Vol. 57, No. 4APPLIED AND ENVIRONMENTAL MICROBIOLOGY, Apr. 1991, p. 1013-10170099-2240/91/041013-05$02.00/0Copyright © 1991, American Society for Microbiology

Detection of Escherichia coli and Shigella spp. in Water by Usingthe Polymerase Chain Reaction and Gene Probes for uidASIM K. BEJ,l* JOSEPH L. DICESARE,2 LAWRENCE HAFF,2 AND RONALD M. ATLAS1

Department of Biology, University of Louisville, Louisville, Kentucky 40292,1 andPerkin-Elmer Corporation, Norwalk, Connecticut 068592

Received 19 October 1990/Accepted 28 January 1991

A method was developed for the detection of the fecal coliform bacterium Escherichia coli, using thepolymerase chain reaction and gene probes, based on amplifying regions of the uid gene that code for1,-glucuronidase, expression of which forms the basis for fecal coliform detection by the commercially availableColilert method. Amplification and gene probe detection of four different regions of uid specifically detected E.coli and Shigella species, including B-glucuronidase-negative strains of E. coli; no amplification was observedfor other coliform and nonenteric bacteria.

The Colilert test, which has been proposed as an alternateto conventional plating procedures for water quality moni-toring, is based on detecting ,-galactosidase activity, using acolorimetric reaction and the substrate o-nitrophenyl-p-ga-lactopyranoside for total coliforms, and 3-D-glucuronidaseactivity, using enzymatic transformation of the fluorogenicsubstrate 4-methylumbelliferyl-,-glucuronidide (MUG) toindicate the presence of the fecal bacterium Escherichia coli(8-10). The U.S. Environmental Protection Agency hasaccepted the Colilert test for total coliform detection but hasdeferred acceptance of Colilert for E. coli-specific detection(11). A MUG-based confirmation test for E. coli has beenaccepted by the U.S. Environmental Protection Agency(11). We have reported previously that polymerase chainreaction (PCR)-gene probe methods can be used to detecttotal coliform bacteria based on the lacZ gene and to detectE. coli, Salmonella spp., and Shigella spp. based on ampli-fication of regions of the lamB gene, which codes for3-galactosidase (5). In this study we examined the ability of

the uid gene, which codes for the 3-glucuronidase enzyme,to serve as a target for PCR-gene probe detection of E. coli.Our aim was to develop a PCR amplification-gene probedetection method that permits specific detection of targetfecal coliform bacteria, using the equivalent target gene, theexpression of which forms the basis for the second stage ofthe Colilert test. Thus, PCR-gene probe detection of lacZand uid would parallel the targets of the Colilert test for totaland fecal coliforms, respectively.

MATERIALS AND METHODSBacterial strains, recovery of DNA, and specificity of PCR

detection. To determine the specificity of uid for E. colidetection, DNA was extracted from exponential cultures byalkaline lysis with 0.5% sodium dodecyl sulfate treatment,using the procedure of Ausubel et al. (3). Following alkalinelysis, 0.7 M NaCl-1% hexadecyltrimethyl ammonium bro-mide was used to complex with polysaccharides. Proteinsand other impurities were removed by using chloroform-isoamyl alcohol (24:1), and DNA was further purified byphenol-chloroform-isoamyl alcohol (24:24:2) extractions.DNA was then precipitated by 2.5 volumes of isopropylalcohol and pelleted by centrifugation at 12,000 x g for 15

* Corresponding author.

min. The DNA pellets were washed once with cold 70%alcohol and dried under vacuum. Using this procedure, wewere able to recover 100 to 250 p.g of purified genomic DNAfrom each bacterial culture.One hundred American Type Culture Collection strains

were tested to determine the specificity of detection (2).These included strains from all genera of the family Entero-bacteriaceae as well as numerous other organisms found inwater and associated with humans. Also, 4 clinical MUG-negative E. coli isolates (7), 20 environmental MUG-positiveE. coli isolates, and 10 environmental MUG-negative E. coliisolates were tested. A mixture of purified genomic DNAs (1,ug each) from human placenta (Sigma) and Pseudomonascepacia, Salmonella typhimurium, Klebsiella oxytoca, Cit-robacter freundii, Enterobacter aerogenes bacterial strainsalso were tested alone or mixed with 50 ng of E. coli genomicDNA to examine whether nonspecific target DNAs wouldinterfere with this method of E. coli detection.PCR amplification. A 0.147-kb coding region of the E. coli

uidA gene, based on the sequence reported by Jefferson etal. (13), was amplified by PCR, using the 20- and 21-merprimers UAL-754 (5'-AAAACGGCAAGAAAAAGCAG-3')and UAR-900 (5'-ACGCGTGGTTACAGTCTTGCG-3').Primer UAL-754 was located between bp 754 and 773 andprimer UAR-900 was located between bp 880 and 900 in theamino-terminal coding region of the uidA gene of E. coli.Another set of 20-mer primers, UAL-1939 (5'-TATGGAATTTCGCCGATTTT-3') and UAR-2105 (5'-TGTTTGCCTCCCTGCTGCGG-3'), was used to amplify a 0.166-kb regionof the uidA gene. Primer UAL-1939 was located between bp1939 and 1958 and primer UAR 2105 was located between bp2085 and 2104 closer to the carboxyl region of the uidA geneof E. coli.A 0.153 kb portion of the regulatory region of uid, desig-

nated uidR, which is located upstream of the uidA structuralgene based on the sequence reported by Blanco et al. (6),was amplified with the 22-mer primers URL-301 (5'-TGTTACGTCCTGTAGAAAGCCC-3') and URR-432 (5'-AAAACTGCCTGGCACAGCAATT-3'). Primer URL-301 was lo-cated between bp 301 and 322 and primer URR-432 waslocated between bp 432 and 453 of the uidR sequence of E.coli. All primer sequences were compared with the GenBanknucleotide sequence data bank, using the Fasta program, forpossible homologies with other nontarget sequences.PCR amplification was performed with a DNA thermal

1013

on August 26, 2020 by guest

http://aem.asm

.org/D

ownloaded from

on A

ugust 26, 2020 by guesthttp://aem

.asm.org/

Dow

nloaded from

on August 26, 2020 by guest

http://aem.asm

.org/D

ownloaded from

APPL. ENVIRON. MICROBIOL.

cycler (Perkin-Elmer Cetus Corp., Norwalk, Conn.). ThePCR solution contained 1 x PCR reaction buffer (10x PCRreaction buffer contains 500 mM KCl, 500 mM Tris chloride[pH 8.9], and 25 mM MgCl2), 200 ,uM each of the deoxynu-cleoside triphosphate (Perkin-Elmer Cetus), 0.2 to 0.5 ,uMeach of the primers, and 2.5 U of Taq DNA polymerase(Perkin-Elmer Cetus). The total volume for PCR reactionwas 100 1.l. Typically, 1 ,ug (as determined by a Lambda IIIspectrophotometer [Perkin-Elmer Corp.]) of template DNAfrom each bacterial strain was initially denatured at 95°C for3 min. Then a total of 25 PCR cycles were run, using a

two-temperature PCR cycle with denaturation at 94°C for 1min and primer annealing and extension at 50°C for primersUAL-754 and UAR-900, 50°C for primers UAL-1939 and2105, and at 59°C for primers URL-301 and URR-432 for 1min. The annealing temperatures for each of the three sets ofuid primers were 5°C lower than the melting temperature, as

determined by using a computer-aided program, called Oligo(14). Oligonucleotide primers were synthesized with a PCR-MATE DNA synthesizer (Applied Biosystems, Foster City,Calif.) and purified by using either Poly-Pak cartridges (GlenResearch, Herndon, Va.) or reverse-phase high-perfor-mance liquid chromatography with a C8 3-,um reverse-phasecolumn (Perkin-Elmer).

Detection of amplified DNAs. PCR-amplified DNAs were

detected by using gel electrophoresis and radiolabeled geneprobes. An aliquot (1/10 volume) of the PCR-amplifiedsamples was separated by 10% vertical polyacrylamide gelelectrophoresis, using TBE buffer (0.089 M Tris-borate,0.089 M boric acid, and 0.002 M Na2EDTA [pH 8.0]), or by4% NuSieve (1:3; 1 part of NuSieve and 3 parts of SeaKemLE) agarose gel (catalog no. 50092, FMC), using TAE buffer(0.04 M Tris-acetate and 0.001 M Na2EDTA [pH 8.0]) (3), at5.7 to 9.0 V/cm for 2 to 3 h. The gels were stained in 2 x10-'% ethidium bromide solution for 5 to 10 min andvisualized with a Photo/Prepl UV transilluminator (Foto-dyne, Inc., New Berlin, Wis.).For Southern blot detection, the PCR-amplified DNAs,

which were separated by either agarose gel or polyacryl-amide gel electrophoresis described above) were denaturedby 0.4 M NaOH treatment for 20 to 30 mmn and transferred toa Zetaprobe nylon membrane (Bio-Rad Laboratories, Rich-mond, Calif.) by electroblotting, using a Trans-Blot appara-tus (Bio-Rad) as described by the manufacterer.The following gene probes were used for the detection of

various PCR-amplified DNAs: for the 0.147-kb uidA ampli-fied DNAs, a 50-mer oligonucleotide probe, UAP-1 (5'-TGCCGGGATCCATCGCAGCGTAATGCTCTACACCACGCCGAACACCTGGG-3'); for the 0.166-kb uidA amplifiedDNA, a 50-mer oligonucleotide probe, UAP-2 (5'AAAGGGATCTTCACTCGCGACCGCAAACCGAAGTCGGCGGCTTTTCTGCT-3'); and for the 0.153-kb uidR amplifiedDNA, a 40-mer URP-1 (5'CAACCCGTGAAATCAAAAAACTCGACGGCCTGTGGGCATT-3') oligonucleotide probe.The oligonucleotide gene probes were radiolabeled at their

5' ends by a modified version of the forward reactiondescribed by Ausubel et al. (3). The 30-1l reaction solutionused in this procedure contained 50 mM Tris hydrochloride(pH 7.5), 10 mM MgCl2, 5 mM dithiothreitol (Sigma), 1 mMKCl, 5 pmol of oligonucleotide probe, 120 pmol of [y-32p]ATP (specific activity, >3,000 Ci/mmol; New England Nu-clear Corp., Boston, Mass.), 1 mM spermidine (disodiumsalt), and 20 U of T4 polynucleotide kinase (US BiochemicalCorp., Cleveland, Ohio). The reaction mixture was incu-bated at 37°C for 1 h, and radiolabeled probes were concen-

trated and purified by using an IsoGene DNA purification kit(Perkin-Elmer Cetus, Emeryville, Calif.).

Sensitivity of PCR detection. To determine the sensitivityof PCR-gene probe detection, genomic DNA from E. coliwas serially diluted to establish a concentration range of 1 to100 ng and PCR amplification was performed with UAL-1939and UAR-2104 primers for the uidA gene and URL-301 andURR-453 primers for the uidR gene of E. coli. Following atotal of 45 cycles of PCR amplification, 0.1 volume of each ofthe PCR-amplified samples was analyzed as follows. Theamplified DNA was denatured by adding 0.1 volume of 3 MNaOH-0.1 M Na2EDTA, incubated at room temperature for5 min, and neutralized with 1 volume of NH4OAc; thesamples were then spotted on a Zetaprobe nylon membrane(Bio-rad) by using a Bio-Rad slot blot manifold at a vacuumpressure of 4 to 5 lb/in2. The hybridization was performedwith radiolabeled UAP-1 and URP-1 oligonucleotide probes,respectively, as described previously.

Similarly, 1 to 10 E. coli cells from 100-ml dechlorinatedpotable water samples were recovered by filtering throughan ethanol-presoaked 13-mm Fluoropore membrane (FHLP;0.5-pm pore size; Millipore Corp.), using a Swinnex filterholder and a filter manifold (Millipore). The filter was rolledand sterily transferred with forceps to a 0.6-ml GeneAmpreaction tube with cell-coated side facing inwards. Onehundred microliters of 0.1% diethylpyrocarbonate (Sigma)-treated autoclaved water was added to the tube, which wasvortexed vigorously for 5 to 10 s to release the cells from thefilter surface to the liquid phase. Five freeze-thaw cycleswere performed, using an ethanol-dry ice bath and warmwater (45 to 50°C), respectively. At every thaw cycle thesample was vortexed for 5 s to ensure the release of cells orDNA or both from the surface of the filter. The PCR reactionmix was added to the tube to a final volume of 150 Rl, andDNA was amplified without further purification. PCR ampli-fications were performed with primers for the uidR gene,URL-301 and URR-453. The amplified DNAs were detectedby radiolabeled URP-1 oligonucleotide probe as describedabove.

RESULTS AND DISCUSSION

Specificity of E. coli PCR detection with uid. PCR amplifi-cation with primers UAL-754 and UAR-900 to amplify theamino coding region of uidA produced amplified DNA bandsof 0.147 kb for all E. coli strains and all four strains ofShigella spp. (Fig. 1A). This primer set also producedpositive amplified DNA bands of identical molecular weightfor all four MUG-negative isolates of E. coli (Fig. 1B).Southern blot DNA-DNA hybridization with a 50-mer radio-labeled UAP-1 oligonucleotide probe showed strong hybrid-ization signals. No amplification was observed for otherbacterial strains tested in this study, suggesting that thetarget amino-terminal end of the uidA gene is unique andconserved in E. coli and Shigella spp.The set of primers, UAL-1939 and UAR-2104, located at

the carboxyl coding region of the uidA gene producedamplified DNA bands of 0.166 kb for E. coli and all fourstrains of Shigella spp. (Fig. 2A). The MUG-negative iso-lates of E. coli also showed amplification of DNA of thesame molecular weight (Fig. 2B). No amplification wasobserved when DNAs from other bacterial strains were usedas targets for PCR. Southern blot DNA-DNA hybridizationswith a 50-mer radiolabeled UAP-2 oligonucleotide probeshowed strong hybridization signals of all amplified DNAsfrom E. coli strains, including MUG-negative strains, and

1014 BEJ ET AL.

on August 26, 2020 by guest

http://aem.asm

.org/D

ownloaded from

DETECTION OF E. COLI AND SHIGELLA SPP. IN WATER

kb

-0.147-

1 2 3 4 5 6 7 8 9 10 11 12 1314

A4 5 2 3 4 5kb

0.147 w__WW

BFIG. 1. Ethidium bromide stained 4% NuSieve-SeaKem (1:3) agarose gel (left) and Southern blot hybridization (right) analyses of the

PCR-amplified DNA (A) from the uidA gene of E. coli, using UAL-754 and UAR-900 primers and radiolabeled UAP-1 oligonucleotide probe,and (B) of MUG-negative E. coli strains, using iuidA primers and probe. Lanes: 1, E. coli; 2, Shigella sonnei; 3, S. flexneri; 4, S. boydii; 5,S. dysenteriae; 6, 123-bp DNA ladder as size standard; 7, Salmonella typhimurium; 8, C. freundii; 9, Enterobacter aerogenes; 10,Enterobacter cloaceae; 11, Aeronomas hydrophila; 12, Klebsiella pneumoniae; 13, Streptococcus lactis; and 14, Pseudomonas alcaligenes.(B) Lanes: 1, E. coli 217; 2, E. coli 220; 3, E. coli 232; 4, E. coli 245; and 5, 123-bp DNA ladder as size standard.

Shigella spp. This result suggests that the carboxyl end ofthe uidA gene is also unique and conserved in E. coli andShigella spp.

In addition to the iuidA gene, the regulatory region of i,id,located upstream of the uidA gene, designated WidR, wasalso used as a target DNA for PCR amplification. PrimersURL-301 and URR-453 were used for the amplification ofDNA from E. coli strains, including MUG-negative isolates,and Shigella spp. In all cases, a 0.152-kb amplified DNAband was observed in an ethidium bromide-stained poly-acrylamide gel (Fig. 3A and B). Southern blot DNA-DNAhybridization with a 40-mer radiolabeled URP-1 oligonucle-otide probe showed strong hybridization signals for allamplified DNAs, suggesting that the target uidR gene ispresent in E. coli and Shigella spp. used in this study. Noamplification was observed for other bacterial strains.

Also, none of the three sets of uid primers showedamplification with nonspecific target DNA from human andseveral bacterial strains, unless DNA from E. coli was addedto the mixture. Thus, nontarget DNA did not interfere withPCR amplification of different regions of uid even when atotal of 120 times more nontarget than target DNA fromhuman and various bacteria was present.

Sensitivity of PCR detection, using uidA and uidR genes.For monitoring purposes, PCR-gene probe-based detectionof indicator and pathogenic organisms requires not onlyspecificity, but also sufficient sensitivity to ensure the safetyof the potable water. U.S. federal regulations require thedetection level to be one bacterial cell per 100 ml of drinkingwater (1, 12).

PCR-amplified DNA from as little as 10 fg of genomicDNA of E. coli was consistently detected when primers and

kb1 2 3 4 5 6 7 8 9 10

0.166 QQ 41 Q

A

1 2 3 4 5 kb 1 2 3 4 5

0.166_-4

BFIG. 2. Ethidium bromide-stained 4% NuSieve-SeaKem (1:3) agarose gel (left) and Southern blot hybridization (right) analyses of the

PCR-amplified DNA (A) from the uidA gene of E. coli, using UAL-1939 and UAR-2105 primers and radiolabeled UAP-2 oligonucleotideprobe, and (B) of MUG-negative E. coli strains, uidA primers and probe. (A) Lanes: 1, E. coli; 2, Shigella sonnei; 3, S. flexneri; 4, 123-bpDNA ladder as size standard; 5, S. boydii; 6, S. dysenteriae; 7, Salmonella typhimurium; 8, C. freundii; 9, Enterobacter aerogenes; and 10,Aeronomas hydrophila. (B) Lanes: 1, E. coli 217; 2, E. coli 220; 3, E. coli 232; 4, E. coli 245; and 5, 123-bp DNA ladder as size standard.

1015VOL. 57, 1991

on August 26, 2020 by guest

http://aem.asm

.org/D

ownloaded from

APPL. ENVIRON. MICROBIOL.

1 2 3 4 5 1 2 3 4 5

BFIG. 3. Ethidium bromide-stained 10% polyacrylamide gel (left) and Southern blot hybridization (right) analyses of the PCR-amplified

DNA (A) from the uidR gene of E. coli, using URL-301 and URR-453 primers and radiolabeled URP-1 oligonucleotide probe, and (B) ofMUG-negative E. coli strains, using uidA primers and probe. (A) Lanes: 1, E. coli; 2, Shigella sonnei; 3, S. flexneri; 4, S. boydii; 5, S.dysenteriae; 6, Salmonella typhimurium; 7, C. freundii; 8, Enterobacter aerogenes; 9, E. cloaceae; 10, Aeronomas hydrophila; 11, K.pneumoniae; 12, Streptococcus lactis; 14, Pseudomonas alcaligenes; and 15, 123-bp DNA ladder as size standard. Lanes: 1, E. coli 217; 2,E. coli 220; 3, E. coli 232; 4, E. coli 245; and 5, 123-bp DNA ladder as size standard.

probe for the uidR gene were used (Fig. 4). This level ofdetection is equivalent to the detection of one to twobacterial cells (4, 5). Approximately 18% of the time we wereable to detect 1-fg level of genomic DNA, which closelycorresponds to the expected Poisson distribution of thetarget gene (5). This detection level is as sensitive asreported previously for PCR-gene probe detection (5).When URL-301 and URR-453 primers and radiolabeled

URP-1 probe were used for the amplification and detection

_ W~f9tif fff M00 ;.i ;f-lag%-i 4o DNA

FIG. 4. Slot blot analysis after PCR amplification of variousamounts of genomic E. coli DNA, using primers URL-301 andURR-453 for uidR amplification. No added target DNA was used asa negative control. For hybridization, radiolabeled URP-1 oligonu-cleotide probe was used.

of the uidR gene of E. coli, we were able to detect one to twoviable cells of E. coli (as determined from the plate counts)consistently with this set of primer and probe. No PCRamplification signal was observed when the sample wasdiluted below the level of detectable viable cells as deter-mined by a plating procedure.

In conclusion, bacteria associated with human fecal con-tamination of potable water can be detected by PCR ampli-fication and gene probe detection of uidA and uidR genes.Moreover, PCR showed positive amplifications of both uidAand uidR targets for MUG-negative E. coli isolated fromboth clinical and environmental samples, which failed toshow positive reactions with a 3-glucuronidase enzyme-fluorogenic substrate-based commercially available Colilerttest. Thus, the gene probe detection may overcome thepotential problem of the Colilert system, i.e., the failure todetect MUG-negative stains, which Chang et al. (7) havereported may constitute 30% of the fecal coliform bacteria insome water sources. Multiplex PCR amplification of lacZ fortotal coliforms (5) and uidA or uidR for fecal coliforms and thedevelopment of a nonisotopic gene probe detection tech-nique, such as immobilized capture probes (4), can permit arapid and reliable means of assessing the bacteriologicalsafety of water and should provide an effective alternativemethodology to the conventional viable culture methods.

ACKNOWLEDGMENTS

This study was funded by Perkin-Elmer Cetus Corp.We thank W. Chang for MUG-negative E. coli strains, M. Boyce

for technical assistance, and K. Zinn for preparation of the manu-script.

REFERENCES1. American Public Health Association. 1985. Standard methods for

the examination of water and wastewater, 16th ed. AmericanPublic Health Association, Washington, D.C.

1016 BEJ ET AL.

on August 26, 2020 by guest

http://aem.asm

.org/D

ownloaded from

DETECTION OF E. COLI AND SHIGELLA SPP. IN WATER

2. Atlas, R. M., A. K. Bej, S. McCarty, J. DiCesare, and L. Haff.1991. In J. R. Hall and G. D. Glysson (ed.), Monitoring water inthe 1990's: meeting new challenges. ASTM STP 1102. In press.

3. Ausubel, F. M., R. Brent, R. E. Kingston, D. D. Moore, J. A.Smith, J. G. Sideman, and K. Struhl (ed.). 1987. Currentprotocols in molecular biology. John Wiley & Sons, Inc., NewYork.

4. Bej, A. K., M. H. Mahbubani, R. Miller, J. L. DiCesare, L. Haff,and R. M. Atlas. 1990. Multiplex PCR amplification and immo-bilized capture probes for detection of bacterial pathogens andindicators in water. Mol. Cell. Probes 4:353-365.

5. Bej, A. K., R. J. Steffan, J. DiCesare, L. Haff, and R. M. Atlas.1990. Detection of coliform bacteria in water by polymerasechain reaction and gene probes. Appl. Environ. Microbiol.56:307-314.

6. Blanco, C., P. Ritzenthaler, and M. Mata-Gilsinger. 1985. Nu-cleotide sequence of a regulatory region of the uidA gene inEscherichia coli K12. Mol. Gen. Genet. 199:101-105.

7. Chang, G. W., J. Brill, and R. Lum. 1989. Proportion of3-glucuronidase-negative Escherichia coli in human fecal sam-

ples. Appl. Environ. Microbiol. 55:335-339.8. Edberg, S. C., M. J. Allen, D. B. Smith, and the National

Collaborative Study. 1989. National field evaluation of a definedsubstrate method for the simultaneous detection of total coli-

forms and Escherichia coli from drinking water: comparisonwith presence-absence techniques. Appl. Environ. Microbiol.55:1003-1008.

9. Edberg, S. C., and M. M. Edberg. 1988. A defined substratetechnology for the enumeration of microbial indicators of envi-ronmental pollution. Yale J. Biol. Med. 61:389-399.

10. Edberg, S. C., and C. M. Kontnick. 1986. Comparison ofbeta-glucuronidase-based substrate systems for identification ofEscherichia coli. J. Clin. Microbiol. 24:368-371.

11. Federal Register. 1990. Drinking water: national primary drink-ing water regulations; analytical techniques coliform bacteriaproposed rule. 55:22752-22756.

12. Geldreich, E. E. 1983. Bacterial populations and indicatorconcepts in feces, sewage, stormwater and solid wastes, p.51-97. In G. Berg (ed.), Indicators of viruses in water and food.Ann Arbor Science Publishers, Inc., Orlando, Fla.

13. Jefferson, R. A., S. M. Burgess, and D. Hirsh. 1986. ,-Glucuron-idase from Escherichia coli as a gene fusion marker. Proc. Natl.Acad. Sci. USA 83:8447-8451.

14. Rychlik, W., and R. E. Rhods. 1989. A computer program forchoosing optimal oligonucleotides for filter hybridization, se-

quencing and in vitro amplification of DNA. Nucleic Acids Res.17:8543-8551.

VOL. 57, 1991 1017

on August 26, 2020 by guest

http://aem.asm

.org/D

ownloaded from

AUTHOR'S CORRECTION

Detection of Escherichia coli and Shigella spp. in Water by Using thePolymerase Chain Reaction and Gene Probes for uidASIM K. BEJ, JOSEPH L. DiCESARE, LAWRENCE HAFF, AND RONALD M. ATLAS

Department of Biology, University of Louisville, Louisville, Kentucky 40292, andPerkin-Elmer Corporation, Norwalk, Connecticut 06859

Volume 57, no. 4, p. 1013-1017: in this paper, we should have cited a paper by Cleuziat and Robert-Baudouy (P. Cleuziatand J. Robert-Baudouy, FEMS Microbiol. Lett. 72:315-322, 1990) that described work on the same subject.

2445