Kaposi’s Sarcoma-Associated Herpesvirus MicroRNAs RepressBreakpoint Cluster Region Protein Expression, Enhance Rac1 Activity,and Increase In Vitro Angiogenesis
Dhivya Ramalingam, Christine Happel, Joseph M. Ziegelbauer
HIV and AIDS Malignancy Branch, National Cancer Institute, National Institutes of Health, Bethesda, Maryland, USA
ABSTRACT
MicroRNAs (miRNAs) are small, �22-nucleotide-long RNAs that regulate gene expression posttranscriptionally. Kaposi’s sarco-ma-associated herpesvirus (KSHV) encodes 12 pre-miRNAs during latency, and the functional significance of these microRNAsduring KSHV infection and their cellular targets have been emerging recently. Using a previously reported microarray profilinganalysis, we identified breakpoint cluster region mRNA (Bcr) as a cellular target of the KSHV miRNA miR-K12-6-5p (miR-K6-5).Bcr protein levels were repressed in human umbilical vein endothelial cells (HUVECs) upon transfection with miR-K6-5 andduring KSHV infection. Luciferase assays wherein the Bcr 3= untranslated region (UTR) was cloned downstream of a luciferasereporter showed repression in the presence of miR-K6-5, and mutation of one of the two predicted miR-K6-5 binding sites re-lieved this repression. Furthermore, inhibition or deletion of miR-K6-5 in KSHV-infected cells showed increased Bcr proteinlevels. Together, these results show that Bcr is a direct target of the KSHV miRNA miR-K6-5. To understand the functional sig-nificance of Bcr knockdown in the context of KSHV-associated disease, we hypothesized that the knockdown of Bcr, a negativeregulator of Rac1, might enhance Rac1-mediated angiogenesis. We found that HUVECs transfected with miR-K6-5 had in-creased Rac1-GTP levels and tube formation compared to HUVECs transfected with control miRNAs. Knockdown of Bcr in la-tently KSHV-infected BCBL-1 cells increased the levels of viral RTA, suggesting that Bcr repression by KSHV might aid lytic re-activation. Together, our results reveal a new function for both KSHV miRNAs and Bcr in KSHV infection and suggest thatKSHV miRNAs, in part, promote angiogenesis and lytic reactivation.
IMPORTANCE
Kaposi’s sarcoma (KS)-associated herpesvirus (KSHV) infection is linked to multiple human cancers and lymphomas. KSHVencodes small nucleic acids (microRNAs) that can repress the expression of specific human genes, the biological functions ofwhich are still emerging. This report uses a variety of approaches to show that a KSHV microRNA represses the expression of thehuman gene called breakpoint cluster region (Bcr). Repression of Bcr correlated with the activation of a protein previouslyshown to cause KS-like lesions in mice (Rac1), an increase in KS-associated phenotypes (tube formation in endothelial cells andvascular endothelial growth factor [VEGF] synthesis), and modification of the life cycle of the virus (lytic replication). Our re-sults suggest that KSHV microRNAs suppress host proteins and contribute to KS-associated pathogenesis.
Kaposi’s sarcoma (KS)-associated herpesvirus (KSHV) is a gam-maherpesvirus that is associated with AIDS-associated KS, pri-
mary effusion lymphoma (PEL), and multicentric Castleman’s dis-ease (MCD) (1, 2). KSHV infects primarily cells of endothelial cell orB-cell origin and persists in either a latent phase, during which only afew viral genes are expressed, or a lytic phase, where the full repertoireof viral genes is expressed and infectious virions are released. Duringlatent infection, KSHV also expresses 12 pre-microRNAs (pre-miRNAs) that are processed to yield �20 mature miRNAs (3–6).miRNAs are �22-nucleotide-long RNAs that typically bind with im-perfect complementarity to the 3= untranslated regions (UTRs) ofmRNAs and cause translational repression and mRNA degradation(7). The KSHV miRNAs are believed to be involved in repressingnumerous targets that are involved in immune evasion (MICB) (8),apoptosis (BCLAF1, TWEAKR, and caspase 3) (9–11), lytic reactiva-tion (RTA) (12, 13), angiogenesis (THBS1) (14), transcription re-pression (BACH1) (15, 16), and cell signaling (p21, I�B, andSMAD5) (17–19).
Previously, we reported a microarray-based expression profil-ing approach to identify cellular mRNAs that are downregulatedin the presence of KSHV miRNAs (11). From this array, we iden-
tified BCLAF1 (11), TWEAKR (9), and IRAK1 and MyD88 (20) ascellular targets of KSHV miRNAs. In this report, we identify thebreakpoint cluster region (Bcr) mRNA and RacGAP1 as cellulartargets of the KSHV miRNA miR-K12-6-5p (miR-K6-5).
Bcr was originally identified as a fusion partner of Bcr-Abl,which is the fusion protein that is associated with most forms ofchronic myelogenous leukemia (CML) and acute lymphocyticleukemias (ALLs) (21). Bcr by itself has been suggested to act as atumor suppressor (22). Bcr interferes with the �-catenin–Tcf4
Received 23 December 2014 Accepted 22 January 2015
Accepted manuscript posted online 28 January 2015
Citation Ramalingam D, Happel C, Ziegelbauer JM. 2015. Kaposi’s sarcoma-associated herpesvirus microRNAs repress breakpoint cluster region proteinexpression, enhance Rac1 activity, and increase in vitro angiogenesis. J Virol89:4249 –4261. doi:10.1128/JVI.03687-14.
Editor: R. M. Longnecker
Address correspondence to Joseph M. Ziegelbauer, [email protected].
Copyright © 2015, American Society for Microbiology. All Rights Reserved.
doi:10.1128/JVI.03687-14
April 2015 Volume 89 Number 8 jvi.asm.org 4249Journal of Virology
on February 14, 2018 by guest
http://jvi.asm.org/
Dow
nloaded from
interaction and is a negative regulator of the Wnt pathway (22,23). Bcr phosphorylates the Ras effector protein AF-6 and facili-tates its interaction with Ras, thereby inhibiting extracellular sig-nal-regulated kinase (ERK) activation and cellular proliferation(24). The Bcr protein has oligomerization, Ser/Thr kinase (25),and guanosine nucleotide exchange factor (GEF) (26, 27) do-mains. In addition, Bcr contains a C-terminal GTPase activationdomain (GAP), with which it inhibits the function of Rac1 (28).Rac1 exists between an active, membrane-bound state (Rac1-GTP) and an inactive, cytoplasmic state (Rac1-GDP) (29). As aRac1 GAP, Bcr enhances the intrinsic GTPase activity of Rac1 andtherefore negatively regulates its function. Rac1 belongs to theRho family of small GTPases that control cytoskeletal organiza-tion, cell motility, and angiogenesis. Deregulated angiogenesis isoften observed in many cancers and is a hallmark of KS. KS is ahighly vascularized tumor that expresses elevated levels of angio-genic molecules such as basic fibroblast growth factor (bFGF),platelet-derived growth factor (PDGF), and vascular endothelialgrowth factor (VEGF) (30). VEGF is a key proangiogenic factorand, upon binding to its receptors on the endothelial cell surface,stimulates angiogenesis by recruiting Rac1. Small interfering RNA(siRNA)-mediated knockdown of Rac1 reduces VEGF-inducedangiogenesis in vitro and tumor progression in mice (31). Aber-rant regulation of Rac1 has been observed for many cancers, in-cluding KS (32–34).
In this study, we identified Bcr, a negative regulator of Rac1, inthe analysis of mRNAs that were downregulated by KSHVmiRNAs. Bcr was repressed by miR-K6-5 in B cells and endothe-lial cells and in the context of de novo KSHV infection. The repres-sion of Bcr by miR-K6-5 caused increases in the levels of Rac1-GTP and VEGF in endothelial cells. Furthermore, the increasedRac1-GTP levels also enhanced tube length in endothelial tubeformation assays, and this effect was recapitulated by an siRNAtargeting Bcr. Finally, siRNA-mediated knockdown of Bcr in la-tently infected BCBL-1 cells increased the levels of the viral RTAprotein, the key regulator of KSHV lytic reactivation, suggesting apotential advantage of Bcr suppression during KSHV infection.These results together identify a cellular mRNA, Bcr, as a target ofthe KSHV miRNA miR-K6-5, and we further demonstrate thatthe virus is able to establish an angiogenic environment and facil-itate lytic reactivation as a consequence of this repression.
MATERIALS AND METHODSCell culture and reagents. Human umbilical vein endothelial cells(HUVECs; Lonza) were maintained for up to five passages with completeEGM-2 BulletKit (Lonza). The latently KSHV-infected body cavity-basedlymphoma cell line (BCBL-1) and the uninfected BJAB B-cell line weremaintained in RPMI 1640 supplemented with 10% fetal bovine serum(FBS), 1� penicillin-streptomycin, and 55 �M �-mercaptoethanol. 293cells and SLK cells (35, 36) were maintained in Dulbecco’s modified Ea-gle’s medium (DMEM) supplemented with 10% FBS and 1� penicillin-streptomycin. KSHV-infected SLK cells (SLK�K cells) (37) were main-tained in DMEM supplemented with 10% FBS, penicillin-streptomycin,and 10 �g/ml of puromycin. Telomerase-immortalized microvascular en-dothelial (TIME) cells were grown in vascular cell basal medium withendothelial cell growth kit-VEGF (ATCC), and KSHV-infected TIMEcells were grown in medium supplemented with 50 �g/ml of hygromycinB. Inducible TIME (iTIME) cells were a gift from Craig McCormick (Dal-housie University) and were generated by using the Retro-X Tet-Off Ad-vanced inducible expression system (Clontech) (38). Clonal TIME celllines expressing Tet-Off Advanced transactivator (tTA-Advanced cells)
were transduced with retroviral vectors encoding KSHV RTA controlledby a modified Tet-responsive element (TREmod) joined to a minimalcytomegalovirus (CMV) promoter. The clonal cells resulting from thesetransductions, dubbed iTIME cells, were cultured in complete vascularcell basal medium (VCBM) supplemented with a VEGF kit (ATCC) con-taining 500 �g/ml G418, 1 �g/ml puromycin, and 200 ng/ml doxycycline.KSHV-infected cells were grown in 200 ng/ml doxycycline and 25 �g/mlhygromycin B. miRVana miRNA mimics were purchased from Ambion;ON-TARGETplus SMARTpool siRNAs targeting human Bcr, RacGAP1,and the nontargeting pool control were obtained from Thermo Scientific.
Production of mutant KSHVs from inducible SLK cell lines. Induc-ible SLK (iSLK) cell lines that harbor either wild-type or mutant KSHVsthat lack miR-K12-6 (�K6-KSHV cells) were a generous gift from RolfRenne and were maintained in DMEM containing 1 �g/ml puromycin,250 �g/ml G418, and 1.2 mg/ml hygromycin B (39, 40). Virus productionwas induced with DMEM containing 1 �g/ml doxycycline and 1 mMvalproate. The iSLK cells were maintained in the induction medium for 4days to allow virus production, after which KSHV virions released into theculture supernatants were purified and concentrated by using the Viva-flow 50 tangential-flow filtration system (Sartorius Stedim Biotech) ac-cording to the manufacturer’s instructions.
For normalization of KSHV infections, viral DNA was extracted byusing DNAzol reagent (Life Technologies, Inc.), and KSHV LANA (laten-cy-associated nuclear antigen) levels were measured by using quantitativePCR (qPCR) with the following set of primers: 5=-GTGACCTTGGCGATGACCTA-3= and 5=-CAGGAGATGGAGAATGAGTA-3=. Infection ofTIME cells was performed by using viruses normalized for their LANADNA. Infected TIME cells were selected on hygromycin B for severalweeks, after which Western blotting was performed to analyze differencesin protein expression.
miRNA transfections and Western blotting. For the transfection ofmiRNAs and siRNAs, 2 � 105 HUVECs were seeded onto 6-well platesovernight. Transfections were performed with 10 nM miRNAs or 16.5 nMsiRNAs using Dharmafect (Thermo Scientific) according to the manufac-turer’s instructions. The transfected cells were harvested at 48 h posttrans-fection (hpt), and their total protein was extracted in radioimmunopre-cipitation assay (RIPA) buffer (Sigma) containing 1� Halt protease andphosphatase inhibitors (Thermo Scientific). For Western blotting, equalamounts of total proteins were electrophoresed by SDS-PAGE, and pro-tein levels were quantified by using a Li-Cor Odyssey infrared imagingsystem. Primary antibodies against Bcr (catalog number 3902) were ob-tained from Cell Signaling, Inc. Primary antibodies against RacGAP1 werepurchased from Thermo Scientific, Inc. Mouse antiactin primary anti-body (catalog number AC-74) was obtained from Sigma. The rabbit anti-RTA antibody was a gift from Don Ganem. Secondary antibodies conju-gated to the infrared fluorescing dyes IRDye 800CW and IRDye 680 wereobtained from Li-Cor. Changes in protein levels were measured relative tothe actin level, and fold changes were obtained relative to values for therespective negative-control RNAs.
3=-UTR reporter assays. Oligonucleotides used for cloning of the Bcr3=UTR were 5=-CTGGAAACCTCTGGCTAATC-3= and 5=-CAAAAAAGCATCACTTCCG-3=. 293 cells were reverse transfected in 96-well platesby using Lipofectamine 2000 (Invitrogen) with 13 nM each KSHVmiRNA (or a negative-control miRNA [miR-Neg]) and a luciferase re-porter plasmid (pD765-Bcr), which expresses herpes simplex virus TK(HSV-TK) promoter-driven firefly luciferase as an internal control andsimian virus 40 (SV40) promoter-driven Renilla luciferase fused to the 3=UTR of Bcr as the reporter (Protein Expression Laboratory, SIAC, Fred-erick, MD). A reporter plasmid lacking any 3=UTR adjacent to the Renillaluciferase served as a control for nonspecific responses of luciferase ex-pression to the KSHV miRNAs. Site-directed mutagenesis was performedon the pD765-Bcr reporter plasmid by using the QuikChange II kit (Strat-agene). The following primers and their reverse complements were usedto introduce mutations into the Bcr 3=UTR: 5=-GTCAGTGGGCAGCTCCTAATGAACCCGCAGCTC-3= for mut1 and 5=-CTCACTGTTGTAT
Ramalingam et al.
4250 jvi.asm.org April 2015 Volume 89 Number 8Journal of Virology
on February 14, 2018 by guest
http://jvi.asm.org/
Dow
nloaded from
CTTGAATAAACGCTAATGCTTCATCCTGTGG-3= for mut2. Forcloning of the 3= UTR of RacGAP1, oligonucleotides containing thepredicted miR-K6-5 binding sites (underlined in the oligonucleotidesbelow) were annealed and cloned into the pCR8-GW-TOPO vector(Life Technologies). Oligonucleotides for the wild-type (WT) Rac-GAP1 site were 5=-AGTACAACTCGTATTTATCTCTGATGTGCTGCTGGCTGAA-3= and 5=-TCAGCCAGCAGCACATCAGAGATAAATACGAGTTGTACTA-3=. The binding site was mutated by using thefollowing oligonucleotides: 5=-AGTACAACTCGTATTTATCTCTGATCACGACGACGCTGAA-3= and 5=-TCAGCGTCGTCGTGATCAGAGATAAATACGAGTTGTACTA-3=. Upon confirmation by sequenc-ing from the pCR8-GW-TOPO vector, these DNA sequences werecloned downstream of the Renilla luciferase in pDEST-765 by usingGateway LR Clonase II enzyme mix (Life Technologies) to generate plas-mids pDEST-WT-RG1 and pDEST-mut-RG1. Assays were performed byusing the Dual-Luciferase reporter system (Promega) at 24 and 48 hpt.The ratio of the activities of renilla luciferase over those of firefly luciferasein each well was used as a measure of total reporter activation. The resultsshown are averages of data from three independent experiments, assayedin triplicate.
Inhibition of miRNAs in BCBL-1 cells using power-locked nucleicacid inhibitors. Power-locked nucleic acid inhibitors (power-LNAs)against miR-K12-6-5p (Exiqon), at a total of 50 pmol, were electroporatedinto 2 � 106 BCBL-1 cells in Nucleofection solution V by using programT-01 of the Nucleofector I instrument, according to the manufacturer’sinstructions (Amaxa, Inc.). Cells were harvested at 48 h postelectropora-tion, and total protein was extracted in RIPA lysis buffer. Expression levelsof the Bcr protein were quantitated relative to actin expression levels, asdescribed above. Changes in protein levels upon LNA electroporationwere compared to those of BCBL-1 cells electroporated with the negative-control LNA (NegA).
De novo KSHV infection. KSHV virions were purified from BCBL-1cultures 7 days after induction with valproic acid and concentrated bycentrifugation. KSHV infection of HUVECs and TIME cells was per-formed with medium containing 8 �g/ml Polybrene for 6 h at 37°C. Me-dium was changed every 2 days, and the adherent cells were harvested at 7or 10 days postinfection (HUVECs) for analysis by Western blotting.
Rac activation assays. HUVECs were transfected with miRNA mimicsas described above. At 5 hpt, cells were washed once with phosphate-buffered saline (PBS), and their medium was replaced with reduced-se-rum Opti-MEM-1 (Gibco) for 20 h. GTPase activity was induced with 10ng/ml of VEGF (Peprotech) for 10 min, after which the cells were pro-cessed for the measurement of Rac1-GTP levels using a G-LISA Rac1activation assay kit as recommended by the manufacturer (Cytoskeleton,Inc.).
Endothelial tube formation assays. HUVECs were transfected withmiRNAs or siRNAs as described above. The transfected cells were har-vested 48 h later, and a portion of the cells was saved for Western blotanalysis. Equal numbers of transfected cells were resuspended in a low-serum medium, EBM2 (basal medium with no supplements added;Lonza), with 10% EGM-2 BulletKit (complete HUVEC medium; Lonza)and plated onto �-slides for angiogenesis assays (Ibidi, LLC). The slideswere coated with the Geltrex reduced growth factor basement membranematrix (Gibco) for 30 min at 37°C. Equal numbers of transfectedHUVECs in low-serum medium were added to each coated well, and tubeformation was allowed to proceed for 16 h at 5% CO2 and 37°C. Toprepare the cells for imaging, the HUVEC networks were stained withCalcein AM (Invitrogen) for 30 min at room temperature and washedthree times with PBS. Images were collected by using a Zeiss AxioObserverZ1 (Carl Zeiss MicroImaging) epifluorescence microscope equipped witha 10� Plan-Neofluar (numerical aperture [NA], 0.3) objective lens, amotorized scanning stage, and a CoolSnap ES charge-coupled-device(CCD) camera (Photometrics). The mosaiX module of the Zeiss Axio-Vision (v. 4.8) image acquisition software was used to collect a series of tileimages that covered the entire area of the individual �-slide wells. The tile
images were stitched together to form a single large image maintaining theorigin pixel information. The stitched images were exported as 16-bit tifffiles, and tube and segment lengths were analyzed by using the “angiogen-esis tube formation” algorithm run in MetaMorph (v. 7.7) (MolecularDevices) software. To avoid any bias that might arise while choosing aregion of interest for tube length analysis, we analyzed the entire imagedwell area for tube length measurements. The fluorescence along the pe-rimeter of the well was considered background and not used for the finalimage analysis. The results are representative of three independent exper-iments, and P values of 0.05 were considered significant.
Real-time quantitative PCR analysis. Total RNA was extracted frommiR-Neg- or miR-K6-5-transfected cells at 48 hpt by using an miRNeasyminikit (Qiagen). A total of 1 �g of the RNA was converted to cDNA by usingthe High Capacity cDNA reverse transcription kit (Applied Biosystems). Thefollowing primers were used for measurement of VEGF mRNA levels: 5=-AGGCCAGCACATAGGAGA-3= and 5=-ACCGCCTCGGCTTGTCACAT-3=.Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) mRNA was used as anormalization control. qPCR analysis was performed by using FastStart Uni-versal SYBR green Master (ROX) (Roche Diagnostics GmbH), using the rel-ative quantitation method. TaqMan miRNA assays (Life Technologies, Inc.)were used for the measurement of KSHV miRNA levels in infected TIMEcells. For analysis of viral lytic mRNAs, primer pairs for RTA, ORF57, ORF59,and K8 were designed as described previously (41).
Immunofluorescence assay. TIME cells infected with either WT- or�K6-KSHV were grown on Lab-Tek II four-well chamber slides (ThermoScientific, Inc.). For LANA staining, cells were fixed with 4% paraformal-dehyde and permeabilized. After blocking, the cells were incubated for 3 hwith rabbit polyclonal antibodies against KSHV LANA. Alexa-594-cou-pled anti-rabbit secondary antibodies were used to visualize LANA undera Zeiss fluorescence microscope, using appropriate filters.
RESULTS
Previously, we reported a microarray profiling analysis for theidentification of mRNAs that were downregulated in the presenceof KSHV miRNAs in B cells and in the context of KSHV infectionof endothelial cells (11). From the array data for BJAB B cells(GEO accession number GSE65148), we identified breakpointcluster region (Bcr) as an mRNA that was downregulated in thepresence of miR-K6-5. Data from two biological replicatesshowed that Bcr was the 176th most repressed gene out of 14,384gene probes (1.2% of genes) in the BJAB arrays (0.43 log2). BcrmRNA levels were also downregulated in the context of KSHVinfection of HUVECs (0.24 log2).
Bcr is a direct target of KSHV miR-K6-5. The microarray datashowed that miR-K6-5 and de novo KSHV infections repress Bcr atthe mRNA level. To ensure that Bcr was also repressed at theprotein level, we transfected individual miRNA mimics into pri-mary endothelial cells (HUVECs). At 48 h posttransfection, weperformed Western blot analyses on the transfected-cell lysatesand normalized the levels of Bcr protein to that of actin (Fig. 1A,top). We observed that several KSHV miRNAs, namely, miR-K1,-K6-5, and -K8, strongly repressed Bcr at the protein level (Fig.1A). Consistent with the mRNA data, expression miR-K6-5 re-sulted in almost a 4-fold downregulation of the Bcr protein, com-pared to the negative-control miRNA or no miRNA.
To validate Bcr as a direct target of KSHV miRNAs, we per-formed luciferase reporter assays wherein the 3= UTR of Bcr wascloned downstream of a renilla luciferase reporter (pD765-Bcr).293 cells were transfected with pD765-Bcr and various KSHVmiRNAs, and repression of reporter activity was used as an indi-cator of miRNA binding to the Bcr 3= UTR. In the presence ofmiR-K6-5, there was a statistically significant repression of re-porter activity, indicating that miR-K6-5 could bind directly to
KSHV MicroRNA Targets Bcr
April 2015 Volume 89 Number 8 jvi.asm.org 4251Journal of Virology
on February 14, 2018 by guest
http://jvi.asm.org/
Dow
nloaded from
the 3= UTR of Bcr (Fig. 1B). The other miRNAs tested (miR-K2,-K8, and -K11) could not repress the luciferase activity, suggestingthat the interaction of miR-K6-5 with the 3= UTR of Bcr wasspecific.
Using TargetScan (42), we identified two potential miR-K6-5binding sites, conforming to either a 7-mer 1A or a 7-mer m8 type,in the 3= UTR of Bcr (Fig. 1C, left). However, TargetScan couldnot identify any potential binding sites for miR-K1 and -K8 (themiRNAs that also repressed Bcr at the protein level) (Fig. 1A) inthe 3= UTR of Bcr. To confirm that Bcr is a direct target of miR-
K6-5, we introduced mutations, “mut1” and “mut2” (Fig. 1C), inthe two predicted miR-6-5 binding sites in the 3= UTR of Bcr.While reporter plasmids bearing the mut1 3= UTR could still berepressed by miR-K6-5, reporter plasmids bearing the mut2 3=UTR were not suppressed by miR-K6-5 (Fig. 1C, right). Thus, themut2 site in the 3= UTR of Bcr is critical for miR-K6-5-mediatedrepression of Bcr. Together, these results suggest that Bcr is a di-rect target of KSHV miR-K6-5.
Bcr is downregulated by miR-K6-5 both in HUVECs andupon de novo KSHV infection. To further validate Bcr as a direct
miR-K6-5: 3'- GGCUACCUAAUCCACGACGACC -5' | | || | ||||||Bcr: 5'- GUCAGUGGGCAGCUCCUGCUGA -3'Bcr mut1: 5'- GUCAGUGGGCAGCUCCUaaUGA -3'
miR-K6-5: 3'- GGCUACCUAAUCCACGACGACC -5' | || || |||||||Bcr: 5'- UAUCUUGAAUAAACGCUGCUGC -3'Bcr mut2: 5'- UAUCUUGAAUAAACGCUaaUGC -3'
neg
6-5 neg
6-5 neg
6-50.0
0.5
1.0
1.5
2.0 24 hr 48 hr
miRNABcr mut1 mut2
Rel
ativ
e lu
cife
rase
act
ivity
*
***
noneNeg 1 2 3 3*4-3 4-5 5 6-3 6-5 7 8-3 9 9* 10
a10
b 110.0
0.5
1.0
1.5
2.0
Bcr
/Act
in
neg 2 6-5 8-3 11
0.0
0.5
1.0
1.5
2.0
2.5
24 hr. 48 hr
**
Rel
ativ
e lu
cife
rase
act
ivity
A.
C.
B.
miRNA miRNA
neg 1 2 3 3* 4-3 4-5 5 6-3 6-5 7 8-3 9 9* 10a 10b 11 neg noneBcr
Actin
FIG 1 Bcr is a direct target of KSHV microRNAs. (A, top) HUVECs were transfected with individual KSHV pre-miRNA mimics, and total cell lysates wereharvested for Western blot analysis at 48 hpt. (Bottom) The relative expression level of Bcr was normalized to that of actin. (B) 293 cells were reverse transfectedwith reporter plasmids wherein the 3=UTR of Bcr was cloned downstream of the Renilla luciferase along with the indicated KSHV miRNAs. Cells were harvestedat 24 or 48 hpt for reporter activity measurements. (C, left) Predicted binding sites for miR-K6-5 in the 3=UTR of Bcr conforming to either the 7-mer 1A (top)or the 7-mer m8 (bottom) type. These sites were also mutated to eliminate miR-K6-5 binding (mut1 or mut2), for use in luciferase assays to identify the precisemiR-K6-5 binding site in the 3=UTR of Bcr. (Right) Luciferase reporter assays performed in 293 cells using Bcr 3=-UTR mutants mut1 and mut2 to identify theexact miR-K6-5 binding site. � denotes a P value of 0.05, and �� denotes a P value of 0.01.
Ramalingam et al.
4252 jvi.asm.org April 2015 Volume 89 Number 8Journal of Virology
on February 14, 2018 by guest
http://jvi.asm.org/
Dow
nloaded from
target of KSHV miR-K6-5, we confirmed Bcr knockdown using ansiRNA targeting Bcr and found that both miR-K6-5 and siBcrresulted in a robust knockdown of the Bcr protein (P 0.001),compared to negative controls (Fig. 2A). We also antagonizedmiR-K6-5 using power-locked nucleic acid inhibitors (power-LNAs) in latently KSHV-infected BCBL-1 cells. We electropo-rated power-LNAs inhibiting miR-K6-5 (LNA-miR-K6-5) orcontrol LNAs (LNA-Neg) into BCBL-1 cells and measured Bcr/
actin protein levels at 48 h postelectroporation. Assuming incom-plete miRNA inhibition, we observed that power-LNAs againstmiR-K6-5 resulted in a statistically significant (P 0.05) increasein the Bcr protein level, compared to LNA-Neg (Fig. 2B).
To confirm that Bcr was also downregulated by KSHV in thecontext of viral infection, we measured Bcr levels in SLK (35, 36)and latently KSHV-infected (SLK�K) (43) cell lines. Bcr proteinlevels were repressed �60% in infected SLK�K cells compared to
SLKSLK+K
SHV
Bcr
Actin
Bcr
Actin
SLK
SLK+KSHV
0.0
0.5
1.0
1.5
Rel
ativ
e B
cr e
xpre
ssio
n
**
*
-KSHV
+KSHV
Bcr
Actin
-KSHV
+KSHV
0.0
0.5
1.0
1.5
Rel
ativ
e B
cr e
xpre
ssio
n
**
A. B. C.
D.
Bcr
Actin
None miR-Neg miR-K6-5 siNeg siBcr Neg m6-5LNA
LNA-Neg
LNA-miR
6-50.0
0.5
1.0
1.5
None
miR-N
eg
miR6-5
siCon
siBcr
0.0
0.5
1.0
1.5
Bcr
/Act
in
Bcr
/Act
in
****
log 2 m
edia
n-ce
nter
ed in
ten s
ity
B-Lymph
ocyte
Centro
blast
Memory
B-Ly
mphoc
yte
Naive P
regerm
inal C
enter
B-Lym
Small C
leave
d Foll
icle C
enter
Primary
Effusio
n Lym
phom
a-6
-4
-2
0
2********
Microarray data source: Basso et.al.E.
FIG 2 Bcr is downregulated by miR-K6-5 and during KSHV infection of endothelial cells. (A) HUVECs were transfected with miR-Neg (control), miR-K6-5,siNeg (siRNA negative control), or siBcr, and the relative levels of Bcr over actin were measured at 48 hpt. The values are averages of data from four independentexperiments with P values of 0.001. (B) BCBL-1 cells were electroporated with power-LNAs that inhibit miR-K6-5 along with a negative-control LNA(LNA-Neg). The relative Bcr levels over actin were measured by Western blotting at 48 h postelectroporation. (C) Bcr/actin protein levels were measured in SLKcells (KSHV negative) or in latently KSHV-infected SLK�K cells by Western blotting (top) and plotted (bottom). (D) HUVECs were either mock infected orinfected with KSHV, and their Bcr/actin levels were measured by Western blotting (top) and plotted (bottom). (E) Microarray data from NCBI GEO accessionnumber GSE2350 (44), comparing Bcr mRNA expression levels in normal B cell types and KSHV-infected primary effusion lymphoma cells. Horizontal barsindicate median values. Expression values were tested by using a Mann-Whitney U test, and �� indicates a P value of 0.01.
KSHV MicroRNA Targets Bcr
April 2015 Volume 89 Number 8 jvi.asm.org 4253Journal of Virology
on February 14, 2018 by guest
http://jvi.asm.org/
Dow
nloaded from
uninfected SLK cells (Fig. 2C). We also performed de novo KSHVinfections of HUVECs and observed that in the context of KSHVinfection, there was a 2-fold repression of the levels of Bcr protein(Fig. 2D). Furthermore, we analyzed the reported levels of BcrmRNA in B cells and B-cell lines using public microarray data-bases (44) and observed that PEL cells (KSHV positive [KSHV�])have lower Bcr mRNA levels than do other KSHV-negative B cells.By using a Mann-Whitney test, the Bcr mRNA expression leveldifferences between PEL cells and all B cells (except memory Blymphocytes) were significant (Fig. 2E).
Bcr is derepressed during infection with a KSHV mutant thatlacks miR-K6. Finally, to confirm that miR-K6-5 was importantfor Bcr repression in KSHV infection, we infected TIME cells witheither wild-type KSHV (WT-KSHV) or a KSHV mutant that lacksmiR-K12-6 (�K6-KSHV). Infected TIME cells were selected withhygromycin B and allowed to expand to generate a pool of TIMEcells that were infected with either WT- or �K6-KSHV. Usingimmunofluorescence, we confirmed that the hygromycin-resis-tant cells were positive for both green fluorescent protein (GFP)and KSHV LANA (Fig. 3A and B).
We measured mRNA levels of Bcr, LANA, and VEGF in TIMEcells infected with either WT- or �K6-KSHV and found that Bcrwas derepressed in TIME cells infected with �K6-KSHV com-pared to WT-KSHV (Fig. 3C, left). VEGF mRNA was repressed in�K6-KSHV infection compared to WT infection, suggesting arole for miR-K6-5 in both Bcr repression and VEGF activation(Fig. 3C). LANA mRNA levels were comparable between WT- and�K6-KSHV infections. Similar results were also obtained with asecond endothelial cell line, iTIME, after infection with WT- or�K6-KSHV (Fig. 3C, right). We also ensured that the expressionof miR-K6 was abrogated in �K6-KSHV using real-time PCR(RT-PCR) analysis (Fig. 3D). The levels of the other miRNAs mea-sured, miR-K1, -K4-3, and -K11, were comparable between WT-and �K6-KSHV. Western blot analysis showed that while WT-KSHV-infected cells robustly repressed the Bcr protein, infectionwith �K6-KSHV resulted in a near-complete derepression of Bcrlevels (Fig. 3E). These results show that miR-K6-5 plays an essen-tial role in the Bcr repression observed during KSHV infections.Together, these results demonstrate that KSHV represses the Bcrprotein by using miR-K6-5 during KSHV infection of endothelialcells and B cells.
KSHV miR-K6-5 represses two Rac-GTPase-activating pro-teins, Bcr and RacGAP1. Bcr, being a Rac-GTPase activation pro-tein (GAP), was shown to enhance the intrinsic GTPase activity ofRac1 (28). An analysis of our previously reported microarray data(11) to identify other GAP proteins that might also be repressed byKSHV revealed Rac-GTPase-activating protein 1 (RacGAP1)mRNA as an mRNA that was strongly repressed upon KSHV in-fection of endothelial cells. Like Bcr, RacGAP1 also negatively reg-ulates Rac-GTPase function by enhancing the hydrolysis of Rac1-bound GTP to GDP (45). RacGAP1 protein levels were repressed�60% in KSHV-infected HUVECs compared to mock infections(Fig. 4A). To identify the specific KSHV miRNA that repressesRacGAP1, we also measured RacGAP1 protein levels in HUVECsthat were transfected with individual KSHV miRNAs. Interest-ingly, transfection of miR-K6-5 resulted in an �40% repression ofRacGAP1 protein levels compared to a negative-control miRNA(n � 4; P 0.05) (Fig. 4B, gray bars). As shown in Fig. 2A, miR-K6-5 also repressed Bcr protein levels in transfected HUVECs(n � 4; P 0.01) (Fig. 4B, hatched bars).
To confirm that RacGAP1 was repressed by miR-K6-5 via adirect interaction, we scanned the 3=UTR of RacGAP1 using Tar-getScan and identified an 8-mer binding site for miR-K6-5. Wecloned this portion of the 3=UTR of RacGAP1 downstream of therenilla luciferase reporter (pDEST-765-RG1) and performed 3=-UTR reporter assays. At 48 hpt, we observed that miR-K6-5 sup-pressed luciferase reporter activity by �30%, compared to themiR-Neg control (Fig. 4C). To further confirm direct binding, wealso mutated the predicted miR-K6-5 binding site. Mutation ofthe binding site completely negated the miR-K6-5-mediated re-pression of the reporter (Fig. 4C), suggesting that miR-K6-5 re-pressed RacGAP1 mRNA via a direct interaction with the 3=UTR.The repression of Bcr and RacGAP1, two proteins that negativelyregulate Rac1, by the same KSHV miRNA suggests the importanceof activation of this pathway in KSHV infections. As Bcr has beendescribed to be a tumor suppressor (22), we focused on under-standing the importance of Bcr repression during KSHV infec-tion.
miR-K6-5-mediated repression of Bcr enhances Rac1 activ-ity in endothelial cells. Active Rac1 plays critical roles in regulat-ing VEGF-induced endothelial cell motility, lumen formation,and, hence, angiogenesis (31, 46, 47). Transgenic mice expressingconstitutively active Rac1 developed KS-like tumors (33). As Bcraccelerates the conversion of Rac1-GTP to Rac1-GDP and acts asa negative regulator of Rac1 (28, 48), we hypothesized that theknockdown of Bcr by miR-K6-5 might increase the levels of activeRac1-GTP in HUVECs. We measured the levels of “active” Rac1in miR-K6-5-transfected HUVECs by measuring the amount ofRac1-GTP bound to a downstream protein using a G-LISA assay.We observed that miR-K6-5-transfected HUVECs had a �30%increase in Rac1-GTP levels, compared to the miR-Neg control(Fig. 4D, hatched bars). A Western blot analysis of these trans-fected HUVECs also showed �2-fold repression in the levels ofthe Bcr protein with miR-K6-5 (P 0.001) (Fig. 4D, gray bars). Asadditional controls, we also transfected HUVECs with siRNAstargeting Bcr and observed a similar increase in the Rac1-GTPlevel (�30%), compared with the siNeg control (Fig. 4D). To-gether, these results suggest that the knockdown of Bcr by eitherKSHV miR-K6-5 or siBcr increases the Rac1-GTP levels inHUVECs.
miR-K6-5-transfected HUVECs have increased VEGF levels.Enhanced Rac1 levels have been linked to increases in angiogene-sis. Since VEGF is one of the key factors that promote the process,we measured the levels of VEGF mRNA in miR-K6-5-transfectedHUVECs using quantitative PCR. HUVECs were transfected witheither miR-K6-5 or miR-Neg, and total RNA was extracted at 48hpt for measurement of VEGF mRNA levels. We found that miR-K6-5-transfected HUVECs had an �35% increase in VEGFmRNA levels, compared to miR-Neg controls (n � 5; P 0.01)(Fig. 4E). A similar increase in VEGF levels was also observed withan siRNA that targets Bcr (Fig. 4E, right). Thus, knockdown of Bcrwith either miR-K6-5 or siRNA can increase both Rac1-GTP levelsand VEGF levels in endothelial cells, and this might contribute tothe angiogenic phenotype of KS.
miR-K6-5 and Bcr repression increase tube formation in en-dothelial cells. We hypothesized that the increased Rac1 activa-tion (Fig. 4D) and the increased VEGF levels (Fig. 4E) observed formiR-K6-5-transfected HUVECs might lead to increased angio-genesis of endothelial cells (31). To test this hypothesis, we trans-fected HUVECs with either miR-K6-5 or siBcr and quantified
Ramalingam et al.
4254 jvi.asm.org April 2015 Volume 89 Number 8Journal of Virology
on February 14, 2018 by guest
http://jvi.asm.org/
Dow
nloaded from
-KSHV
+WT K
SHV
Bcr
Actin
+ΔK6 K
SHV
C.
D.
A. B.WT infection ΔK6 infectionGFP GFPDAPI DAPI
LANA Merge LANA Merge
Levels of mRNAs in infected TIME cells:
Levels of miRNAs in infected TIME cells:
98% 93%
WT-KSHV
DK6-KSHV
0
1
2
3
Fold
cha
nge
in R
NA
leve
ls u
pon
infe
ctio
n Bcr LANA VEGF
WT-KSHV
DK6-KSHV
0
1
2
3
4
Fold
cha
nge
in R
NA
leve
ls u
pon
infe
ctio
n Bcr LANA VEGF
Levels of mRNAs in infected iTIME cells:
E.
None
WT-KSHV
DK6-KSHV
0.0
0.5
1.0
1.5
Fold
cha
nge
in B
cr p
rote
in le
vels
WT-KSHV
DK6-KSHV
0.0
0.5
1.0
1.5
Fold
cha
nge
in m
iRN
A
miR-K6 miR-K1
miR-K4-3 miR-K11
miR-K6 Undet
FIG 3 Bcr is derepressed upon infection with a KSHV mutant that lacks miR-K12-6 expression. (A and B) TIME cells were infected with either WT-KSHV (A)or �K6-KSHV (B), and infected cells were selected for hygromycin resistance for several weeks. (Left) An immunofluorescence assay was performed to confirmKSHV infection using GFP (top) or LANA (red dots) (bottom) expression. (Right) Infected cell nuclei were stained with 4=,6-diamidino-2-phenylindole (DAPI)(top), and the merged channels are shown (bottom). The inset numbers state the percentages of infected cells that were positive for LANA expression. (C) TotalRNA was extracted from infected TIME cells (left) or iTIME cells (right), and levels of Bcr, VEGF, and LANA were measured by using quantitative RT-PCR. (D)Total RNA was extracted from the infected TIME cells, and levels of KSHV miRNAs miR-K1, -K4-3, -K6-5, and -K11 were measured by using quantitativeRT-PCR. (E) TIME cells were left uninfected (lane 1) or infected with either WT-KSHV (lane 2) or �K6-KSHV (lane 3), and the levels of Bcr protein wereanalyzed by Western blotting.
April 2015 Volume 89 Number 8 jvi.asm.org 4255Journal of Virology
on February 14, 2018 by guest
http://jvi.asm.org/
Dow
nloaded from
angiogenesis using a basement membrane matrix-based tube for-mation assay. Briefly, the transfected HUVECs were layered over abasement membrane matrix overnight to allow tube formation(Fig. 5A and C). Using the “angiogenesis tube formation” algo-rithm in Metamorph, we measured the tube and segment lengthsacross the entire well area to obtain a complete and unbiased mea-sure of angiogenesis. A sample of the transfected cells was alsoused for Western blotting to confirm Bcr knockdown for eachassay. In tube formation assays, we observed that HUVECs trans-fected with miR-K6-5 had �30% increases in both tube and seg-ment lengths compared to the miR-Neg control (P 0.05)(Fig. 5A and B). Western blot analysis confirmed Bcr repression by
miR-K6-5 (Fig. 4D, gray bars). Furthermore, siRNAs targeting Bcrshowed �80% increases in tube (and segment) length comparedto the siNeg control (P 0.05) (Fig. 5C and D). The greater effectof siBcr on angiogenesis than that of miR-K6-5 is likely due to thefact that the siRNA to Bcr results in a greater degree of knockdownof Bcr protein (�75%) than does miR-K6-5 (�50%) (Fig. 2A and4D). These data show that miR-K6-5 or siRNA-mediated knock-down of Bcr enhances Rac1 activity, endothelial tube formation,and angiogenesis.
Repression of Bcr stimulates lytic gene expression. To deter-mine the role of Bcr in KSHV infection, we knocked down Bcrprotein expression in BCBL-1 cells (latently infected with KSHV)
FIG 4 miR-K6-5 represses Bcr and RacGAP1 and increases Rac1-GTP levels in endothelial cells. (A) HUVECs were either mock infected or infected with KSHV, andtheir RacGAP1/actin levels were measured by Western blotting (top) and plotted (bottom). (B) HUVECs were transfected with miR-Neg (control) or miR-K6-5, and therelative levels of RacGAP1 over actin were measured at 48 hpt. The level of Bcr protein was used as an additional control. (C) 293 cells were reverse transfected withreporter plasmids wherein a portion of the 3=UTR of RacGAP1 (WT-RG1) or a mutated version (mut-RG1) was cloned downstream of the Renilla luciferase along withmiR-Neg or miR-K6-5. Cells were harvested at 24 or 48 hpt for reporter activity measurements. (D) HUVECs were transfected with miR-Neg, miR-K6-5, siNeg,or siBcr, and their Rac1-GTP levels were measured by using a G-LISA. (E) HUVECs were transfected with either miR-K6-5 or siBcr, along with their corre-sponding negative controls. VEGF mRNA levels were measured by quantitative RT-PCR. * denotes a P value of 0.05, and ** denotes a P value of 0.01.
Ramalingam et al.
4256 jvi.asm.org April 2015 Volume 89 Number 8Journal of Virology
on February 14, 2018 by guest
http://jvi.asm.org/
Dow
nloaded from
using siRNAs. We electroporated siRNAs against Bcr into BCBL-1cells and observed a �95% knockdown in Bcr protein levels at 48h postelectroporation, compared to the siNeg control (Fig. 6A).Surprisingly, knockdown of Bcr via siRNAs resulted in �2-foldincreases in the levels of the KSHV replication and transcriptionactivator protein (RTA or ORF50). RTA is a transcriptional acti-vator and is the master regulator of KSHV lytic reactivation (49,50). Bcr repression by KSHV might therefore facilitate the transi-tion from latent infection to lytic reactivation. To understand thisfurther, we also measured the levels of Bcr protein in BCBL-1 cellsthat were undergoing lytic reactivation upon valproate treatment.As expected, treatment with valproate resulted in �10-fold acti-vation of RTA in these cells (Fig. 6B), while Bcr protein was re-pressed by �40%, which may be a result of host shutoff (51).
Finally, we measured the mRNA levels of several KSHV lyticgenes in the presence of an siRNA against Bcr. Consistent with theprotein data, we observed an �2-fold increase in the level of viralRTA mRNA upon Bcr knockdown, relative to siNeg (Fig. 6C). Inaddition, we also observed similar increases in the levels of thethree lytic mRNAs ORF57, ORF59, and K8 upon Bcr knockdown.Together, our data suggest that Bcr repression by KSHV might bebeneficial for KSHV to transition from latency into lytic replica-tion.
DISCUSSION
Using an unbiased, microarray-based gene profiling approach, wehave identified the breakpoint cluster region (Bcr) mRNA as thecellular target of a KSHV microRNA, miR-K6-5, and demon-strated that the virus utilizes miRNAs to enhance Rac1-GTP levelsand promote angiogenesis of endothelial cells. The Bcr proteinserves as a negative regulator of Rac1 (28), and its overexpressionresults in the formation of stress fibers due to its effect on smallGTPases, suggesting a potential role for Bcr in cell motility (52).The robust Bcr repression that we observed in miR-K6-5-trans-fected cells (Fig. 1 and 2) suggested that KSHV might be repressingBcr to enhance Rac1 activity and promote angiogenesis. Consis-tent with this hypothesis, Rac1-GTP levels were enhanced in bothmiR-K6-5- and siBcr-transfected HUVECs (Fig. 4D), and this in-crease also corresponded to a comparable increase in tube forma-tion in endothelial cells (Fig. 5). We also observed an increase inthe level of VEGF mRNA in HUVECs transfected with miR-K6-5(Fig. 4E). Thus, we describe an important role of viral microRNAsin the establishment of KS-associated angiogenesis and demon-strate a new angiogenic function of Bcr.
The enhancement of Rac1-GTP levels as a consequence of Bcrknockdown might also have implications for other cellular path-ways. For instance, active Rac1 can positively regulate NF-�B-
A. B.
* ** *
miR-N
eg
miR6-5
0.0
0.5
1.0
1.5
Segment lengthTube length
Segment lengthTube length
miR-Neg miR-K6-5
C. D.
* ** *
siNeg
siBcr
0.0
0.5
1.0
1.5
2.0
2.5
Fold
cha
nge
in T
ube/
Seg
men
t len
gth
Fold
cha
nge
in T
ube/
Seg
men
t len
gth
siNeg siBcr
FIG 5 miR-K6-5- or siRNA-mediated repression of Bcr increases tube formation in endothelial cells. (A and C) HUVECs were transfected with miR-Neg ormiR-K6-5 (A) and siNeg or siBcr (C) and transferred onto Geltrex at 48 hpt to allow tube formation. The tubes were stained with Calcein AM and imaged asdescribed in Materials and Methods. (B and D) The total lengths of tubes and segments across the complete well area were measured by using Metamorph(Molecular Devices, Inc.) and plotted. The term “segment” defines the extent of branching of a given tube; in other words, a tube is made of many segments. Theresults are averages of data from three independent experiments, and P values of 0.05 were considered to be significant.
KSHV MicroRNA Targets Bcr
April 2015 Volume 89 Number 8 jvi.asm.org 4257Journal of Virology
on February 14, 2018 by guest
http://jvi.asm.org/
Dow
nloaded from
dependent transcription and promote the survival of cancer cells(53). By inhibiting Rac1-GTP formation, Bcr also inhibits the ac-tivation of p21-activated protein kinase (PAK1) (54). Thus, miR-K6-5-mediated repression of Bcr might also contribute to the in-creased PAK1 activity that is observed in KSHV-infected HUVECs
(32). Furthermore, Rac1 also regulates NAPDH-oxidase and en-hances reactive oxygen species (ROS) generation. ROS is an im-portant second-messenger molecule and plays numerous roles inthe progression of cancer, including the establishment of angio-genesis (for a review, see reference 55). In studies with knockout
siNeg
siBcr
No drug
Valpro
ate0
5
10
15
20
RTA
/Act
inBcr
Actin
RTA
Valproate - +
Bcr
/Act
in
No drug
Valpro
ate0.0
0.2
0.4
0.6
0.8
1.0**
Bcr
Actin
RTA
siNeg
siBcr
0
1
2
3
Pro
tein
leve
ls in
BC
BL-
1
RTA/Actin Bcr/Actin
*A.
B.
C. *** ** ***********
siNeg
siBcr
0
1
2
3
Fold
cha
nge
in m
RN
A le
vels
RTA ORF57ORF59 K8
Bcr
FIG 6 Repression of Bcr stimulates lytic gene expression. (A) BCBL-1 cells were electroporated with either control siRNAs (siNeg) or siBcr. Bcr and RTA levels weremeasured at 48 h postelectroporation, normalized to actin levels, and quantified. (B) BCBL-1 cells were either left untreated or treated with valproate to induce lyticreactivation. Cells were harvested at 24 h posttreatment, and their Bcr and RTA levels were measured and normalized to that of actin. (C) BCBL-1 cells were electropo-rated with either control siRNAs (siNeg) or siBcr, and mRNA levels of the RTA, ORF57, ORF59, and K8 viral genes were measured by using quantitative RT-PCR.
Ramalingam et al.
4258 jvi.asm.org April 2015 Volume 89 Number 8Journal of Virology
on February 14, 2018 by guest
http://jvi.asm.org/
Dow
nloaded from
mice, neutrophils from bcr/ mice had increased membrane-associated Rac1-GTP levels and �2-fold-higher levels of ROSthan did wild-type mice (48). However, we were unable to detectan effect of miR-K6-5- or siRNA-mediated Bcr repression on ROSlevels (data not shown). One possible reason for this result is thedifference in cell types used: the previous study (48) used phorbolmyristate acetate (PMA)-activated neutrophils that are special-ized in ROS generation, whereas we studied endothelial cells thatgenerate �100-fold-lower levels of ROS (56).
While latency is the default pathway in infection by many her-pesviruses, the virus should also be able to transition into lyticreplication under appropriate conditions. The viral protein RTAregulates this process, and induction of RTA expression activateslytic reactivation in KSHV-infected cells. Repression of cellularfactors to regulate the latency-lytic cycle was described previously(11, 18, 57–59). KSHV RTA is itself repressed by miR-K12-9-5,-7-5, and -5 (12, 13, 60). In BCBL-1 cells (latently infected withKSHV), we observed �2-fold activation of RTA (and other lyticmRNAs) upon siRNA-mediated Bcr repression. Bcr was also re-pressed during valproate-mediated lytic reactivation of BCBL-1cells (Fig. 6). Thus, we describe an important function formiRNA-mediated suppression of Bcr during lytic reactivation ofKSHV infection.
KSHV miRNAs have been demonstrated to have numerousroles in the establishment of KS. While the complete repertoire ofthe cellular targets of these miRNAs is still emerging, we show thatKSHV miRNAs repress Bcr, a tumor suppressor (22), and enhancetube formation in endothelial cells. Expression of constitutivelyactive Rac1 stimulated KS-like tumors in animal models, and Rac1is overexpressed in spindle cells from AIDS-KS biopsy specimens(33). Furthermore, Guilluy et al. demonstrated that KSHV infec-tion increases Rac1-GTP levels in both infected HUVECs and tu-mor tissue (32). Here, we demonstrate that miR-K6-5-mediatedrepression of Bcr brings about a similar enhancement in Rac1activity in HUVECs. Infection of endothelial cells by KSHV isknown to enhance angiogenesis by inducing many angiogenicmolecules, such as VEGF and matrix metalloproteinases (MMPs).KSHV proteins such as K1 (61) and viral G protein-coupled re-ceptor (vGPCR) (62) contribute to this process. It is likely that theincreased angiogenesis observed with miR-K6-5 is further en-hanced in the context of KSHV infection due to the contributionof other viral proteins and/or miRNAs. The combination of thesefactors may also promote increased proliferation of endothelialcells to promote infection of more cells by KSHV. Complete char-acterization of the roles played by the KSHV microRNAs and thehost factors that they suppress might further our understanding ofthe establishment of Kaposi’s sarcoma.
ACKNOWLEDGMENTS
We thank Robert Yarchoan for critical reviews of the manuscript andmembers of the Ziegelbauer laboratory for their help and support. Wethank Michael Kruhlak and the Analytical Imaging Facility at NCI fortheir assistance with confocal microscopy. We thank Craig McCormickfor the iTIME cell line. We are also thankful for the gift of the iSLK wild-type and mutant producer cell lines from Rolf Renne.
REFERENCES1. Cesarman E, Chang Y, Moore PS, Said JW, Knowles DM. 1995. Kaposi’s
sarcoma-associated herpesvirus-like DNA sequences in AIDS-relatedbody-cavity-based lymphomas. N Engl J Med 332:1186 –1191. http://dx.doi.org/10.1056/NEJM199505043321802.
2. Chang Y, Cesarman E, Pessin MS, Lee F, Culpepper J, Knowles DM,Moore PS. 1994. Identification of herpesvirus-like DNA sequences inAIDS-associated Kaposi’s sarcoma. Science 266:1865–1869. http://dx.doi.org/10.1126/science.7997879.
3. Cai X, Lu S, Zhang Z, Gonzalez CM, Damania B, Cullen BR. 2005.Kaposi’s sarcoma-associated herpesvirus expresses an array of viral mi-croRNAs in latently infected cells. Proc Natl Acad Sci U S A 102:5570 –5575. http://dx.doi.org/10.1073/pnas.0408192102.
4. Grundhoff A, Sullivan CS, Ganem D. 2006. A combined computational andmicroarray-based approach identifies novel microRNAs encoded by humangamma-herpesviruses.RNA12:733–750.http://dx.doi.org/10.1261/rna.2326106.
5. Pfeffer S, Sewer A, Lagos-Quintana M, Sheridan R, Sander C, GrasserFA, van Dyk LF, Ho CK, Shuman S, Chien M, Russo JJ, Ju J, RandallG, Lindenbach BD, Rice CM, Simon V, Ho DD, Zavolan M, Tuschl T.2005. Identification of microRNAs of the herpesvirus family. Nat Methods2:269 –276. http://dx.doi.org/10.1038/nmeth746.
6. Samols MA, Hu J, Skalsky RL, Renne R. 2005. Cloning and identificationof a microRNA cluster within the latency-associated region of Kaposi’ssarcoma-associated herpesvirus. J Virol 79:9301–9305. http://dx.doi.org/10.1128/JVI.79.14.9301-9305.2005.
7. Fabian MR, Sonenberg N, Filipowicz W. 2010. Regulation of mRNAtranslation and stability by microRNAs. Annu Rev Biochem 79:351–379.http://dx.doi.org/10.1146/annurev-biochem-060308-103103.
8. Nachmani D, Stern-Ginossar N, Sarid R, Mandelboim O. 2009. Diverseherpesvirus microRNAs target the stress-induced immune ligand MICBto escape recognition by natural killer cells. Cell Host Microbe 5:376 –385.http://dx.doi.org/10.1016/j.chom.2009.03.003.
9. Abend JR, Uldrick T, Ziegelbauer JM. 2010. Regulation of tumor necro-sis factor-like weak inducer of apoptosis receptor protein (TWEAKR) ex-pression by Kaposi’s sarcoma-associated herpesvirus microRNA preventsTWEAK-induced apoptosis and inflammatory cytokine expression. J Vi-rol 84:12139 –12151. http://dx.doi.org/10.1128/JVI.00884-10.
10. Suffert G, Malterer G, Hausser J, Viiliainen J, Fender A, Contrant M,Ivacevic T, Benes V, Gros F, Voinnet O, Zavolan M, Ojala PM, Haas JG,Pfeffer S. 2011. Kaposi’s sarcoma herpesvirus microRNAs target caspase 3and regulate apoptosis. PLoS Pathog 7:e1002405. http://dx.doi.org/10.1371/journal.ppat.1002405.
11. Ziegelbauer JM, Sullivan CS, Ganem D. 2009. Tandem array-basedexpression screens identify host mRNA targets of virus-encoded micro-RNAs. Nat Genet 41:130 –134. http://dx.doi.org/10.1038/ng.266.
12. Bellare P, Ganem D. 2009. Regulation of KSHV lytic switch proteinexpression by a virus-encoded microRNA: an evolutionary adaptationthat fine-tunes lytic reactivation. Cell Host Microbe 6:570 –575. http://dx.doi.org/10.1016/j.chom.2009.11.008.
13. Lin X, Liang D, He Z, Deng Q, Robertson ES, Lan K. 2011. miR-K12-7-5p encoded by Kaposi’s sarcoma-associated herpesvirus stabilizes thelatent state by targeting viral ORF50/RTA. PLoS One 6:e16224. http://dx.doi.org/10.1371/journal.pone.0016224.
14. Samols MA, Skalsky RL, Maldonado AM, Riva A, Lopez MC, Baker HV,Renne R. 2007. Identification of cellular genes targeted by KSHV-encodedmicroRNAs. PLoS Pathog 3:e65. http://dx.doi.org/10.1371/journal.ppat.0030065.
15. Gottwein E, Mukherjee N, Sachse C, Frenzel C, Majoros WH, Chi JT,Braich R, Manoharan M, Soutschek J, Ohler U, Cullen BR. 2007. A viralmicroRNA functions as an orthologue of cellular miR-155. Nature 450:1096 –1099. http://dx.doi.org/10.1038/nature05992.
16. Skalsky RL, Samols MA, Plaisance KB, Boss IW, Riva A, Lopez MC,Baker HV, Renne R. 2007. Kaposi’s sarcoma-associated herpesvirus en-codes an ortholog of miR-155. J Virol 81:12836 –12845. http://dx.doi.org/10.1128/JVI.01804-07.
17. Gottwein E, Cullen BR. 2010. A human herpesvirus microRNA inhibitsp21 expression and attenuates p21-mediated cell cycle arrest. J Virol 84:5229 –5237. http://dx.doi.org/10.1128/JVI.00202-10.
18. Lei X, Bai Z, Ye F, Xie J, Kim CG, Huang Y, Gao SJ. 2010. Regulationof NF-kappaB inhibitor IkappaBalpha and viral replication by a KSHVmicroRNA. Nat Cell Biol 12:193–199. http://dx.doi.org/10.1038/ncb2019.
19. Liu Y, Sun R, Lin X, Liang D, Deng Q, Lan K. 2012. Kaposi’s sarcoma-associated herpesvirus-encoded microRNA miR-K12-11 attenuates trans-forming growth factor beta signaling through suppression of SMAD5. JVirol 86:1372–1381. http://dx.doi.org/10.1128/JVI.06245-11.
20. Abend JR, Ramalingam D, Kieffer-Kwon P, Uldrick TS, Yarchoan R,Ziegelbauer JM. 2012. Kaposi’s sarcoma-associated herpesvirus microRNAstarget IRAK1 and MYD88, two components of the Toll-like receptor/
KSHV MicroRNA Targets Bcr
April 2015 Volume 89 Number 8 jvi.asm.org 4259Journal of Virology
on February 14, 2018 by guest
http://jvi.asm.org/
Dow
nloaded from
interleukin-1R signaling cascade, to reduce inflammatory-cytokine expres-sion. J Virol 86:11663–11674. http://dx.doi.org/10.1128/JVI.01147-12.
21. Groffen J, Stephenson JR, Heisterkamp N, de Klein A, Bartram CR,Grosveld G. 1984. Philadelphia chromosomal breakpoints are clusteredwithin a limited region, bcr, on chromosome 22. Cell 36:93–99. http://dx.doi.org/10.1016/0092-8674(84)90077-1.
22. Ress A, Moelling K. 2005. Bcr is a negative regulator of the Wnt signallingpathway. EMBO Rep 6:1095–1100. http://dx.doi.org/10.1038/sj.embor.7400536.
23. Ress A, Moelling K. 2006. Bcr interferes with beta-catenin-Tcf1 interac-tion. FEBS Lett 580:1227–1230. http://dx.doi.org/10.1016/j.febslet.2006.01.034.
24. Radziwill G, Erdmann RA, Margelisch U, Moelling K. 2003. The Bcrkinase downregulates Ras signaling by phosphorylating AF-6 and bindingto its PDZ domain. Mol Cell Biol 23:4663– 4672. http://dx.doi.org/10.1128/MCB.23.13.4663-4672.2003.
25. Maru Y, Witte ON. 1991. The BCR gene encodes a novel serine/threoninekinase activity within a single exon. Cell 67:459 – 468. http://dx.doi.org/10.1016/0092-8674(91)90521-Y.
26. Ron D, Zannini M, Lewis M, Wickner RB, Hunt LT, Graziani G,Tronick SR, Aaronson SA, Eva A. 1991. A region of proto-dbl essentialfor its transforming activity shows sequence similarity to a yeast cell cyclegene, CDC24, and the human breakpoint cluster gene, bcr. New Biol3:372–379.
27. Whitehead IP, Campbell S, Rossman KL, Der CJ. 1997. Dbl familyproteins. Biochim Biophys Acta 1332:F1–F23.
28. Diekmann D, Brill S, Garrett MD, Totty N, Hsuan J, Monfries C, HallC, Lim L, Hall A. 1991. Bcr encodes a GTPase-activating protein forp21rac. Nature 351:400 – 402. http://dx.doi.org/10.1038/351400a0.
29. Fryer BH, Field J. 2005. Rho, Rac, Pak and angiogenesis: old roles andnewly identified responsibilities in endothelial cells. Cancer Lett 229:13–23. http://dx.doi.org/10.1016/j.canlet.2004.12.009.
30. Ensoli B, Sturzl M. 1998. Kaposi’s sarcoma: a result of the interplayamong inflammatory cytokines, angiogenic factors and viral agents. Cy-tokine Growth Factor Rev 9:63– 83. http://dx.doi.org/10.1016/S1359-6101(97)00037-3.
31. Vader P, van der Meel R, Symons MH, Fens MH, Pieters E, WilschutKJ, Storm G, Jarzabek M, Gallagher WM, Schiffelers RM, Byrne AT.2011. Examining the role of Rac1 in tumor angiogenesis and growth: aclinically relevant RNAi-mediated approach. Angiogenesis 14:457– 466.http://dx.doi.org/10.1007/s10456-011-9229-x.
32. Guilluy C, Zhang Z, Bhende PM, Sharek L, Wang L, Burridge K,Damania B. 2011. Latent KSHV infection increases the vascular permea-bility of human endothelial cells. Blood 118:5344 –5354. http://dx.doi.org/10.1182/blood-2011-03-341552.
33. Ma Q, Cavallin LE, Yan B, Zhu S, Duran EM, Wang H, Hale LP, DongC, Cesarman E, Mesri EA, Goldschmidt-Clermont PJ. 2009. Antitu-morigenesis of antioxidants in a transgenic Rac1 model of Kaposi’s sar-coma. Proc Natl Acad Sci U S A 106:8683– 8688. http://dx.doi.org/10.1073/pnas.0812688106.
34. Sahai E, Marshall CJ. 2002. RHO-GTPases and cancer. Nat Rev Cancer2:133–142. http://dx.doi.org/10.1038/nrc725.
35. Herndier BG, Werner A, Arnstein P, Abbey NW, Demartis F, CohenRL, Shuman MA, Levy JA. 1994. Characterization of a human Kaposi’ssarcoma cell line that induces angiogenic tumors in animals. AIDS 8:575–581. http://dx.doi.org/10.1097/00002030-199405000-00002.
36. Sturzl M, Gaus D, Dirks WG, Ganem D, Jochmann R. 2013. Kaposi’ssarcoma-derived cell line SLK is not of endothelial origin, but is a contam-inant from a known renal carcinoma cell line. Int J Cancer 132:1954 –1958. http://dx.doi.org/10.1002/ijc.27849.
37. Vieira J, O’Hearn PM. 2004. Use of the red fluorescent protein as amarker of Kaposi’s sarcoma-associated herpesvirus lytic gene expression.Virology 325:225–240. http://dx.doi.org/10.1016/j.virol.2004.03.049.
38. Leidal AM, Cyr DP, Hill RJ, Lee PW, McCormick C. 2012. Subversionof autophagy by Kaposi’s sarcoma-associated herpesvirus impairs onco-gene-induced senescence. Cell Host Microbe 11:167–180. http://dx.doi.org/10.1016/j.chom.2012.01.005.
39. Brulois KF, Chang H, Lee AS, Ensser A, Wong LY, Toth Z, Lee SH, LeeHR, Myoung J, Ganem D, Oh TK, Kim JF, Gao SJ, Jung JU. 2012.Construction and manipulation of a new Kaposi’s sarcoma-associatedherpesvirus bacterial artificial chromosome clone. J Virol 86:9708 –9720.http://dx.doi.org/10.1128/JVI.01019-12.
40. Myoung J, Ganem D. 2011. Generation of a doxycycline-inducible KSHV
producer cell line of endothelial origin: maintenance of tight latency withefficient reactivation upon induction. J Virol Methods 174:12–21. http://dx.doi.org/10.1016/j.jviromet.2011.03.012.
41. Scholz BA, Harth-Hertle ML, Malterer G, Haas J, Ellwart J, Schulz TF,Kempkes B. 2013. Abortive lytic reactivation of KSHV in CBF1/CSL de-ficient human B cell lines. PLoS Pathog 9:e1003336. http://dx.doi.org/10.1371/journal.ppat.1003336.
42. Lewis BP, Burge CB, Bartel DP. 2005. Conserved seed pairing, oftenflanked by adenosines, indicates that thousands of human genes are mi-croRNA targets. Cell 120:15–20. http://dx.doi.org/10.1016/j.cell.2004.12.035.
43. Chandriani S, Ganem D. 2010. Array-based transcript profiling andlimiting-dilution reverse transcription-PCR analysis identify additionallatent genes in Kaposi’s sarcoma-associated herpesvirus. J Virol 84:5565–5573. http://dx.doi.org/10.1128/JVI.02723-09.
44. Basso K, Saito M, Sumazin P, Margolin AA, Wang K, Lim WK, KitagawaY, Schneider C, Alvarez MJ, Califano A, Dalla-Favera R. 2010. Integratedbiochemical and computational approach identifies BCL6 direct target genescontrolling multiple pathways in normal germinal center B cells. Blood 115:975–984. http://dx.doi.org/10.1182/blood-2009-06-227017.
45. Wang SM, Ooi LL, Hui KM. 2011. Upregulation of Rac GTPase-activating protein 1 is significantly associated with the early recurrence ofhuman hepatocellular carcinoma. Clin Cancer Res 17:6040 – 6051. http://dx.doi.org/10.1158/1078-0432.CCR-11-0557.
46. Bayless KJ, Davis GE. 2002. The Cdc42 and Rac1 GTPases are requiredfor capillary lumen formation in three-dimensional extracellular matrices.J Cell Sci 115:1123–1136.
47. Soga N, Namba N, McAllister S, Cornelius L, Teitelbaum SL, DowdySF, Kawamura J, Hruska KA. 2001. Rho family GTPases regulate VEGF-stimulated endothelial cell motility. Exp Cell Res 269:73– 87. http://dx.doi.org/10.1006/excr.2001.5295.
48. Voncken JW, van Schaick H, Kaartinen V, Deemer K, Coates T, LandingB, Pattengale P, Dorseuil O, Bokoch GM, Groffen J, Heisterkamp N. 1995.Increased neutrophil respiratory burst in bcr-null mutants. Cell 80:719–728.http://dx.doi.org/10.1016/0092-8674(95)90350-X.
49. Lukac DM, Renne R, Kirshner JR, Ganem D. 1998. Reactivation ofKaposi’s sarcoma-associated herpesvirus infection from latency by ex-pression of the ORF 50 transactivator, a homolog of the EBV R protein.Virology 252:304 –312. http://dx.doi.org/10.1006/viro.1998.9486.
50. Sun R, Lin SF, Gradoville L, Yuan Y, Zhu F, Miller G. 1998. A viral genethat activates lytic cycle expression of Kaposi’s sarcoma-associated herpes-virus. Proc Natl Acad Sci U S A 95:10866 –10871. http://dx.doi.org/10.1073/pnas.95.18.10866.
51. Glaunsinger B, Ganem D. 2004. Lytic KSHV infection inhibits host geneexpression by accelerating global mRNA turnover. Mol Cell 13:713–723.http://dx.doi.org/10.1016/S1097-2765(04)00091-7.
52. Zheng X, Guller S, Beissert T, Puccetti E, Ruthardt M. 2006. BCR andits mutants, the reciprocal t(9;22)-associated ABL/BCR fusion proteins,differentially regulate the cytoskeleton and cell motility. BMC Cancer6:262. http://dx.doi.org/10.1186/1471-2407-6-262.
53. Perona R, Montaner S, Saniger L, Sanchez-Perez I, Bravo R, Lacal JC.1997. Activation of the nuclear factor-kappaB by Rho, CDC42, and Rac-1proteins. Genes Dev 11:463– 475. http://dx.doi.org/10.1101/gad.11.4.463.
54. Lu W, Mayer BJ. 1999. Mechanism of activation of Pak1 kinase by mem-brane localization. Oncogene 18:797– 806. http://dx.doi.org/10.1038/sj.onc.1202361.
55. Ushio-Fukai M, Nakamura Y. 2008. Reactive oxygen species and angio-genesis: NADPH oxidase as target for cancer therapy. Cancer Lett 266:37–52. http://dx.doi.org/10.1016/j.canlet.2008.02.044.
56. Van Buul JD, Fernandez-Borja M, Anthony EC, Hordijk PL. 2005.Expression and localization of NOX2 and NOX4 in primary human en-dothelial cells. Antioxid Redox Signal 7:308 –317. http://dx.doi.org/10.1089/ars.2005.7.308.
57. He Z, Liu Y, Liang D, Wang Z, Robertson ES, Lan K. 2010. Cellularcorepressor TLE2 inhibits replication-and-transcription-activator-mediated transactivation and lytic reactivation of Kaposi’s sarcoma-associated herpesvirus. J Virol 84:2047–2062. http://dx.doi.org/10.1128/JVI.01984-09.
58. Kang H, Wiedmer A, Yuan Y, Robertson E, Lieberman PM. 2011.Coordination of KSHV latent and lytic gene control by CTCF-cohesinmediated chromosome conformation. PLoS Pathog 7:e1002140. http://dx.doi.org/10.1371/journal.ppat.1002140.
59. Yang Z, Wood C. 2007. The transcriptional repressor K-RBP modulates
Ramalingam et al.
4260 jvi.asm.org April 2015 Volume 89 Number 8Journal of Virology
on February 14, 2018 by guest
http://jvi.asm.org/
Dow
nloaded from
RTA-mediated transactivation and lytic replication of Kaposi’s sarcoma-associated herpesvirus. J Virol 81:6294 – 6306. http://dx.doi.org/10.1128/JVI.02648-06.
60. Lu F, Stedman W, Yousef M, Renne R, Lieberman PM. 2010.Epigenetic regulation of Kaposi’s sarcoma-associated herpesvirus la-tency by virus-encoded microRNAs that target Rta and the cellularRbl2-DNMT pathway. J Virol 84:2697–2706. http://dx.doi.org/10.1128/JVI.01997-09.
61. Wang L, Wakisaka N, Tomlinson CC, DeWire SM, Krall S, Pagano JS,
Damania B. 2004. The Kaposi’s sarcoma-associated herpesvirus (KSHV/HHV-8) K1 protein induces expression of angiogenic and invasion fac-tors. Cancer Res 64:2774 –2781. http://dx.doi.org/10.1158/0008-5472.CAN-03-3653.
62. Bais C, Santomasso B, Coso O, Arvanitakis L, Raaka EG, Gutkind JS,Asch AS, Cesarman E, Gershengorn MC, Mesri EA. 1998. G-protein-coupled receptor of Kaposi’s sarcoma-associated herpesvirus is a viral on-cogene and angiogenesis activator. Nature 391:86 – 89. http://dx.doi.org/10.1038/34193.
KSHV MicroRNA Targets Bcr
April 2015 Volume 89 Number 8 jvi.asm.org 4261Journal of Virology
on February 14, 2018 by guest
http://jvi.asm.org/
Dow
nloaded from
