bovine theca cell. Theca cells were 854

cultured without or with gossypol (5 μg/mL), without or with LH (1 ng/mL) or without or 855

with 100 nM PMA for 6h as mentioned above. After the experimental periods, spent media 856

were collected and production of A4 in the medium was measured. Data were expressed as 857

mean ± SEM (n=4). Different letters (a,b,c) indicate significant differences; P<0.05. 858

Superscripts *** indicate P<0.001 between gossypol and no gossypol treatments. 859

860

861

862

863

864

865

866

867

50

CHAPTER 5 868

EFFECT OF GOSSYPOL ON BOVINE THECA CELLS CARBOHYDRATE 869

METABOLISM 870

Introduction 871

In the Chapter 3, it was demonstrated that gossypol at 5 µg/mL or less suppressed 872

androstenedione (A4) production by suppressing gene expression of StAR and steroidogenic 873

enzymes in cultured bovine theca cells without affecting cellular viability. These results 874

indicate that gossypol inhibits theca cell steroidogenesis through mechanisms other than 875

apoptosis. Gossypol is apparently able to act by a number of mechanisms, including the 876

inhibition of cellular energy metabolism through suppressing glycolysis and expression of 877

enzymes involved in glycolytic pathway. 878

The glycolytic pathway is the central metabolic pathway necessary for energy 879

production. Glucose metabolism through glycolytic pathway has been shown to be key 880

determinants of follicle development, maturation and ovulation (Boland et al. 1993, 1994a, 881

b). Ovarian follicles appear to utilize anaerobic glycolysis leading to production of lactate 882

for energy production (Boland et al. 1993). Since decrease in glucose supply suppresses 883

follicular steroidogenesis (Boland et al. 1994b), it is possible that gossypol decreases 884

steroidogenesis by suppressing glucose utilization. 885

Once glucose is transported into cell by glucose transporters (GLUTs) across the 886

cell membrane, it enters glycolysis mediated by 10 glycolytic enzymes, namely hexokinase 887

51

(HK), phosphoglucoisomerse (GPI), phosphofructokinase (PFK), aldolase (Aldo), 888

triosesphosphate isomerase (TPI), glyceraldehyde-3-phosphate dehydrogenase (GAPDH), 889

phosphoglycerate kinase (PGK), phosphoglycerate mutase (PGM), enolase (ENO) and 890

pyruvate kinase (PK), leading to formation of two molecules of pyruvate. In anaerobic 891

glycolysis, pyruvate is converted to lactate by lactate dehydrogenase (LDH). Of these 892

enzymes, HK, PFK, PK and LDH are considered as rate limiting enzymes. 893

Inhibition of LDH activity by gossypol was reported in mouse kidney, liver and 894

testis (Lee et al. 1981), in rat testis (Giridharan et al. 1982) and in bull spermatozoa (Rovan 895

et al. 1984). Disturbance of sperm energy metabolism by inhibiting glucose and fructose 896

utilization in the presence of gossypol is also reported by Wichmann et al. (1983). These 897

results imply that the inhibitory effect of gossypol on theca cell steroidogenesis may be 898

caused by suppression of glucose metabolism at steps mediated by LDH or/and key 899

enzymes of glycolysis. However, nothing is known about the effect of gossypol on 900

carbohydrate metabolism in the theca cell in any species. 901

The purpose of this chapter is to elucidate the effect of gossypol on carbohydrate 902

metabolism in bovine theca cells. In the first part, we elucidated gene expression of HK, 903

PFK, PK and LDH isozymes and subunits in theca tissues collected from growing and 904

maturing follicles. In the second part we elucidated effect of gossypol on the lactate 905

production and expression of these key glycolytic enzymes in cultured bovine theca cells. 906

907

908

52

Materials and methods 909

Follicles collection 910

Paired ovaries were harvested from Holstein x Japanese Black F1 heifers (21-26 911

months old) at an abattoir. Only healthy ovarian pairs were used in the present study. The 912

ovaries were prepared as mentioned previously in the Chapter 2. Physiological condition of 913

follicles (developing vs matured) were decided using the criteria mentioned in Nishimoto et 914

al. (2009). 915

Classification of follicles 916

Follicular diameters were estimated from the weight of FF using the equation: 917

y=12.96x0.31, where y = the diameter of follicles (mm) and x = the weight of FF (g) 918

(Murasawa et al. 2005). Small and large follicles were classified based on the diameter 919

("8.5 mm or <8.5 mm), relative concentrations of E2 and P4 in FF (E/P "1 or <1), the 920

stages of CL and accompanying follicles (Table 5.2). 921

Collection of theca cells 922

Bovine ovaries were obtained from the local abattoir. Ovaries were transported to 923

the laboratory in the next morning in Dulbecco’s phosphate buffered saline (DPBS) 924

supplemented with 17.5 mM glucose and 15 mM MgCl2.6H2O at 20℃. Large follicles 925

>10-15 mm with amber follicular fluid and vascularized follicles in diameter were used. 926

Theca cells were prepared as mentioned in Chapter 2. 927

53

Theca Cell culture 928

Approximately 7x104 theca cells were cultured in 96 well plates in 200 µL of 929

culture medium with 5% fetal calf serum (FCS: Fetal clone III, Hyclone laboratories, 930

Logan, Utah, USA), without or with 1 ng/mL LH (bovine LH, AFP-11118B, National 931

Institute of Diabetes and Digestive and Kidney Disease, NIDDK) and various concentration 932

of gossypol (0, 0.2, 1, 5 and 25 µg/mL) for 24h. At the end of the experimental period, the 933

spent medium was collected and stored at -20℃ for steroid assays. 934

Glucose and lactate assays 935

Glucose concentration in the spent medium and follicular fluid was measured 936

using a commercial glucose assay kit (Wako Pure Chemical Industries, Osaka, Japan) 937

following the procedures provided by the supplier. Lactate production in the medium was 938

measured by lactic acid kit (Determiner LA, Kyowa Medex Co., Tokyo). The intra- and 939

inter assay coefficient of variations were less than 10%. 940

RNA extraction, reverse transcription (RT) and quantitative polymerase chain 941

reaction (qPCR) 942

Total RNA was extracted from theca cells by using phenol-chloroform method and 943

reverse-transcribed using a commercial kit (Ominiscript Reverse Transcription kit; 944

QIAGEN, GmbH, Hilden, Germany) following the procedures provided by the 945

manufacturers. The abundance of mRNAs encoding HK1, HK2, PFKL, PFKM, PFKP, 946

PKM, LDHA and LDHB were quantified by a real-time quantitative PCR (LightCycler 947

54

Nano; Roche, Basel, Swizerland) using a commercial real-time PCR kit (FastStart Essential 948

DNA Green Master; Roche). Specific primers for target genes were designed and PCR was 949

performed as mentioned in Chapter 2 (Table. 5.1). All cDNA samples were amplified in 950

duplication and each transcript level was normalized to the geometric mean of 3 reference 951

genes selected by geNorm as mentioned in the Chapter 2. The intra- and inter-assay 952

coefficient of variations was less than 10% for all measurements. 953

Statistical analysis 954

All data were presented as mean ± SEM. Data were subjected to one-way analysis 955

of variance (ANOVA) followed by Tukey multiple comparison test or t-test. Levels of gene 956

expression were analyzed using one-way repeated measures ANOVA. P < 0.05 was 957

considered to be statistically significant. 958

959

960

961

962

963

964

965

55

Results 966

Gene Expression of glycolytic enzymes in bovine follicles 967

Gene expression of the glycolytic enzymes HK1 and HK2, but not HK3; all three 968

subunits of PFK, PFKL, PFKM, and PFKP, PKM but not PKL; and both LDHA and LDHB 969

were examined in preovulatory small growing follicles (SG) and early dominant follicles 970

(ED) (Fig. 5.1). HK2 and PKFM genes express significantly higher in early dominant 971

follicles (P<0.05) (Fig. 5.1B, D). 972

Effect of gossypol on lactate production in preovulatory bovine theca cells 973

During 6h experimental period, gossypol significantly inhibited preovulatory 974

bovine theca cell lactate production in dose-dependent manner (Fig. 5.2). 975

Effect of gossypol on gene expression of glycolytic enzymes, HK1, HK2, PFKL, PFKM, 976

PFKP, PKM, LDHA and LDHB 977

Treatment with LH seemed to have no effect on the gene expressions of HK1, HK2, 978

PFKL, PFKM, PFKP, PKM, LDHA and LDHB (Fig. 5.3). Gossypol also had no effect on 979

gene expressions of glycolytic enzymes except for PFKM (Fig. 5.3D). Expression of PFKL 980

and LDHA were tended to be slightly decreased (Fig. 5.3C, G), that of PFKP and LDHB 981

(Fig. 5.3E, H) were not affected and that of HK1, HK2 and PKM (Fig. 5.3A, B, F) seemed 982

to be increased by gossypol. 983

984

56

Discussion 985

In the present chapter, we investigated the expression of isozymes and subunits of 986

four key enzymes, HK, PFK, PK and LDH, in anaerobic glycolytic pathway in the bovine 987

theca interna and effect of gossypol on the expression of these enzymes and production of 988

lactate, the terminal product of anaerobic glycolysis, in cultured bovine theca cells. Glucose 989

is a main energy substrate in the ovary and availability of glucose has been shown to affect 990

ovarian function (Rabiee et al. 1997). Glucose appears to be mainly metabolized through 991

anaerobic glycolysis in the ovarian follicle (Boland et al. 1993). The anaerobic glycolysis is 992

mediated by10 glycolytic enzymes and LDH. Of which, four enzymes, HK, PFK, PK and 993

LDH catalyze rate-limiting steps that determine velocity of the pathway (Li et al. 2015). 994

Despite the importance of these enzymes in cellular functions, little is known about their 995

expressions and activities in the follicle of any species. Thus, we have examined the gene 996

expression of isozymes and subunits of these enzymes in the theca interna harvested from 997

bovine growing follicles (<8.5 mm) and large preovulatory follicles (>8.5 mm). 998

Our results demonstrated that the bovine theca interna expresses gene encoding 999

HK isozymes, HK1 and HK2, but not HK3; all three subunits of PFK, PFKL, PFKM and 1000

PFKP; PKM, but not PKL; and both LDHA and LDHB. HK catalyzes the first step of the 1001

glycolysis, phosphorylation of glucose to produce glucose-6-phosphate. There are three 1002

HKs with high substrate affinity (Wilson 2003; Li et al. 2015). HK1 is a ubiquitous HK 1003

found in all mammalian tissues and plays as a housekeeping HK (Wilson 2003; Li et al. 1004

2015). HK2 is a predominant HK found in skeletal muscles and heart and plays as the key 1005

57

HK regulating rate of glycolysis (Wilson 2003; Li et al. 2015). HK3 is less characterized 1006

HK and little is known about its metabolic role (Wilson 2003; Li et al. 2015). Our results, 1007

that both HKs were expressed in the bovine theca interna and the expression of HK2 but 1008

not HK1 increased as follicular development progressed indicate that the first step of the 1009

glycolysis is mediated by both HK1 and HK2 but increase in the rate of glycolysis to keep 1010

up with increasing glucose requirement associated with follicular maturation is met by HK2. 1011

The second rate-limiting step of the glycolysis is mediated by PFK, which converts 1012

fructose-6-phosphate to fructose1, 6-biphosphate at an expense of an ATP. In the present 1013

study, we identified all three PFK subunit genes encoding liver-type (PFKL), muscle-type 1014

(PFKM) and platelet type (PFKP) in the theca interna. These results indicate that PFK, a 1015

tetrameric enzyme, consists of combinations of any of these subunits in the bovine theca 1016

interna. PFK is the most important rate-limiting enzyme in the glycolytic pathway (Li et al. 1017

2015), and we observed significantly higher expression of PFKM in association with 1018

follicular development. 1019

PK catalyzes the third rate-limiting step and converts phosphoenolpyruvate to 1020

pyruvate and generates one molecule of ATP. There are two isozymes of PK, PKL and 1021

PKM (Li et al. 2015). In the present study, only PKM was found in the bovine theca interna 1022

and its expression was not significantly altered between small growing follicles and large 1023

preovulatory follicles. 1024

The interconversion of pyruvate and lactate is catalyzed by LDH. This process 1025

occurs under anaerobic condition in general but has been shown to occur in aerobic 1026

58

condition in cultured murine ovarian follicles (Boland et al. 1993). LDH is an enzyme 1027

comprises of four subunits in combinations of two forms of subunits, LDHA, an anaerobic 1028

muscle form and LDHB, an aerobic heart form (Li et al. 2015). The third LDH subunit 1029

unique to testis, LDHC was also reported (Wheat & Goldberg 1983). There are five 1030

isoforms of LDH: LDH-1 (B4), LDH-2 (B3A1), LDH-3 (B2A2), LDH-4 (B1A3) and LDH-1031

5 (A4) (Li et al. 2015). These five isozymes were shown to be expressed in the rat ovary, 1032

and gonadotropin treatment shifted ratio of the isozymes from LDH-1, LDH-2 and LDH-3 1033

to LDH-5 (Matsuzawa & Takikawa 1968). LDH activity in the human follicles was shown 1034

to mainly occur in theca interna and its activity was strong in preovulatory follicles 1035

(Breitenecker et al. 1978). Our study demonstrated that LDHA and LDHB are both 1036

expressed in bovine theca interna. However, we could not observe any significant changes 1037

in the expressions of LDHA and LDHB with the follicular development although the 1038

LDHA: LDHB ratio is in favor of LDHA. In these follicles, concomitant increase in 1039

glucose and decrease in lactate in follicular fluid were observed. These results imply that 1040

LDH isozymes are changing with follicular development with well vascularized 1041

preovulatory follicles express more aerobic forms of LDH and this shift is mainly regulated 1042

by the expression of LDHA subunit in the bovine follicle. 1043

Taken together, our results demonstrated that the glycolysis is regulated by 1044

multiple isozymes of rate-limiting enzymes in the bovine theca interna. 1045

In the present study, gossypol significantly inhibited lactate production in cultured 1046

bovine theca cells. These results clearly demonstrated that gossypol suppresses anaerobic 1047

59

glycolysis in bovine theca cells. To our knowledge, this is the first report that demonstrated 1048

antagonistic effect of gossypol on glycolysis in theca cells. 1049

Gossypol inhibition of LDH activity was well documented in various organs and 1050

cells in various species; in the kidney and liver of mice (Lee et al. 1981), in the testis of 1051

rodents (Lee et al. 1981; Giridharan et al. 1982; Kim et al. 1985) and cattle (Oligati & 1052

Toscano 1983), in the spermatozoa of rabbits, monkeys, cattle and humans (Eliasson & 1053

Virji 1983; Ikeda 1990; Rovan et al. 1984; Stephens et al. 1983). Our results are in 1054

consistent with these reports. 1055

In the present study, however, we couldn’t demonstrate clear effect of gossypol on 1056

the gene expression of the key rate-limiting enzymes of anaerobic glycolysis except for 1057

PFKM. Although expression of PFKL and LDHA was tended to be slightly decreased, that 1058

of PFKP and LDHB was not affected and that of HK1, HK2 and PKM was even increased 1059

by gossypol. It is likely that gossypol affects glycolysis through directly inhibiting enzyme 1060

activity without affecting gene expression of the enzyme. 1061

Alternatively gossypol may suppress lactate production by inhibiting glucose 1062

uptake mediated by GLUT on the cellular membrane. Bovine theca cells were shown to 1063

express passive transporter GLUT1 and GLUT3 as well as insulin-dependent active 1064

transporter GLUT4 (Nishimoto et al. 2006). Gossypol was shown to disturb sperm energy 1065

metabolism by inhibiting glucose and fructose utilization (Wichmann et al. 1983). In the 1066

present study, however, we couldn’t measure glucose consumption by theca cells since the 1067

amount of glucose consumed was much less compared to total amount of glucose present in 1068

60

the culture medium (17.5 mM) to estimate glucose consumption by subtracting the amount 1069

of glucose remains in the spent medium from the initial amount of glucose present in the 1070

medium before the culture. A further study is necessary to elucidate effect of gossypol on 1071

glucose uptake by theca cells. 1072

Taken together, our results demonstrated that gossypol inhibits glucose 1073

metabolism somewhere along glucose uptake and the following anaerobic glycolysis 1074

leading lactate production. These results imply that the inhibitory effect of gossypol on 1075

theca cell steroidogenesis may be caused by suppression of glucose metabolism through 1076

anaerobic glycolysis. It was reported that development and steroidogenesis of cultured 1077

murine follicles was dependent on glucose concentration in the culture medium and glucose 1078

lower than 2 mM retarded follicular development (Boland et al. 1994b). To prove this 1079

hypothesis, however, a further study is necessary. 1080

1081

1082

1083

1084

1085

1086

1087

61

1088

Table 5.1 Oligonucleotide primers used for quantitative real-time PCR 1089

Gene (size: bp) Primer Sequence (5’-3’) GenBank No. Positiona

HK-1 (134) Sense tgggaaaaagagatcggtggaa AF542053 1641

Anti-Sense tgatgcccatgtagtccaggaa AF542053 1774

HK-2 (152) Sense gcctcacatctgctcgcctact XM_001255831 478

Anti-Sense gctccaagccctttctccatct XM_001255831 629

HK-3 (204) Sense ggcctggaagagctgaccatatc NM_001101929 815

Anti-Sense gagctggttgctggagacttct NM_001101929 1043

PFK-L (108) Sense acatgaccatcggcacagac XM_585495 473

Anti-Sense ccatcacctccagcacaaag XM_585495 580

PFK-M (85) Sense cgcatcaagcagtcagcag NM_001075268 1718

Anti-Sense agtagccgcccatcgtttcaat NM_001075268 1784

PFK-P (149) Sense cgcgtgttcatcatcgagac NM_001193220 1802

Anti-Sense ttctccgtcaggtgctcca NM_001193220 1950

PK-L (200) Sense cgtgtaccaccggcagctctt NM_001076176 1402

Anti-Sense gggtgacggcaatgactgttg NM_001076176 1601

PK-M (135) Sense cactgaagatcaccctggac XM_590109 580

Anti-Sense gcagagaaataagcccatca XM_590109 714

LDHA (144) Sense attggactgtcagtggccgatt NM_174099 754

Anti-Sense tccattctgtcccaagatgcaa NM_174099 897

LDHB (143) Sense ctgacgagcttgctcttgtgga NM_174100 137

Anti-Sense cacgatcttggaattggcagtg NM_174100 279

GAPDH (178) Sense gcgccaagagggtcatcatc NM_001034034 409

62

Anti-Sense agtccctccacgatgccaaa NM_001034034 586

Nucleotide position in the reported sequence. 1090

Table 5.2. Size and biochemical characteristics of small and large healthy follicles 1091

Follicular

category (n)

Size

(mm)

E2

(ng/mL)

P4

(ng/mL)

E2:P4 ratio

(ng/ng)

Glucose

(mg/dL)

Lactate

(mg/dL)

Lac:Glc ratio

(mol/mol)

Small follicle

<8.5 mm (5) 8.0 ± 0.2 a 15.8 ± 3.4 a 11.6 ± 1.8 a 1.34 ± 0.22 57.8 ± 4.1 a 83.7 ± 4.7 a 1.47 ± 0.08 a

Large follicle

≥8.5 mm (5) 14.3 ± 1.7 c 55.6 ± 10.8 c 24.5 ± 3.6 b 2.35 ± 0.45 75.5 ± 1.3 c 52.7 ± 8.1 b 0.93 ± 0.14 c

Values are expressed as mean ± SD. Values with different superscripts within each column 1092

and same follicle categories are significantly different (a,b; P<0.05: a,c; P<0.01). 1093

1094

1095

1096

1097

1098

1099

1100

1101

63

1102

1103

Figure 5.1 Gene expression of glycolytic enzymes HK1 (A), HK2 (B), PFKL (C), PFKM 1104

(D), PFKP (E), PKM (F), LDHA (G) and LDHB (H) in small growing follicles (SG) and 1105

64

dominant preovulatory follicles (ED). Follicles were selected following the criteria 1106

mentioned in the materials and methods. Data were expressed as mean ± SEM (n=5). 1107

1108

Figure 5.2 Effect of gossypol on the production of lactate in preovulatory bovine theca cells. 1109

Bovine theca cells were cultured without or with LH (1 ng/mL) and gossypol (0.2-25 1110

µg/mL) for 24h as mentioned in materials and methods. After the culture, culture media 1111

were collected and amount of lactate was determined. Results of a representative 1112

experiment out of three repeated trials were presented. Data were expressed as mean ± 1113

SEM (n=4). 1114

1115

1116

1117

1118

65

1119

1120

1121

1122

Figure 5.3 Effect of gossypol on the gene expression of HK1, HK2, PFKL, PFKM, PFKP, 1123

PKM, LDHA and LDHB in cultured bovine theca cells. Bovine theca cells were harvested 1124

from healthy preovulatory follicles and cultured without or with LH (1 ng/mL) and 1125

gossypol (0.2-25 µg/mL) for 24h as mentioned in the materials and methods. After the 1126

66

culture, theca cells were collected and mRNA was extracted. Levels of gene expression 1127

were quantified by a real-time PCR and normalized to the geometric means of three 1128

reference genes, TBP, RPL4 and HSPCB for HK1 (A), HK2 (B), PFKL (C), PFKM (D), 1129

PFKP (E), PKM (F), LDHA (G) and LDHB (H). Data were expressed as mean ± SEM of 1130

three repeated experiments. 1131

CHAPTER 6 1132

GENERAL DISCUSSION 1133

In the present study, we have conducted a series of experiments to elucidate the effect 1134

of gossypol on steroidogenesis and its inhibitory mechanism in cultured bovine theca cells. 1135

The main findings are as follows; 1) gossypol inhibits cultured bovine theca cells 1136

steroidogenesis not by affecting cell viability but by suppressing expression of genes 1137

encoding steroidogenic enzymes responsible for androgen production, 2) the mechanism of 1138

antisteroidogenic effect of gossypol is mainly exerted through inhibiting cAMP dependent 1139

signaling pathway at a step distal to cAMP production, 3) gossypol inhibits anaerobic 1140

glycolysis, a carbohydrate metabolism leading to lactate production, in bovine theca cell. 1141

Gossypol has been known to suppress gonadal functions in both male and female for 1142

decades. In animals fed cottonseed or cottonseed meal containing gossypol, various 1143

negative effects on reproductive function such as deterioration of spermatogenesis, 1144

disruption of testicular function, disturbance of estrus cycle, decrease conception rate and 1145

increase incidence of abortion have been reported (Lin et al. 1981; Donaldson et al. 1985; 1146

Pearce et al. 1986a, Lagerlöf & Tone 1985; Santos et al. 2003). This holds a serious threat 1147

67

to livestock industry that heavily dependent on cottonseed as a precious nutritional source 1148

especially in cotton glowing developing countries. 1149

The deleterious effects of gossypol on reproduction are likely to be at least partially 1150

caused by suppression of gonadal steroidogenesis. 1151

To date, several studies have been conducted to investigate effect of gossypol on 1152

steroidogenesis (i.e., P4 and E2) in cultured granulosa and luteal cells in various species 1153

including cattle (Basini et al. 2009; Gu et al. 1990a, b, 1991; Ohmura et al. 1996; Vranová 1154

et al. 1998; Wang et al. 1987). However, little has been done to elucidate effect of gossypol 1155

on theca cell function in any species. Theca cells play a vital role in E2 production in 1156

follicles through supplying androgen, the substrate for estrogen production. Theca cells are 1157

likely to be more readily affected by gossypol since well vascularized theca interna is more 1158

likely affected by blood-borne gossypol than avascular granulosa cells. In the present study, 1159

therefore, we conducted a series of experiments to elucidate effect of gossypol and its 1160

inhibitory mechanism in cultured bovine theca cells. 1161

Theca cells used in the present study were harvested from large preovulatory follicles in 1162

which both estrogen and androgen production are increased (Kruip & Dieleman 1985; 1163

Nishimoto et al. 2009; Tetsuka et al. 2010). Under the present culture condition, theca cells 1164

produced more A4 than P4 at Day 1 but A4 production was sharply decreased in the 1165

subsequent days to levels much lower than P4 production (Fig. 3.1). Preliminary study 1166

showed that although theca cells maintained ability to produce androgen at the response to 1167

LH stimulation, the A4 production level never exceeded that of P4. P4 production, on the 1168

68

contrary, increased sharply after Day 4 indicating luteinization occurred. Based on these 1169

results, we employed culture period of one day (Chapter 3 & 5) or less (6h: Chapter 4) for 1170

unluteinized model and 7 days for luteinized model (Chapter 3). 1171

In the chapter 3, it was demonstrated that gossypol inhibited LH-stimulated 1172

steroidogenesis in cultured bovine theca cells. Production of A4 appeared to be more 1173

sensitive to gossypol than that of P4 as A4 production was inhibited by gossypol at a level 1174

as low as 1 μg/mL whereas P4 production was inhibited at 25 μg/mL. Although the safe 1175

upper limit of plasma gossypol concentration in cattle was advocated as 4 μg/mL (Noftsger 1176

et al. 2000), the present results indicate that ovarian steroidogenesis might be suppressed at 1177

lower levels of gossypol. Taken together, these results implicate that gossypol suppresses 1178

follicular E2 production by suppressing thecal androgen production in cattle fed large 1179

amounts of cottonseed meal. 1180

The mechanism of antisteroidogenic property of gossypol appears to be exerted through 1181

various mechanisms. One of the mechanisms is cell cytotoxicity. Because of this property, 1182

gossypol has been attracted an attention as a possible anticancer drug (Gilbert et al. 1995; 1183

Jiang et al. 2004; Zhang et al. 2003). 1184

In our study, however, gossypol up to 25 μg/mL had no effect on cell viability. The 1185

results indicate that anti-steroidogenic effect of gossypol is not caused by cytotoxicity in 1186

bovine theca cells at least under the condition used (Chapter 3). 1187

69

Since the LH-stimulated expression of steroidogenic genes, StAR, CYP11A1, HSD3B 1188

and CYP17A1 were suppressed by gossypol at a dose as low as 0.2 μg/mL (Chapter 3), we 1189

investigated effect of gossypol on intracellular signaling pathways in cultured theca cells in 1190

the following chapter (Chapter 4). 1191

LH exerts its effect mainly via two intracellular signaling pathways, cAMP-dependent 1192

PKA signaling pathway and DAG/IP3-dependent PKC signaling pathway (Davis 1994). 1193

The present results indicate that inhibitory effect of gossypol is exerted through suppression 1194

of cAMP-dependent pathway in bovine theca cells, for gossypol inhibited LH-, forskolin- 1195

and dbcAMP-stimulated but not PMA-stimulated A4 production. Both LH- and forskolin-1196

stimulated cAMP production was not affected by gossypol also indicates that gossypol 1197

exerts its inhibitory effect somewhere after the cAMP production. Taken together, the 1198

results obtained in the Chapter 3 and 4 indicate that gossypol exerts its inhibitory effect on 1199

steroidogenesis at a step or steps distal to cAMP production, and suppresses gene 1200

expressions of StAR and down-stream steroidogenic enzymes responsible for androgen 1201

biosynthesis in cultured bovine theca cells. 1202

In the Chapter 5, we investigated effect of gossypol on anaerobic glycolysis, a main 1203

metabolic pathway in the ovarian follicle (Boland et al. 1993). 1204

Unlike in the case of steroid production, LH did not stimulate lactate production in 1205

cultured bovine theca cells. Nevertheless, gossypol dose-dependently suppressed lactate 1206

production, implying that the inhibitory effect of gossypol is cAMP-dependent signaling 1207

pathway independent. Bovine theca cell expresses genes encoding multiple isozymes and 1208

70

subunits of four key rate-limiting enzymes; HK1, HK2, PFKL, PFKM, PFKP, PKM, 1209

LDHA and LDHB. Unlike in the case of steroidogenic genes, the effect of gossypol on the 1210

expression of these genes was not clear. To clarify the effect of gossypol on carbohydrate 1211

metabolism, a further study is necessary. 1212

In conclusion, gossypol inhibits LH-stimulated androgen production in cultured bovine 1213

theca cells at doses comparable to that found in the plasma in cattle fed with large amount 1214

of cottonseed. The inhibitory effect of gossypol appears to be at least partially mediated 1215

through suppression of cAMP-dependent signaling pathway at a step or steps distal to 1216

cAMP formation, leading to decrease in the expression of genes encoding StAR, CYP11A1, 1217

HSD3B and CYP17A1. Gossypol appears to also suppress anaerobic glycolysis. The 1218

mechanism of this inhibition was not clarified in the present study but it is also likely to be 1219

responsible for the gossypol-induced decrease in thecal steroidogenesis, for decrease in 1220

glucose supply was reported to affect steroidogenesis in cultured murine follicles (Boland 1221

et al. 1994b). 1222

1223

1224

1225

1226

1227

1228

1229

1230

71

1231

1232

1233

1234

1235

1236

ACKNOWLEDGEMENTS 1237

This research was made possible from the support of Japanese Government 1238

(Monbukagakusho: MEXT). 1239

First I would like to offer a sincere thank you to my supervisor Dr. Masafumi 1240

Tetsuka, Professor, Division of Animal Production Science, Obihiro University of 1241

Agriculture and Veterinary Medicine for his guidance, encouragement and comments 1242

during my PhD program. I would also like to thank him for passing his vast experience and 1243

knowledge in all things reproductive. I would like to extend my thanks to my two co-1244

chairmen, Dr. Katsuya Kida and Dr. Ken Sawai. Without their support, it would have been 1245

impossible to achieve my goal. 1246

I would like to extend my special thanks to Union Minister, Minister of Ministry of 1247

Livestock, Fisheries and Rural Development, H.S. U Ohn Myint for the opportunity to 1248

perform this work in Japan. 1249

I wish to express my sincere appreciation to Professor Dr. Mar Mar Win, the Rector 1250

of University of Veterinary Sciences, Myanmar, for her kind supports for this study. I also 1251

would like to thank all my teachers and colleagues at the University of Veterinary Science, 1252

72

Yezin, Myanmar. Their willingness to share their scholarly experience thus made it 1253

possible for me to obtain this PhD degree. 1254

A dear thanks must also go to my laboratory mates, my country mates and 1255

international friends in Obihiro City for their sincere help and moral supports throughout 1256

my stay in Japan. 1257

Lastly but not the least, I wish to express my deepest love and gratitude to my 1258

family for their exceptional care, steadfast support, sacrifices and love. 1259

1260

1261

1262

1263

1264

1265

1266

1267

1268

1269

1270

1271

1272

1273

1274

1275

73

1276

1277

1278

1279

1280

1281

1282

REFERENCES 1283

Abou-Donia MB, Dieckert JW. 1974. Urinary and biliary excretion of 14C gossypol in 1284

swine. Journal of Nutrition 104, 754-760. 1285

Abou-Donia MB. 1976. Physiological effects and metabolism of gossypol. Residue 1286

Reviews 61, 125-160. 1287

Adams AL, Staples CR, Van Horn HH, Thatcher WW. 1998. Effects of gossypol from 1288

whole cottonseed on lactation and reproductive performance of dairy cows. 35th Florida 1289

Dairy Production Conference, Gainesville. 1290

Akingbemi BT, Aire TA, Oke BO. 1996. Infection with Trypanosoma brucei potentiates 1291

the antifertility effect of gossypol, especially in the protein-malnourished male rat. 1292

International Journal of Andrology 19, 179-189. 1293

Akinola OB, Dosunmu OO, Dini L, Ajayi S. 2006. Proteinaceous diet inhibits gossypol-1294

induced spermatotoxicity. European Journal of Histochemistry 50, 205-208. 1295

74

Akira A, Ohmura H, Uzumcu M, Araki T, Lin YC. 1994. Gossypol inhibits aromatase 1296

activity in cultured porcine granulosa cells. Theriogenology 41, 1489-1497. 1297

Alexander J, Benford D, Cockburn A, Cravedi JP, Dogliotti E, Domenico AD, Férnandez 1298

ML, Fürst P, Gremmels JF, Galli CL, Grandjean P, Gzyl J, Heinemeyer G, Johansson 1299

N, Mutti A, Schlatter J, Leeuwen RV, Peteghem CV, Verger P. 2008. Gossypol as 1300

undesirable substance in animal feed. The EFSA Journal 908, 1–55. 1301

Arshami J, Ruttle JL. 1988. Effects of diets containing gossypol on spermatogenic tissues 1302

of young bulls. Theriogenology 30, 507–516. 1303

Barraza ML, Coppock CE, Brooks KN, Wilks DL, Saunders RG, Latimer GW Jr. 1991. 1304

Iron sulfate and feed pelleting to detoxify free gossypol in cottonseed diets for dairy 1305

cattle. Journal of Dairy Science 74, 3457–3467. 1306

Basini G, Bussolati S, Baioni L, Grasselli F. 2009. Gossypol, a polyphenolic aldehyde from 1307

cotton plant, interferes with swine granulosa cell function. Domestic Animal 1308

Endocrinology 37, 30-36. 1309

Berardi LC, Goldblatt LA. 1969. Gossypol. In: Liener I (ed.) Toxic constituents of plant 1310

foodstuffs. Academic Press, New York, 183-237. 1311

Boland NI, Humpherson PG, Leese HJ, Gosden RG. 1994a. Characterization of follicular 1312

energy metabolism. Human Reproduction 9, 604–609. 1313

75

Boland NI, Humpherson PG, Leese HJ, Gosden RG. 1994b. The effect of glucose 1314

metabolism on murine follicle development and steroidogenesis in vitro. Human 1315

Reproduction 9, 617-623. 1316

Boland, N.I., P.G. Humpherson, H.J. Leese, and R.G. Gosden, 1993. Pattern of lactate 1317

production and Steroidogenesis during growth and maturation of mouse ovarian 1318

follicles in vitro. Biology of Reproduction 48, 798-806. 1319

Breitbart H, Mayevsky A, Nass-Arden L. 1989. Molecular mechanisms of gossypol action 1320

on sperm motility. International Journal of Biochemistry 21, 1097–1102. 1321

Breitbart H, Rubinstein S, Nass-Arden L. 1984. Effect of gossypol-acetic acid on calcium 1322

transport and ATPase activity in plasma membranes from ram and bull spermatozoa. 1323

International Journal of Andrology 7, 439–447. 1324

Breitenecker G, Friedrich F, Kemeter P. 1978. Further investigations on the maturation and 1325

degeneration of human ovarian follicles and their oocytes. Fertility and Sterility 29, 1326

336-341. 1327

Brocas C, Rivera RM, Paula-Lopes FF, McDowell LR, Calhoun MC, Staples 1328

CR, Wilkinson NS, Boning AJ, Chenoweth PJ, Hansen PJ. 1997. Deleterious actions of 1329

gossypol on bovine spermatozoa, oocytes, and embryos. Biology of Reproduction 57, 1330

901-907. 1331

76

Burgos de NM, Burgos C, Montamat EE, Moreno J, Blanco A. 1978. A shuttle system for 1332

the transfer of reducing equivalents in mouse sperm mitochondria. Biochemical and 1333

Biophysical Research Communications 81, 644-649. 1334

Calhoun MC, Kuhlmann SW, Baldwin BC Jr. 1995. Cotton feed product composition and 1335

gossypol availability and toxicity. In Proc. National Invitational Symposium on 1336

Alternative Feeds for Dairy and Beef Cattle, St. Louis, MO, 125-145. 1337

Chang JS, Hsu YL, Kuo PL, Chiang LC, Lin CC. 2004. Upregulation of Fas/Fas ligand-1338

mediated apoptosis by gossypol in an immortalized human alveolar lung cancer cell line. 1339

Clinical and Experimental Pharmacology and Physiology 31, 716-722. 1340

Chen QQ, Chen H, Lei HP. 1987. Comparative study on the metabolism of optical 1341

gossypol in rats. Journal of Ethnopharmacology 20, 31–37. 1342

Chenoweth PJ, Chase CC Jr, Risco CA, Larsen RE. 2000. Characterization of gossypol-1343

induced sperm abnormalities in bulls. Theriogenology 53, 1193–1203. 1344

Chin EC, Abayasekara D R E. 2004. Progesterone secretion by luteinizing human 1345

granulosa cells: a possible cAMP-dependent but PKA-independent mechanism 1346

involved in its regulation. Journal of Endocrinology 183, 51-60. 1347

Chomczynski P, Sacchi N. 1987. Single step method of RNA isolation by acid guanidinium 1348

thiocyanate phenol chloroform extraction. Analytical Biochemistry 162, 156–159. 1349

Coppock CE, West JW, Moya JR, Nave DH, LaBore JM. 1985. Effects of 1350

77

amount of whole cottonseed on intake, digestibility, and physiological responses 1351

of dairy cows. Journal of Dairy Science 68, 2248-2258. 1352

Coutinho EM, Athayde C, Atta G, Gu ZP, Chen ZW, Sang GW, Emuveyan E, Adekunle 1353

AO, Mati J, Otubu J, Reidenberg MM, Segal SJ. 2000. Gossypol blood levels and 1354

inhibition of spermatogenesis in men taking gossypol as a contraceptive. A multicenter, 1355

international, dose-finding study. Contraception 61, 61-67. 1356

Coutinho EM. 2002. Gossypol: a contraceptive for men. Contraception 65, 259-63. 1357

Davis JS. 1994. Mechanisms of hormone action: luteinizing hormone receptors and 1358

secondmessenger pathways. Current Opinion in Obstetrics and Gynecology 6, 254-261. 1359

Dodou K. 2005. Investigations of gossypol – past and present developments. Expert 1360

Opinion on Investigational Drugs 14, 1419-1434. 1361

Donalson A, Sufi SB, Jeffcoate SL. 1985. Inhibition by gossypol of testosterone production 1362

by mouse leydig cells in vitro. Contraception 31, 165-171. 1363

Eliasson R, Virji. 1983. Effects of gossypol acetic acid on the activity of LDH-C4 from 1364

human and rabbit spermatozoa. International Journal of Andrology 6, 109-112. 1365

Ewing WN. 1997. The Feeds Directory. Context Publications, Ashby de la Zouch, 1366

Leicestershire, UK. 1367

Fortune JE. 1986. Bovine theca and granulosa cells interact to promote androgen 1368

production. Biology of Reproduction 35, 292-299. 1369

78

Gadelha IC, de Macedo MF, Oloris SC, Melo MM, Soto-Blanco B. 2014. Gossypol 1370

promotes degeneration of ovarian follicles in rats. The Scientific World Journal, doi: 1371

10.1155/2014/986184 . 1372

Gilbert NE, O’Reilly JE, Chang CJ, Lin YC, Brueggemeier RW. 1995. Antiproliferative 1373

activity of gossypol and gossypolone on human breast cancer cells. Life Sciences 57, 1374

61-67. 1375

Giridharan N, Mahtab S. Bamji, A.V.B. 1982. SankaramInhibition of rat testis LDH-X 1376

activity by gossypol. Contraception 26, 607-615. 1377

Gray ML, Greene LW, Williams GL. 1993. Effects of dietary gossypol consumption on 1378

metabolic homeostasis and reproductive endocrine function in beef heifers and cows. 1379

Journal of Animal Science 71, 3052-3059. 1380

Gu Y, Chang CJG, Rikihisa Y, Lin YC. 1990 a. Inhibitory effect of gossypol on human 1381

chorionic gonadotropin (hCG) induced progesterone secretion in cultured bovine luteal 1382

cells. Life Sciences 47,407-414. 1383

Gu Y, Lin YC, Rikihisa Y, Brueggemeier RW. 1991. Gossypolone suppresses progesterone 1384

synthesis in bovine luteal cells. The Journal of Steroid Biochemistry and Molecular 1385

Biology 38, 709-715. 1386

Gu Y, Lin YC, Rikihisa Y. 1990 b. Inhibitory effects of gossypol on steroidogenic 1387

pathways in cultured bovine luteal cells. Biochemical and Biophysical Research 1388

Communications 169, 455-461. 1389

79

Haschek WM, Beasley VR, Buck WB, Finnell JH. 1989. Cottonseed meal (gossypol) 1390

toxicosis in a swine herd. Journal of the American Veterinary Medical Association 195, 1391

613-615. 1392

Hernández-Cerón J, Jousan FD, Soto P, Hansen PJ. 2005. Timing of inhibitory actions of 1393

gossypol on cultured bovine embryos. Journal of Dairy Science 88, 922–928. 1394

Hoffer AR. 1982. Ultrastructural studies of spermatozoa and the epithelial lining of the 1395

epididymis and vas deferens in rats treated with gossypol. Archives of Andrology 8, 1396

233-246. 1397

Hu YF, Chang CJ, Brueggemeier RW, Lin YC. 1993. Gossypol inhibits basal and estrogen-1398

stimulated DNA synthesis in human breast carcinoma cells. Life Sciences 53, 433–438. 1399

Ikeda M. 1990. Inhibition kinetics of NAD-linked enzymes by gossypol acetic acid. 1400

Andrologia 22, 409-416. 1401

Jarvis WD, Turner AJ, Povirk LF, Traylor RS, Grant S. 1994. Induction of apoptotic DNA 1402

fragmentation and cell death in HL-60 human promyelocytic leukemia cells by 1403

pharmacological inhibitors of protein kinase C. Cancer Research 54, 1707–1714. 1404

Jiang J, Sugimoto Y, Liu S, Chang HL, Park KY, Kulp SK, Lin YC. 2004. The inhibitory 1405

effects of gossypol on human prostate cancer cells-PC3 are associated with 1406

transforming growth factor beta1 (TGFbeta1) signal transduction pathway. Anticancer 1407

Research 24: 91-100. 1408

80

Jo Y, King SR, Khan SA & Stocco DM. 2005. Involvement of protein kinase C and cyclic 1409

adenosine 3',5'-monophosphate-dependent kinase in steroidogenic acute regulatory 1410

protein expression and steroid biosynthesis in Leydig cells. Biology of Reproduction 73, 1411

244-255. 1412

Kaminski T. 2004. The response of phospholipase C/protein kinase C and adenylyl 1413

cyclase/protein kinase A pathways in porcine theca interna cells to opioid agonist FK 1414

33-824. Domestic animal endocrinology 27, 379-396. 1415

Ke YB and Tso WW. 1982. Variations of gossypol susceptibility in rat spermatozoa during 1416

spermatogenesis. International Journal of Fertility 27, 42-46. 1417

Kim IC, Waller DP, Fong HH. 1985. Inhibition of LDH-X by gossypol optical isomers. 1418

Journal of Andrology 6, 344-347. 1419

Kolena J, S Vrsanská, E Nagyová, M Jezová. 2001. Gossypol inhibits follicle stimulating 1420

hormone and epidermal growth factor-stimulated expansion of oocyte-cumulus 1421

complex from porcine preovulatory follicles. Physiological Research 50, 627-630. 1422

Kruip TA, Dieleman SJ. 1985. Steroid hormone concentrations in the fluid of bovine 1423

follicles relative to size, quality and stage of the oestrus cycle. Theriogenology 24, 395-1424

408. 1425

Lagerlöf RK, Tone JM. 1985. The effect of gossypol acetic acid on female reproduction. 1426

Drug and Chemical Toxicology 8, 469-482. 1427

81

Lee CY, Mailing HY. 1981. Selective inhibition of sperm specific lactate dehydrogenase X 1428

by an antifertility agent, gossypol. Federation Proceedings 40, 718-723. 1429

Lee CYG, Moon YS, Yuan JFI, Chen AF. 1982. Enzyme inactivation and inhibition by 1430

gossypol. Molecular and Cellular Biochemistry 47, 65-70 1431

Li SS. 1990. Human and mouse lactate dehydrogenase genes A (muscle), B (heart), and C 1432

(testis): protein structure, genomic organization, regulation of expression, and 1433

molecular evolution. Progress in Clinical and Biological Research 344, 75-99. 1434

Li YF, Booth GM, Seegmiller RE. 1989. Evidence for embryotoxicity of gossypol in mice 1435

and chicks with no evidence of mutagenic activity in the Ames test. Reproductive 1436

Toxicology 3, 59–62. 1437

Li XB, Gu JD, Zhou QH. 2015. Review of aerobic glycolysis and its key enzymes – new 1438

targets for lung cancer therapy. Thoracic Cancer 6, 17–24. 1439

Lin T, Murono EP, Osterman J, Narkin HR, Coulson PD. 1981. Gossypol inhibits testicular 1440

steroidogenesis. Fertility and Sterility 35, 563-566. 1441

Lin YC, Coskun S, Sanbuissho A. 1994. Effects of gossypol on in vitro bovine oocyte and 1442

steroidogenesis in bovine granulosa cells. Theriogenology 41, 1601-1611. 1443

Lin YC, Fukaya T, Rikihisa Y, Walton A. 1985. Gossypol in female fertility control: ovum 1444

implantation and early pregnancy inhibited in rats. Life Sciences 37, 39-47. 1445

82

Lin YC, Nuber DC, Gu Y, Cutler G, Hinchcliff KW, Haibel G. 1991. Gossypol 1446

pharmacokinetics in mid-lactation Brown Swiss dairy cows. Veterinary Research 1447

Communications 15, 379-385. 1448

Lindsey TO, Hawkins GE, Guthrie LD. 1980. Physiological responses of lactating cows to 1449

gossypol from cottonseed meal rations. Journal of Dairy Science 63, 562-573. 1450

Liu GZ 1985. Clinical trial of gossypol as a male contraceptive: a randomized controlled 1451

study. Zhonghua Yi. Xue. Za Zhi. 65, 107-109. 1452

Lonsdale CR. 1989. Straights: Raw Materials for Animal Feed Compounders and Farmers. 1453

Chalcombe Publications, Marlow, Buckinghamshire, UK. 1454

Manna PR and Stocco DM. 2005. Regulation of the steroidogenic acute regulatory protein 1455

expression: functional and physiological consequences. Current Drug Targets-Immune 1456

Endocrine Metabolic Disorder 5, 93-108. 1457

Matsuzawa T, Takikawa H. 1968. The alteration of isozymic patterns in lactate 1458

dehydrogenase during artificial maturation of rat ovary. Endocrinologia japonica 15, 1459

291-297. 1460

Murasawa M, Takahashi T, Nishimoto H, Yamamoto S, Hamano S, Tetsuka M. 2005. 1461

Relationship between ovarian weight and follicular population in heifers. Journal of 1462

Reproduction and Development 51, 689-693. 1463

83

Needle E, Piparo K, Cole D, Worrall C, Whitehead I, Mahon G, Goldsmith LT. 2007. 1464

Protein Kinase A-independent cAMP stimulation of progesterone in a luteal cell model 1465

is tyrosine kinase dependent but phosphatidylinositol-3-kinase and mitogen-motivated 1466

protein kinase independent. Biology of reproduction 77, 147-155. 1467

Nishimoto H, Hamano S, Hill GA, Miyamoto A, Tetsuka M. 2009. Classification of bovine 1468

follicles based on the concentrations of steroids, glucose and lactate in follicular fluid 1469

and the status of accompanying follicles. Journal of Reproduction and Development 55, 1470

219–224. 1471

Nishimoto H, Matsutani R, Yamamoto S, Takahashi T, Hayashi KG, Miyamoto A, 1472

Hamano S, Tetsuka M. 2006. Gene expression of glucose transporter (GLUT) 1, 3 and 1473

4 in bovine follicle and corpus luteum. Journal of Endocrinology 188, 111-119. 1474

Noftsger SM, Hopkins BA, Diaz DE, Brownie C, Whitlow W. 2000. Effect of whole and 1475

expanded-expelled cottonseed. Journal of Dairy Science 83, 2539-2547. 1476

Ohmura H. 1996. Suppressive effect of Gossypol, Gossypolone and serum from Gossypol 1477

treated rats on steroidogenesis in cultured porcine granulosa cells. Nippon Ika Daigaku 1478

Zasshi 63, 181-189. 1479

Oko R and Hrudka F. 1982. Segmentai aplasia of the mitochondrial sheath and sequelae 1480

induced by gossypol in rat spermatozoa. Biology of Reproduction 26, 183-195. 1481

Olgiati KL, Toscano DG, Atkins WM, JR. 1984. Gossypol inhibition of adenylate 1482

cyclase. Archives Biochemistry Biophysics 231, 411-415. 1483

84

Olgiati KL, Toscano WAJr. 1983. Kinetics of gossypol inhibition of bovine lactate 1484

dehydrogenase X. Biochemical and Biophysical Research Communications 115, 1485

180-185. 1486

Pearce S, Sufi SB, Donaldson A, Jeffcoate SL. 1985. The viability of mouse Leydig cells in 1487

vitro following incubation with gossypol. Contraception 32, 275-81. 1488

Pearce S, Sufi SB, O'Shaughnessy PJ, Donaldson A, Jeffcoate SL. 1986a. Site of gossypol 1489

inhibition of steroidogenesis in purified mouse Leydig cells. Journal of Steroid 1490

Biochemistry 25, 683-687. 1491

Pearce S, Sufi SB, O'Shaughnessy PJ, Donaldson A, Jeffcoate SL. 1986b. Inhibition by 1492

gossypol of cyclic AMP production in mouse leydig cells. Contraception 34, 639-46. 1493

Pons WA Jr, Hoffpauir CL, Hopper TH. 1953. Gossypol in cottonseed: influence of variety 1494

of cottonseed and environment. Journal of Agricultural and Food Chemistry 18, 1115–1495

1118. 1496

Qiu J, Levin LR, Buck J, Reidenberg MM. 2002. Different pathways of cell killing by 1497

gossypol enantiomers. Experimental Biology and Medicine 227, 398-401. 1498

Rabiee AR, Lean IJ, Gooden JM, Miller BG, Scaramuzzi RJ. 1997. An evaluation of 1499

transovarian uptake of metabolites using arterio-venous difference methods in dairy 1500

cattle. Animal Reproduction Science 48, 9-25. 1501

85

Randel RD, Chase CC, Wyse SJ. 1992. Effects of gossypol and cotton seed products on 1502

reproduction of mammals. Journal of Animal Science 70, 1628-1638. 1503

Reiser R, Fu HC. 1962. The mechanism of gossypol detoxification by ruminant animals. 1504

Journal of Nutrition 76, 215-218. 1505

Risco CA, Chenoweth PJ, Larson RE, Velez L, Shaw N, Tran T, Chase CC Jr. 1993. The 1506

effect of gossypol in cottonseed meal on performance and on hematological and semen 1507

traits in postpubertal brahman heifers. Theriogenology 40, 629-642. 1508

Robinson PH, Getachew G, DePeters EJ, Calhoun MC. 2001. Influence of variety and 1509

storage up to 22 days on nutrient composition and gossypol level of Pima cottonseed 1510

(Gossypium spp.). Animal Feed Science and Technology 91, 149-156. 1511

Rovan E, N. R. Kalla , J. Frick and H. Adam . 1984. Effect of Gossypol on Bull 1512

Spermatozoa in Vitro. Urological Research 12, 187-192. 1513

Santos JEP, Villasenor M, Robinson PH, DePeters EJ, Holmberg CA. 2003. Type of cotton 1514

seed and level of gossypol in diets of lactating dairy cows: Plasma gossypol, Health and 1515

reproductive performance. Journal of Diary Science 86, 892-905. 1516

Schneider IC, Ames ML, Rasmussen MA, Reilly PJ. 2002. Fermentation of cottonseed and 1517

other feedstuffs in cattle rumen fluid. Journal of Agricultural and Food Chemistry 50, 1518

2267–2273. 1519

86

Shelley MD, Hartley L, Groundwater PW, Fish RG. 2000. Structure–activity studies on 1520

gossypol in tumor cell lines. Anticancer Drugs 11, 209–16. 1521

Stephens DT, Critchlow LM, Hoskins DD. Metabolism of inhibition by gossypol of 1522

glycolysis and motility of monket spermatozoa in vitro. 1983. Journal of 1523

Reproduction and Fertility 69, 447-452. 1524

Stephens SG. 1958. Factors affecting seed dispersal in gossypium and their responsible 1525

evolutionary significance. North Carolina Agriculture Experiment Station 131, 32. 1526

Stocco DM & Clark BJ. 1996. Regulation of the acute production of steroids in 1527

steroidogenic cells. Endocrine Reviews 17, 221-244. 1528

Sufi SB, Donaldson A, Jeffcoate SL, Matlin SA, Zhou RH. 1985. Inhibition by (+) and (-) 1529

isomers of gossypol of testosterone release from mouse Leydig cells in vitro. 1530

Contraception 31, 159-64. 1531

Taha TA, Shaaban WF, El-Mahdy AR, El-Nouty FD, Salem MH. 2006. Reproductive 1532

toxicological effects of gossypol on male rabbits: semen characteristics and hormonal 1533

levels. Animal Science 82, 259-269. 1534

Teng CS. 1995. Gossypol-induced apoptotic DNA fragmentation correlates with inhibited 1535

protein kinase C activity in spermatocytes. Contraception 52, 389-395. 1536

Teng C. S. 1997. Reversible changes in the content of cellular and microtubular tubulin in 1537

spermatogenic cells after gossypol treatment. Contraception 55, 41–46. 1538

87

Tetsuka M, Nishimoto H, Miyamoto A, Okuda K, Hamano S. 2010. Gene Expression of 1539

11β-HSD and Glucocorticoid Receptor in the Bovine (Bos taurus) Follicle During 1540

Follicular Maturation and Atresia: The Role of Follicular Stimulating Hormone. 1541

Journal of Reproduction and Development 56, 616-622. 1542

Tilly JL and Johnson AL. 1988. Attenuation of hen granulosa cell steroidogenesis by a 1543

phorbol ester and 1-Oleoyl-2-Acetylglycerol. Biology of reproduction 39, l-8. 1544

Tilly JL and Johnson AL. 1989. Regulation of androstenedione production by adenosine 1545

3',5'-monophosphate and phorbol myristate acetate in ovarian thecal cells of the 1546

domestic hen. Endocrinology 125, 1691-1699. 1547

Timurkaan N, Yilmaz F, Timurkaan S. 2011. Effects of cottonseed flour on 1548

immunohistochemical localization of androgen receptors (AR) in rat testes. Revue de 1549

Médecine Vétérinaire 162, 13–17. 1550

Ueno H, Sahni MK, Segal SJ, Koide SS. 1988. Interaction of gossypol with sperm 1551

macromolecules and enzymes. Contraception 37, 333–341. doi:10.1016/0010-1552

7824(88)90033-9. 1553

Vandesompele J, De Preter K, Pattyn F, Poppe B, Van Roy N, De Paepe A, Speleman F. 1554

2002. Accurate normalization of real-time quantitative RT-PCR data by geometric 1555

averaging of multiple internal control genes. Genome Biology 18, Research0034. 1556

Velasquez-Pereira J, Risco CA, McDowell LR, Staples CR, Prichard D, Chenoweth PJ, 1557

Martin FG, Williams SN, Rojas LX, Calhoun MC and Wilkinson NS. 1999. Long-term 1558

88

effects of feeding gossypol and vitamin E to dairy calves. Journal of dairy Science 82, 1559

1240-1251. 1560

Villaseñor M, Coscioni AC, Galvão KN, Chebel RC, Santos JEP. 2008. Gossypol disrupts 1561

embryo development in heifers. Journal of Dairy Science 91, 3015–3024. 1562

Vranová J, Ježová M, Scsuková S. 1999. Inhibitory effect of gossypol on basal and 1563

luteinization factor-stimulated progesterone synthesis in porcine granulosa cells. 1564

Physiological Research 48,119-128. 1565

Wang NG, Guan MH, Lei HP. 1987a. Effects of gossypol on rat luteal cells in vitro. 1566

Journal of Ethnopharmacology 20, 45-51. 1567

Wang NG, Zhou LF, Guan MH, Lei HP. 1987b. Effect of (-)- and (+)-gossypol on fertility 1568

in male rats. Journal of Ethnopharmacology 20, 45-51. 1569

Wichmann K, Kapyaho K, Sinervirta R, Janne J. 1983. Effect of gossypol on the motility 1570

and metabolism of human spermatozoa. Journal of Reproduction and Fertility 69, 259-1571

264. 1572

Wilson JE. 2003. Isozymes of mammalian hexokinase: structure, subcellular localization 1573

and metabolic function. Journal of Experimental Biology 206, 2049-2057. 1574

Wheat TE, Goldberg E. 1983. Sperm-specific lactate dehydrogenase C4: antigenic structure 1575

and immunosuppression of fertility. Isoenzymes Current Topics in Biological and 1576

Medical Research 7, 113-130. 1577

89

Wu D. 1989. An overview of the clinical pharmacology and therapeutic potential of 1578

gossypol as a male contraceptive agent in gynaecological disease. Drugs 38, 333-341. 1579

Xiao DM, Zhou WH, Zhang YH, Wang XL, Zhu B, Zhang JB, Yang GD, Chen HC. 1993. 1580

Comparison between the effects of (-) and (+) gossypol on protein kinase C and protein 1581

kinase A. Yao Xue Xue Bao 28, 494-498. 1582

Zhang M, He Z, Yuan H, Wen L. 2011. DNA damage and decrease of cellular oxidase 1583

activity in piglet sertoli cells exposed to gossypol. African Journal of Biotechnology 10, 1584

2797–2802. 1585

Zhang M, Liu H, Guo R, Ling Y, Wu X, Li B, Roller PP, Wang S, Yang D. 2003. 1586

Molecular mechanism of gossypol-induced cell growth inhibition and cell death of HT-1587

29 human colon carcinoma cells. Biochemical Pharmacology 66, 93-103. 1588

Zirkle SM, Lin YC, Gwazdauskas FC, Canseco RS. 1988. Effect of gossypol on bovine 1589

embryo development during the preimplantation period. Theriogenology 30,575-582. 1590

1591