CLONING AND SELECTION

Cell cloning of primary cultureCell cloning of a continuous monolayer cells

Monolayer cells : Technique of cloning:Dilution cloning of monolayer cellsCloning Isolation of clones Stimulation of plating efficiency

Suspension cloning : Cloning in agar or Methocel®

CHARACTERIZATION OF CELLS

Methods of characterization: Normal hybridization Principles of hybridization

In situ hybridization Autoradiography General procedures Visualization of results

A primary culture refers to a culture from the time of isolation until its first subculture.

A cell line is formed when a primary culture is sub-cultured.

A cell line may be (a)finite (survives for a fixed number of population doublings, usually around 40 to 60, before senescing and ceasing proliferation) or(b) continuous (immortal, over 200 population doublings).

Immortalisation is the indefinite extension of lifespan in culture, usually achieved by the introduction of a viral gene, but already acquired by some cancer cells.

Transformation is a heritable change involving an alteration in the genotype, usually subsequent to immortalisation. It is best reserved to describe an alteration in growth characteristics (phenotype) associated with malignancy(eg. anchorage independence, loss of contact inhibition and density limitation of cell proliferation, tumourigenesis in vivo).

Revision

CELL CLONING OF PRIMARY CULTURE

CULTURE HETEROGENETY

PURE CELL STRAIN

Eg. Juxtaglomerular and glomerular cells from kidneyKupffer cells from Chinese hamster liver

CELL CLONING OF A CONTINUOUS MONOLAYER CELLS

CELL STRAIN

Cell strains are cell lines which have been

• purified by physical separation, selection or cloning, and • which have specific defined characteristics,

BHK-21 cell lines infected with polyoma virus and transformed by the virus

e.g. BHK-21-PyY, anchorage-independent cells cloned from the BHK-21 cell line following transformation with polyoma virus

Cloning a cell means to derive a (clonal) population of cells from a single cell.

This is an important in vitro procedure when the expansion of a single cell with certain characteristics is desired, for example in the production of gene-targeted ES cells.

Most individuals began as a single cell and are therefore the result of clonal expansion in vivo.

Cell Cloning is the generation of a colony from a single cell, and subculture of such a colony would give rise to a cell strain.

Because of potential confusion with molecular cloning, this term is probably better modified to cell cloning.

Cloning is used

• For Isolating cell strains• As Survival assay for optimizing growth conditions•

TECHNIQUE OF CLONING DILUTION CLONING OF MONOLAYER CELLS

For the selection of specific cell strainsMonolayer culture – cells attached to flasks, petridishes etc ,

Micromanipulation

i. Trypsinize the cells to produce a single cell suspensionii. Count the cells and dilute the cell suspension to the desired seeding concentration. The aim is to incubate the cells at low density

Eg. If no. of cells is 105.6 cells/mlTherefore to obtain 10, 50, 100 and 200 cells/ml

The dilution

105.6 /101 = 104.6 (dilute 40,000 times to get 10 cells per ml)105.6/101.7 = 103.9 (dilute 8,000 times to get 50 cells per ml)105.6/102 = 103.6 (dilute 4,000 times to get 100 cells per ml)105.6/102.3 = 103.3 (dilute 2,000 times to get 200 cells/ml)

ISOLATION OF CLONES

1) using cloning rings - By placing cloning rings (porcelain glass, PTFE or stainless steel ring) dipped in silicon grease (to seal the area) around the desired colony, the colony is trypsinised and transferred to either a one of the wells of a 24-or 12 well plate or to a 25cm2 flask

2) By irradiation (shielding one colony) with lead Need X-ray machines and radioctive source 60Co (Cobalt)

3) Distribute on very small coverslips or broken glass (monolayer cells)4) Drawing into a glass capillary tube-scan the capillary with a densitometer

STIMULATION OF PLATING EFFICIENCY

Improving clonal growth:

• Medium –rich medium such as Hams F12

• Serum-fetal bovine better than calf or horse

• Hormones - Insulin, dexamathasone increase plating efficiency

• Intermediary metabolites: keto acids _ eg pyruvate, • alpha ketoglutarate, nucleosides

• Carbon dioxide maximum cloning efficiency for most cells is 2-5%HEPES buffer. May be used with 2% CO2 protect cells against fluctuation and in event of failure of CO2 supply

• Bicarbonate – altered to get equilibrium at pH 7.2-7.4

• Treatment of substrate-fibronectin and polylysine improves plating

• Trypsin, purified is best and carried out at 4oC, can carry out trypsinization at 37oC.

• Conditioned medium- medium that has been used for the growth of other cells acquires metabolites, growth factors and matrix products

• Feeder layers-culture cells onto a growth arrested feeder layer The feeder cells may provide nutrients, growth factors and matrix constituents

Stimulation of plating efficiency

SUSPENSION CLONING

Suspension cells – seeding cells into a gel or a viscous solution- the stability or viscosity of the gel ensures that daughter cells do not break away from the colony as they form

Cloning in agar or Methocel®

Particularly for hematopoietic stem cells and virally transformed fibroblasts-the colony of cells are held together by agar (liquid at high temperature but is a gel at 37oC) or Methocel® (a low-melting temperature agarose),

-plated out over an agar underlay or into petri dishes (petridishes need not be treated for TC use)

Cloning in suspension

Cultured cells or primary suspensionfrom bone marrows or tumours, suspended in agar or low-melting temperature agarose which is then allowed to set, form colonies in suspension. Use of an underlay prevents attachment to the base of the dish

Suspension cloning :The colony is drawn into a pipettor or Pasteur pipette and the colony transferred to one of the wells of a 24-or 12 well plate or to a 25cm2 flask

CHARACTERIZATION

Requirements for cell line characterization

i. Confirm Species of origin

ii. Correlation with tissue of origin a. Identification of lineage b. position of cells within the lineage ie. Stem cells, precursor or differentiated status

iii. Transformed i.e. finite or continuous cell line have malignancy properties

iv. Confirmed absence of cross contamination with other cell lines

v. Indication whether the cell is prone to genetic instability, transformation

vi. and phenotypic variation

vi. Identification of specific cell lines, selected cell strains or hybrid cell lines – demonstration of features unique to the cell line

METHODS OF CHARACTERIZATION

i. DNA content – characteristics to the species in normal cell lines DNA hybridization DNA finger printing PCR and (Restriction fragment length polymorphism (RFLP)

ii. Enzyme activities or antigenic markers : `markers of differentiation’activity of specific enzymes related to specialised functions and cell strains:mobility of isoenzymes in gel electrophoresis system

iii. RNA and protein: characteristic phenotype by Northern blotting using radioactive, fluorescence or luminescent probes

iv. Karyotyping or Chromosome analysis well-defined criteria for identifying cell lines relating to the species and sex from which they were derived

v. Morphology : appearance and patterns of the cells Disadvantages;different culture conditions can change the morphology Use : inverted microscopy, staining methods,

NORMAL HYBRIDIZATION

• requires the extraction and isolation of DNA or RNA

• digest of DNA with restriction enzymes

• separating it on a gel,

• blotting it onto nitrocellulose and

• probing it with a complementary sequence. 

The basic principles for in situ hybridization are the same, except one is utilizing the probe to detect specific nucleotide sequences within cells and tissues.

detect specific RNA and DNA sequences in a biological sample

DNA and RNA , 4 nucleotide bases : CGAT(U)

C G A T

G C T A

Target gene

Complementary nucleotide basesprobe

CTTAGGTCAGTAA

GAATCCAGTCATTHYBRID

Hybridizatiion ; chemical reaction between the probe and the DNA or RNA to be detected

PRINCIPLES OF HYBRIDIZATION

Examples of some use of hybridization

- DNA ISH can be used to determine the structure of chromosome, mapping a gene on the chromososme

- Fluorescent DNA ISH ; FISH can be used to assess chromosomal integrity

- Autoradiographic RNA ISH can be used usedto measure and localise mRNAs and other transcripts

ISH : within tissue sections and whole mounts

Fig caption: Human-mouse cell hybrids. The gene under study expressed in the hybrid Cells can be detected by Southern blot hybridization with a suitable probe.

Human-mouse cell hybrids retaining human chromosome 11 are found to have the human beta globin gene

Eg. of normal DNA hybridization (extract DNA)

Blotted on nitrocellulose paper

IN-SITU HYBRIDIZATION (ISH)

ISH is a type of hybridization that uses

A labelled complementary DNA or RNA strand (i.e. probe) to localise a specific mRNA or DNA sequence in a morphologically preservedportion of actual tissue sections, cell preparations or isolated chromosomes

Or if the tissue is small enough (eg.plant seeds, Drosophila embryos) in the entire tissues (whole mount ISH)

- by hybridizing the complementary strand of a nucleotide probe to the sequence of interest. 

Types in-situ hybridization allowing visualization

-autoradiographic in-situ hybridization (35S, 32P)-Fluorescence in-situ hybridization (FITC dye)

-enzymatic in-situ hybridization (biotin, digoxigenin)

Autoradiographic in situ hybridization

PrincipleEach nucleotide base binds with a complementary nucleotide base

Specific binding of a labelled DNA probe to a complementary sequence in a tissue samples followed by visualization of the probe

Detection of specific nucleotide sequence in DNA (Northern blotting)Detection of specific nucleotide sequence in RNA (Southern Blotting)

UCCAAUGGCUUAUUUCCCUA

5’ 3’transcriptsRNA

Radiolabelled-RNA

RNAprobes-DNA - stable hybridsRNAprobes-RNA – stable hybrids

1. Rapid processing of tissues to preserve the RNA

-freezing samples at -70oC and -cryosectioned using a cryostat equipmentment to 1µm in thickness-placed on coated slides to hold specimen-fixed in 4% formaldehyde (to prevent tissue disintegration)

OR

-fixing tissues in 4%formaldehyde-Embed in paraffin wax (need to dewax before hybridization)-section to 1 um in thickness-placed on coated slides to hold the specimen

During tissue preparation – to protect specimen from RNAse-use gloves, DEPC to treat water and galsswares etc

GENERAL PROCEDURES FOR HYBRIDIZATION

2. Labelling of RNA probes with radioactive [35S)-UTP add Linearised DNA template of the target sequence RNA polymerase to generate single-stranded RNA probes Transcription buffer dinucleotide phosphates -ATP, CTP and GTP

5’

3’

DNA

UCCAAUGGCUUAUUUCCCUA

5’ 3’transcriptsRNA

Radiolabelled-RNA probe

3. Prehyvridization

- Protease treatment-permeabilise the cell membrane to increase accessibility of the probe-Acetylation (acetic anhydride) –prevent non-specific binding to amino groups

4. Hybridization

-hybridization buffer –formamide-helix destabiliser Reduces the melting point of the hybrid – lower temperature helps to preserve tissue architectureDextran sulphate -increaes the concentration of the probe by volume exclusion, Therefore reduces hybridization time

Time for complete hybridization - 5-6 hoursselection of the temperature, salt concentration and formamide concentration - very important

5. Post hybridization washes - remove unbound and non-specifically bound probes

Fig 1. In-situ hybridization of a virus infected cell in a parraffin section of infected lung.The infected cell can be recognised by the dense pattern of silver grains

Fig 2. The presence of virus in the nucleus of the infected cell stained withrabbit anti DNA-RNA conjugated with FITC. The DNA infected virusin the cell nucleus is stained fluorescent green

VISUALIZATION OF RESULTS

Radioactive labelled-autoradiography to visualise the resultsAnti species DNA-RNA conjugated with FITC- fluorescent UV microscope