![Page 1: Inhibition of miR-200c restores endothelial function in diabetic … · 2016. 1. 14. · Kong, Hong Kong, China. Tel: +852 3943 6787. E-mail: yu-huang@cuhk.edu.hk Total word count:](https://reader033.vdocuments.site/reader033/viewer/2022060821/6099e66c8e2d4726e7734079/html5/thumbnails/1.jpg)
1
Inhibition of miR-200c restores endothelial function in diabetic mice
through suppression of COX-2
Huina Zhang1,2,3,
*, Jian Liu1,
*, Dan Qu1, Li Wang
1, Jiang-Yun Luo
1, Chi Wai Lau
1, Pingsheng Liu
3,
Zhen Gao1, George L. Tipoe
4, Hung Kay Lee
5, Chi Fai Ng
6, Ronald Ching Wan Ma
7, Xiaoqiang
Yao1, Yu Huang
1
1Institute of Vascular Medicine, Shenzhen Research Institute, and Li Ka Shing Institute of Health
Sciences , Chinese University of Hong Kong, Hong Kong, China; 2Beijing Institute of Heart, Lung
and Blood Vessel Diseases, Beijing Anzhen Hospital Affiliated to the Capital Medical University,
Beijing, China; 3National Laboratory of Biomacromolecules, Institute of Biophysics, Chinese
Academy of Sciences, Beijing, China; 4Department of Anatomy, University of Hong Kong, Hong
Kong, China; 5Department of Chemistry,
6Department of Surgery and
7Department of Medicine and
Therapeutics, Chinese University of Hong Kong, Hong Kong, China;
*These authors contributed equally to this work.
Running title: MiR-200c/COX-2 in diabetic endothelial function
Correspondence to: Yu Huang, PhD, School of Biomedical Sciences, Chinese University of Hong
Kong, Hong Kong, China. Tel: +852 3943 6787. E-mail: [email protected]
Total word count: 3980
Number of figures: 6
Page 2 of 41Diabetes
Diabetes Publish Ahead of Print, published online January 28, 2016
![Page 2: Inhibition of miR-200c restores endothelial function in diabetic … · 2016. 1. 14. · Kong, Hong Kong, China. Tel: +852 3943 6787. E-mail: yu-huang@cuhk.edu.hk Total word count:](https://reader033.vdocuments.site/reader033/viewer/2022060821/6099e66c8e2d4726e7734079/html5/thumbnails/2.jpg)
2
Abstract
Endothelial dysfunction plays a crucial role in the development of diabetic vasculopathy. Our initial
qPCR results showed an increased miR-200c expression in arteries from diabetic mice and patients.
However, whether miR-200c is involved in diabetic endothelial dysfunction is unknown.
Overexpression of miR-200c impaired endothelium-dependent relaxations (EDRs) in non-diabetic
mouse aortas, while suppression of miR-200c by anti-miR-200c enhanced EDRs in diabetic db/db
mice. MiR-200c suppressed ZEB1 expression and ZEB1 overexpression ameliorated endothelial
dysfunction induced by miR-200c or associated with diabetes. More importantly, overexpression of
anti-miR-200c or ZEB1 in vivo attenuated miR-200c expression and improved EDRs in db/db mice.
Mechanistic study with the use of COX-2-/-
mice revealed that COX-2 mediated miR-200c-induced
endothelial dysfunction and miR-200c up-regulated COX-2 expression in endothelial cells via
suppression of ZEB1 and increased production of PGE2 which also reduced EDR. In conclusion, our
study demonstrates for the first time that miR-200c is a new mediator of diabetic endothelial
dysfunction and inhibition of miR-200c rescues EDRs in diabetic mice. These new findings suggest
the potential usefulness of miR-200c as the target for drug intervention against diabetic vascular
complications.
Page 3 of 41 Diabetes
![Page 3: Inhibition of miR-200c restores endothelial function in diabetic … · 2016. 1. 14. · Kong, Hong Kong, China. Tel: +852 3943 6787. E-mail: yu-huang@cuhk.edu.hk Total word count:](https://reader033.vdocuments.site/reader033/viewer/2022060821/6099e66c8e2d4726e7734079/html5/thumbnails/3.jpg)
3
Diabetes mellitus affects 9.5% of the adult population worldwide (1). Most of diabetic patients die of
cardiovascular complications, including coronary heart disease, stroke, and nephropathy (2; 3).
Endothelial dysfunction associated with reduced nitric oxide (NO) bioavailability is one of the
important initiators of vascular pathogenesis leading to the development of diabetic cardiovascular
events (4). Hyperglycemia decreases the bioavailability of endothelium-derived relaxing factors
(EDRFs) such as NO while it increases the production of endothelium-derived contracting factors
(EDCFs), contributing to endothelial dysfunction (5; 6). However, the molecular mechanisms for
hyperglycemia-mediated disrupted balance between EDRFs and EDCFs in the endothelium remain
largely unclear.
MicroRNAs (miRNAs) are the small noncoding RNAs that bind to sequence-specific mRNA
and consequently inhibit the translation (7). Growing evidence has pinpointed miRNAs as important
modulators of cardiovascular health and disease. For instance, miRNAs participate in vascular
inflammation (8), arterial remodeling (9), smooth muscle plasticity (10), atherosclerosis (11), and
endothelial cell apoptosis (12). Nevertheless, the role of miRNAs in the development of diabetic
endothelial dysfunction is sparsely studied.
The miR-200 family, comprised of miR-200c, -200a, -200b, -141, and -429, plays a role in the
development of diabetic complications. Down-regulation of miR-200b increased VEGF expression,
promoted angiogenesis and ameliorated diabetic retinopathy (13) while elevated miR-200b induced
inflammation by promoting the expression of cyclooxygenase-2 (COX-2) and monocyte chemotactic
protein 1 in vascular smooth muscle cells (14). In diabetic mouse glomeruli and renal mesangial cells,
increased miR-200 family (miR-200b and miR-200c) may promote the expression of fibrotic genes
in diabetic nephropathy (15). Our initial screening of miRNAs showed a marked increase of
miR-200c expression in db/db mouse aortas. However, the exact involvement of miR-200c in
diabetic endothelial dysfunction has never been investigated.
Page 4 of 41Diabetes
![Page 4: Inhibition of miR-200c restores endothelial function in diabetic … · 2016. 1. 14. · Kong, Hong Kong, China. Tel: +852 3943 6787. E-mail: yu-huang@cuhk.edu.hk Total word count:](https://reader033.vdocuments.site/reader033/viewer/2022060821/6099e66c8e2d4726e7734079/html5/thumbnails/4.jpg)
4
The present study therefore hypothesized that miRNA-200c plays a critical role in
diabetes–associated endothelial dysfunction and inhibition of miR-200c is effective as a novel
intervention against diabetic vasculopathy.
Page 5 of 41 Diabetes
![Page 5: Inhibition of miR-200c restores endothelial function in diabetic … · 2016. 1. 14. · Kong, Hong Kong, China. Tel: +852 3943 6787. E-mail: yu-huang@cuhk.edu.hk Total word count:](https://reader033.vdocuments.site/reader033/viewer/2022060821/6099e66c8e2d4726e7734079/html5/thumbnails/5.jpg)
5
RESEARCH DESIGNS AND METHODS
Animals
C57BL/6 mice, db/db and db/m+ mice were purchased from the Laboratory Animal Center of
Chinese University of Hong Kong (CUHK). COX-2-/-
mice were supplied by University of Hong
Kong. All animal experiments were approved by CUHK Animal Experimentation Ethics Committee
and in compliance with the Guide for the Care and Use of Laboratory Animals (NIH Publication
Eighth Edition, updated 2011).
Human renal artery specimens
All collection and treatment of human samples were conducted under the guideline established by
the Joint CUHK-New Territories East Cluster Clinical Research Ethics Committee. Human renal
arteries were obtained from nephrectomy patients (with poorly-functioning kidney, e.g.
hydronephrosis or renal calculus) with hyperglycemia (diabetes) or normal blood glucose
(non-diabetes) after obtaining their informed consent. The mean age of patients was 58 (range from
44-72).
Endothelial cell culture
Primary mouse endothelial cells (MAECs) were cultured as reported (16). The H5V mouse
endothelial cell line was purchased from American Type Culture Collection and cultured in
Dulbecco’s Modified Eagle’s Media (DMEM, Gibco, USA).
Organ culture of mouse arteries and functional assay
Mouse thoracic aortas were dissected in Krebs-Henseleit solution containing (in mM): 119 NaCl, 4.7
KCl, 2.5 CaCl2, 1 MgCl2, 25 NaHCO3, 1.2 KH2PO4, and 11 D-glucose) (17). Some aortas were
treated with high glucose or transduced with adenovirus-mediated miR-200c for 24 hours in DMEM
Page 6 of 41Diabetes
![Page 6: Inhibition of miR-200c restores endothelial function in diabetic … · 2016. 1. 14. · Kong, Hong Kong, China. Tel: +852 3943 6787. E-mail: yu-huang@cuhk.edu.hk Total word count:](https://reader033.vdocuments.site/reader033/viewer/2022060821/6099e66c8e2d4726e7734079/html5/thumbnails/6.jpg)
6
and then changes in isometric force were recorded in myograph (Danish Myo Technology, Aarhus,
Denmark). Acetylcholine (ACh) induce endothelium-dependent relaxations (EDRs) were examined.
All drugs and chemicals were purchased from Sigma-Aldrich (St Louis, MO, USA).
Flow-mediated dilatation in pressure myograph
Resistance mesenteric arteries were dissected in sterilized PBS solution and transduced with
indicated adenovirus for 24 hours. Flow-mediated dilatation (FMD) was recorded by Zeiss Axiovert
40 microscope, model 110P, with video camera monitored with the Myo-View software (Danish
Myo Technology) as described (18).
ROS detection by DHE fluorescence and electron paramagnetic resonance (EPR) spectroscopy
Aortic segments (2 mm in length) were incubated in 5 µM dihydroethidium (DHE, Molecular Probes,
Eugene, OR, USA), cut open and observed under FV1000 confocal microscope (Olympus, Tokyo,
Japan; excitation: 515 nm; emission: 585 nm). ROS released from MAECs was also measured by
EMX EPR spectrometer (Bruker, Germany) with 100 µM 1-hydroxy-2,2,6,6-tetramethyl
-4-oxo-piperidine hydrochloride (TEMPONE-H, Alexis) and 5,5-dimethyl-l-pyrroline-N-oxide
(DMPO, Alexis) as spin trap agents. HX-XO (100 µM hypoxanthine plus 0.01 units/ml xanthine
oxidase) was used as positive control.
Adenovirus construction and transduction
A fragment containing mature miR-200c flanked by 150 bp upstream and 150 bp downstream of
genomic sequence was amplified by PCR from mouse and human genomic DNA and cloned into
pAdTrack-U6 (which also contains a GFP cassette) (19; 20). Oligonucleotides against the mature
sequence of miR-200c gene: CCGGTCCATCATTACCCGGCAGTATTATTTTTC (forward) and
TCGAGAAAAATAATACTGCCGGGTAATGATGGA (reverse) were annealed and cloned into
Page 7 of 41 Diabetes
![Page 7: Inhibition of miR-200c restores endothelial function in diabetic … · 2016. 1. 14. · Kong, Hong Kong, China. Tel: +852 3943 6787. E-mail: yu-huang@cuhk.edu.hk Total word count:](https://reader033.vdocuments.site/reader033/viewer/2022060821/6099e66c8e2d4726e7734079/html5/thumbnails/7.jpg)
7
pAdTrack-U6 and named as anti-miR-200c. Mutant miR-200c sequence was modified from
TAATACTGCCGGGTAATGATGGA to ATAAAGTCCCGGGTAATGATGGA. The cDNA of
mouse ZEB1 was subcloned from pcDNA-ZEB1-HIS (a kind gift from Professor Gregory Goodall,
University of Adelaide, Australia) into pAdtrack-CMV. All vectors were constructed to adenoviral
plasmid through recombining with pAdeasy-1 in BJ5183 E. coli. After PacI (New England Biolabs,
MA, USA) digestion, adenoviral plasmids were transfected into HEK293 cells to generate infectious
adenovirus particles. pAdtrack-CMV-GFP (Ad-GFP) and pAdtrack-U6 (named as miR-Ctrl)
adenoviruses were used as control in corresponding experiments.
Protein preparation and Western blotting
Proteins prepared from MAECs or mouse aortas were dissolved in 5×SDS loading buffer, denatured
at 95°C for 5 minutes and then developed on SDS-PAGE and transferred to a PVDF membrane
(Millipore, Bedford, MA, USA) for Western blotting using antibodies detected by ECL system (GE
Healthcare, Pittsburgh, PA, USA). The primary antibodies used included Anti-COX-2 (1:1000,
Abcam, Cambridge, UK), Anti-GAPDH (1:5000, Ambion, Austin, TX, USA), and Anti-ZEB1
(1:1000, Santa Cruz, USA).
MiRNA analysis
MiRNAs from endothelial cells or aortas were extracted using mirVana™ miRNA Isolation Kit
(Ambion). MicroRNA screening was done using NCode™ SYBR® Green miRNA qRT-PCR Kit
(Invitrogen, USA) . Primers for mmu-miR-223: tgtcagtttgtcaaatacccca; mmu-miR-200c:
taatactgccgggtaatgatgga; mmu-miR-24: tggctcagttcagcaggaacag; mmu-miR-320:
aaaagctgggttgagagggcga; mmu-miR-503: tagcagcgggaacagtactgcag; mmu-miR-200b:
taatactgcctggtaatgatga; mmu-let-7b: tgaggtagtaggttgtgtggtt; mmu-miR-20b: caaagtgctcatagtgcaggtag;
mmu-miR-21: tagcttatcagac tgatgttga; mmu-miR-146a: tgagaactgaattccatgggtt; mmu-miR-221:
Page 8 of 41Diabetes
![Page 8: Inhibition of miR-200c restores endothelial function in diabetic … · 2016. 1. 14. · Kong, Hong Kong, China. Tel: +852 3943 6787. E-mail: yu-huang@cuhk.edu.hk Total word count:](https://reader033.vdocuments.site/reader033/viewer/2022060821/6099e66c8e2d4726e7734079/html5/thumbnails/8.jpg)
8
agctacattgtctgctgggtttc; mmu-miR-155: ttaatgctaattgtgataggggt; mmu-miR-23b:
atcacattgccagggattacc. MiR-200a, b and c expression were determined by Applied Biosystems
Taqman miRNA Assay (Life Technology, USA) in ABI ViiA7 system (Applied Biosystems) (21).
Primer identification catalog numbers were: 000502 for mmu-miR-200a-3p/ hsa-miR-200a-3p;
002251 for mmu-miR-200b-3p/hsa-miR-200b-3p; 000505 for mmu-miR-200c-3p /hsa-miR-200c-3p
and 001973 for snRU6.
RT-qPCR
Total RNA from MAECs or mouse aortas was extracted using Trizol reagent (Invitrogen). Reverse
transcription was carried out in 2 µg of total RNA using iScript cDNA Synthesis Kit (Bio-Rad, USA).
Complementary DNA was amplified using SYBR® Green Real-Time PCR Master Mixes (Life
Technology). GAPDH was used as endogenous control. Primers for mouse ZEB1 were: sense: 5'
CAAACACCACCTGAAAGAGCAC 3', antisense: 5' AAGAGATGGCGAGGAAC ACTG 3';
primers for mouse GAPDH were: 5' AGGTCGGTGTGAACGGATTTG 3', antisense: 5'
TGTAGACCATGTAGTTGAGGTCA 3'; primers for mouse Cbr1: sense: 5'
CGCAGGCATCGCCTTCAA 3', antisense: 5' CCTCTGTGATGGTCTCGCTT 3'; primers for
mouse Fam213b: sense: 5' GGAGCATCCTGGACCAACAC 3', antisense: 5'
GGCAGCTGGTAGGATGCTTA 3' ; primers for mouse Prostaglandin E2 (PGE2) synthase: sense: 5'
CATCAAGATGTACGCGGTGG 3', antisense: 5' CTCCACATCTGGGTCACTCC 3' ; primers for
mouse prostacyclin (PGI2) synthase: sense: 5' GGTGGCGGTGACTTGTTGC 3', antisense: 5'
TCCAACGGAGGCTCACCAG 3' ; primers for mouse thromboxane A2 (TXA2) synthase: sense:
5' ACCTACTTCTTTCTCCACCACCT 3', antisense: 5' TGATGCCCAACTTCTCCAGTC 3'.
Plasmids construction and luciferase reporter gene assay
Page 9 of 41 Diabetes
![Page 9: Inhibition of miR-200c restores endothelial function in diabetic … · 2016. 1. 14. · Kong, Hong Kong, China. Tel: +852 3943 6787. E-mail: yu-huang@cuhk.edu.hk Total word count:](https://reader033.vdocuments.site/reader033/viewer/2022060821/6099e66c8e2d4726e7734079/html5/thumbnails/9.jpg)
9
The plasmid (pcDNA-ZEB1-HIS) contains coding sequence for mouse ZEB1. The expression
plasmids (pcDNA-c-Fos, c-Jun, p65 and p50) of c-Fos, c-Jun (two units of AP-1), p65 and p50 (two
units of NF-κB) were kindly provided by Professor De-Pei Liu (Peking Union Medical College,
China). A 1, 301bp human COX-2 promoter fragment (-1, 267 to +34) was cloned into the
KpnI/HindIII site of pGL3-basic to construct pGL-COX-2. The purified luciferase plasmids were
transfected into H5V cells cultured in 24-well plate using the Lipofectamine 2000 (Invitrogen)
pRL-TK reporter (Promega, USA) was used as internal control. Luciferase activity was assessed
using the Dual-Luciferase Reporter Assay System (Promega).
Measurement of prostaglandins by high performance liquid chromatography-coupled mass
spectrometry (HPLC-MS)
Prostaglandin F2α (PGF2α), PGE2, 6-keto PGF1α (the stable product of PGI2), TXB2 (the stable
product of TXA2) were measured using HPLC-MS method (22). Briefly, after treatment with
miR-200c overexpressing virus for 24 hours, C57BL/6 mouse aortas were transferred to
Krebs-Henseleit solution and exposed to acetylcholine (3 µM) for 3 minutes. The levels of
prostaglandins in the aortas and the medium were measured by Agilent 1100 series HPLC (Agilent
Technologies, CA, USA) and Bruker Daltonics MicrOTOFQ mass spectrometer (Bremen,
Germany).
Oral glucose tolerance test and intra-peritoneal insulin tolerance test
Mice were fasted for 8-h and then loaded with glucose (1.2 g/kg body weight) orally. Blood glucose
was measured at times 0, 15, 30, 60, 90 and 120 min with a commercial glucometer (Ascensia
ELITE®, Bayer, Mishawaka, IN). For insulin tolerance test, mice were fasted for 2-h and then
injected with insulin at 0.75 U/kg body weight. Blood glucose was measured as mentioned earlier.
Page 10 of 41Diabetes
![Page 10: Inhibition of miR-200c restores endothelial function in diabetic … · 2016. 1. 14. · Kong, Hong Kong, China. Tel: +852 3943 6787. E-mail: yu-huang@cuhk.edu.hk Total word count:](https://reader033.vdocuments.site/reader033/viewer/2022060821/6099e66c8e2d4726e7734079/html5/thumbnails/10.jpg)
10
Statistical Analysis
Results represent means±SEM of n separate experiments. Concentration-response curves were
analyzed using GraphPad Prism software (Version 4.0). Statistical significance was determined by
Student’s t-test (two-tailed) or one-way ANOVA followed by the Bonferroni post hoc test when
more than two treatments were compared. P<0.05 indicates statistical difference between groups.
Page 11 of 41 Diabetes
![Page 11: Inhibition of miR-200c restores endothelial function in diabetic … · 2016. 1. 14. · Kong, Hong Kong, China. Tel: +852 3943 6787. E-mail: yu-huang@cuhk.edu.hk Total word count:](https://reader033.vdocuments.site/reader033/viewer/2022060821/6099e66c8e2d4726e7734079/html5/thumbnails/11.jpg)
11
RESULTS
MiR-200c expression is elevated in arteries from diabetic mice and patients and in high
glucose-treated mouse aortic endothelial cells
We first performed qPCR to detect the relative expression of a number of miRNAs which were
reportedly present in endothelial cells, and found that miR-200c level was markedly higher in aortas
of diabetic db/db mice as compared to non-diabetic mice (Online Figure IA). Furthermore, the
TaqMan probe-based qPCR analysis showed that miR-200c was the most abundant isoform among
the miR-200 family members, over 100-fold more than miR-200a and miR-200b in non-diabetic
db/m+ mouse aortas (Figure 1A) and about 30-fold more than miR-200a and miR-200b in renal
arteries of non-diabetic subjects (Figure 1B). We thus selected miR-200c as the target molecule for
subsequent studies. The expression of miR-200c in db/db mouse aortas and in renal arteries from
diabetic patients was ∼2-fold greater than that of respective arteries from non-diabetic mice (Figure
1C) or human (Figure 1D). The miR-200c expression was also elevated in high glucose (HG, 30 mM,
24 hours)-treated primary mouse aortic endothelial cells (MAECs) and this effect was reversed by
co-treatment with ROS scavenger tempol (100 µM) (Figure 1E). Furthermore, 24-hour treatment
with 100 µM hypoxanthine plus 0.01 units/ml xanthine oxidase (HX-XO to release ROS) augmented
miR-200c expression in MAECs, which was abolished by tempol (Figure 1F). However, miR-200c
overexpression by adenoviral (ad-miR-200c) transduction did not affect ROS production in MAECs,
as detected by electron paramagnetic resonance spectroscopy (Figure 1G & Online Figure IB), and in
the endothelium of db/m+ mouse aortas, as indicated by en face dihydroethidium staining (Figure 1H
& Online Figure IC). These results indicate that hyperglycemia up-regulates miR-200c expression
most likely through ROS elevation.
MiR-200c overexpression impairs endothelium-dependent relaxations in db/m+ mouse aortas
and inhibition of miR-200c restores endothelial function in diabetic mice
Page 12 of 41Diabetes
![Page 12: Inhibition of miR-200c restores endothelial function in diabetic … · 2016. 1. 14. · Kong, Hong Kong, China. Tel: +852 3943 6787. E-mail: yu-huang@cuhk.edu.hk Total word count:](https://reader033.vdocuments.site/reader033/viewer/2022060821/6099e66c8e2d4726e7734079/html5/thumbnails/12.jpg)
12
Ex vivo transduction of ad-miR-200c markedly impaired acetylcholine-induced
endothelium-dependent relaxations (EDRs) and increased the miR-200c level in db/m+ mouse aortas
while miR-Ctrl overexpressing virus (ad-miR-Ctrl) and mut-miR-200c overexpressing virus
(ad-mut-miR-200c) had no effect (Figure 2A&B, Online Figure IIA&B). By contrast,
endothelium-independent relaxations to SNP were unaffected by ad-miR-200c (Online Figure IIC),
suggesting that miR-200c-reduced EDRs was likely caused by dysfunction of endothelial cells but
not vascular smooth muscle cells. Notably, miR-200c overexpression also attenuated EDRs in human
renal arteries (Figure 2C). Co-treatment with ad-anti-miR-200c reversed miR-200c-induced
impairment of EDRs in both mouse aortas (Figure 2A) and human renal arteries (Figure 2C).
To explore the pathological role of elevated miR-200c in diabetic endothelial dysfunction, db/db
mouse aortas were cultured and transfected with ad-anti-miR-200c for 24 hours. Ad-anti-miR-200c
dramatically reduced miR-200c expression (Online Figure IIIA) and improved EDRs (Figure 2D &
2E) in db/db mouse aortas in a dose-dependent manner. Inhibition of miR-200c by anti-miR-200c
also improved flow-mediated dilatation of second-order mesenteric resistance arteries (Figure 2F &
Online Figure IIIB). In addition, 24-hour incubation with ad-anti-miR-200c protected against high
glucose (HG, 30 mM, 48 hours)-induced attenuation of EDRs in db/m+ mouse aortas (Figure 2G).
These results clearly suggest that miR-200c elevation is most likely to mediate endothelial
dysfunction in diabetic mice.
MiR-200c reduces ZEB1 expression while ZEB1 overexpression inhibits miR-200c-induced
endothelial dysfunction in db/m+ mice
Transduction (24 hours) with ad-miR-200c suppressed the expression of ZEB1 at mRNA and protein
levels in MAECs and both effects were reversed by ad-anti-miR-200c (Figure 3A&B), thus
suggesting the involvement of ZEB1 inhibition in miR-200c-mediated endothelial dysfunction.
Page 13 of 41 Diabetes
![Page 13: Inhibition of miR-200c restores endothelial function in diabetic … · 2016. 1. 14. · Kong, Hong Kong, China. Tel: +852 3943 6787. E-mail: yu-huang@cuhk.edu.hk Total word count:](https://reader033.vdocuments.site/reader033/viewer/2022060821/6099e66c8e2d4726e7734079/html5/thumbnails/13.jpg)
13
Indeed, transduction with a ZEB1-overexpressing virus (ad-ZEB1, 24 hours) (Figure 3C) abolished
ad-miR-200c-induced impairment of EDRs in db/m+ mouse aortas (Figure 3D).
ZEB1 is reduced in db/db mouse aortas and ZEB1 overexpression improves endothelial
function in db/db mouse arteries
ZEB1 expression was significantly decreased both in db/db mouse aortas (Figure 4A) and in renal
arteries from diabetic patients (Figure 4B) compared to that in the respective non-diabetic controls.
Inhibition of miR-200c by anti-miR-200c increased ZEB1 expression in db/db mouse aortas (Figure
4C). Likewise, ad-anti-miR-200c also prevented HG (30 mM, 24 hours)-induced ZEB1
down-regulation in MAECs (Figure 4D). These results indicate that decreased ZEB1 expression due
to miR-200c up-regulation may account for diabetic endothelial dysfunction. Indeed, overexpression
of ZEB1 by transduction with adenovirus (ad-ZEB1) (Online Figure IVA) reversed endothelial
dysfunction in db/db mouse aortas and mesenteric arteries (Figure 4E&F, Online Figure IVB &
Online Figure IVC). In consistence with previous report in other tissues (23), overexpression of
ZEB1 dose-dependently inhibited miR-200c expression in db/db mouse aortas and in MAECs
(Figure 4G &H).
In vivo inhibition of miR-200c by ad-anti-miR-200c and ad-ZEB1 improves EDR in db/db mice
To further confirm the significant role of miR-200c elevation in the maintenance of diabetic
endothelial dysfunction, ad-anti-miR-200c or ad-miR-Ctrl was administered into db/db mice through
tail intravenous injection (107
pfu). After one-week treatment, EDRs in ad-anti-miR-200c-treated
mice were markedly augmented in aortas, accompanied by reduced miR-200c expression but
elevated ZEB1 expression (Figure 5A-C). Similarly, in vivo transduction of ad-ZEB1 in db/db mice
also improved EDRs, increased ZEB1 expression, and decreased miR-200c expression (Figure
5D-F).
Page 14 of 41Diabetes
![Page 14: Inhibition of miR-200c restores endothelial function in diabetic … · 2016. 1. 14. · Kong, Hong Kong, China. Tel: +852 3943 6787. E-mail: yu-huang@cuhk.edu.hk Total word count:](https://reader033.vdocuments.site/reader033/viewer/2022060821/6099e66c8e2d4726e7734079/html5/thumbnails/14.jpg)
14
COX-2-dependent production of PGE2 may participate in miR-200c-induced endothelial
dysfunction and miR-200c up-regulates COX-2 expression by inhibition of ZEB1
We and others demonstrated before that COX-2 is an important mediator of endothelial dysfunction
(24-26) and ZEB1 is reported to suppress COX-2 expression (14). We next tested the hypothesis that
COX-2 contributes to miR-200c-induced endothelial dysfunction based on our observation that
miR-200c suppressed ZEB1 expression in endothelial cells. As expected, miR-200c failed to
attenuate EDRs in aortas of COX-2-/-
mice (Figure 6A, Online Figure VA). In support of the
functional results, miR-200c elevated COX-2 protein expression in MAECs (Figure 6B), which was
reversed by overexpression of ZEB1 or anti-miR-200c (Figure 6B&C). However, COX-1 protein
expression was not changed by miR-200c (Figure 6B&C). Moreover, the luciferase reporter gene
assay demonstrated that miR-200c increased promoter activity of COX-2, which was inhibited by
overexpression of ZEB1 but not by overexpression of c-Fos/c-Jun (AP-1) or p65/p50 (NF-κB)
(Figure 6D), suggesting that ZEB1 directly inhibits miR-200c-stimulated COX-2 up-regulation at the
transcriptional level in mouse endothelial cells. In vitro evidence also showed that ZEB1
overexpression down-regulated COX-2 expression in db/db mouse aortas (Figure 6E). Further
experiments showed that miR-200c (24 hours) did not change the mRNA levels of PGF2α synthases
(Cbr1 and Fam213b), PGE2 synthase, PGI2 synthase, and TXA2 synthase (Online Figure VB), but it
increased PGE2 level by ~5 folds in the medium (3-4 ng/ml vs 15-20 ng/ml) and by ~2 folds in the
aortas (0.15-0.2 ng/mg vs 0.4-0.5ng/mg aorta). PGI2 (assayed in form of 6-keto PGF1α) level was also
increased by ~2 folds in the medium (10-13 ng/ml vs 17-25 ng/ml), but not in the aortas (Online
Figure VC&D). We next tested whether these two elevated PGs affected EDRs in mouse aortas.
PGE2 at a concentration of 100 nmol/L (35.2 ng/ml, ~2-fold of the level in the medium) attenuated
ACh-induced relaxation (Online Figure VE). However, 100 nmol/L of PGI2 (37.4 ng/ml, ~2-fold of
the level in the medium) had no effect, indicating that PGE2 is likely involved in miR-200c-induced
endothelial dysfunction in mouse aortas.
Page 15 of 41 Diabetes
![Page 15: Inhibition of miR-200c restores endothelial function in diabetic … · 2016. 1. 14. · Kong, Hong Kong, China. Tel: +852 3943 6787. E-mail: yu-huang@cuhk.edu.hk Total word count:](https://reader033.vdocuments.site/reader033/viewer/2022060821/6099e66c8e2d4726e7734079/html5/thumbnails/15.jpg)
15
DISCUSSION
The key findings of the present study include (i) miR-200c expression is elevated in arteries from
diabetic mice and patients, and hyperglycemia stimulates miR-200c expression via a ROS-dependent
mechanism; (ii) miR-200c overexpression impairs EDRs in non-diabetic mouse aortas and
suppression of miR-200c by ad-anti-miR-200c improved EDRs in db/db mouse aortas and
flow-mediated dilatation of resistance mesenteric arteries; (iii) miR-200c suppresses ZEB-1, leading
to COX-2 up-regulation which in turn impairs endothelial function in diabetic mice; and (iv) ZEB-1
overexpression restores endothelial function in both conduit and resistance arteries in diabetes. The
present results highlight the prospect of miR-200c-ZEB1-COX-2 axis as potential novel therapeutic
targets to restore endothelial function in diabetes (Figure 6F).
Approximately 2000 miRNAs have so far been identified in human, which are believed to
control the expression of at least 30% of genes and participate in nearly every aspect of biological
processes, including cell proliferation, differentiation, apoptosis, and development (27). Most studies
of miRNAs have mainly focused on their roles in the development and cancer growth. However, it is
only known to a much lesser degree concerning the involvement of miRNAs in the development of
diabetes and its vascular complications. Our initial screening shows a markedly elevated expression
of miR-200c in db/db mouse aortas. Nevertheless, the pathological significance of miR-200c
up-regulation in diabetic vasculopathy is basically unexplored.
ROS is critically involved in hyperglycemia-induced endothelial dysfunction as elimination of
ROS by tempol improves endothelial function in db/db mouse aortas (28). The present study shows
that high glucose is able to up-regulate miR-200c expression, which is mediated by oxidative stress
because high glucose-stimulated miR-200c up-regulation in MAECs is reversed by tempol.
Furthermore, HX-XO, a ROS generator, also increases miR-200c expression. Likewise, a recent
study shows that H2O2 raises miR-200c expression in human endothelial cells (29). By contrast,
miR-200c overexpression does not affect ROS production in endothelial cells as reflected by both in
Page 16 of 41Diabetes
![Page 16: Inhibition of miR-200c restores endothelial function in diabetic … · 2016. 1. 14. · Kong, Hong Kong, China. Tel: +852 3943 6787. E-mail: yu-huang@cuhk.edu.hk Total word count:](https://reader033.vdocuments.site/reader033/viewer/2022060821/6099e66c8e2d4726e7734079/html5/thumbnails/16.jpg)
16
situ DHE staining and ERP spectroscopy. These results suggest that hyperglycemia-associated
oxidative stress is most likely to account for miR-200c up-regulation in endothelial cells under
diabetic conditions. These initial observations drove us to elucidate the pathophysiological role of
miR-200c in diabetic endothelial dysfunction, aided by the use of viral constructs in a series of in
vitro, ex vivo and in vivo studies. We first demonstrate that overexpression of miR-200c impairs
endothelial function in aortas from non-diabetic mice and such impairment can be reversed by
inhibition of miR-200c in both conduit and resistance arteries in db/db mice. Taken together, we
establish that elevated expression of miR-200c in diabetic conditions is likely a key mediator of
diabetic endothelial dysfunction.
We next studied the detailed molecular mechanisms underlying miR-200c-induced endothelial
dysfunction. ZEB1 is a zinc finger transcriptional repressor and expressed in various types of cells.
MiR-200 family is known to inhibit epithelial to mesenchymal transition (ETM) during cancer
development by repression of ZEB1 (30-32). One previous study showed that miR-200c suppresses
ZEB1 expression and subsequently leads to endothelial cell senescence and apoptosis (29). We also
found that miR-200c inhibits ZEB1 expression in non-diabetic mouse aortas while overexpression of
ZEB1 attenuates miR-200c-induced impairment of endothelial function in these aortas, indicating
that ZEB1 down-regulation is likely involved in miR-200c-induced endothelial dysfunction in
normal mice. However, it is unknown whether ZEB1 also plays a significant role in diabetes-related
endothelial dysfunction. The present study shows that ZEB1 expression is decreased in db/db mouse
aortas and suppression of miR-200c restores the diminished ZEB1 expression. More importantly,
transduction of ZEB1 overexpressing adenovirus profoundly improves endothelial function in db/db
mice without affecting insulin sensitivity (Online Figure VI), and this effect is almost identical to
that of miR-200c inhibition. It is therefore probable that hyperglycemia in diabetes up-regulates
miR-200c expression which subsequently down-regulates ZEB1 expression, leading to impaired
endothelial function. This notion is clearly supported by the observation that ZEB1 overexpression is
Page 17 of 41 Diabetes
![Page 17: Inhibition of miR-200c restores endothelial function in diabetic … · 2016. 1. 14. · Kong, Hong Kong, China. Tel: +852 3943 6787. E-mail: yu-huang@cuhk.edu.hk Total word count:](https://reader033.vdocuments.site/reader033/viewer/2022060821/6099e66c8e2d4726e7734079/html5/thumbnails/17.jpg)
17
accompanied simultaneously with miR-200c down-regulation in aortas from not only non-diabetic
mice but also diabetic db/db mice. Previous studies on epithelial cells showed that miR-200 and ZEB
are mutually negative regulators of their expression and control the typical EMT-associated
properties in cancer development (23). Here, we also demonstrate that this reciprocal negative
regulatory circuit plays an important role in the maintenance of diabetic endothelial dysfunction.
Previous studies revealed that the up-regulated COX-2 expression and activity is a crucial
contributor to diabetes- or hyperglycemia-associated endothelial dysfunction (33; 34). However, the
exact molecular mechanism mediating hyperglycemia-stimulated COX-2 up-regulation remains
largely unclear. Few earlier studies suggested that the PI3K/Akt signaling and transcriptional factors
NF-κB and CREB are involved (35; 36). Here, we report that miR-200c stimulation elevates COX-2
expression in non-diabetic mouse aortas, which is reversed by anti-miR-200c or ZEB1
overexpression. In addition, ZEB1 overexpression down-regulates COX-2 expression in db/db
mouse aortas. These results suggest that the miR-200c/ZEB1 negative feedback loop mediates a
substantial part of hyperglycemia-stimulated COX-2 up-regulation in endothelial cells under diabetic
conditions. The essential role of COX-2 in miR-200c-induced endothelial dysfunction is finally
confirmed by the inability of miR-200c to attenuate EDRs in aortas from COX-2-/-
mice. The present
study showed that miR 200c-induced COX-2 up-regulation resulted in a 5-fold increase of PGE2 in
the medium and a 2-fold increase in mouse aortas. PGI2 (assayed in form of 6-keto PGF1α) was also
increased by 2 folds only in the medium. PGE2 induces vasoconstriction by binding to PGE2 receptor
1 and 3 (37; 38). PGI2 was also reported to induce contraction in aortas of spontaneously
hypertensive rats and aged Wistar-Kyoto rats probably by interacting with thromboxane A2 receptors
(39). Therefore, either PGE2 or PGI2 are possible candidates to mediate miR-200c-induced
endothelial dysfunction. Further experiments showed that pretreatment with PGE2 but not PGI2 can
actually attenuate ACh-induced relaxations in C57BL/6 mouse aortas, thus suggesting that PGE2 is
likely to contribute to COX-2 up-regulation-associated endothelial dysfunction in mice.
Page 18 of 41Diabetes
![Page 18: Inhibition of miR-200c restores endothelial function in diabetic … · 2016. 1. 14. · Kong, Hong Kong, China. Tel: +852 3943 6787. E-mail: yu-huang@cuhk.edu.hk Total word count:](https://reader033.vdocuments.site/reader033/viewer/2022060821/6099e66c8e2d4726e7734079/html5/thumbnails/18.jpg)
18
The clinical use of several COX-2 inhibitors was found to increase thrombotic cardiovascular
events (40; 41). This adverse effect is likely related to the disrupted prothrombotic/antithrombotic
balance. Human platelets contain only COX-1 and the major prostaglandin is the potent
pro-aggregatory and vasoconstrictive thromboxane A2 (TXA2) (42), while endothelial cells normally
express COX-2 and the major COX-2-derived arachidonic acid product is prostacyclin (PGI2) in
endothelial cells (43; 44). PGI2 can interact with platelet IP receptor to inhibit platelet aggregation.
However, selective inhibition of COX-2 reduces the production of PGI2 in endothelial cells, while
leaving platelet production of TXA2 intact, tilting the prothrombotic/antithrombotic balance toward
thrombosis (40; 41), which is probably the main cause of cardiovascular events associated with the
use of COX-2 inhibitors in some patients. On the other hand, our experimental results show that
COX-2 up-regulation leads to elevated production of PGE2, the latter can reduce EDR, suggesting
that type(s) of prostaglandins derived from COX-2 upregulation induced in different situations may
determine its impact (harmful or beneficial) on vascular function.
It is very important to note that like diabetic mouse arteries, renal arteries from diabetic patients
also exhibit an increased miR-200c expression and decreased ZEB1 expression. Moreover,
overexpression of miR-200c impairs endothelial function in renal arteries from non-diabetic subjects,
which is again reversed by co-treatment with ad-anti-miR-200c. Although the renal vascular
reactivity can be influenced by the varied disease backgrounds of diabetic patients from whom the
arteries were obtained, the present study provides useful evidence for the first time that abnormal
miR-200c/ZEB-1 expression may involve endothelial dysfunction in diabetic patients.
In conclusion, we demonstrate the up-regulated miR-200c in arteries from both diabetic mice and
patients. Inhibition of miR-200c by anti-miR-200c and ZEB1 overexpression effectively restore the
impaired endothelial function in both conduit and resistance arteries of diabetic mice through
inhibiting the expression and activity of COX-2, an important mediator of vascular dysfunction
probably through elevating prostaglandins such as PGE2. The present study not only deepens our
Page 19 of 41 Diabetes
![Page 19: Inhibition of miR-200c restores endothelial function in diabetic … · 2016. 1. 14. · Kong, Hong Kong, China. Tel: +852 3943 6787. E-mail: yu-huang@cuhk.edu.hk Total word count:](https://reader033.vdocuments.site/reader033/viewer/2022060821/6099e66c8e2d4726e7734079/html5/thumbnails/19.jpg)
19
understanding about the role of miRNAs in vascular pathophysiology associated with diabetes but
also adds candidates to the existing list of recently described therapeutic “anti-miRs” if their safety is
to be approved. Taken together, miR-200c could serve as a promising target for ameliorating diabetic
vasculopathy.
Acknowledgments
We thank Professor Gregory Goodall (University of Adelaide, Australia) and Professor De-Pei Liu
(Peking Union Medical College, China) for kindly providing us the plasmids. This study was
supported by Research Grants Council of Hong Kong (CUHK2/CRF/12G, T12-402/13N), National
Natural Science Foundation of China (81270932, 81471082 and 91339117), Beijing Natural Science
Foundation (5122028), Hong Kong Scholarship Program, and CUHK High Promise Initiatives.
Author Contributions
H.Z., J.L., D.Q., L.W., and J.L. conducted the experiments and analyzed the data. H.Z., J.L. and Y.H.
designed the experiments and prepared the manuscript. C.W.L. and Z.G. helped with functional
studies; P.L. provided plasmids; G.L.T. provided knockout mice; H.K.L. performed bioassays; C.F.N.
provided human samples; X.Y. and R.C.W.M. assisted with discussion. Y.H. is the guarantor of this
work and, as such, had full access to all the data in the study and takes responsibility for the integrity
of the data and the accuracy of the data analysis.
Conflict of Interest
No.
Page 20 of 41Diabetes
![Page 20: Inhibition of miR-200c restores endothelial function in diabetic … · 2016. 1. 14. · Kong, Hong Kong, China. Tel: +852 3943 6787. E-mail: yu-huang@cuhk.edu.hk Total word count:](https://reader033.vdocuments.site/reader033/viewer/2022060821/6099e66c8e2d4726e7734079/html5/thumbnails/20.jpg)
20
References
1. Danaei G, Finucane MM, Lu Y, Singh GM, Cowan MJ, Paciorek CJ, Lin JK, Farzadfar F, Khang
YH, Stevens GA, Rao M, Ali MK, Riley LM, Robinson CA, Ezzati M, Global Burden of Metabolic
Risk Factors of Chronic Diseases Collaborating G: National, regional, and global trends in fasting
plasma glucose and diabetes prevalence since 1980: systematic analysis of health examination
surveys and epidemiological studies with 370 country-years and 2.7 million participants. Lancet
2011;378:31-40
2. King H, Aubert RE, Herman WH: Global burden of diabetes, 1995-2025 - Prevalence, numerical
estimates, and projections. Diabetes Care 1998;21:1414-1431
3. Grundy SM, Benjamin IJ, Burke GL, Chait A, Eckel RH, Howard BV, Mitch W, Smith SC, Jr.,
Sowers JR: Diabetes and cardiovascular disease: a statement for healthcare professionals from the
American Heart Association. Circulation 1999;100:1134-1146
4. Spinetti G, Kraenkel N, Emanueli C, Madeddu P: Diabetes and vessel wall remodelling: from
mechanistic insights to regenerative therapies. Cardiovasc Res 2008;78:265-273
5. Tesfamariam B, Brown ML, Cohen RA: Elevated Glucose Impairs Endothelium-Dependent
Relaxation by Activating Protein-Kinase-C. J Clin Invest 1991;87:1643-1648
6. Williams SB, Goldfine AB, Timimi FK, Ting HH, Roddy MA, Simonson DC, Creager MA: Acute
hyperglycemia attenuates endothelium-dependent vasodilation in humans in vivo. Circulation
1998;97:1695-1701
7. Bushati N, Cohen SM: MicroRNA functions. Annu Rev Cell Dev Bi 2007;23:175-205
8. Urbich C, Kuehbacher A, Dimmeler S: Role of microRNAs in vascular diseases, inflammation,
and angiogenesis. Cardiovasc Res 2008;79:581-588
9. Ji RR, Cheng YH, Yue JM, Yang J, Liu XJ, Chen H, Dean DB, Zhang CX: MicroRNA expression
signature and antisense-mediated depletion reveal an essential role of microRNA in vascular
neointimal lesion formation. Circ Res 2007;100:1579-1588
Page 21 of 41 Diabetes
![Page 21: Inhibition of miR-200c restores endothelial function in diabetic … · 2016. 1. 14. · Kong, Hong Kong, China. Tel: +852 3943 6787. E-mail: yu-huang@cuhk.edu.hk Total word count:](https://reader033.vdocuments.site/reader033/viewer/2022060821/6099e66c8e2d4726e7734079/html5/thumbnails/21.jpg)
21
10. Leeper NJ, Raiesdana A, Kojima Y, Chun HJ, Azuma J, Maegdefessel L, Kundu RK,
Quertermous T, Tsao PS, Spin JM: MicroRNA-26a Is a Novel Regulator of Vascular Smooth Muscle
Cell Function. J Cell Physiol 2011;226:1035-1043
11. Fang Y, Shi CZ, Manduchi E, Civelek M, Davies PF: MicroRNA-10a regulation of
proinflammatory phenotype in athero-susceptible endothelium in vivo and in vitro. P Natl Acad Sci
USA 2010;107:13450-13455
12. Zhang Y, Qin W, Zhang L, Wu X, Du N, Hu Y, Li X, Shen N, Xiao D, Zhang H, Li Z, Zhang Y,
Yang H, Gao F, Du Z, Xu C, Yang B: MicroRNA-26a prevents endothelial cell apoptosis by directly
targeting TRPC6 in the setting of atherosclerosis. Scientific reports 2015;5:9401
13. McArthur K, Feng B, Wu Y, Chen S, Chakrabarti S: MicroRNA-200b regulates vascular
endothelial growth factor-mediated alterations in diabetic retinopathy. Diabetes 2011;60:1314-1323
14. Reddy MA, Jin W, Villeneuve L, Wang M, Lanting L, Todorov I, Kato M, Natarajan R:
Pro-inflammatory role of microrna-200 in vascular smooth muscle cells from diabetic mice.
Arterioscl Throm Vas 2012;32:721-729
15. Kato M, Arce L, Wang M, Putta S, Lanting L, Natarajan R: A microRNA circuit mediates
transforming growth factor-beta 1 autoregulation in renal glomerular mesangial cells. Kidney Int
2011;80:358-368
16. Wong WT, Tian XY, Xu A, Yu J, Lau CW, Hoo RL, Wang Y, Lee VW, Lam KS, Vanhoutte PM,
Huang Y: Adiponectin is required for PPARgamma-mediated improvement of endothelial function
in diabetic mice. Cell metabolism 2011;14:104-115
17. Tian XY, Wong WT, Xu A, Lu Y, Zhang Y, Wang L, Cheang WS, Wang Y, Yao X, Huang Y:
Uncoupling protein-2 protects endothelial function in diet-induced obese mice. Circ Res
2012;110:1211-1216
18. Chan YC, Leung FP, Wong WT, Tian XY, Yung LM, Lau CW, Tsang SY, Yao X, Chen ZY,
Huang Y: Therapeutically relevant concentrations of raloxifene dilate pressurized rat resistance
Page 22 of 41Diabetes
![Page 22: Inhibition of miR-200c restores endothelial function in diabetic … · 2016. 1. 14. · Kong, Hong Kong, China. Tel: +852 3943 6787. E-mail: yu-huang@cuhk.edu.hk Total word count:](https://reader033.vdocuments.site/reader033/viewer/2022060821/6099e66c8e2d4726e7734079/html5/thumbnails/22.jpg)
22
arteries via calcium-dependent endothelial nitric oxide synthase activation. Arterioscl Throm Vas
2010;30:992-999
19. Luo J, Deng ZL, Luo X, Tang N, Song WX, Chen J, Sharff KA, Luu HH, Haydon RC, Kinzler
KW, Vogelstein B, He TC: A protocol for rapid generation of recombinant adenoviruses using the
AdEasy system. Nat Protoc 2007;2:1236-1247
20. Marquart TJ, Allen RM, Ory DS, Baldan A: miR-33 links SREBP-2 induction to repression of
sterol transporters. P Natl Acad Sci USA 2010;107:12228-12232
21. Urbich C, Kuehbacher A, Dimmeler S: Role of microRNAs in vascular diseases, inflammation,
and angiogenesis. Cardiovasc Res 2008;79:581-588
22. Wong SL, Leung FP, Lau CW, Au CL, Yung LM, Yao X, Chen ZY, Vanhoutte PM, Gollasch M,
Huang Y: Cyclooxygenase-2-derived prostaglandin F2alpha mediates endothelium-dependent
contractions in the aortae of hamsters with increased impact during aging. Circ Res
2009;104:228-235
23. Burk U, Schubert J, Wellner U, Schmalhofer O, Vincan E, Spaderna S, Brabletz T: A reciprocal
repression between ZEB1 and members of the miR-200 family promotes EMT and invasion in
cancer cells. Embo Rep 2008;9:582-589
24. Bagi Z, Erdei N, Toth A, Li W, Hintze TH, Koller A, Kaley G: Type 2 diabetic mice have
increased arteriolar tone and blood pressure: enhanced release of COX-2-derived constrictor
prostaglandins. Arterioscl Throm Vas 2005;25:1610-1616
25. Tian XY, Wong WT, Leung FP, Zhang Y, Wang YX, Lee HK, Ng CF, Chen ZY, Yao X, Au CL,
Lau CW, Vanhoutte PM, Cooke JP, Huang Y: Oxidative stress-dependent cyclooxygenase-2-derived
prostaglandin f(2alpha) impairs endothelial function in renovascular hypertensive rats. Antioxid
Redox Signal 2012;16:363-373
26. Wong WT, Tian XY, Chen Y, Leung FP, Liu L, Lee HK, Ng CF, Xu A, Yao X, Vanhoutte PM,
Tipoe GL, Huang Y: Bone morphogenic protein-4 impairs endothelial function through oxidative
Page 23 of 41 Diabetes
![Page 23: Inhibition of miR-200c restores endothelial function in diabetic … · 2016. 1. 14. · Kong, Hong Kong, China. Tel: +852 3943 6787. E-mail: yu-huang@cuhk.edu.hk Total word count:](https://reader033.vdocuments.site/reader033/viewer/2022060821/6099e66c8e2d4726e7734079/html5/thumbnails/23.jpg)
23
stress-dependent cyclooxygenase-2 upregulation: implications on hypertension. Circ Res
2010;107:984-991
27. Lewis BP, Burge CB, Bartel DP: Conserved seed pairing, often flanked by adenosines, indicates
that thousands of human genes are microRNA targets. Cell 2005;120:15-20
28. Lau YS, Tian XY, Mustafa MR, Murugan D, Liu J, Zhang Y, Lau CW, Huang Y: Boldine
improves endothelial function in diabetic db/db mice through inhibition of angiotensin II-mediated
BMP4-oxidative stress cascade. Br J Pharmacol 2013;170:1190-1198
29. Magenta A, Cencioni C, Fasanaro P, Zaccagnini G, Greco S, Sarra-Ferraris G, Antonini A,
Martelli F, Capogrossi MC: miR-200c is upregulated by oxidative stress and induces endothelial cell
apoptosis and senescence via ZEB1 inhibition. Cell Death Differ 2011;18:1628-1639
30. Wellner U, Schubert J, Burk UC, Schmalhofer O, Zhu F, Sonntag A, Waldvogel B, Vannier C,
Darling D, zur Hausen A, Brunton VG, Morton J, Sansom O, Schuler J, Stemmler MP, Herzberger C,
Hopt U, Keck T, Brabletz S, Brabletz T: The EMT-activator ZEB1 promotes tumorigenicity by
repressing stemness-inhibiting microRNAs. Nat Cell Biol 2009;11:1487-1495
31. Schliekelman MJ, Gibbons DL, Faca VM, Creighton CJ, Rizvi ZH, Zhang Q, Wong CH, Wang
H, Ungewiss C, Ahn YH, Shin DH, Kurie JM, Hanash SM: Targets of the Tumor Suppressor
miR-200 in Regulation of the Epithelial-Mesenchymal Transition in Cancer. Cancer Res
2011;71:7670-7682
32. Bracken CP, Gregory PA, Kolesnikoff N, Bert AG, Wang J, Shannon MF, Goodall GJ: A
double-negative feedback loop between ZEB1-SIP1 and the microRNA-200 family regulates
epithelial-mesenchymal transition. Cancer Res 2008;68:7846-7854
33. Pannirselvam M, Wiehler WB, Anderson T, Triggle CR: Enhanced vascular reactivity of small
mesenteric arteries from diabetic mice is associated with enhanced oxidative stress and
cyclooxygenase products. Br J Pharmacol 2005;144:953-960
Page 24 of 41Diabetes
![Page 24: Inhibition of miR-200c restores endothelial function in diabetic … · 2016. 1. 14. · Kong, Hong Kong, China. Tel: +852 3943 6787. E-mail: yu-huang@cuhk.edu.hk Total word count:](https://reader033.vdocuments.site/reader033/viewer/2022060821/6099e66c8e2d4726e7734079/html5/thumbnails/24.jpg)
24
34. Cosentino F, Eto M, De Paolis P, van der Loo B, Bachschmid M, Ullrich V, Kouroedov A, Delli
Gatti C, Joch H, Volpe M, Luscher TF: High glucose causes upregulation of cyclooxygenase-2 and
alters prostanoid profile in human endothelial cells: role of protein kinase C and reactive oxygen
species. Circulation 2003;107:1017-1023
35. Shanmugam N, Gonzalo ITG, Natarajan R: Molecular mechanisms of high glucose-induced
cyclooxygenase-2 expression in monocytes. Diabetes 2004;53:795-802
36. Sheu ML, Ho FM, Yang RS, Chao KF, Lin WW, Lin-Shiau SY, Liu SH: High glucose induces
human endothelial cell apoptosis through a phosphoinositide 3-kinase-regulated cyclooxygenase-2
pathway. Arterioscl Throm Vas 2005;25:539-545
37. Dong YJ, Jones RL, Wilson NH: Prostaglandin E receptor subtypes in smooth muscle: agonist
activities of stable prostacyclin analogues. Br J Pharmacol 1986;87:97-107
38. Chen L, Miao Y, Zhang Y, Dou D, Liu L, Tian X, Yang G, Pu D, Zhang X, Kang J, Gao Y,
Wang S, Breyer MD, Wang N, Zhu Y, Huang Y, Breyer RM, Guan Y: Inactivation of the
E-prostanoid 3 receptor attenuates the angiotensin II pressor response via decreasing arterial
contractility. Arterioscl Throm Vas 2012;32:3024-3032
39. Feletou M, Verbeuren TJ, Vanhoutte PM: Endothelium-dependent contractions in SHR: a tale of
prostanoid TP and IP receptors. Br J Pharmacol 2009;156:563-574
40. Antman EM, Bennett JS, Daugherty A, Furberg C, Roberts H, Taubert KA, American Heart A:
Use of nonsteroidal antiinflammatory drugs: an update for clinicians: a scientific statement from the
American Heart Association. Circulation 2007;115:1634-1642
41. Patrono C, Baigent C: Nonsteroidal anti-inflammatory drugs and the heart. Circulation
2014;129:907-916
42. Rocca B, Secchiero P, Ciabattoni G, Ranelletti FO, Catani L, Guidotti L, Melloni E, Maggiano N,
Zauli G, Patrono C: Cyclooxygenase-2 expression is induced during human megakaryopoiesis and
characterizes newly formed platelets. P Natl Acad Sci USA 2002;99:7634-7639
Page 25 of 41 Diabetes
![Page 25: Inhibition of miR-200c restores endothelial function in diabetic … · 2016. 1. 14. · Kong, Hong Kong, China. Tel: +852 3943 6787. E-mail: yu-huang@cuhk.edu.hk Total word count:](https://reader033.vdocuments.site/reader033/viewer/2022060821/6099e66c8e2d4726e7734079/html5/thumbnails/25.jpg)
25
43. Topper JN, Cai J, Falb D, Gimbrone MA, Jr.: Identification of vascular endothelial genes
differentially responsive to fluid mechanical stimuli: cyclooxygenase-2, manganese superoxide
dismutase, and endothelial cell nitric oxide synthase are selectively up-regulated by steady laminar
shear stress. P Natl Acad Sci USA 1996;93:10417-10422
44. Yu Y, Ricciotti E, Scalia R, Tang SY, Grant G, Yu Z, Landesberg G, Crichton I, Wu W, Pure E,
Funk CD, FitzGerald GA: Vascular COX-2 modulates blood pressure and thrombosis in mice. Sci
Transl Med 2012;4:132ra154
Page 26 of 41Diabetes
![Page 26: Inhibition of miR-200c restores endothelial function in diabetic … · 2016. 1. 14. · Kong, Hong Kong, China. Tel: +852 3943 6787. E-mail: yu-huang@cuhk.edu.hk Total word count:](https://reader033.vdocuments.site/reader033/viewer/2022060821/6099e66c8e2d4726e7734079/html5/thumbnails/26.jpg)
26
Figure legends
Figure 1. The elevated expression of miR-200c in diabetic db/db mouse aortas and in high
glucose-treated primary mouse endothelial cells (MAECs)
Real-time quantitative polymerase chain reaction (qPCR) analysis of miR-200a, b, c expression in
db/m+ mouse aortas (A) and in human renal arteries (B). *p
<0.05 vs. miR-200a. (C) qPCR analysis
of miR-200c expression in non-diabetic or diabetic mouse aortas. *p
<0.05 vs. db/m
+. (D) MiR-200c
expression in renal arteries from non-diabetic subjects (non-DM) and diabetic patients (DM).
*p<0.05 vs. Non-DM. (E) qPCR assay of miR-200c expression in MAECs incubated in high
mannitol (HM, 25 mM plus 5 mM glucose, 24 hours) or high glucose (HG, 30 mM, 24 hours) in the
presence or absence of tempol (100 µM). *p<0.05 vs. HM; #p<0.05 vs. HG. (F) qPCR assay of
miR-200c expression in MAECs incubated in HX-XO (100 µM hypoxanthine plus 0.01 units/ml
xanthine oxidase, 24 hours) in the presence or absence of tempol (100 µM). *p<0.05 vs. Control;
#p<0.05 vs. HX-XO. (G&H) The effect of miR-200c overexpression on ROS production as
measured by ERP spectroscopy (G) and in situ DHE staining of endothelium of mouse aortas (H).
*p<0.05 vs. miR-Ctrl. Data are means±SEM of 4-5 experiments.
Figure 2. MiR-200c impairs endothelium-dependent relaxations in normal mouse aortas and
suppression of miR-200c enhances endothelial function in diabetic mice
(A) The inhibitory effect of ad-miR-200c (adenovirus-mediated miR-200c, 107 pfu, 24-hour
incubation) on ACh-induced EDRs in db/m+ mouse aortas was reversed by ad-anti-miR-200c.
*p<0.05 vs. miR-Ctrl; #p<0.05 vs. miR-200c. (B) qPCR analysis of the relative miR-200c expression
in db/m+ mouse aortas treated with ad-miR-200c for 24 hours with or without co-treatment of
ad-anti-miR-200c. *p<0.05 vs. miR-Ctrl, #p<0.05 vs. miR-200c. (C) The inhibitory effect of
ad-miR-200c transduction on EDRs in renal arteries of non-diabetic subjects. *p<0.05 vs. miR-Ctrl;
#p<0.05 vs. miR-200c. (D&E) Ad-anti-miR-200c improved EDRs in db/db mouse aortas. *p<0.05
Page 27 of 41 Diabetes
![Page 27: Inhibition of miR-200c restores endothelial function in diabetic … · 2016. 1. 14. · Kong, Hong Kong, China. Tel: +852 3943 6787. E-mail: yu-huang@cuhk.edu.hk Total word count:](https://reader033.vdocuments.site/reader033/viewer/2022060821/6099e66c8e2d4726e7734079/html5/thumbnails/27.jpg)
27
vs. miR-Ctrl. (F) Ad-anti-miR-200c augmented flow-mediated dilatation in resistance mesenteric
arteries of db/db mice. *p <0.05 vs. miR-Ctrl. (G) Ad-anti-miR-200c reversed high glucose (30 mM,
48 hours)-induced endothelial dysfunction in normal mouse aortas. *p <0.05 vs. miR-Ctrl. Data are
means±SEM of 5-6 experiments.
Figure 3. MiR-200c suppresses ZEB1 expression and ZEB1 overexpression ameliorates
miR-200c-induced endothelial dysfunction
(A&B) Ad-miR-200c transduction suppressed ZEB1 mRNA and protein levels in MAECs, which
was reversed by co-treatment with ad-anti-miR-200c. *p <0.05 vs. miR-Ctrl; #p<0.05 vs. miR-200c.
(C) Western blotting analysis of ZEB1 expression in MAECs transduced with ad-miR-ZEB1 for 24
hours. *p<0.05 vs. ad-GFP. (D) Ad-ZEB1 (107 pfu, 24 hours) reversed miR-200c-induced
endothelial dysfunction in normal mouse aortas. *p <0.05 vs. miR-Ctrl; #p<0.05 vs. miR-200c. Data
are means±SEM of 4-5 experiments.
Figure 4. ZEB1 expression is decreased in diabetic mouse aortas and ad-ZEB1 transduction
improves endothelial function in diabetic mice
(A) Western blotting analysis of ZEB1 expression in db/m+ or db/db mouse aortas.
*p
<0.05 vs.
db/m+. (B) ZEB1 expression in renal arteries from non-diabetic and diabetic humans. *p< 0.05 vs.
Non-DM. (C) Ad-anti-miR-200c (24 hours) increased ZEB1 expression in db/db mouse aortas in a
dose-dependent manner. *p<0.05 vs. miR-Ctrl. (D) Ad-anti-miR-200c reversed the high glucose (30
mM, 24 hours)-induced reduction in ZEB1 expression in MAECs. *p< 0.05 vs. Mannitol; #p<0.05 vs.
high glucose. (E&F) Ad-ZEB1 transduction enhanced endothelial function in both aortas and
mesenteric arteries in db/db mice. *p<0.05 vs. ad-GFP. (G) Ad-ZEB1 transduction reduced
miR-200c level in db/db mouse aortas. *p<0.05 vs. ad-GFP. (H) The effect of ad-ZEB1 transduction
on miR-200c expression in MACEs. *p<0.05 vs. ad-GFP. Data are means±SEM of 4-5 experiments.
Page 28 of 41Diabetes
![Page 28: Inhibition of miR-200c restores endothelial function in diabetic … · 2016. 1. 14. · Kong, Hong Kong, China. Tel: +852 3943 6787. E-mail: yu-huang@cuhk.edu.hk Total word count:](https://reader033.vdocuments.site/reader033/viewer/2022060821/6099e66c8e2d4726e7734079/html5/thumbnails/28.jpg)
28
Figure 5. In vivo delivery of ad-anti-miR-200c or ad-ZEB1 suppresses miR-200c expression and
improves endothelial function in db/db mice
(A) Ad-anti-miR-200c in vivo improved EDRs in db/db mouse aortas. *p <0.05 vs. miR-Ctrl. (B&C)
In vivo ad-anti-miR-200c transduction suppressed miR-200c expression and increased ZEB1
expression in db/db mouse aortas. *p<0.05 vs. miR-Ctrl. (D) In vivo ad-ZEB1 transduction improved
EDRs in db/db mouse aortas. *p<0.05 vs. ad-GFP. (E&F) ad-ZEB1 transduction increased ZEB1
expression and suppressed miR-200c expression in db/db mouse aortas. *p<0.05 vs. ad-GFP. Data
are means±SEM of 4-5 experiments.
Figure 6. COX-2 mediates miR-200c-induced endothelial dysfunction
(A) EDRs in COX-2-/-
mouse aortas were not affected by 24-hour treatment with ad-miR-200c (107
pfu). (B) Overexpression of ZEB1 reduced miR-200c-induced up-regulation of COX-2 without
affecting COX-1 expression in MAECs. *p<0.05 vs. miR-Ctrl; #p<0.05 vs. miR-200c. (C)
Ad-miR-200c transduction raised expression of COX-2 but not COX-1 in MAECs. *p<0.05 vs.
miR-Ctrl; #p<0.05 vs. miR-200c. (D) Luciferase reporter gene assay showing that miR-200c-induced
COX-2 promoter activity was reversed by overexpression of ZEB1, but not NF-κB or AP-1 in H5V
mouse endothelial cells. *p<0.05 vs. miR-Ctrl. (E) Reduced COX-2 expression in db/db mouse
aortas after in vitro ZEB1 overexpression. *p<0.05 vs. ad-GFP. Data are means±SEM of 4-5
experiments. (F) The schematic illustration of the proposed role of miR-200c/ZEB1/COX-2
signaling cascade in endothelial dysfunction in diabetes.
Page 29 of 41 Diabetes
![Page 29: Inhibition of miR-200c restores endothelial function in diabetic … · 2016. 1. 14. · Kong, Hong Kong, China. Tel: +852 3943 6787. E-mail: yu-huang@cuhk.edu.hk Total word count:](https://reader033.vdocuments.site/reader033/viewer/2022060821/6099e66c8e2d4726e7734079/html5/thumbnails/29.jpg)
199x265mm (300 x 300 DPI)
Page 30 of 41Diabetes
![Page 30: Inhibition of miR-200c restores endothelial function in diabetic … · 2016. 1. 14. · Kong, Hong Kong, China. Tel: +852 3943 6787. E-mail: yu-huang@cuhk.edu.hk Total word count:](https://reader033.vdocuments.site/reader033/viewer/2022060821/6099e66c8e2d4726e7734079/html5/thumbnails/30.jpg)
199x265mm (300 x 300 DPI)
Page 31 of 41 Diabetes
![Page 31: Inhibition of miR-200c restores endothelial function in diabetic … · 2016. 1. 14. · Kong, Hong Kong, China. Tel: +852 3943 6787. E-mail: yu-huang@cuhk.edu.hk Total word count:](https://reader033.vdocuments.site/reader033/viewer/2022060821/6099e66c8e2d4726e7734079/html5/thumbnails/31.jpg)
199x265mm (300 x 300 DPI)
Page 32 of 41Diabetes
![Page 32: Inhibition of miR-200c restores endothelial function in diabetic … · 2016. 1. 14. · Kong, Hong Kong, China. Tel: +852 3943 6787. E-mail: yu-huang@cuhk.edu.hk Total word count:](https://reader033.vdocuments.site/reader033/viewer/2022060821/6099e66c8e2d4726e7734079/html5/thumbnails/32.jpg)
199x265mm (300 x 300 DPI)
Page 33 of 41 Diabetes
![Page 33: Inhibition of miR-200c restores endothelial function in diabetic … · 2016. 1. 14. · Kong, Hong Kong, China. Tel: +852 3943 6787. E-mail: yu-huang@cuhk.edu.hk Total word count:](https://reader033.vdocuments.site/reader033/viewer/2022060821/6099e66c8e2d4726e7734079/html5/thumbnails/33.jpg)
199x265mm (300 x 300 DPI)
Page 34 of 41Diabetes
![Page 34: Inhibition of miR-200c restores endothelial function in diabetic … · 2016. 1. 14. · Kong, Hong Kong, China. Tel: +852 3943 6787. E-mail: yu-huang@cuhk.edu.hk Total word count:](https://reader033.vdocuments.site/reader033/viewer/2022060821/6099e66c8e2d4726e7734079/html5/thumbnails/34.jpg)
199x265mm (300 x 300 DPI)
Page 35 of 41 Diabetes
![Page 35: Inhibition of miR-200c restores endothelial function in diabetic … · 2016. 1. 14. · Kong, Hong Kong, China. Tel: +852 3943 6787. E-mail: yu-huang@cuhk.edu.hk Total word count:](https://reader033.vdocuments.site/reader033/viewer/2022060821/6099e66c8e2d4726e7734079/html5/thumbnails/35.jpg)
Data Supplement - Zhang et al., 2015
1
Inhibition of miR-200c restores endothelial function in diabetic mice
through suppression of COX-2
Huina Zhang1,2,3
, Jian Liu1, Dan Qu
1, Li Wang
1, Jiang-Yun Luo
1, Chi Wai Lau
1, Pingsheng Liu
3,
Zhen Gao1, George L. Tipoe
4, Hung Kay Lee
5, Chi Fai Ng
6, Ronald Ching Wan Ma
7, Xiaoqiang
Yao1, Yu Huang
1
1Institute of Vascular Medicine, Shenzhen Research Institute, and Li Ka Shing Institute of Health
Sciences , Chinese University of Hong Kong, Hong Kong, China; 2Beijing Institute of Heart, Lung
and Blood Vessel Diseases, Beijing Anzhen Hospital Affiliated to the Capital Medical University,
Beijing, China; 3National Laboratory of Biomacromolecules, Institute of Biophysics, Chinese
Academy of Sciences, Beijing, China; 4Department of Anatomy, University of Hong Kong, Hong
Kong, China; 5Department of Chemistry,
6Department of Surgery and
7Department of Medicine and
Therapeutics, Chinese University of Hong Kong, Hong Kong, China;
Additional Results
Page 36 of 41Diabetes
![Page 36: Inhibition of miR-200c restores endothelial function in diabetic … · 2016. 1. 14. · Kong, Hong Kong, China. Tel: +852 3943 6787. E-mail: yu-huang@cuhk.edu.hk Total word count:](https://reader033.vdocuments.site/reader033/viewer/2022060821/6099e66c8e2d4726e7734079/html5/thumbnails/36.jpg)
Data Supplement - Zhang et al., 2015
2
The expression of miRNAs in mouse aortas and the effect of miR-200c overexpression on ROS
production in endothelial cells. The miRNA screening assay demonstrated that miR-200c was
significantly higher in db/db mouse aortas (Online Figure IA). Overexpression of miR-200c did not
induce ROS production in mouse aortic endothelial cells (MAECs) as detected by ERP spectroscopy
(Online Figure IB) or by DHE staining (Online Figure IC).
Online Figure I. (A) The miRNAs screening assay comparing the expression levels of
endothelium-relevant miRNAs in diabetic db/db and non-diabetic db/m+ mouse aortas. *p<0.05 vs.
db/m+. (B&C) The effect of miR-200c on ROS production in MAECs. *p<0.05 vs. miR-Ctrl. Data are
means±SEM of 4-5 experiments.
Page 37 of 41 Diabetes
![Page 37: Inhibition of miR-200c restores endothelial function in diabetic … · 2016. 1. 14. · Kong, Hong Kong, China. Tel: +852 3943 6787. E-mail: yu-huang@cuhk.edu.hk Total word count:](https://reader033.vdocuments.site/reader033/viewer/2022060821/6099e66c8e2d4726e7734079/html5/thumbnails/37.jpg)
Data Supplement - Zhang et al., 2015
3
The miR-200c overexpression attenuates endothelium-dependent relaxations (EDRs) in mouse
aortas. Overexpression of miR-200c (ad-miR-200) but not miR-Ctrl (ad-miR-Ctrl) by adenovirus
transduction (107 pfu, 24 hours) reduced ACh-induced EDRs in db/m
+ mouse aortas (Online Figure
IIA&B). By contrast, sodium nitroprusside (SNP)-induced endothelium-independent relaxations in
db/m+ mouse aortas were comparable in different groups of mice (Online Figure IIC).
Online Figure II. (A) Representative traces showing that ACh-induced EDRs in db/m
+ mouse aortas
were attenuated following transduction with miR-200c overexpressing adenovirus. (B) Lack of the
effect of ad-miR-Ctrl on EDRs. (C) SNP-induced endothelium-independent relaxations in db/m+
mouse aortas following viral transduction. Data are means±SEM of 4-5 experiments.
Page 38 of 41Diabetes
![Page 38: Inhibition of miR-200c restores endothelial function in diabetic … · 2016. 1. 14. · Kong, Hong Kong, China. Tel: +852 3943 6787. E-mail: yu-huang@cuhk.edu.hk Total word count:](https://reader033.vdocuments.site/reader033/viewer/2022060821/6099e66c8e2d4726e7734079/html5/thumbnails/38.jpg)
Data Supplement - Zhang et al., 2015
4
Anti-miR-200c suppresses miR-200c expression and improves flow-mediated dilatation of db/db
mouse mesenteric arteries. Transduction of anti-miR-200 overexpressing adenovirus (24 hours, 0.1,
0.3,1 *107 pfu) progressively suppressed miR-200 expression in db/db mouse aortas (Online Figure IIIA)
and augmented flow-induced dilatation in db/db mouse mesenteric arteries (Online Figure IIIB).
Online Figure III. (A) qPCR analysis of miR-200c expression in db/db mouse aortas following ex
vivo 24-hour incubation with different dosages of ad-anti-miR-200c. *p<0.05 vs. miR-Ctrl. (B). Traces
showed the effect of ad-anti-miR-200c on flow-mediated dilatation in db/db mouse resistance
mesenteric arteries. Data are means±SEM of 4-5 experiments.
Page 39 of 41 Diabetes
![Page 39: Inhibition of miR-200c restores endothelial function in diabetic … · 2016. 1. 14. · Kong, Hong Kong, China. Tel: +852 3943 6787. E-mail: yu-huang@cuhk.edu.hk Total word count:](https://reader033.vdocuments.site/reader033/viewer/2022060821/6099e66c8e2d4726e7734079/html5/thumbnails/39.jpg)
Data Supplement - Zhang et al., 2015
5
ZEB1 overexpression improves EDRs and flow-mediated dilatation of mesenteric arteries
from db/db mice. Ad-ZEB1 transduction increased ZEB1 expression in db/db mouse aortas in
a dose-dependent manner (Online Figure IVA) and enhanced EDRs in aortas and
flow-mediated dilatation of mesenteric arteries from db/db mice (Online Figure IVB&C).
Online Figure IV. (A) ZEB1 expression in db/db mouse aortas after ad-ZEB1 transduction. *p< 0.05
vs. ad-GFP. (B&C) Traces showing the effect of ad-ZEB1 transduction on EDRs in db/db mouse
aortas and on flow-mediated dilatation in db/db mouse mesenteric arteries. Data are means±SEM of
4-5 experiments.
Page 40 of 41Diabetes
![Page 40: Inhibition of miR-200c restores endothelial function in diabetic … · 2016. 1. 14. · Kong, Hong Kong, China. Tel: +852 3943 6787. E-mail: yu-huang@cuhk.edu.hk Total word count:](https://reader033.vdocuments.site/reader033/viewer/2022060821/6099e66c8e2d4726e7734079/html5/thumbnails/40.jpg)
Data Supplement - Zhang et al., 2015
6
The miR-200c-induced EDR impairment may involve COX-2-dependent PGE2
production. MiR-200c-induced endothelial dysfunction was absent in COX-2 knockout mice
(Online Figure VA). MiR-200c overexpression increased Cbr1 expression (Online Figure VB),
PGE2 and PGI2 levels in the medium (Online Figure VC) and PGE2 level in the mouse aortas
(Online Figure VD). Pretreatment with PGE2, but not PGI2, attenuated ACh-induced relaxation
(Online Figure VE).
Online Figure V. (A) Traces showing the effect of ad-miR-200c transduction (24 hours) on EDRs in
aortas from COX-2 knockout mice. (B) The mRNA level of PGs synthases in the mouse aortas after
miR-200c overexpression. (C) Levels of four PGs in the medium measured by LC/MS. *p< 0.05 vs.
miR-Ctrl. (D) The amount of four PGs in mouse aortas measured by LC/MS. *p< 0.05 vs. miR-Ctrl. (F)
Acute inhibitory effect of PGE2 (100 nmol/L) but not PGI2 (100 nmol/L) on ACh-induced
relaxations.*p<0.05 vs.Control. Data are means±SEM of 4-5 experiments.
Page 41 of 41 Diabetes
![Page 41: Inhibition of miR-200c restores endothelial function in diabetic … · 2016. 1. 14. · Kong, Hong Kong, China. Tel: +852 3943 6787. E-mail: yu-huang@cuhk.edu.hk Total word count:](https://reader033.vdocuments.site/reader033/viewer/2022060821/6099e66c8e2d4726e7734079/html5/thumbnails/41.jpg)
Data Supplement - Zhang et al., 2015
7
Transduction of anti-miR-200c overexpressing adenovirus or ad-ZEB1 does not affect
insulin sensitivity in db/db mice. There was no difference in glucose tolerance (Online Figure
VIA) and insulin tolerance (Online Figure VIB) in db/db mice after anti-miR-200c or ad-ZEB1
transduction (one week).
Online Figure VI. Effects of anti-miR-200c or ad-ZEB1 transduction on glucose tolerance (A) and
insulin tolerance (B) in db/db mice. Data are means±SEM of 4-5 experiments.
Page 42 of 41Diabetes