inhibition of mir-200c restores endothelial function in diabetic … · 2016. 1. 14. · kong, hong...

1

Inhibition of miR-200c restores endothelial function in diabetic mice

through suppression of COX-2

Huina Zhang1,2,3,

*, Jian Liu1,

*, Dan Qu1, Li Wang

1, Jiang-Yun Luo

1, Chi Wai Lau

1, Pingsheng Liu

3,

Zhen Gao1, George L. Tipoe

4, Hung Kay Lee

5, Chi Fai Ng

6, Ronald Ching Wan Ma

7, Xiaoqiang

Yao1, Yu Huang

1

1Institute of Vascular Medicine, Shenzhen Research Institute, and Li Ka Shing Institute of Health

Sciences , Chinese University of Hong Kong, Hong Kong, China; 2Beijing Institute of Heart, Lung

and Blood Vessel Diseases, Beijing Anzhen Hospital Affiliated to the Capital Medical University,

Beijing, China; 3National Laboratory of Biomacromolecules, Institute of Biophysics, Chinese

Academy of Sciences, Beijing, China; 4Department of Anatomy, University of Hong Kong, Hong

Kong, China; 5Department of Chemistry,

6Department of Surgery and

7Department of Medicine and

Therapeutics, Chinese University of Hong Kong, Hong Kong, China;

*These authors contributed equally to this work.

Running title: MiR-200c/COX-2 in diabetic endothelial function

Correspondence to: Yu Huang, PhD, School of Biomedical Sciences, Chinese University of Hong

Kong, Hong Kong, China. Tel: +852 3943 6787. E-mail: [email protected]

Total word count: 3980

Number of figures: 6

Page 2 of 41Diabetes

Diabetes Publish Ahead of Print, published online January 28, 2016

2

Abstract

Endothelial dysfunction plays a crucial role in the development of diabetic vasculopathy. Our initial

qPCR results showed an increased miR-200c expression in arteries from diabetic mice and patients.

However, whether miR-200c is involved in diabetic endothelial dysfunction is unknown.

Overexpression of miR-200c impaired endothelium-dependent relaxations (EDRs) in non-diabetic

mouse aortas, while suppression of miR-200c by anti-miR-200c enhanced EDRs in diabetic db/db

mice. MiR-200c suppressed ZEB1 expression and ZEB1 overexpression ameliorated endothelial

dysfunction induced by miR-200c or associated with diabetes. More importantly, overexpression of

anti-miR-200c or ZEB1 in vivo attenuated miR-200c expression and improved EDRs in db/db mice.

Mechanistic study with the use of COX-2-/-

mice revealed that COX-2 mediated miR-200c-induced

endothelial dysfunction and miR-200c up-regulated COX-2 expression in endothelial cells via

suppression of ZEB1 and increased production of PGE2 which also reduced EDR. In conclusion, our

study demonstrates for the first time that miR-200c is a new mediator of diabetic endothelial

dysfunction and inhibition of miR-200c rescues EDRs in diabetic mice. These new findings suggest

the potential usefulness of miR-200c as the target for drug intervention against diabetic vascular

complications.

Page 3 of 41 Diabetes

3

Diabetes mellitus affects 9.5% of the adult population worldwide (1). Most of diabetic patients die of

cardiovascular complications, including coronary heart disease, stroke, and nephropathy (2; 3).

Endothelial dysfunction associated with reduced nitric oxide (NO) bioavailability is one of the

important initiators of vascular pathogenesis leading to the development of diabetic cardiovascular

events (4). Hyperglycemia decreases the bioavailability of endothelium-derived relaxing factors

(EDRFs) such as NO while it increases the production of endothelium-derived contracting factors

(EDCFs), contributing to endothelial dysfunction (5; 6). However, the molecular mechanisms for

hyperglycemia-mediated disrupted balance between EDRFs and EDCFs in the endothelium remain

largely unclear.

MicroRNAs (miRNAs) are the small noncoding RNAs that bind to sequence-specific mRNA

and consequently inhibit the translation (7). Growing evidence has pinpointed miRNAs as important

modulators of cardiovascular health and disease. For instance, miRNAs participate in vascular

inflammation (8), arterial remodeling (9), smooth muscle plasticity (10), atherosclerosis (11), and

endothelial cell apoptosis (12). Nevertheless, the role of miRNAs in the development of diabetic

endothelial dysfunction is sparsely studied.

The miR-200 family, comprised of miR-200c, -200a, -200b, -141, and -429, plays a role in the

development of diabetic complications. Down-regulation of miR-200b increased VEGF expression,

promoted angiogenesis and ameliorated diabetic retinopathy (13) while elevated miR-200b induced

inflammation by promoting the expression of cyclooxygenase-2 (COX-2) and monocyte chemotactic

protein 1 in vascular smooth muscle cells (14). In diabetic mouse glomeruli and renal mesangial cells,

increased miR-200 family (miR-200b and miR-200c) may promote the expression of fibrotic genes

in diabetic nephropathy (15). Our initial screening of miRNAs showed a marked increase of

miR-200c expression in db/db mouse aortas. However, the exact involvement of miR-200c in

diabetic endothelial dysfunction has never been investigated.


4

The present study therefore hypothesized that miRNA-200c plays a critical role in

diabetes–associated endothelial dysfunction and inhibition of miR-200c is effective as a novel

intervention against diabetic vasculopathy.


5

RESEARCH DESIGNS AND METHODS

Animals

C57BL/6 mice, db/db and db/m+ mice were purchased from the Laboratory Animal Center of

Chinese University of Hong Kong (CUHK). COX-2-/-

mice were supplied by University of Hong

Kong. All animal experiments were approved by CUHK Animal Experimentation Ethics Committee

and in compliance with the Guide for the Care and Use of Laboratory Animals (NIH Publication

Eighth Edition, updated 2011).

Human renal artery specimens

All collection and treatment of human samples were conducted under the guideline established by

the Joint CUHK-New Territories East Cluster Clinical Research Ethics Committee. Human renal

arteries were obtained from nephrectomy patients (with poorly-functioning kidney, e.g.

hydronephrosis or renal calculus) with hyperglycemia (diabetes) or normal blood glucose

(non-diabetes) after obtaining their informed consent. The mean age of patients was 58 (range from

44-72).

Endothelial cell culture

Primary mouse endothelial cells (MAECs) were cultured as reported (16). The H5V mouse

endothelial cell line was purchased from American Type Culture Collection and cultured in

Dulbecco’s Modified Eagle’s Media (DMEM, Gibco, USA).

Organ culture of mouse arteries and functional assay

Mouse thoracic aortas were dissected in Krebs-Henseleit solution containing (in mM): 119 NaCl, 4.7

KCl, 2.5 CaCl2, 1 MgCl2, 25 NaHCO3, 1.2 KH2PO4, and 11 D-glucose) (17). Some aortas were

treated with high glucose or transduced with adenovirus-mediated miR-200c for 24 hours in DMEM


6

and then changes in isometric force were recorded in myograph (Danish Myo Technology, Aarhus,

Denmark). Acetylcholine (ACh) induce endothelium-dependent relaxations (EDRs) were examined.

All drugs and chemicals were purchased from Sigma-Aldrich (St Louis, MO, USA).

Flow-mediated dilatation in pressure myograph

Resistance mesenteric arteries were dissected in sterilized PBS solution and transduced with

indicated adenovirus for 24 hours. Flow-mediated dilatation (FMD) was recorded by Zeiss Axiovert

40 microscope, model 110P, with video camera monitored with the Myo-View software (Danish

Myo Technology) as described (18).

ROS detection by DHE fluorescence and electron paramagnetic resonance (EPR) spectroscopy

Aortic segments (2 mm in length) were incubated in 5 µM dihydroethidium (DHE, Molecular Probes,

Eugene, OR, USA), cut open and observed under FV1000 confocal microscope (Olympus, Tokyo,

Japan; excitation: 515 nm; emission: 585 nm). ROS released from MAECs was also measured by

EMX EPR spectrometer (Bruker, Germany) with 100 µM 1-hydroxy-2,2,6,6-tetramethyl

-4-oxo-piperidine hydrochloride (TEMPONE-H, Alexis) and 5,5-dimethyl-l-pyrroline-N-oxide

(DMPO, Alexis) as spin trap agents. HX-XO (100 µM hypoxanthine plus 0.01 units/ml xanthine

oxidase) was used as positive control.

Adenovirus construction and transduction

A fragment containing mature miR-200c flanked by 150 bp upstream and 150 bp downstream of

genomic sequence was amplified by PCR from mouse and human genomic DNA and cloned into

pAdTrack-U6 (which also contains a GFP cassette) (19; 20). Oligonucleotides against the mature

sequence of miR-200c gene: CCGGTCCATCATTACCCGGCAGTATTATTTTTC (forward) and

TCGAGAAAAATAATACTGCCGGGTAATGATGGA (reverse) were annealed and cloned into


7

pAdTrack-U6 and named as anti-miR-200c. Mutant miR-200c sequence was modified from

TAATACTGCCGGGTAATGATGGA to ATAAAGTCCCGGGTAATGATGGA. The cDNA of

mouse ZEB1 was subcloned from pcDNA-ZEB1-HIS (a kind gift from Professor Gregory Goodall,

University of Adelaide, Australia) into pAdtrack-CMV. All vectors were constructed to adenoviral

plasmid through recombining with pAdeasy-1 in BJ5183 E. coli. After PacI (New England Biolabs,

MA, USA) digestion, adenoviral plasmids were transfected into HEK293 cells to generate infectious

adenovirus particles. pAdtrack-CMV-GFP (Ad-GFP) and pAdtrack-U6 (named as miR-Ctrl)

adenoviruses were used as control in corresponding experiments.

Protein preparation and Western blotting

Proteins prepared from MAECs or mouse aortas were dissolved in 5×SDS loading buffer, denatured

at 95°C for 5 minutes and then developed on SDS-PAGE and transferred to a PVDF membrane

(Millipore, Bedford, MA, USA) for Western blotting using antibodies detected by ECL system (GE

Healthcare, Pittsburgh, PA, USA). The primary antibodies used included Anti-COX-2 (1:1000,

Abcam, Cambridge, UK), Anti-GAPDH (1:5000, Ambion, Austin, TX, USA), and Anti-ZEB1

(1:1000, Santa Cruz, USA).

MiRNA analysis

MiRNAs from endothelial cells or aortas were extracted using mirVana™ miRNA Isolation Kit

(Ambion). MicroRNA screening was done using NCode™ SYBR® Green miRNA qRT-PCR Kit

(Invitrogen, USA) . Primers for mmu-miR-223: tgtcagtttgtcaaatacccca; mmu-miR-200c:

taatactgccgggtaatgatgga; mmu-miR-24: tggctcagttcagcaggaacag; mmu-miR-320:

aaaagctgggttgagagggcga; mmu-miR-503: tagcagcgggaacagtactgcag; mmu-miR-200b:

taatactgcctggtaatgatga; mmu-let-7b: tgaggtagtaggttgtgtggtt; mmu-miR-20b: caaagtgctcatagtgcaggtag;

mmu-miR-21: tagcttatcagac tgatgttga; mmu-miR-146a: tgagaactgaattccatgggtt; mmu-miR-221:


8

agctacattgtctgctgggtttc; mmu-miR-155: ttaatgctaattgtgataggggt; mmu-miR-23b:

atcacattgccagggattacc. MiR-200a, b and c expression were determined by Applied Biosystems

Taqman miRNA Assay (Life Technology, USA) in ABI ViiA7 system (Applied Biosystems) (21).

Primer identification catalog numbers were: 000502 for mmu-miR-200a-3p/ hsa-miR-200a-3p;

002251 for mmu-miR-200b-3p/hsa-miR-200b-3p; 000505 for mmu-miR-200c-3p /hsa-miR-200c-3p

and 001973 for snRU6.

RT-qPCR

Total RNA from MAECs or mouse aortas was extracted using Trizol reagent (Invitrogen). Reverse

transcription was carried out in 2 µg of total RNA using iScript cDNA Synthesis Kit (Bio-Rad, USA).

Complementary DNA was amplified using SYBR® Green Real-Time PCR Master Mixes (Life

Technology). GAPDH was used as endogenous control. Primers for mouse ZEB1 were: sense: 5'

CAAACACCACCTGAAAGAGCAC 3', antisense: 5' AAGAGATGGCGAGGAAC ACTG 3';

primers for mouse GAPDH were: 5' AGGTCGGTGTGAACGGATTTG 3', antisense: 5'

TGTAGACCATGTAGTTGAGGTCA 3'; primers for mouse Cbr1: sense: 5'

CGCAGGCATCGCCTTCAA 3', antisense: 5' CCTCTGTGATGGTCTCGCTT 3'; primers for

mouse Fam213b: sense: 5' GGAGCATCCTGGACCAACAC 3', antisense: 5'

GGCAGCTGGTAGGATGCTTA 3' ; primers for mouse Prostaglandin E2 (PGE2) synthase: sense: 5'

CATCAAGATGTACGCGGTGG 3', antisense: 5' CTCCACATCTGGGTCACTCC 3' ; primers for

mouse prostacyclin (PGI2) synthase: sense: 5' GGTGGCGGTGACTTGTTGC 3', antisense: 5'

TCCAACGGAGGCTCACCAG 3' ; primers for mouse thromboxane A2 (TXA2) synthase: sense:

5' ACCTACTTCTTTCTCCACCACCT 3', antisense: 5' TGATGCCCAACTTCTCCAGTC 3'.

Plasmids construction and luciferase reporter gene assay


9

The plasmid (pcDNA-ZEB1-HIS) contains coding sequence for mouse ZEB1. The expression

plasmids (pcDNA-c-Fos, c-Jun, p65 and p50) of c-Fos, c-Jun (two units of AP-1), p65 and p50 (two

units of NF-κB) were kindly provided by Professor De-Pei Liu (Peking Union Medical College,

China). A 1, 301bp human COX-2 promoter fragment (-1, 267 to +34) was cloned into the

KpnI/HindIII site of pGL3-basic to construct pGL-COX-2. The purified luciferase plasmids were

transfected into H5V cells cultured in 24-well plate using the Lipofectamine 2000 (Invitrogen)

pRL-TK reporter (Promega, USA) was used as internal control. Luciferase activity was assessed

using the Dual-Luciferase Reporter Assay System (Promega).

Measurement of prostaglandins by high performance liquid chromatography-coupled mass

spectrometry (HPLC-MS)

Prostaglandin F2α (PGF2α), PGE2, 6-keto PGF1α (the stable product of PGI2), TXB2 (the stable

product of TXA2) were measured using HPLC-MS method (22). Briefly, after treatment with

miR-200c overexpressing virus for 24 hours, C57BL/6 mouse aortas were transferred to

Krebs-Henseleit solution and exposed to acetylcholine (3 µM) for 3 minutes. The levels of

prostaglandins in the aortas and the medium were measured by Agilent 1100 series HPLC (Agilent

Technologies, CA, USA) and Bruker Daltonics MicrOTOFQ mass spectrometer (Bremen,

Germany).

Oral glucose tolerance test and intra-peritoneal insulin tolerance test

Mice were fasted for 8-h and then loaded with glucose (1.2 g/kg body weight) orally. Blood glucose

was measured at times 0, 15, 30, 60, 90 and 120 min with a commercial glucometer (Ascensia

ELITE®, Bayer, Mishawaka, IN). For insulin tolerance test, mice were fasted for 2-h and then

injected with insulin at 0.75 U/kg body weight. Blood glucose was measured as mentioned earlier.


10

Statistical Analysis

Results represent means±SEM of n separate experiments. Concentration-response curves were

analyzed using GraphPad Prism software (Version 4.0). Statistical significance was determined by

Student’s t-test (two-tailed) or one-way ANOVA followed by the Bonferroni post hoc test when

more than two treatments were compared. P<0.05 indicates statistical difference between groups.


11

RESULTS

MiR-200c expression is elevated in arteries from diabetic mice and patients and in high

glucose-treated mouse aortic endothelial cells

We first performed qPCR to detect the relative expression of a number of miRNAs which were

reportedly present in endothelial cells, and found that miR-200c level was markedly higher in aortas

of diabetic db/db mice as compared to non-diabetic mice (Online Figure IA). Furthermore, the

TaqMan probe-based qPCR analysis showed that miR-200c was the most abundant isoform among

the miR-200 family members, over 100-fold more than miR-200a and miR-200b in non-diabetic

db/m+ mouse aortas (Figure 1A) and about 30-fold more than miR-200a and miR-200b in renal

arteries of non-diabetic subjects (Figure 1B). We thus selected miR-200c as the target molecule for

subsequent studies. The expression of miR-200c in db/db mouse aortas and in renal arteries from

diabetic patients was ∼2-fold greater than that of respective arteries from non-diabetic mice (Figure

1C) or human (Figure 1D). The miR-200c expression was also elevated in high glucose (HG, 30 mM,

24 hours)-treated primary mouse aortic endothelial cells (MAECs) and this effect was reversed by

co-treatment with ROS scavenger tempol (100 µM) (Figure 1E). Furthermore, 24-hour treatment

with 100 µM hypoxanthine plus 0.01 units/ml xanthine oxidase (HX-XO to release ROS) augmented

miR-200c expression in MAECs, which was abolished by tempol (Figure 1F). However, miR-200c

overexpression by adenoviral (ad-miR-200c) transduction did not affect ROS production in MAECs,

as detected by electron paramagnetic resonance spectroscopy (Figure 1G & Online Figure IB), and in

the endothelium of db/m+ mouse aortas, as indicated by en face dihydroethidium staining (Figure 1H

& Online Figure IC). These results indicate that hyperglycemia up-regulates miR-200c expression

most likely through ROS elevation.

MiR-200c overexpression impairs endothelium-dependent relaxations in db/m+ mouse aortas

and inhibition of miR-200c restores endothelial function in diabetic mice


12

Ex vivo transduction of ad-miR-200c markedly impaired acetylcholine-induced

endothelium-dependent relaxations (EDRs) and increased the miR-200c level in db/m+ mouse aortas

while miR-Ctrl overexpressing virus (ad-miR-Ctrl) and mut-miR-200c overexpressing virus

(ad-mut-miR-200c) had no effect (Figure 2A&B, Online Figure IIA&B). By contrast,

endothelium-independent relaxations to SNP were unaffected by ad-miR-200c (Online Figure IIC),

suggesting that miR-200c-reduced EDRs was likely caused by dysfunction of endothelial cells but

not vascular smooth muscle cells. Notably, miR-200c overexpression also attenuated EDRs in human

renal arteries (Figure 2C). Co-treatment with ad-anti-miR-200c reversed miR-200c-induced

impairment of EDRs in both mouse aortas (Figure 2A) and human renal arteries (Figure 2C).

To explore the pathological role of elevated miR-200c in diabetic endothelial dysfunction, db/db

mouse aortas were cultured and transfected with ad-anti-miR-200c for 24 hours. Ad-anti-miR-200c

dramatically reduced miR-200c expression (Online Figure IIIA) and improved EDRs (Figure 2D &

2E) in db/db mouse aortas in a dose-dependent manner. Inhibition of miR-200c by anti-miR-200c

also improved flow-mediated dilatation of second-order mesenteric resistance arteries (Figure 2F &

Online Figure IIIB). In addition, 24-hour incubation with ad-anti-miR-200c protected against high

glucose (HG, 30 mM, 48 hours)-induced attenuation of EDRs in db/m+ mouse aortas (Figure 2G).

These results clearly suggest that miR-200c elevation is most likely to mediate endothelial

dysfunction in diabetic mice.

MiR-200c reduces ZEB1 expression while ZEB1 overexpression inhibits miR-200c-induced

endothelial dysfunction in db/m+ mice

Transduction (24 hours) with ad-miR-200c suppressed the expression of ZEB1 at mRNA and protein

levels in MAECs and both effects were reversed by ad-anti-miR-200c (Figure 3A&B), thus

suggesting the involvement of ZEB1 inhibition in miR-200c-mediated endothelial dysfunction.


13

Indeed, transduction with a ZEB1-overexpressing virus (ad-ZEB1, 24 hours) (Figure 3C) abolished

ad-miR-200c-induced impairment of EDRs in db/m+ mouse aortas (Figure 3D).

ZEB1 is reduced in db/db mouse aortas and ZEB1 overexpression improves endothelial

function in db/db mouse arteries

ZEB1 expression was significantly decreased both in db/db mouse aortas (Figure 4A) and in renal

arteries from diabetic patients (Figure 4B) compared to that in the respective non-diabetic controls.

Inhibition of miR-200c by anti-miR-200c increased ZEB1 expression in db/db mouse aortas (Figure

4C). Likewise, ad-anti-miR-200c also prevented HG (30 mM, 24 hours)-induced ZEB1

down-regulation in MAECs (Figure 4D). These results indicate that decreased ZEB1 expression due

to miR-200c up-regulation may account for diabetic endothelial dysfunction. Indeed, overexpression

of ZEB1 by transduction with adenovirus (ad-ZEB1) (Online Figure IVA) reversed endothelial

dysfunction in db/db mouse aortas and mesenteric arteries (Figure 4E&F, Online Figure IVB &

Online Figure IVC). In consistence with previous report in other tissues (23), overexpression of

ZEB1 dose-dependently inhibited miR-200c expression in db/db mouse aortas and in MAECs

(Figure 4G &H).

In vivo inhibition of miR-200c by ad-anti-miR-200c and ad-ZEB1 improves EDR in db/db mice

To further confirm the significant role of miR-200c elevation in the maintenance of diabetic

endothelial dysfunction, ad-anti-miR-200c or ad-miR-Ctrl was administered into db/db mice through

tail intravenous injection (107

pfu). After one-week treatment, EDRs in ad-anti-miR-200c-treated

mice were markedly augmented in aortas, accompanied by reduced miR-200c expression but

elevated ZEB1 expression (Figure 5A-C). Similarly, in vivo transduction of ad-ZEB1 in db/db mice

also improved EDRs, increased ZEB1 expression, and decreased miR-200c expression (Figure

5D-F).


14

COX-2-dependent production of PGE2 may participate in miR-200c-induced endothelial

dysfunction and miR-200c up-regulates COX-2 expression by inhibition of ZEB1

We and others demonstrated before that COX-2 is an important mediator of endothelial dysfunction

(24-26) and ZEB1 is reported to suppress COX-2 expression (14). We next tested the hypothesis that

COX-2 contributes to miR-200c-induced endothelial dysfunction based on our observation that

miR-200c suppressed ZEB1 expression in endothelial cells. As expected, miR-200c failed to

attenuate EDRs in aortas of COX-2-/-

mice (Figure 6A, Online Figure VA). In support of the

functional results, miR-200c elevated COX-2 protein expression in MAECs (Figure 6B), which was

reversed by overexpression of ZEB1 or anti-miR-200c (Figure 6B&C). However, COX-1 protein

expression was not changed by miR-200c (Figure 6B&C). Moreover, the luciferase reporter gene

assay demonstrated that miR-200c increased promoter activity of COX-2, which was inhibited by

overexpression of ZEB1 but not by overexpression of c-Fos/c-Jun (AP-1) or p65/p50 (NF-κB)

(Figure 6D), suggesting that ZEB1 directly inhibits miR-200c-stimulated COX-2 up-regulation at the

transcriptional level in mouse endothelial cells. In vitro evidence also showed that ZEB1

overexpression down-regulated COX-2 expression in db/db mouse aortas (Figure 6E). Further

experiments showed that miR-200c (24 hours) did not change the mRNA levels of PGF2α synthases

(Cbr1 and Fam213b), PGE2 synthase, PGI2 synthase, and TXA2 synthase (Online Figure VB), but it

increased PGE2 level by ~5 folds in the medium (3-4 ng/ml vs 15-20 ng/ml) and by ~2 folds in the

aortas (0.15-0.2 ng/mg vs 0.4-0.5ng/mg aorta). PGI2 (assayed in form of 6-keto PGF1α) level was also

increased by ~2 folds in the medium (10-13 ng/ml vs 17-25 ng/ml), but not in the aortas (Online

Figure VC&D). We next tested whether these two elevated PGs affected EDRs in mouse aortas.

PGE2 at a concentration of 100 nmol/L (35.2 ng/ml, ~2-fold of the level in the medium) attenuated

ACh-induced relaxation (Online Figure VE). However, 100 nmol/L of PGI2 (37.4 ng/ml, ~2-fold of

the level in the medium) had no effect, indicating that PGE2 is likely involved in miR-200c-induced

endothelial dysfunction in mouse aortas.


15

DISCUSSION

The key findings of the present study include (i) miR-200c expression is elevated in arteries from

diabetic mice and patients, and hyperglycemia stimulates miR-200c expression via a ROS-dependent

mechanism; (ii) miR-200c overexpression impairs EDRs in non-diabetic mouse aortas and

suppression of miR-200c by ad-anti-miR-200c improved EDRs in db/db mouse aortas and

flow-mediated dilatation of resistance mesenteric arteries; (iii) miR-200c suppresses ZEB-1, leading

to COX-2 up-regulation which in turn impairs endothelial function in diabetic mice; and (iv) ZEB-1

overexpression restores endothelial function in both conduit and resistance arteries in diabetes. The

present results highlight the prospect of miR-200c-ZEB1-COX-2 axis as potential novel therapeutic

targets to restore endothelial function in diabetes (Figure 6F).

Approximately 2000 miRNAs have so far been identified in human, which are believed to

control the expression of at least 30% of genes and participate in nearly every aspect of biological

processes, including cell proliferation, differentiation, apoptosis, and development (27). Most studies

of miRNAs have mainly focused on their roles in the development and cancer growth. However, it is

only known to a much lesser degree concerning the involvement of miRNAs in the development of

diabetes and its vascular complications. Our initial screening shows a markedly elevated expression

of miR-200c in db/db mouse aortas. Nevertheless, the pathological significance of miR-200c

up-regulation in diabetic vasculopathy is basically unexplored.

ROS is critically involved in hyperglycemia-induced endothelial dysfunction as elimination of

ROS by tempol improves endothelial function in db/db mouse aortas (28). The present study shows

that high glucose is able to up-regulate miR-200c expression, which is mediated by oxidative stress

because high glucose-stimulated miR-200c up-regulation in MAECs is reversed by tempol.

Furthermore, HX-XO, a ROS generator, also increases miR-200c expression. Likewise, a recent

study shows that H2O2 raises miR-200c expression in human endothelial cells (29). By contrast,

miR-200c overexpression does not affect ROS production in endothelial cells as reflected by both in


16

situ DHE staining and ERP spectroscopy. These results suggest that hyperglycemia-associated

oxidative stress is most likely to account for miR-200c up-regulation in endothelial cells under

diabetic conditions. These initial observations drove us to elucidate the pathophysiological role of

miR-200c in diabetic endothelial dysfunction, aided by the use of viral constructs in a series of in

vitro, ex vivo and in vivo studies. We first demonstrate that overexpression of miR-200c impairs

endothelial function in aortas from non-diabetic mice and such impairment can be reversed by

inhibition of miR-200c in both conduit and resistance arteries in db/db mice. Taken together, we

establish that elevated expression of miR-200c in diabetic conditions is likely a key mediator of

diabetic endothelial dysfunction.

We next studied the detailed molecular mechanisms underlying miR-200c-induced endothelial

dysfunction. ZEB1 is a zinc finger transcriptional repressor and expressed in various types of cells.

MiR-200 family is known to inhibit epithelial to mesenchymal transition (ETM) during cancer

development by repression of ZEB1 (30-32). One previous study showed that miR-200c suppresses

ZEB1 expression and subsequently leads to endothelial cell senescence and apoptosis (29). We also

found that miR-200c inhibits ZEB1 expression in non-diabetic mouse aortas while overexpression of

ZEB1 attenuates miR-200c-induced impairment of endothelial function in these aortas, indicating

that ZEB1 down-regulation is likely involved in miR-200c-induced endothelial dysfunction in

normal mice. However, it is unknown whether ZEB1 also plays a significant role in diabetes-related

endothelial dysfunction. The present study shows that ZEB1 expression is decreased in db/db mouse

aortas and suppression of miR-200c restores the diminished ZEB1 expression. More importantly,

transduction of ZEB1 overexpressing adenovirus profoundly improves endothelial function in db/db

mice without affecting insulin sensitivity (Online Figure VI), and this effect is almost identical to

that of miR-200c inhibition. It is therefore probable that hyperglycemia in diabetes up-regulates

miR-200c expression which subsequently down-regulates ZEB1 expression, leading to impaired

endothelial function. This notion is clearly supported by the observation that ZEB1 overexpression is


17

accompanied simultaneously with miR-200c down-regulation in aortas from not only non-diabetic

mice but also diabetic db/db mice. Previous studies on epithelial cells showed that miR-200 and ZEB

are mutually negative regulators of their expression and control the typical EMT-associated

properties in cancer development (23). Here, we also demonstrate that this reciprocal negative

regulatory circuit plays an important role in the maintenance of diabetic endothelial dysfunction.

Previous studies revealed that the up-regulated COX-2 expression and activity is a crucial

contributor to diabetes- or hyperglycemia-associated endothelial dysfunction (33; 34). However, the

exact molecular mechanism mediating hyperglycemia-stimulated COX-2 up-regulation remains

largely unclear. Few earlier studies suggested that the PI3K/Akt signaling and transcriptional factors

NF-κB and CREB are involved (35; 36). Here, we report that miR-200c stimulation elevates COX-2

expression in non-diabetic mouse aortas, which is reversed by anti-miR-200c or ZEB1

overexpression. In addition, ZEB1 overexpression down-regulates COX-2 expression in db/db

mouse aortas. These results suggest that the miR-200c/ZEB1 negative feedback loop mediates a

substantial part of hyperglycemia-stimulated COX-2 up-regulation in endothelial cells under diabetic

conditions. The essential role of COX-2 in miR-200c-induced endothelial dysfunction is finally

confirmed by the inability of miR-200c to attenuate EDRs in aortas from COX-2-/-

mice. The present

study showed that miR 200c-induced COX-2 up-regulation resulted in a 5-fold increase of PGE2 in

the medium and a 2-fold increase in mouse aortas. PGI2 (assayed in form of 6-keto PGF1α) was also

increased by 2 folds only in the medium. PGE2 induces vasoconstriction by binding to PGE2 receptor

1 and 3 (37; 38). PGI2 was also reported to induce contraction in aortas of spontaneously

hypertensive rats and aged Wistar-Kyoto rats probably by interacting with thromboxane A2 receptors

(39). Therefore, either PGE2 or PGI2 are possible candidates to mediate miR-200c-induced

endothelial dysfunction. Further experiments showed that pretreatment with PGE2 but not PGI2 can

actually attenuate ACh-induced relaxations in C57BL/6 mouse aortas, thus suggesting that PGE2 is

likely to contribute to COX-2 up-regulation-associated endothelial dysfunction in mice.


18

The clinical use of several COX-2 inhibitors was found to increase thrombotic cardiovascular

events (40; 41). This adverse effect is likely related to the disrupted prothrombotic/antithrombotic

balance. Human platelets contain only COX-1 and the major prostaglandin is the potent

pro-aggregatory and vasoconstrictive thromboxane A2 (TXA2) (42), while endothelial cells normally

express COX-2 and the major COX-2-derived arachidonic acid product is prostacyclin (PGI2) in

endothelial cells (43; 44). PGI2 can interact with platelet IP receptor to inhibit platelet aggregation.

However, selective inhibition of COX-2 reduces the production of PGI2 in endothelial cells, while

leaving platelet production of TXA2 intact, tilting the prothrombotic/antithrombotic balance toward

thrombosis (40; 41), which is probably the main cause of cardiovascular events associated with the

use of COX-2 inhibitors in some patients. On the other hand, our experimental results show that

COX-2 up-regulation leads to elevated production of PGE2, the latter can reduce EDR, suggesting

that type(s) of prostaglandins derived from COX-2 upregulation induced in different situations may

determine its impact (harmful or beneficial) on vascular function.

It is very important to note that like diabetic mouse arteries, renal arteries from diabetic patients

also exhibit an increased miR-200c expression and decreased ZEB1 expression. Moreover,

overexpression of miR-200c impairs endothelial function in renal arteries from non-diabetic subjects,

which is again reversed by co-treatment with ad-anti-miR-200c. Although the renal vascular

reactivity can be influenced by the varied disease backgrounds of diabetic patients from whom the

arteries were obtained, the present study provides useful evidence for the first time that abnormal

miR-200c/ZEB-1 expression may involve endothelial dysfunction in diabetic patients.

In conclusion, we demonstrate the up-regulated miR-200c in arteries from both diabetic mice and

patients. Inhibition of miR-200c by anti-miR-200c and ZEB1 overexpression effectively restore the

impaired endothelial function in both conduit and resistance arteries of diabetic mice through

inhibiting the expression and activity of COX-2, an important mediator of vascular dysfunction

probably through elevating prostaglandins such as PGE2. The present study not only deepens our


19

understanding about the role of miRNAs in vascular pathophysiology associated with diabetes but

also adds candidates to the existing list of recently described therapeutic “anti-miRs” if their safety is

to be approved. Taken together, miR-200c could serve as a promising target for ameliorating diabetic

vasculopathy.

Acknowledgments

We thank Professor Gregory Goodall (University of Adelaide, Australia) and Professor De-Pei Liu

(Peking Union Medical College, China) for kindly providing us the plasmids. This study was

supported by Research Grants Council of Hong Kong (CUHK2/CRF/12G, T12-402/13N), National

Natural Science Foundation of China (81270932, 81471082 and 91339117), Beijing Natural Science

Foundation (5122028), Hong Kong Scholarship Program, and CUHK High Promise Initiatives.

Author Contributions

H.Z., J.L., D.Q., L.W., and J.L. conducted the experiments and analyzed the data. H.Z., J.L. and Y.H.

designed the experiments and prepared the manuscript. C.W.L. and Z.G. helped with functional

studies; P.L. provided plasmids; G.L.T. provided knockout mice; H.K.L. performed bioassays; C.F.N.

provided human samples; X.Y. and R.C.W.M. assisted with discussion. Y.H. is the guarantor of this

work and, as such, had full access to all the data in the study and takes responsibility for the integrity

of the data and the accuracy of the data analysis.

Conflict of Interest

No.


20

References

1. Danaei G, Finucane MM, Lu Y, Singh GM, Cowan MJ, Paciorek CJ, Lin JK, Farzadfar F, Khang

YH, Stevens GA, Rao M, Ali MK, Riley LM, Robinson CA, Ezzati M, Global Burden of Metabolic

Risk Factors of Chronic Diseases Collaborating G: National, regional, and global trends in fasting

plasma glucose and diabetes prevalence since 1980: systematic analysis of health examination

surveys and epidemiological studies with 370 country-years and 2.7 million participants. Lancet

2011;378:31-40

2. King H, Aubert RE, Herman WH: Global burden of diabetes, 1995-2025 - Prevalence, numerical

estimates, and projections. Diabetes Care 1998;21:1414-1431

3. Grundy SM, Benjamin IJ, Burke GL, Chait A, Eckel RH, Howard BV, Mitch W, Smith SC, Jr.,

Sowers JR: Diabetes and cardiovascular disease: a statement for healthcare professionals from the

American Heart Association. Circulation 1999;100:1134-1146

4. Spinetti G, Kraenkel N, Emanueli C, Madeddu P: Diabetes and vessel wall remodelling: from

mechanistic insights to regenerative therapies. Cardiovasc Res 2008;78:265-273

5. Tesfamariam B, Brown ML, Cohen RA: Elevated Glucose Impairs Endothelium-Dependent

Relaxation by Activating Protein-Kinase-C. J Clin Invest 1991;87:1643-1648

6. Williams SB, Goldfine AB, Timimi FK, Ting HH, Roddy MA, Simonson DC, Creager MA: Acute

hyperglycemia attenuates endothelium-dependent vasodilation in humans in vivo. Circulation

1998;97:1695-1701

7. Bushati N, Cohen SM: MicroRNA functions. Annu Rev Cell Dev Bi 2007;23:175-205

8. Urbich C, Kuehbacher A, Dimmeler S: Role of microRNAs in vascular diseases, inflammation,

and angiogenesis. Cardiovasc Res 2008;79:581-588

9. Ji RR, Cheng YH, Yue JM, Yang J, Liu XJ, Chen H, Dean DB, Zhang CX: MicroRNA expression

signature and antisense-mediated depletion reveal an essential role of microRNA in vascular

neointimal lesion formation. Circ Res 2007;100:1579-1588


21

10. Leeper NJ, Raiesdana A, Kojima Y, Chun HJ, Azuma J, Maegdefessel L, Kundu RK,

Quertermous T, Tsao PS, Spin JM: MicroRNA-26a Is a Novel Regulator of Vascular Smooth Muscle

Cell Function. J Cell Physiol 2011;226:1035-1043

11. Fang Y, Shi CZ, Manduchi E, Civelek M, Davies PF: MicroRNA-10a regulation of

proinflammatory phenotype in athero-susceptible endothelium in vivo and in vitro. P Natl Acad Sci

USA 2010;107:13450-13455

12. Zhang Y, Qin W, Zhang L, Wu X, Du N, Hu Y, Li X, Shen N, Xiao D, Zhang H, Li Z, Zhang Y,

Yang H, Gao F, Du Z, Xu C, Yang B: MicroRNA-26a prevents endothelial cell apoptosis by directly

targeting TRPC6 in the setting of atherosclerosis. Scientific reports 2015;5:9401

13. McArthur K, Feng B, Wu Y, Chen S, Chakrabarti S: MicroRNA-200b regulates vascular

endothelial growth factor-mediated alterations in diabetic retinopathy. Diabetes 2011;60:1314-1323

14. Reddy MA, Jin W, Villeneuve L, Wang M, Lanting L, Todorov I, Kato M, Natarajan R:

Pro-inflammatory role of microrna-200 in vascular smooth muscle cells from diabetic mice.

Arterioscl Throm Vas 2012;32:721-729

15. Kato M, Arce L, Wang M, Putta S, Lanting L, Natarajan R: A microRNA circuit mediates

transforming growth factor-beta 1 autoregulation in renal glomerular mesangial cells. Kidney Int

2011;80:358-368

16. Wong WT, Tian XY, Xu A, Yu J, Lau CW, Hoo RL, Wang Y, Lee VW, Lam KS, Vanhoutte PM,

Huang Y: Adiponectin is required for PPARgamma-mediated improvement of endothelial function

in diabetic mice. Cell metabolism 2011;14:104-115

17. Tian XY, Wong WT, Xu A, Lu Y, Zhang Y, Wang L, Cheang WS, Wang Y, Yao X, Huang Y:

Uncoupling protein-2 protects endothelial function in diet-induced obese mice. Circ Res

2012;110:1211-1216

18. Chan YC, Leung FP, Wong WT, Tian XY, Yung LM, Lau CW, Tsang SY, Yao X, Chen ZY,

Huang Y: Therapeutically relevant concentrations of raloxifene dilate pressurized rat resistance


22

arteries via calcium-dependent endothelial nitric oxide synthase activation. Arterioscl Throm Vas

2010;30:992-999

19. Luo J, Deng ZL, Luo X, Tang N, Song WX, Chen J, Sharff KA, Luu HH, Haydon RC, Kinzler

KW, Vogelstein B, He TC: A protocol for rapid generation of recombinant adenoviruses using the

AdEasy system. Nat Protoc 2007;2:1236-1247

20. Marquart TJ, Allen RM, Ory DS, Baldan A: miR-33 links SREBP-2 induction to repression of

sterol transporters. P Natl Acad Sci USA 2010;107:12228-12232

21. Urbich C, Kuehbacher A, Dimmeler S: Role of microRNAs in vascular diseases, inflammation,

and angiogenesis. Cardiovasc Res 2008;79:581-588

22. Wong SL, Leung FP, Lau CW, Au CL, Yung LM, Yao X, Chen ZY, Vanhoutte PM, Gollasch M,

Huang Y: Cyclooxygenase-2-derived prostaglandin F2alpha mediates endothelium-dependent

contractions in the aortae of hamsters with increased impact during aging. Circ Res

2009;104:228-235

23. Burk U, Schubert J, Wellner U, Schmalhofer O, Vincan E, Spaderna S, Brabletz T: A reciprocal

repression between ZEB1 and members of the miR-200 family promotes EMT and invasion in

cancer cells. Embo Rep 2008;9:582-589

24. Bagi Z, Erdei N, Toth A, Li W, Hintze TH, Koller A, Kaley G: Type 2 diabetic mice have

increased arteriolar tone and blood pressure: enhanced release of COX-2-derived constrictor

prostaglandins. Arterioscl Throm Vas 2005;25:1610-1616

25. Tian XY, Wong WT, Leung FP, Zhang Y, Wang YX, Lee HK, Ng CF, Chen ZY, Yao X, Au CL,

Lau CW, Vanhoutte PM, Cooke JP, Huang Y: Oxidative stress-dependent cyclooxygenase-2-derived

prostaglandin f(2alpha) impairs endothelial function in renovascular hypertensive rats. Antioxid

Redox Signal 2012;16:363-373

26. Wong WT, Tian XY, Chen Y, Leung FP, Liu L, Lee HK, Ng CF, Xu A, Yao X, Vanhoutte PM,

Tipoe GL, Huang Y: Bone morphogenic protein-4 impairs endothelial function through oxidative


23

stress-dependent cyclooxygenase-2 upregulation: implications on hypertension. Circ Res

2010;107:984-991

27. Lewis BP, Burge CB, Bartel DP: Conserved seed pairing, often flanked by adenosines, indicates

that thousands of human genes are microRNA targets. Cell 2005;120:15-20

28. Lau YS, Tian XY, Mustafa MR, Murugan D, Liu J, Zhang Y, Lau CW, Huang Y: Boldine

improves endothelial function in diabetic db/db mice through inhibition of angiotensin II-mediated

BMP4-oxidative stress cascade. Br J Pharmacol 2013;170:1190-1198

29. Magenta A, Cencioni C, Fasanaro P, Zaccagnini G, Greco S, Sarra-Ferraris G, Antonini A,

Martelli F, Capogrossi MC: miR-200c is upregulated by oxidative stress and induces endothelial cell

apoptosis and senescence via ZEB1 inhibition. Cell Death Differ 2011;18:1628-1639

30. Wellner U, Schubert J, Burk UC, Schmalhofer O, Zhu F, Sonntag A, Waldvogel B, Vannier C,

Darling D, zur Hausen A, Brunton VG, Morton J, Sansom O, Schuler J, Stemmler MP, Herzberger C,

Hopt U, Keck T, Brabletz S, Brabletz T: The EMT-activator ZEB1 promotes tumorigenicity by

repressing stemness-inhibiting microRNAs. Nat Cell Biol 2009;11:1487-1495

31. Schliekelman MJ, Gibbons DL, Faca VM, Creighton CJ, Rizvi ZH, Zhang Q, Wong CH, Wang

H, Ungewiss C, Ahn YH, Shin DH, Kurie JM, Hanash SM: Targets of the Tumor Suppressor

miR-200 in Regulation of the Epithelial-Mesenchymal Transition in Cancer. Cancer Res

2011;71:7670-7682

32. Bracken CP, Gregory PA, Kolesnikoff N, Bert AG, Wang J, Shannon MF, Goodall GJ: A

double-negative feedback loop between ZEB1-SIP1 and the microRNA-200 family regulates

epithelial-mesenchymal transition. Cancer Res 2008;68:7846-7854

33. Pannirselvam M, Wiehler WB, Anderson T, Triggle CR: Enhanced vascular reactivity of small

mesenteric arteries from diabetic mice is associated with enhanced oxidative stress and

cyclooxygenase products. Br J Pharmacol 2005;144:953-960


24

34. Cosentino F, Eto M, De Paolis P, van der Loo B, Bachschmid M, Ullrich V, Kouroedov A, Delli

Gatti C, Joch H, Volpe M, Luscher TF: High glucose causes upregulation of cyclooxygenase-2 and

alters prostanoid profile in human endothelial cells: role of protein kinase C and reactive oxygen

species. Circulation 2003;107:1017-1023

35. Shanmugam N, Gonzalo ITG, Natarajan R: Molecular mechanisms of high glucose-induced

cyclooxygenase-2 expression in monocytes. Diabetes 2004;53:795-802

36. Sheu ML, Ho FM, Yang RS, Chao KF, Lin WW, Lin-Shiau SY, Liu SH: High glucose induces

human endothelial cell apoptosis through a phosphoinositide 3-kinase-regulated cyclooxygenase-2

pathway. Arterioscl Throm Vas 2005;25:539-545

37. Dong YJ, Jones RL, Wilson NH: Prostaglandin E receptor subtypes in smooth muscle: agonist

activities of stable prostacyclin analogues. Br J Pharmacol 1986;87:97-107

38. Chen L, Miao Y, Zhang Y, Dou D, Liu L, Tian X, Yang G, Pu D, Zhang X, Kang J, Gao Y,

Wang S, Breyer MD, Wang N, Zhu Y, Huang Y, Breyer RM, Guan Y: Inactivation of the

E-prostanoid 3 receptor attenuates the angiotensin II pressor response via decreasing arterial

contractility. Arterioscl Throm Vas 2012;32:3024-3032

39. Feletou M, Verbeuren TJ, Vanhoutte PM: Endothelium-dependent contractions in SHR: a tale of

prostanoid TP and IP receptors. Br J Pharmacol 2009;156:563-574

40. Antman EM, Bennett JS, Daugherty A, Furberg C, Roberts H, Taubert KA, American Heart A:

Use of nonsteroidal antiinflammatory drugs: an update for clinicians: a scientific statement from the

American Heart Association. Circulation 2007;115:1634-1642

41. Patrono C, Baigent C: Nonsteroidal anti-inflammatory drugs and the heart. Circulation

2014;129:907-916

42. Rocca B, Secchiero P, Ciabattoni G, Ranelletti FO, Catani L, Guidotti L, Melloni E, Maggiano N,

Zauli G, Patrono C: Cyclooxygenase-2 expression is induced during human megakaryopoiesis and

characterizes newly formed platelets. P Natl Acad Sci USA 2002;99:7634-7639


25

43. Topper JN, Cai J, Falb D, Gimbrone MA, Jr.: Identification of vascular endothelial genes

differentially responsive to fluid mechanical stimuli: cyclooxygenase-2, manganese superoxide

dismutase, and endothelial cell nitric oxide synthase are selectively up-regulated by steady laminar

shear stress. P Natl Acad Sci USA 1996;93:10417-10422

44. Yu Y, Ricciotti E, Scalia R, Tang SY, Grant G, Yu Z, Landesberg G, Crichton I, Wu W, Pure E,

Funk CD, FitzGerald GA: Vascular COX-2 modulates blood pressure and thrombosis in mice. Sci

Transl Med 2012;4:132ra154


26

Figure legends

Figure 1. The elevated expression of miR-200c in diabetic db/db mouse aortas and in high

glucose-treated primary mouse endothelial cells (MAECs)

Real-time quantitative polymerase chain reaction (qPCR) analysis of miR-200a, b, c expression in

db/m+ mouse aortas (A) and in human renal arteries (B). *p

<0.05 vs. miR-200a. (C) qPCR analysis

of miR-200c expression in non-diabetic or diabetic mouse aortas. *p

<0.05 vs. db/m

+. (D) MiR-200c

expression in renal arteries from non-diabetic subjects (non-DM) and diabetic patients (DM).

*p<0.05 vs. Non-DM. (E) qPCR assay of miR-200c expression in MAECs incubated in high

mannitol (HM, 25 mM plus 5 mM glucose, 24 hours) or high glucose (HG, 30 mM, 24 hours) in the

presence or absence of tempol (100 µM). *p<0.05 vs. HM; #p<0.05 vs. HG. (F) qPCR assay of

miR-200c expression in MAECs incubated in HX-XO (100 µM hypoxanthine plus 0.01 units/ml

xanthine oxidase, 24 hours) in the presence or absence of tempol (100 µM). *p<0.05 vs. Control;

#p<0.05 vs. HX-XO. (G&H) The effect of miR-200c overexpression on ROS production as

measured by ERP spectroscopy (G) and in situ DHE staining of endothelium of mouse aortas (H).

*p<0.05 vs. miR-Ctrl. Data are means±SEM of 4-5 experiments.

Figure 2. MiR-200c impairs endothelium-dependent relaxations in normal mouse aortas and

suppression of miR-200c enhances endothelial function in diabetic mice

(A) The inhibitory effect of ad-miR-200c (adenovirus-mediated miR-200c, 107 pfu, 24-hour

incubation) on ACh-induced EDRs in db/m+ mouse aortas was reversed by ad-anti-miR-200c.

*p<0.05 vs. miR-Ctrl; #p<0.05 vs. miR-200c. (B) qPCR analysis of the relative miR-200c expression

in db/m+ mouse aortas treated with ad-miR-200c for 24 hours with or without co-treatment of

ad-anti-miR-200c. *p<0.05 vs. miR-Ctrl, #p<0.05 vs. miR-200c. (C) The inhibitory effect of

ad-miR-200c transduction on EDRs in renal arteries of non-diabetic subjects. *p<0.05 vs. miR-Ctrl;

#p<0.05 vs. miR-200c. (D&E) Ad-anti-miR-200c improved EDRs in db/db mouse aortas. *p<0.05


27

vs. miR-Ctrl. (F) Ad-anti-miR-200c augmented flow-mediated dilatation in resistance mesenteric

arteries of db/db mice. *p <0.05 vs. miR-Ctrl. (G) Ad-anti-miR-200c reversed high glucose (30 mM,

48 hours)-induced endothelial dysfunction in normal mouse aortas. *p <0.05 vs. miR-Ctrl. Data are

means±SEM of 5-6 experiments.

Figure 3. MiR-200c suppresses ZEB1 expression and ZEB1 overexpression ameliorates

miR-200c-induced endothelial dysfunction

(A&B) Ad-miR-200c transduction suppressed ZEB1 mRNA and protein levels in MAECs, which

was reversed by co-treatment with ad-anti-miR-200c. *p <0.05 vs. miR-Ctrl; #p<0.05 vs. miR-200c.

(C) Western blotting analysis of ZEB1 expression in MAECs transduced with ad-miR-ZEB1 for 24

hours. *p<0.05 vs. ad-GFP. (D) Ad-ZEB1 (107 pfu, 24 hours) reversed miR-200c-induced

endothelial dysfunction in normal mouse aortas. *p <0.05 vs. miR-Ctrl; #p<0.05 vs. miR-200c. Data

are means±SEM of 4-5 experiments.

Figure 4. ZEB1 expression is decreased in diabetic mouse aortas and ad-ZEB1 transduction

improves endothelial function in diabetic mice

(A) Western blotting analysis of ZEB1 expression in db/m+ or db/db mouse aortas.

*p

<0.05 vs.

db/m+. (B) ZEB1 expression in renal arteries from non-diabetic and diabetic humans. *p< 0.05 vs.

Non-DM. (C) Ad-anti-miR-200c (24 hours) increased ZEB1 expression in db/db mouse aortas in a

dose-dependent manner. *p<0.05 vs. miR-Ctrl. (D) Ad-anti-miR-200c reversed the high glucose (30

mM, 24 hours)-induced reduction in ZEB1 expression in MAECs. *p< 0.05 vs. Mannitol; #p<0.05 vs.

high glucose. (E&F) Ad-ZEB1 transduction enhanced endothelial function in both aortas and

mesenteric arteries in db/db mice. *p<0.05 vs. ad-GFP. (G) Ad-ZEB1 transduction reduced

miR-200c level in db/db mouse aortas. *p<0.05 vs. ad-GFP. (H) The effect of ad-ZEB1 transduction

on miR-200c expression in MACEs. *p<0.05 vs. ad-GFP. Data are means±SEM of 4-5 experiments.


28

Figure 5. In vivo delivery of ad-anti-miR-200c or ad-ZEB1 suppresses miR-200c expression and

improves endothelial function in db/db mice

(A) Ad-anti-miR-200c in vivo improved EDRs in db/db mouse aortas. *p <0.05 vs. miR-Ctrl. (B&C)

In vivo ad-anti-miR-200c transduction suppressed miR-200c expression and increased ZEB1

expression in db/db mouse aortas. *p<0.05 vs. miR-Ctrl. (D) In vivo ad-ZEB1 transduction improved

EDRs in db/db mouse aortas. *p<0.05 vs. ad-GFP. (E&F) ad-ZEB1 transduction increased ZEB1

expression and suppressed miR-200c expression in db/db mouse aortas. *p<0.05 vs. ad-GFP. Data

are means±SEM of 4-5 experiments.

Figure 6. COX-2 mediates miR-200c-induced endothelial dysfunction

(A) EDRs in COX-2-/-

mouse aortas were not affected by 24-hour treatment with ad-miR-200c (107

pfu). (B) Overexpression of ZEB1 reduced miR-200c-induced up-regulation of COX-2 without

affecting COX-1 expression in MAECs. *p<0.05 vs. miR-Ctrl; #p<0.05 vs. miR-200c. (C)

Ad-miR-200c transduction raised expression of COX-2 but not COX-1 in MAECs. *p<0.05 vs.

miR-Ctrl; #p<0.05 vs. miR-200c. (D) Luciferase reporter gene assay showing that miR-200c-induced

COX-2 promoter activity was reversed by overexpression of ZEB1, but not NF-κB or AP-1 in H5V

mouse endothelial cells. *p<0.05 vs. miR-Ctrl. (E) Reduced COX-2 expression in db/db mouse

aortas after in vitro ZEB1 overexpression. *p<0.05 vs. ad-GFP. Data are means±SEM of 4-5

experiments. (F) The schematic illustration of the proposed role of miR-200c/ZEB1/COX-2

signaling cascade in endothelial dysfunction in diabetes.


199x265mm (300 x 300 DPI)


Data Supplement - Zhang et al., 2015

1

Inhibition of miR-200c restores endothelial function in diabetic mice

through suppression of COX-2

Huina Zhang1,2,3

, Jian Liu1, Dan Qu

1, Li Wang

1, Jiang-Yun Luo

1, Chi Wai Lau

1, Pingsheng Liu

3,

Zhen Gao1, George L. Tipoe

4, Hung Kay Lee

5, Chi Fai Ng

6, Ronald Ching Wan Ma

7, Xiaoqiang

Yao1, Yu Huang

1

1Institute of Vascular Medicine, Shenzhen Research Institute, and Li Ka Shing Institute of Health

Sciences , Chinese University of Hong Kong, Hong Kong, China; 2Beijing Institute of Heart, Lung

and Blood Vessel Diseases, Beijing Anzhen Hospital Affiliated to the Capital Medical University,

Beijing, China; 3National Laboratory of Biomacromolecules, Institute of Biophysics, Chinese

Academy of Sciences, Beijing, China; 4Department of Anatomy, University of Hong Kong, Hong

Kong, China; 5Department of Chemistry,

6Department of Surgery and

7Department of Medicine and

Therapeutics, Chinese University of Hong Kong, Hong Kong, China;

Additional Results



2

The expression of miRNAs in mouse aortas and the effect of miR-200c overexpression on ROS

production in endothelial cells. The miRNA screening assay demonstrated that miR-200c was

significantly higher in db/db mouse aortas (Online Figure IA). Overexpression of miR-200c did not

induce ROS production in mouse aortic endothelial cells (MAECs) as detected by ERP spectroscopy

(Online Figure IB) or by DHE staining (Online Figure IC).

Online Figure I. (A) The miRNAs screening assay comparing the expression levels of

endothelium-relevant miRNAs in diabetic db/db and non-diabetic db/m+ mouse aortas. *p<0.05 vs.

db/m+. (B&C) The effect of miR-200c on ROS production in MAECs. *p<0.05 vs. miR-Ctrl. Data are

means±SEM of 4-5 experiments.



3

The miR-200c overexpression attenuates endothelium-dependent relaxations (EDRs) in mouse

aortas. Overexpression of miR-200c (ad-miR-200) but not miR-Ctrl (ad-miR-Ctrl) by adenovirus

transduction (107 pfu, 24 hours) reduced ACh-induced EDRs in db/m

+ mouse aortas (Online Figure

IIA&B). By contrast, sodium nitroprusside (SNP)-induced endothelium-independent relaxations in

db/m+ mouse aortas were comparable in different groups of mice (Online Figure IIC).

Online Figure II. (A) Representative traces showing that ACh-induced EDRs in db/m

+ mouse aortas

were attenuated following transduction with miR-200c overexpressing adenovirus. (B) Lack of the

effect of ad-miR-Ctrl on EDRs. (C) SNP-induced endothelium-independent relaxations in db/m+

mouse aortas following viral transduction. Data are means±SEM of 4-5 experiments.



4

Anti-miR-200c suppresses miR-200c expression and improves flow-mediated dilatation of db/db

mouse mesenteric arteries. Transduction of anti-miR-200 overexpressing adenovirus (24 hours, 0.1,

0.3,1 *107 pfu) progressively suppressed miR-200 expression in db/db mouse aortas (Online Figure IIIA)

and augmented flow-induced dilatation in db/db mouse mesenteric arteries (Online Figure IIIB).

Online Figure III. (A) qPCR analysis of miR-200c expression in db/db mouse aortas following ex

vivo 24-hour incubation with different dosages of ad-anti-miR-200c. *p<0.05 vs. miR-Ctrl. (B). Traces

showed the effect of ad-anti-miR-200c on flow-mediated dilatation in db/db mouse resistance

mesenteric arteries. Data are means±SEM of 4-5 experiments.



5

ZEB1 overexpression improves EDRs and flow-mediated dilatation of mesenteric arteries

from db/db mice. Ad-ZEB1 transduction increased ZEB1 expression in db/db mouse aortas in

a dose-dependent manner (Online Figure IVA) and enhanced EDRs in aortas and

flow-mediated dilatation of mesenteric arteries from db/db mice (Online Figure IVB&C).

Online Figure IV. (A) ZEB1 expression in db/db mouse aortas after ad-ZEB1 transduction. *p< 0.05

vs. ad-GFP. (B&C) Traces showing the effect of ad-ZEB1 transduction on EDRs in db/db mouse

aortas and on flow-mediated dilatation in db/db mouse mesenteric arteries. Data are means±SEM of

4-5 experiments.



6

The miR-200c-induced EDR impairment may involve COX-2-dependent PGE2

production. MiR-200c-induced endothelial dysfunction was absent in COX-2 knockout mice

(Online Figure VA). MiR-200c overexpression increased Cbr1 expression (Online Figure VB),

PGE2 and PGI2 levels in the medium (Online Figure VC) and PGE2 level in the mouse aortas

(Online Figure VD). Pretreatment with PGE2, but not PGI2, attenuated ACh-induced relaxation

(Online Figure VE).

Online Figure V. (A) Traces showing the effect of ad-miR-200c transduction (24 hours) on EDRs in

aortas from COX-2 knockout mice. (B) The mRNA level of PGs synthases in the mouse aortas after

miR-200c overexpression. (C) Levels of four PGs in the medium measured by LC/MS. *p< 0.05 vs.

miR-Ctrl. (D) The amount of four PGs in mouse aortas measured by LC/MS. *p< 0.05 vs. miR-Ctrl. (F)

Acute inhibitory effect of PGE2 (100 nmol/L) but not PGI2 (100 nmol/L) on ACh-induced

relaxations.*p<0.05 vs.Control. Data are means±SEM of 4-5 experiments.



7

Transduction of anti-miR-200c overexpressing adenovirus or ad-ZEB1 does not affect

insulin sensitivity in db/db mice. There was no difference in glucose tolerance (Online Figure

VIA) and insulin tolerance (Online Figure VIB) in db/db mice after anti-miR-200c or ad-ZEB1

transduction (one week).

Online Figure VI. Effects of anti-miR-200c or ad-ZEB1 transduction on glucose tolerance (A) and

insulin tolerance (B) in db/db mice. Data are means±SEM of 4-5 experiments.


inhibition of mir-200c restores endothelial function in diabetic … · 2016. 1. 14. · kong, hong...

Documents