cis elements and frans-acting factors affecting regulation of a

Plant Physiol. (1995) 108: 1 1 09-1 11 7

cis Elements and frans-Acting Factors Affecting Regulation of a Nonphotosynthetic Light-Regulated

Gene for Chloroplast Glutamine Synthetase’

Gabrielle Tjaden‘, Janice W. Edwards3, and Gloria M. Coruni*

Department of Biology, New York University, 1009 Main Building, New York, New York 10003

The glutamine synthetase (GS) gene family in pea (Pisum safivum) consists of four nuclear genes encoding distinct isoenzymes. Mo- lecular studies have shown that the GS2 gene encoding chloroplast- localized CS is expressed in specific cell types and is regulated by diverse factors such as light and photorespiration. Here, we present the nucleotide sequence of the pea GS2 gene promoter. To identify the elements involved in regulation of GS2 expression, GS2 promoter-deletion analyses were performed using GS2-GUS fusions in tobacco (Nicotiana tabacum). This analysis revealed that the CS2 transit peptide is not required for mesophyll cell-specific expression of P-glucuronidase (CUS). CUS activity was induced 2- to 4-fold in light-grown versus etiolated T, seedlings. However, high levels of CUS activity were observed in etiolated seedlings. This observation demonstrated that regulation of expression of GS2, a nonphotosynthetic light-regulated gene, involves additional factors. A 323-bp CSZ promoter sequence i s sufficient to confer light regulation to the CUS reporter gene in leaves of mature transgenic tobacco. Light- regulated expression of this pea gene promoter is observed in both tobacco and Arabidopsis, suggesting that the regulatory elements are conserved. Cel-shift analysis detected DNA-protein complexes formed with potential transcription elements within this short, light-responsive CS2 promoter fragment.

The GS gene family in pea (Pisum sativum) consists of four nuclear genes encoding distinct isoenzymes (Tingey et al., 1987,1988). The chloroplast form of GS (GS2) is respon- sible for assimilation of primary nitrogen reduced from nitrate in chloroplasts. Chloroplast GS2 is also the isoenzyme involved in the reassimilation of photorespiratory ammonia. Molecular studies have shown that the GS2 gene is expressed in specific cell types and is regulated by diverse factors such as light and photorespiration. Transcrip- tion of the GS2 gene is positively regulated by light via the photoreceptor phytochrome (Tingey et al., 1988; Edwards and Coruzzi, 1989). Levels of GS2 mRNA are also modu- lated by physiological processes associated with the GS2

‘This work was supported by National Institutes of Health (NIH) grant No. GM32877 and NIH postdoctoral fellowship No. GM14429-03 (G.T). Computing analysis was supported by the National Science Foundation under grant No. DIR-8908095.

* Present address: AgBiotech Center, Foran Hall, Rutgers Uni- versity, New Brunswick, NJ 08903.

Present address: Monsanto, St. Louis, MO 63198. * Corresponding author; e-mail [email protected];

fax 1-212-995-4204.

isoenzyme. GS2 mRNA levels are induced in leaves of plants grown under photorespiratory conditions, compared to plants grown under conditions that repress photorespiration (2% CO,) (Edwards and Coruzzi, 1989).

The essential role of GS2 in the reassimilation of photorespiratory ammonia was made evident by studies of photorespiratory mutants of barley specifically deficient in GS2 (Wallsgrove et al., 1987). These GS2 mutants die when grown under photorespiratory conditions (e.g. air), even though they possess normal levels of cytosolic GS. Further studies of the GS2 gene also suggest that the GS2 isoenzyme performs a unique role in mesophyll cells, distinct from its cytosolic counterpart. A transgene consisting of 1.5 kb of the GS2 promoter fused to the GUS reporter gene exhibited light-regulated expression in tobacco (Nicotiana tabacum). Histological analysis of the GSZ-GUS-containing tobacco plants revealed GUS activity specifically in the photosynthetic cells, e.g. mesophyll and palisade paren- chyma layers (Edwards et al., 1990). By contrast, promoter- GUS fusions with the cytosolic GS3A gene were expressed only in vascular cells (Edwards et al., 1990). The results of these studies using GS-GUS transgenes were later confirmed by immunolocalization, which showed that GS2 is the only GS isoenzyme expressed in tobacco leaf mesophyll cells (Carvalho et al., 1992). Thus, studies of the cell-specific expression patterns of the GS genes have shown that GS2 and its cytosolic counterparts are expressed in distinct, nonoverlapping cell types.

The light-regulated and cell-specific pattern of expression of pea GS2 is a reflection of the role of this isoenzyme in plant metabolism. A detailed dissection of the promoter elements for the GS2 gene of P. sativum should uncover the basis for the complex transcriptional regulation of this gene, formerly thought to be a “housekeeping” gene. Pro- moter studies have been performed on GInS (Cock et al., 1992). A construct containing 0.8 kb of the GInS promoter exhibited tissue-specific expression and light-regulated expression in seedlings of transgenic tobacco (Cock et al., 1992). A promoter-deletion analysis revealed that cis elements important to the tissue-specific and light-regulated

Abbreviations: F1 to F4, fragments 1 to 4; GS, Gln synthetase; GS2, nuclear gene encoding chloroplast-localized Gln synthase of Pisum sativum; Gln8, nuclear gene encoding chloroplast-localized Gln synthase of Phaseolus vulgaris; HMG, high mobility group; TD, nuclear extract from leaves of dark-adapted tobacco; TL, nuclear extract from leaves of light-grown tobacco.

1109

1110 Tjaden et al. Plant Physiol. Vol. 108, 1995

expression of GlnS lie between -786 and +43 bp of the promoter (Cock et al., 1992). However, a shorter construct containing 327 bp of the GlnS promoter gave barely detectable levels of GUS activity and was not useful in further dissection of the regulatory cis elements.

Here, we present the nucleotide sequence of the pea GS2 gene promoter and 5’- and 3‘-deletion analyses of this promoter in transgenic tobacco. Our results demonstrate that 323 bp of the GS2 promoter sequence is sufficient to confer light regulation to the GUS reporter gene in seedlings and in leaves of mature transgenic tobacco. Gel-shift analysis was used to detect DNA-protein complexes formed with potential transcription elements within this short, light-responsive GS2 promoter fragment.

MATERIALS A N D METHODS

Determination of the D N A Sequence of the 5’ Region of the GSZ Gene

The sequence of the GS2 genomic clone containing approximately 1800 bp of GS2 5’ region was determined by double-stranded sequencing of both DNA strands using the Sequenase kit (United States Biochemical).

Determination of the GSZ Transcriptional Start Site by RNase Protection

The template for riboprobe production was produced by ligating a PCR fragment of the GS2 gene, bp -210 to +502, into the BamHI site of the pGEM4Z vector (Promega). This template was linearized by digestion with HindIII. The riboprobe was synthesized using SP6 polymerase, the Ri- boprobe Gemini System I1 kit (Promega), and [32P]CTP (NEN). Hybridization and digestion with TI RNase were performed using the Ribonuclease Protection Assay I1 kit from Ambion (Austin, TX).

Production of Transgenic Tobacco

GS2 promoter fragments containing SalI and BamHI sites were produced by PCR ‘using the AmpliTaq enzyme (Per- kin-Elmer Cetus). After digestion with SalI and BamHI, followed by gel purification, these fragments were ligated into the SalI and BamHI sites of the pBIlOl vectors (Clon- tech, Palo Alto, CA). The vector pBI101.1 was used to make a11 of the constructs, with the exception of GS2/3’+11, which was constructed using pBI101.2. The pBI-GS2 constructs were introduced into Agrobacferium tumefaciens strain LBA4404 by triparental mating or electroporation. At least two independent A. tumefaciens transformants from each construct were used for plant transformation. Nicoti- una tabacum cv SR1 was transformed using the leaf-disc method (Horsch et al., 1985). Arabidopsis fhaliana ecotype C24 was transformed as described (Schmidt and Willmitzer, 1988). Fluorometric analysis of GUS activity in plant extracts was performed as described by Jefferson et al. (1987).

lsolation and Analysis of RNA

Total RNA was extracted from plant tissue using the buffer described by Jackson and Larkins (19761, separated on a 6% formaldehyde-1.5% agarose gel, and transferred to a Hybond I1 filter (NEN) as described previously by Aus- ubel et al. (1988). Prehybridization and hybridization were performed in 50% formamide buffers (Ausubel et al., 1988) at 65°C. Filters were washed at high stringency (0.1 X SSC, 0.1% SDS at 65°C). The GUS riboprobe template consisted of the 534-bp uid A HincII fragment isolated from the pBI221 construct and ligated into the SmaI site of the pGEM3Z vector (Promega). The 598-base riboprobe was synthesized from the EcoRI-linearized template by SP6 polymerase using the Riboprobe Gemini System I1 kit (Pro- mega) and [32P]CTP (NEN).

Cel-Shift Analysis

Gel-shift analysis was performed as described previously (Tjaden and Coruzzi, 1994). The DNA fragment probes were generated by PCR, digested with restriction fragments, and gel purified. These were then labeled using the Klenow enzyme and [32P]deoxyribonucleotide triphos- phates (NEN). Nuclear extracts were prepared from leaves of tobacco plants either grown in the light or dark-adapted for 4 d by the method of Green et al. (1987, 1988).

RESULTS

The GS2 Gene Promoter Sequence and Determination of the Transcription Start Site

A genomic GS2 clone was isolated (Edwards et al., 1990), and more than 1 kb of promoter plus the 5’ portion of the structural gene was sequenced (Fig. 1). The 5’ nontranslated leader is separated from the ATG of the chloroplast transit peptide by an intron of 387 bp identified by sequence comparison with the GS2 cDNA (Tingey et al., 1988). The 5’ nontranslated leader contains a palindromic sequence that has the potential to form a stable hairpin structure (-13.3 kcal). This hairpin, located at +64 to +479 bp, involves sequences mainly in the nontranslated leader and encompasses the initiator ATG (see underlined arrows in Fig. 1).

Mapping of the transcription start site of the GS2 gene began with primer extension analysis. However, this pro- cedure gave anomalous results, most likely because of the presence of the stable hairpin in the 5‘ nontranslated leader of the GS2 mRNA and the high AT content of this region (Edwards and Coruzzi, 1989; see Fig. 1). The transcription start site of the GS2 gene was instead mapped by RNase protection using a 711-nucleotide riboprobe, which encompasses the 5’ nontranslated leader (exon 1) and the start of translation (exon 2) as shown in Figure 2a. Following RNA hybridization and RNase digestion, multiple protected RNA species were detected, suggesting that transcription from the GS2 gene promoter may be initiated at severa1 sites (see fragments A-C in Fig. 2b). However, a major transcription start site is apparent (fragment A) as shown in Figure 2b. This site is indicated as +1 in the GS2 gene

GS2 Promoter c/s Elements and trans Factors 1 1 1 1

aatcacatga gaaaatactt gaatacactt aaatcaatta ttttatactctccttgacga ataacgggga agtcaacctt ttagtatttt taccaagaatacacaaataa atagaatcta attctcttaa tagaaatcaa ttatccgatgcacacaattg ctgcgattaa tttctcgagt agaatttgat taaaactaaa

T-S49tatacataaa tgagtgagaa caccaaataa ataaaattat aaaaaataat

GT- 1attataatgt attaagatga taaageataa ttaactttag acttaaatgaT-53S

gttttttttt tactcttcca ttattttatt tggagtttcc ccccattttttaaatcccaa aacaatgtta cttatgtgct aatttgtcaa atcatagttt

tgatattaaa attttcaaat atattgtaat gctacataag tttcacgtgcf-3S» GT ' f-3«

attatttctc aatcatcata tttactacta aatgttaaaa tttgacatagf-332 y-323

aaatcaaaat tgtataaatt caaaaactat ataatcataa ttgcaaattabox 1atgtttctaa gcaaagcaac ttaagttaag aagatctaag caaagatacaaagatattgt caacatagaa tttagtaatc attattcatt gtagttatagaatctaaaca tgaaaattaa ttggataaaa aaagaaagag aaaccttatctaaaatattg aaagtccaag cttctcttgg tgctetttaa gggaccaaaa

-11SAacaaacttca tceactcaaa aactcacccc tatcgttatt gcaatagcca

-59 Aacaaacttgt tttcttgccc accaccaacc cS.;fe*g*$*iac acaactctct

+1CtCactCtCT ATTGCTCCAT TGACACAAOG CTCATTCTCA CTTGAACCCA

TTTTCAACCT TTGCTGTTTT TGCCATTTTT CAACTCTGTA TTGgtgagtttctttctacc ttcaatacca ttttcgtcct ttttcttaaa cgtttatttatgacattcaa aattcaatct ttgtagtttc ttgctagtga aaatttatgatggttctttg aatatacttt agcttcatgc aaaactaact tctttatcattttgagcaaa ttgatgttta gtagctatga aagaatttgg atctgattaatcactttgtt ttattgtgtt atatctaaat atgattccaa aaagcaatgctcttggtaaa ctttactctc ttttatgtta gttagatatt ttcttgaatgattatttact tcttggttgg ttttttgcaa tgtgcatctt aatagaatgctgtttgattc tttttttttt tgttgagtag AAAATGOCGC AGATTTTGGC

< M A 0 I L AACCTTCGACG.CAATOGCAGA TGAGAATCAC AAAAACCTCT CCTTOTOCAA

P S T^Q W Q M R I T K T S P C A

CTCCAATCAC ATCAAAQATG TGGAGTTCTT TGOTTATGAA ACAAACTAAGT P I T S K M M S S L V M K Q T KAAAOTTOCGC ATTCTGCTAA ATTTAGAGTT ATOGCAGTC.

K V A H S A K F R V A M A V *

Figure 1. DNA sequence of the CS2 gene promoter. The primarytranscription start site, as determined by RNase protection (see Fig.2), is designated +1. The coding sequence is shown in uppercase;the intronic sequence and noncoding 5' sequence are shown inlowercase. The 5' end of the longest cDNA corresponds with nucle-otide +22. The ends of the 5'-deletion constructs are indicated by Tabove the sequence. The ends of the 3'-deletion constructs areindicated by A below the sequence, c/s elements are underlined andwere identified either by sequence homology (broken underlines) orby gel-shift analysis (solid underlines). The chloroplast transit peptidecleavage point is indicated by A (Tingey et al., 1988). The predictedstable hairpin structure in the GS2 transcript ( + 64 to +480) isindicated by arrows (Edwards and Coruzzi, 1989). The functionalTATA transcription initiation element is shaded. The GenBank ac-cession number for the CS2 promoter sequence is U22971.

sequence shown in Figure 1. To determine whether thepresence of a stable hairpin in the GS2 mRNA interferedwith hybridization of the riboprobe to GS2 mRNA, thesame experiment was performed using a shorter riboprobethat lacked the hairpin sequence. The sizes of the protectedproducts indicated that the hairpin was not interferingwith intermolecular hybridization and placed the majorstart site at +1 (data not shown).

None of the GS2 transcripts detected in RNA extractedfrom leaves of light-grown pea (Fig. 2b, lane L) were de-tected in RNA from etiolated tissue (Fig. 2b, lane D). This

suggests that transcription initiation at these sites is lightregulated. Sequence analysis revealed two TATA-like se-quences within the upstream region of the GS2 promoter(-331 and -213 bp) (Fig. 1). However, neither of thesesequences is located near the major transcription start site(+1) or either of the two minor transcription start sites(-35 and -87 bp) (Fig. 2b). Furthermore, when either ofthese two potential transcription initiation TATA elementswas deleted internally, no significant loss of GUS activitywas observed (data not shown). There is a TATA-like se-quence (TTATTT) located 27 bp upstream of the majortranscription start site (Fig. 1). This TATA element corre-sponds in sequence and location to that determined for theGlnd gene (Cock et al., 1992). Deletion of this TATA se-quence in 3'-deletion constructs revealed this to be a func-tional TATA element by in vivo analysis (construct GS2/3'-59 in Fig. 3) (see below).

711 base rlboprob*: 5' -

Major protected fragments:

Minor protected fragments: •

L D Y

El

E2(D) -^

172 b

120 b

85 b

30 b

Figure 2. Determination of the transcriptional start site of the CS2gene, a., Schematic representation of the RNA fragment that spans the5' end of the CS2 gene. A to D, Fragments protected from RNasedigestion. Hatched box, 5' nontranslated sequence; open box, trans-lated region of exon 2. b, Autoradiogram of GS2 riboprobe fragmentsprotected from RNase digestion (see "Materials and Methods" fordetails). RNA samples were from light-grown pea seedlings (lane L),etiolated pea seedlings (lane D), or yeast as a control (lane Y). El,Exon 1; E2, exon 2.

1112

fmdtppld. & GS2/3’+631 -858 ATO 11+631 10

exonl exon2 A GS2/3’+502 -858 ATG +502 9

GS2/3‘+11 -058 - + i 1 12 ,

GS2/3’-59 -858 e -59 14

GS2/3’-115 -858 + -115 13

Tjaden et ai. Plant Physiol. Vol. 108, 1995

, . . .I . . . . 8 4 ~ 1 0 ~

-1 .. 2.5 x 105

. 2 x 104

460

n.d.

Figure 3. Fluorometric analysis of GUS enzyme activity in primary transformants containing the GS2-GUS 3‘-deletion constructs. The primary transcription start site, as determined by RNase protection, i s designated +l. GUS activity in leaves from mature plants was determined fluorometrically (Jefferson et al., 1987). The vertical lines on the graph represent the means for each construct. n.d., Not detectable; n, number of independent primary transformants analyzed; 4-MU, 4-methylumbelliferone.

Analysis of cis Elements 3‘ to the Transcription Start of GS2 by Deletion Analysis

A previous GS2 promoter-GUS fusion expressed in transgenic plants was a translational fusion that contained the entire GS2 transit peptide (Edwards et al., 1990). To determine whether the transit peptide, intron, or nontranslated 5’ leader present in this construct played a role in GS2 gene expression, a series of 3‘-deletion mutants were constructed. The specific sequences of these 3’ deletions are indicated in Figure 1 (A). These four 3’-deletion constructs positioned at +631, +502, +11, and -59 were fused to GUS, transferred into tobacco, and assayed for GUS expression by histochemical and northern analyses (Fig. 3). His- tological analysis of transformants containing the 3’-deletion constructs revealed GUS activity predominantly in the mesophyll cells of the leaf blade (data not shown). Thus, deleting the chloroplast transit peptide did not alter the mesophyll cell-specific expression pattern of GS2.

GUS enzyme activity was measured fluorometrically in 9 to 13 independent primary transformants containing these 3’-deletion constructs. The results of this analysis are shown in Figure 3. The longest 3‘-deletion construct (GS2/ 3’+631) was a translational fusion (+631) containing the complete GS2 transit peptide-coding sequence. This construct gave the highest mean level of GUS activity of a11 the constructs analyzed, as determined fluorometrically (Fig. 3). The next longest 3’-deletion construct (GS2/3’+502) was also a translational fusion (+502); however, this construct lacked most of the transit peptide-coding sequence. Mean GUS activity for GS2/3’+502 decreased by more than 2-fold compared to GS2/3’+631 (Fig. 3). This decrease in GUS activity suggests that the GS2 transit peptide may play a role in stabilization of the GUS protein, perhaps via sequestration to the chloroplast. The next longest 3’-deletion construct (GS2/3’+11) was a transcriptional fusion to +11, which lacked the first intron of GS2 and most of the 5’ nontranslated leader. In this construct, the ATG of the uid A (GUS) gene serves as the translational start sequence. The mean GUS activity for GS2/3’+11 was 10-fold less than that of GS2/3’+502, which contains the plant GS2 gene initiator ATG (Fig. 3). The dramatic reduction in GUS

activity observed for GS2/3‘+11 was most likely due, at least in part, to reduced translational efficiency from sequences surrounding the initiator ATG of the uid A gene.

For other plant promoters, it has been shown that a GUS gene engineered with an initiator ATG positioned in a eukaryotic ATG consensus has detectable GUS enzyme activity, whereas the identical promoter gave no detectable expression when fused to the GUS gene with the ATG in a prokaryotic consensus context (N. Ngai and G. Coruzzi, unpublished results). Deletion of an additional70 bp from the 5‘ end results in a fusion (GS2/3’-59) that is missing the entire 5’ nontranslated leader and 59 bp of promoter sequence. This GS2/3’-59 deletion resulted in a total ab- sence of GUS activity; the median level of expression for this construct was O (Fig. 3). These results are in line with the fact that this deletion eliminated the proposed functional TATA sequence at -27 relative to the major transcription start site (Fig. 1). An additional deletion of 50 bp to -109 (GS2/3’-115) also resulted in no detectable GUS activity (Fig. 3).

Analysis of GUS mRNA levels was also performed on several primary transformants containing 3’-deletion constructs. Transgenic plants containing constructs GS2/3‘+631 and GS2/3’+502 had similar levels of GUS mRNA, whereas GS2/3’+11 had reduced levels of GUS mRNA as determined by northern analysis (data not shown). No GUS mRNA was detected in plants that contained GS2/3‘-115 (data not shown). These results suggest that the intron and/or 5’ nontranslated leader of GS2 may play some role in accumulation of the GS2 mRNA. How- ever, the results of our 5’-promoter-deletion analysis pre- sented below indicate that the 5‘ nontranslated leader and intron are not essential for light regulation of the GS2 gene.

5’-Deletion Analysis of cis Elements of the GS2 Promoter lnvolved in Cene Regulation

To determine the role of DNA sequence elements within the 5’ region of the GS2 gene promoter, several 5’ deletions were fused to the GUS reporter gene (Fig. 4). The 3’ end of each of these deletions was +11, the same as for GS2/

GS2 Promoter cis Elements and trans Factors 1113

GSZS-649 - 6 4 9 1 3 - " - S - ~ 7

GSWS-535 -535 -I&@-- 9

GSZ5'-429 -429 9

GS2/5'-399 -399 8

GSZ5'465 -365 9 . ...I. GS2/5'-332

GSZ5'923

)I. * -332- 9

-323 5 4 ) . ' . ' . ' . ' ' I

O 1 0 0 0 0 2 0 0 0 0 3 0 0 0 0 4 0 0 0 0 5 0 0 0 0

pmoles 4-MU mg pmtein-1 min.-1

Figure 4. Fluorometric analysis of GUS enzyme activity in primary transformants containing the GS2-GUS 5'-deletion constructs. cis elements identified by gel-shift and/or sequence analysis are indicated. GUS activity in leaves from mature plants was determined fluorometrically (Jefferson et al., 1987). The lines represent the means for each construct. n, Number of independent primary transformants analyzed; 4-MU, 4-methylumbelliferone.

3 '+ l l described above. The 5' ends of these fragments are indicated in Figure 1 (V). GUS enzyme activity was determined by fluorometric analysis of extracts from 5 to 10 independent primary transformants analyzed for each construct. The results of this analysis are shown in a scatter plot format in Figure 4, with the mean values indicated as vertical bars. These 5' deletion results reveal that a number of cis elements function to either enhance or repress transcription of the GS2 gene. In particular, one deletion (-365 to -332) results in a 10-fold decrease in GUS, as previously reported (Tjaden and Coruzzi, 1994). Deletion of bp -399 to -365 resulted in an increase in GUS activity, suggesting that a repressor element exists in this region. However, a search of the transcription factor-binding sites data base did not identify homology to any previously identified repressor-binding sites. We next determined which was the shortest active 5' deletion of the GS2 promoter that dis- played light regulation.

Previously, a 1.5-kb fragment of the GS2 gene containing 948 bp of promoter sequence in a translational fusion construct was shown to direct light regulation to GUS at the RNA level in tobacco (Edwards et al., 1990). We therefore analyzed GUS expression in the above series of 5' deletions to specifically delimit cis elements involved in this regulation. Since the GUS enzyme synthesized in light-grown GS2-GUS plants is stable, enzyme activity cannot be used to monitor light-regulated changes in GUS expression. In- stead, we examined GUS activity in etiolated seedlings of GS2-GUS plants, in which GS2 expression is reduced, and monitored induction of GUS activity in light-grown seedlings. For this analysis, TI seedlings were germinated and grown in either light or constant darkness, and GUS enzyme activity was measured in several independent transformants.

Previous histological analysis of a GS2-GUS fusion in tobacco seedlings revealed GUS expression primarily in the cotyledons of light-grown seedlings (Edwards et al., 1990).

This high-leve1 expression of GS2-GUS in cotyledons most likely reflects the requirement for the GS2 isoenzyme in the reassimilation of ammonia released during the breakdown of seed storage proteins during germination. In a11 of the 5'-deletion GS2-GUS constructs, GUS activity was detectable by histological analysis in cotyledons of etiolated tobacco seedlings, as well as in cotyledons of light-grown seedlings (data not shown). Thus, the GS2 promoter is active in cotyledons, independently of light. The high basal level of GS2-GUS expression in cotyledons of etiolated seedlings may explain why there is a low fold induction of GUS enzyme activity in light-grown versus dark-grown seedlings (Table I). Similiar results were obtained with isolated cotyledons (data not shown). Overall, the levels of GUS activity in light-grown GS2-GUS seedlings were at least double the activity in etiolated seedlings, suggesting that a11 of the GS2-GUS promoter fragments tested contained DNA elements sufficient for light regulation.

We next examined levels of GUS mRNA in leaves of light-grown versus dark-adapted tobacco plants. T, plants containing constructs GS2/3'+631, GS2/3'+11, GS2/ 5'-399, and GS2/5'-323 were grown in continuous light or were dark adapted for 4 d, and total RNA was isolated from leaves. Northern analysis was performed using a GUS riboprobe. Light-induced changes in GUS mRNA levels were observed in several independent transformants containing these constructs, and representative results are shown in Figure 5a. Constructs GS2/3'+631 and GS2/ 5'-399 also exhibited light regulation of GUS mRNA levels in transgenic Arabidopsis (Fig. 5c). Light-induced changes in GUS mRNA were observed for a11 constructs, including the shortest 5'-deletion construct, GS2/5'-323. The results for four independent GS2/5' -323 transformants are shown in Figure 5b. These results indicate that the 323-bp GS2 promoter of the GS2/5'-323 construct contains elements sufficient for light-regulated expression of GUS mRNA in leaves of mature tobacco.

1114 Tjaden et al. Plant Physiol. Vol. 108, 1995

Table I. CUS activity in T, seedlingsLevels of GUS activity were measured in etiolated or light-grown

10-d-old seedlings. GUS activity is expressed as pmol 4-methylum-belliferone per mg protein per minute. X, Mean value. XL/XE, Ratio ofthe mean value of the light-grown seedlings to the mean of theetiolated seedlings, n.d., Not detectable.

Construct

GS2/3' + 11

GS2/5' - 429

GS2/5' - 399

GS2/5' - 365

GS2/5' - 332

GS2/5' - 323

Light

15,3332,21013,933

X = 10,492740

15,8603,0503,1005,2101,3502,7604,890

X = 4,6203,9709,7139,0501,1631,880

X = 5,1555,2825,3308,7426,1781,7553,355

X = 5,1071,2234,6501,327530

X = 1,933597862n.d.

5,710X = 1,792

Etiolated XL/XE

2,2591,5276,260

X = 3,349 3.1n.d.

7,3531,4301,8873,373957

1,1503,240

X = 2,424 1.91,3583,2021,772n.d.n.d.

X = 1,266 4.1n.d.

2,2683,6072,173950

1,132X = 1,688 3.0

n.d.3,420493n.d.

X = 978 2.0420587608

2,090X = 926 1 .9

Analysis of frans-Acting Protein Factors That Bind to cisElements in the GS2 Promoter

Deletion analysis detailed above revealed that 323 bp ofthe GS2 promoter were able to confer light-regulated ex-pression to the GUS reporter gene. Sequence analysis of the323-bp GS2 promoter revealed the presence of a number ofcis elements shown to regulate other plant genes, such asGT-1 (Green et al., 1987,1988), I box (Giuliano et al., 1988),and box 1 (Tjaden and Coruzzi, 1994). In addition, thisportion of the GS2 promoter contains a sequence desig-nated "box 2," which is repeated in tandem with a partialpalindrome located between the repeats (see Fig. 1 for exactsequence of box 2). We characterized nuclear protein fac-tors that bound to these DNA sequences using in vitrogel-shift analysis (Fig. 6). Gel-shift analysis was performedusing nuclear extracts made from the leaves of tobaccogrown in the light or dark-adapted for 4 d. The entire 334

bp (bp -323 to bp +11) of GS2/5'-323 was divided intofour DNA fragments of approximately 100 bp each asshown in Figure 6a. Fl contained the box 2 and partialpalindrome sequences. No complexes were detected withthe full-length Fl (data not shown). However, smaller unitscontained in Fl, which consisted of the box 2 elements withthe palindrome ("native" box 2 probe) or the palindromealone (palindrome probe), detected DNA-protein com-plexes shown in Figure 6b, lanes 2 and 3 and 5 and 6,respectively. These complexes were detected with both theTL and TD nuclear extracts. Gel-shift analysis of F2 re-vealed at least one binding site for the light regulatoryGT-1 factor (Fig. 6c, lane 7). Competition by the GT-1-binding box II element from the pea rbcS gene (Fig. 6c, lane8), but not by the mutant box II element (Fig. 6c, lane 9),confirmed that the DNA-nuclear protein complex formedwith F2 was the GT-1 complex. In addition, F2 formedDNA-protein complexes similar to those detected withHMG proteins and the HMG-like protein ATBP-1 (Tjadenand Coruzzi, 1994) that bind to the box 1 element furtherupstream in the GS2 promoter (Fig. 6c, lane 7). Competitionof the low-mobility box 1 shift (Fig. 6c, lane 7) by poly-(dAdT) suggested that this is a binding site for the ATBP-1protein previously described by Tjaden and Coruzzi (1994;data not shown). AT-rich elements similar to the box 1 andbox 1* sequences of the GS2 promoter have been found to

D L D La

GUSmRNA

rRNA

GS2/3'+631 GS2/3'+11 GS2/5'-399

GUSmRNA

rRNA

D L D L D L D L

GUSmRNA

D L

GS2/5'-323

D L

rRNA

GS2/3'+631 GS2/5'-399

Figure 5. G52-GUSconstructs confer light regulation to GUS mRNAin transgenic tobacco. Total RNA (30 /xg) isolated from leaves oftransgenic plants grown in light (L) or dark-adapted for 4 d (D) wasprobed with a 598-base GUS riboprobe. The sequences of constructsGS2/3' + 631 (-858 to +631) and GS2/3' + 11 (-858 to +11) andGS2/5'-399 (-399to +11) and GS2/5'-323 (-323 to +11) areasshown in Figures 3 and 4, respectively, a and b, Transgenic tobaccoRNA. c, Transgenic Arabidopsis RNA.

CS2 Promoter c/s Elements and trans Factors 1115

a-323

-300 -2001

Box 1* GT~1 1 box———— 0-B-D——

———— F2 ————

-100I

CO

TATA

— F4

1

+11

TD TL - TD TLCcompetitor:

GT-1-..

boxr-»-

HMGs{

1 2 3 4 5 6Box 2 palindromenative_______

F1

TD - TD

I

8 9

F210 11 12 13

F3 F4

Figure 6. Detection of protein-binding sites within the 323-bp CS2promoter is shown to confer light regulation, a, Schematic presenta-tion of the four overlapping DMA fragments of the promoter of CS2(-323 to +11) used to detect DNA-protein complexes in gel-shiftanalysis. F1 was further dissected into the box 2 native probe andpalindrome probes as indicated, b, Gel-shift analysis of F1. c, Com-petition of F2 CT-1 complex formation by the rbcS box II multimer(Lam and Chua, 1990). The mutant IT (Lam and Chua, 1990) wasused as a negative control, d, Gel-shift analysis of F3 and F4.

bind to nuclear proteins and to activate transcription inplants (Castresana et alv 1988; Bustos et al., 1989; Lam et al.,1990; Czarnecka et al., 1992; Tjaden and Coruzzi, 1994).Similarly, deletion of the box 1 element from the GS2promoter resulted in a reduction in transcription (Fig. 4;Tjaden and Coruzzi, 1994). The DNA fragments of F3 andF4 did not contain many known c/s elements based onDNA sequence comparison; however, the fragments werefound to form DNA-protein complexes (Fig. 6d, lanes 10-13). These complexes were detected with both the TL andTD nuclear extracts.

DISCUSSION

Although nucleotide identity indicates that the nucleargenes for chloroplast and cytosolic GS have evolved from acommon ancestral nuclear gene, their patterns of expres-sion and regulatory elements are completely divergent(Tingey et al., 1988). The nuclear gene for GS2 is expressedspecifically in mesophyll cells, and its expression is regu-lated by light predominantly via phytochrome (Edwards etal., 1990). There is also evidence that physiological pro-cesses such as photorespiration affect the levels of GS2mRNA. The GS2 promoter sequence reveals a number ofc/s-acting elements defined for other light-regulated genes(e.g. GT-1, I box). However, GS2 is distinct from light-regulated photosynthetic genes such as rbcS and Cab in thatthe GS2 gene product is also required in plastids of non-green tissues, such as roots, where it functions to assimilate

ammonia. Here, we have examined the molecular basis forthe regulation of GS2 both at the level of n's-acting elementsof the promoter and protein factors that bind to elementstherein.

The GS2 promoter sequence revealed two potentialTATA boxes at —329 and -212. However, we determinedby RNase protection assay that detectable levels of GS2RNA are not produced from these upstream TATA boxes.Instead, further downstream there is a major transcriptionstart site (+1) and two additional upstream minor startsites (-35 and -87). All three detected transcripts occur inRNA from light-grown plants and not in RNA from dark-adapted plants. Multiple transcription start sites were alsoproposed for GlnS (Cock et al., 1992).

In our previous report concerning the cell-specific activ-ity of the pea GS2 promoter, the chimeric GS2-GUS con-struct was a translational fusion that included the entiretransit peptide. To determine whether the presence of thetransit peptide affects the mesophyll cell specific expres-sion of GUS, we constructed a series of 3' deletions, two(+502 and +11) that specifically delete part or all of thetransit peptide. Interestingly, both deletions decrease levelsof GUS activity but do not affect the mesophyll cell-specificexpression pattern of GUS. It is likely that the dramaticreduction in GUS activity, which occurs when the entiretransit peptide is deleted, results from the fact that theprokaryotic ATG of GUS does not function as efficiently asthe native GS2 ATG in translation. We cannot, however,discount the possibility that 3' elements deleted are in-volved in mRNA accumulation. The shortest active 3' de-letion (+11) does, however, show light regulation (seebelow). Further 3' deletions (-59 and -115) that delete theTATA and CCAT boxes abolish expression.

To assess the importance of various 5' elements in theGS2 promoter, we analyzed the expression of a series of5'-deletion mutants. The deletion mutants were assayed forGUS activity in leaves of primary transformants. Thesestudies revealed that the shortest promoter fragment tested(-323) was able to confer mesophyll cell-specific expres-sion to GL7S. Quantitation of GUS activity suggested thepresence of a number of upstream enhancers and repres-sers. The shortest deletion (-323) was still able to drivemesophyll cell-specific GL7S expression. We next assayedthe T! progeny for light-regulated expression and per-formed GUS assays in etiolated versus green seedlingsharvested at the cotyledon stage. It is interesting that weobserved high basal level expression of GS2-GL7S in etio-lated seedlings. This high level of light-independent GS2expression most likely reflects the function of GS2 in thereassimilation of ammonia released during seed storageprotein breakdown in cotyledons and is reflected by therelatively low fold induction by light (2- to 4-fold). In thisrespect, the GS2 gene differs from other light-regulatednuclear genes such as Cab and rbcS that have no physio-logical role in nongreen or etiolated tissues. To assay thelight regulation of GS2-GL7S in mature transgenic plants,we monitored levels of GUS mRNA (Fig. 5) in transgenictobacco and Arabidopsis. The pea GS2 promoter drives

1116 I Tjaden et al. Plant Physiol. Vol. 108, 1995

0.92 -172 agagaaac~aaaatattgaaagtccaagcttctcttggtgctct III IIIIIIIIII I I III II IIII IIIIIIII IIIIII

-122 ttaa accaaaaacaaacttcatccactcaaaaactcacccctatcgt I I l f f f l I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I

-119 taaa~aCCaaaaaCaaatttCatCCaCtC.gtaaCaCaCCCCt8tCW

........ . A T - T T T C A A C C +50

OTC-. . .- I I I I I I I I I I I IIIIIII I I I I I I +69

-TOCC&.TT-AT gagtttctttct +99

TTccnnccrr-~TCT~AT+gagtttctctg+ +119 I I III I I I I I I I I I l l l l l l l l l ~ l l l l l l l l I I

Figure 7. DNA sequence homology between the GS2 and Gln6 gene promoters. A BestFit analysis was performed using the promoter sequences of the GS2 (-1 72 to +99) and the Gln6 genes (Cock et al., 1992). Coding sequences are shown in uppercase; noncoding sequences are shown in lowercase. The putative TATA sequence is indicated by overlining. An I box sequence (Ciuliano et al., 1988) shared between the two promoters is underlined.

light-regulated expression of GUS RNA for a11 deletions, including the shortest deletion -323.

Having defined a short region of the pea GS2 promoter as functional and able to confer light-regulated transcription to GUS in transgenic tobacco and Arabidopsis, we concluded that elements that regulate GS2 genes must be conserved in a variety of species from legumes to mustard plants. Using the Compare program of the Genetics Com- puter Group (Madison, WI) software package, we found that the pea GS2 gene promoter possesses considerable homology with the similarly regulated Gln6. A BestFit analysis of these sequences is shown in Figure 7. The particularly striking feature revealed by this comparison is the extent of nucleotide identity within the 5’ regions of the genes, since the intronic sequences diverge considerably. It is interesting that much of this similarity is within the 5‘ nontranslated leader, which may play a role in transcription as well as translational control, since a deletion remov- ing much of this region resulted in a significant reduction in GUS mRNA and GUS activity. The putative TATA elements and primary transcriptional start sites also lie within the highly conserved regions of the two GS2 promoters. Multiple transcripts detected for chloroplast GS of pea have also been seen for the GS2 genes of P. vulgaris, alfalfa, and barley (Tischer et al., 1986; Freeman et al., 1990; Cock et al., 1992). These results are particularly interesting in light of the following observations. First, expression of the genes for GS2 in pea and P. vulgaris are regulated in re- sponse to photorespiratory conditions, presumably via metabolic control (Edwards and Coruzzi, 1989; Cock et al., 1991). Second, the Esckerickia coli Gln A gene is transcribed from one of two different promoters, depending on the nitrogen source (Reitzer and Magasanik, 1985). It is tempt- ing to speculate that the 5’ region contains elements involved in transcription and translational control, consider-

ing the extent of homology between these two genes. Perhaps transcription of the GS2 gene from different sites within the GS2 promoter is differentially regulated by physiological conditions that affect the nitrogen sources within the plant, e.g. photorespiratory conditions. This may provide a reason for the high leve1 of conservation observed in the 5’ regions of these two genes. Analysis of the expression of the GS2-GUS constructs under conditions that influence nitrogen sources within the plant may address this question.

Sequence analysis, combined with gel-shift analysis, revealed the presence of several cis elements in this short, light-responsive promoter. Of particular interest is the presence of at least one binding site for the nuclear protein GT-1 in the 323-bp, shortest GS2 promoter fragment. DNA elements that bind GT-1 have been implicated in the regulation of gene expression by light for other plant genes (Kuhlemeier et al., 1988; Lam and Chua, 1990). Additional protein-DNA complexes were detected with fragments of the 323-bp promoter. One of these fragments, F1, contained two directly repeating box 2 sequences separated by a palindromic sequence. Shorter fragments containing these sequences detected DNA-protein complexes. Multiple high mobility complexes were detected with DNA fragment F2. Complexes with similar mobility have been reported to contain HMG proteins (Pederson et al., 1991; Czarnecka et al., 1992). F2 also formed complexes with similar charac- teristics to the AT-rich DNA-protein complexes detected with the upstream, box 1-containing GS2 promoter region (Tjaden and Coruzzi, 1994). Further mutation analysis is necessary to determine whether the GT-1-binding element is required for light regulation within this short 323-bp GS2 promoter fragment. As mentioned above, the 323-bp fragment also contains a binding site for the ATBP-1 factor, which binds to AT-rich cis elements that have been found to enhance transcription (Tjaden and Coruzzi, 1994, and refs. therein). Therefore, there are potentially several factors that can bind to and trans-activate this 323-bp GS2 minimal promoter. Previous results regarding the light regulatory GT-1 factor suggest that GT-1 requires other DNA-binding proteins (e.g. TGla) to regulate transcription of chimeric genes (Lam and Chua, 1990). In the native rbcS promoter, this regulation is probably due to protein-protein interactions involving GT-1 and other unidentified nuclear factors. It will be interesting to determine whether the multiple factors that bind to the 323-bp promoter, such as GT-1 and ATBP-1, interact with each other to control light regulation of GS2 gene expression.

Received December 15, 1994; accepted March 20,1995. Copyright Clearance Center: 0032-0889/95/l08/ll09/09.

LITERATURE ClTED

Ausubel FM, Brent R, Kingston RE, Moore DD, Seidman JG, Smith JA, Struhl K, eds (1988) Current Protocols in Molecular Biology. Wiley and Sons, New York

Bustos MM, Guiltinan MJ, Jordano J, Begum D, Kalkan FA, Hall TC (1989) Regulation of P-glucuronidase expression in transgenic tobacco plants by an A/T-rich, cis-acting sequence found upstream of a French bean P-phaseolin gene. Plant Cell 1: 839-853

GS2 Promoter cis Elements and trans Factors 1117

Carvalho H, Pereira SD, Sunkel C, Salema R (1992) Detection of cytosolic glutamine synthetase in leaves of Nicotianu tubucum L. by immunochemical methods. Plant Physiol 100: 1591-1594

Castresana C, Garcia-Luque I, Alonso E, Malik VS, Cashmore AR (1988) Both positive and negative elements mediate expression of a photoregulated cub gene from Nicotianu plumbuginifoliu.

Cock JM, Brock IW, Watson AT, Swarup R, Morby A, Cullimore JV (1991) Regulation of glutamine synthetase genes in leaves of Phaseolus vulguris. Plant Mo1 Biol 17: 761-771

Cock JM, Hemon P, Cullimore JV (1992) Characterization of the gene encoding the plastid-located glutamine synthetase of Phuseolus vulguris: regulation of beta-glucuronidase gene fusions in transgenic tobacco. Plant Mo1 Biol 18: 1141-1149

Czarnecka E, Ingersoll JC, Gurley WB (1992) AT-rich promoter elements of soybean heat shock gene Gmhspl7.5E bind two distinct sets of nuclear proteins in vitro. Plant Mo1 Biol 16

Edwards JW, Coruzzi GM (1989) Photorespiration and light act in concert to regulate the expression of the nuclear gene for chloroplast glutamine synthetase. Plant Cell 1: 241-248

Edwards JW, Walker EL, Coruzzi GM (1990) Cell-specific expression in transgenic plants reveals nonoverlapping roles for chloroplast and cytosolic glutamine synthetase. Proc Natl Acad Sci

Freeman J, Marquez AJ, Wallsgrove RM, Saarelainen R, Forde BG (1990) Molecular analysis of barley mutants deficient in chloroplast glutamine synthetase. Plant Mo1 Biol 1 4 297-311

Giuliano G, Pichersky E, Malik VS, Timko MP, Scolnik PA, Cashmore AR (1988) An evolutionarily conserved protein binding sequence upstream of a plant light-regulated gene. Proc Natl Acad Sci USA 8 5 7089-7093

Green PJ, Kay SA, Chua N-H (1987) Sequence specific interactions of a pea nuclear factor with light responsive elements upstream of the pea rbcS-3A gene. EMBO J 6: 2543-2549

Green PJ, Yong M-H, Cuozzo M, Kano-Murakami Y, Silverstein P, Chua N-H (1988) Binding site requirements for pea nuclear protein factor GT-1 correlate with sequences required for light- dependent transcriptional activation of the pea rbcS-3A gene. EMBO J 7: 4035-4044

Horsch RB, Fry JW, Hoffman NL, Eicholtz D, Rogers SG, Fraley RJ (1985) A simple and general method for transferring genes into plants. Science 227: 1229-1231

EMBO J 7: 1929-1936

877-890

USA 87: 3459-3463

Jackson AO, Larkins BA (1976) Influence of ionic strength, pH, and chelation of divalent metals on isolation of polyribosomes from tobacco leaves. Plant Physiol 57: 5-10

Jefferson RA, Kavanagh TA, Bevan MW (1987) GUS fusions: P-glucuronidase as a sensitive and versatile gene fusion marker in higher plants. EMBO J 6 3901-3907

Kuhlemeier C, Cuozzo M, Green P, Goyvaerts E, Ward K, Chua N-H (1988) Localization and conditional redundancy of regulatory elements in rbcS-3A, a pea gene encoding the small subunit of ribulose-bisphosphate carboxylase. Proc Natl Acad Sci USA 85: 4662-4666

Lam E, Chua N-H (1990) GT-1 binding site confers light responsive expression in transgenic tobacco. Science 27: 471474

Lam E, Kano-Murakami Y, Gilmartin P, Niner B, Chua N-H (1990) A metal-dependent DNA-binding protein interacts with a constitutive element of a light-responsive promoter. Plant Cell2:

Pederson TJ, Arwood LJ, Spiker S, Guiltinan MJ, Thompson WF (1991) High mobility group chromosomal proteins bind to AT- rich tracts flanking plant genes. Plant Mo1 Biol 16 95-104

Reitzer LJ, Magasanik B (1985) Expression of GlnA in Eschericlziu coli is regulated at tandem promoters. Proc Natl Acad Sci USA

Schmidt R, Willmitzer L (1988) High efficiency Agrobucterium tumefaciens-mediated transformation of Arubidopsis thaliunu leaf and cotyledon explants. Plant Cell Rep 7: 583-586

Tingey SV, Tsai F-Y, Edwards JW, Walker EL, Coruzzi GM (1988) Chloroplast and cytosolic glutamine synthetase are encoded by homologous nuclear genes which are differentially expressed in vivo. J Biol Chem 263: 9651-9657

Tingey SV, Walker EL, Coruzzi GM (1987) Glutamine synthetase genes of pea encode distinct polypeptides which are differentially expressed in leaves, roots and nodules. EMBO J 6 1-9

Tischer E, DasSarma S, Goodman HM (1986) Nucleotide sequence of an alfalfa glutamine synthetase gene. Mo1 Gen Genet

Tjaden G, Coruzzi G (1994) A nove1 AT-rich DNA binding protein that combines an HMG I-like DNA binding domain with a putative transcription domain. Plant Cell 6 107-118

Wallsgrove RM, Turner JP, Hall NP, Kendall AC, Bright SWJ (1987) Barley mutants lacking chloroplast glutamine synthetase. Biochemical and genetic analysis. Plant Physiol 83: 155-158

857-866

8 2 1979-1983

203: 221-229

cis elements and frans-acting factors affecting regulation of a

Documents