cancer research hsa-mir-191 is a candidate oncogene ......a novel therapeutic for hcc. we also...

Ther

hsaHep

Eran EEric G

Abst

Intro

Micregulaforma(UTR)by eithsion stdiffereically,regularelativcommcancermotheSorafeincreato seartargetscausereguladiseasbe a kIn t

HCC.

AuthorGenom4Isis Ph

Note:Resear

E. Elya

CorresStreet,222-07

doi: 10

©2010

www.a

Published OnlineFirst October 5, 2010; DOI: 10.1158/0008-5472.CAN-10-1313

Canceresearch

apeutics, Targets, and Chemical Biology

-miR-191 Is a Candidate Oncogene Target for

R

atocellular Carcinoma Therapy

lyakim1, Einat Sitbon1, Alexander Faerman1, Sarit Tabak1, Eve Montia1, Liron Belanis1, Avital Dov1,
. Marcusson3, C. Frank Bennett4, Ayelet Chajut1, Dalia Cohen2, and Noga Yerushalmi1
ractHep

The idpeutictherapreduce

his study,miR-191 w

s' Affiliationics, Inc., Pharmaceutic

Supplemench Online (h

kim and E. S

ponding AuRehovot 7601; E-mail:

.1158/0008-

American A

acrjourna

Download

atocellular carcinoma (HCC) is generally a fatal disease due to a paucity of effective treatment options.entification of oncogenic microRNAs that exert pleiotropic effects in HCC cells may offer new thera-targets. In this study, we have identified the human microRNA miR-191 as a potential target for HCCy. Inhibition of miR-191 decreased cell proliferation and induced apoptosis in vitro and significantlyd tumor masses in vivo in an orthotopic xenograft mouse model of HCC. Additionally, miR-191 wasto be upregulated by a dioxin, a known liver carcinogen, and was found to be a regulator of a variety
found
of cancer-related pathways. Our findings offer a preclinical proof of concept for miR-191 targeting as a rationalstrategy to pursue for improving HCC treatment. Cancer Res; 70(20); 8077–87. ©2010 AACR.

in sommecha191 istion bcanceand ina novmiR-1dioxins, a family of environmental pollutants, and show theinvolv

Mate

miR ePat

ceived(SeoulKoreacludedtient.GmbHtution

duction

roRNAs (miR) are a class of small RNA molecules thatte gene expression (1). Their activity is a result of duplextion between the miR and the 3′ untranslated regionof targetedmRNAs. This results in translational silencinger mRNA degradation or translation blocking. Expres-udies indicate significant changes in miR expression innt disease states comparedwith normal tissue (2). Specif-several studies have reported that various miRs are de-ted in hepatocellular carcinoma (HCC) tissue samplese to nontumor liver controls (3–10). HCC is the fifth moston cancer in the world, and the third leading cause ofdeaths with poor prognosis inmost cases. Standard che-rapy usually has no beneficial outcome on HCC patients.nib was recently approved for use in HCC and shown tose survival by 3months (11). It is still extremely importantch for new therapeutic modalities and novel therapeuticto generate effective therapies for this fatal disease. Be-miRs are master regulators of gene expression, their de-tion in diseases can trigger changes that lead to thee phenotype, and the modulation of their activity caney to the development of novel therapies.

we propose the involvement of miR-191 inas previously identified as being upregulated

accord(IRB)RNA

sue using toforma7- to 1EZ-RNextracMic

usingQua

Sampprevio

s: 1Rosetta Genomics Ltd., Rehovot, Israel; 2Rosettailadelphia, Pennsylvania; and 3Regulus Therapeutics;als, Inc., Carlsbad, California

tary data for this article are available at Cancerttp://cancerres.aacrjournals.org/).

itbon contributed equally to this work.

thor: Noga Yerushalmi, Rosetta Genomics, 10 Plaut706, Israel. Phone: 972-73-222-0712; Fax: [email protected].

5472.CAN-10-1313

ssociation for Cancer Research.

ls.org

Research. on February 1, 20cancerres.aacrjournals.org ed from

e solid tumors, but not in HCC, and no functional ornistic data were reported (12, 13). We show that miR-upregulated in liver cancer tissue and that its inhibi-y a 2-O-metoxyethyl (MOE) anti-miR can reverse therous phenotype of human HCC cells, both in vitrovivo. Thus, this compound has the potential of being

el therapeutic for HCC. We also propose a role for91 in the mechanism, toxicity, and carcinogenesis of

ement of this miR in cancer-related pathways.

rials and Methods

xpression profilingients and samples. Southeast Asian samples were re-as fresh-frozen tissues from Dr. Jung Hwan YoonNational University College of Medicine, Seoul, South). Samples were taken from 30 HCC patients and in-tumor and adjacent to tumor tissue from each pa-

Caucasian samples were purchased from Indivumedas formalin-fixed, paraffin-embedded sections. Insti-

al review approvals were obtained for all samples inance with each institute's Institutional Review Boardor IRB-equivalent guidelines.extraction. Total RNA was extracted from frozen tis-

ing the miRvana miRNA isolation kit (Ambion) accord-the manufacturer's instructions. Total RNA from

lin-fixed, paraffin-embedded samples was isolated from0-μm-thick tissue sections as previously described (14).A II kit (Biological Industries) was used for total RNAtion from cell lines.roRNA microarray platform. Samples were measuredcustom miR microarrays as previously described (14).ntitative reverse transcription-PCR for miRs.

les were measured by quantitative real-time PCR asusly described (15).

8077

21. © 2010 American Association for Cancer

http://cancerres.aacrjournals.org/

Anti-m2′-M

Pharmlot 10and pExplorraphymiRs wanalysquenccontrwhichsix mi

TissueCel

HepGCulturconditing OlreagentransfInd

culturSupel1 μmo10 nmwas foCell

miR acates.for prCell PufactuCas

cates wby meApo-ODua

quencRenillatransfa vect48 houtem (PResultlucifertweennonmCan

Reportechni191 oractivitexpres3′-U

wereing th

GenommiR-mLucifethe mto a ssequeshowncontrotreatmexperitreatecells wChr

were tand pThe imand tcriptiotranscAffy

transfand fronto GUnit, WIn v

ductedfollowCommoratorfree aBasems.c. toharvestrationjectioncontin40 aftenatedweighwas cImm

embedmonofieldspositivProlifpositivfield.

Resu

ExpremiR tCom

HCC a(Table

Elyakim et al.

Cance8078


iR chemistryOE–modified oligonucleotides were synthesized by Isisaceuticals as previously described (16) on AKTA Oligopi-(Amersham/GE Healthcare) oligonucleotide synthesizerurified by ion exchange chromatography on an AKTAer (GE Healthcare) high-performance liquid chromatog-(HPLC) system on a strong anion exchange column. Anti-ere characterized by ion-pair HPLCmass spectrometricis with Agilent 1100 MSD system. The anti–miR-191 se-e was AGCTGCTTTTGGGATTCCGTTG and the negativeol anti-miR was ACATACTCCTTTCTCAGAGTCCA,is the reverse complement sequence of miR-122a withsmatches, thus being an irrelevant sequence.

culture workl growth and transfections. Hep3B, SNU423, and2 cell lines were purchased from the American Typee Collection. Cells were grown under standard growthions. Transfection of cells with anti-miRs was done us-igofectamine (Invitrogen) or with Lipofectamine 2000t (Invitrogen) when both anti-miRs and vectors wereected, according to the manufacturer's instructions.uction of miR-191 expression by TCDD in tissuee. 2,3,7,8-Tetrachlorodibenzo-p-dioxin (TCDD) fromco (Sigma) in toluene was diluted in DMSO tol/L concentration. Cells were grown and treated withol/L TCDD in serum-free media. Exposure to TCDDr 24 to 48 hours.proliferation assay. Cells were transfected with anti-t a concentration range of 20 to 300 nmol/L, in tripli-Seventy-two hours after transfection, cells were testedoliferation using CellTiter 96 AQueous One Solutionroliferation Assay kit (Promega), according to the man-rer's instructions.pase-3/7 activation. Cells were transfected in tripli-ith 50 to 200 nmol/L anti-miRs. Apoptosis was assessedasuring caspase level 24 hours after transfection usingNE Homogenous Caspase-3/7 Assay kit (Promega).l-luciferase reporter assay. Reverse complement se-es to selected miRs were inserted into the 3′-UTR ofluciferase in psiCHECK-2 vector (Promega). Cells were

ected in triplicates with the vector or cotransfected withor and an anti-miR. Luminescence was assayed 24 andrs later using the Dual-Luciferase Reporter Assay Sys-romega) according to the manufacturer's instructions.s were normalized to the constitutively expressed fireflyase from the same vector and shown as the ratio be-the various treatments and cells transfected with aodified vector.cer pathway reporter array. Cignal Finder 10-Pathwayter Array (SABiosciences) was used. Reverse transfectionquewas implemented. Cells were treated with anti–miR-negative control anti-miR. Relative firefly luciferasey was calculated and normalized to the constitutivelysed Renilla luciferase.TR reporter assay for miR target validation. Cells
transfected with luciferase reporter plasmids harbor-e complete 3′-UTR of the desired gene (SwitchGear
(Suppupreg

r Res; 70(20) October 15, 2010

Research. on February 1, 20cancerres.aacrjournals.org Downloaded from

ics), and the relevant treatment of anti-miR orimic. Luminescence was assayed 24 hours later usingrase Reporter Assay System (Promega) according toanufacturer's instructions. Results were normalizedignal from a control vector harboring nonrelevantnce of 2,500 bp (R01 control from SwitchGear) andas the fold change between miR-191 and a negativel treatment for both the mimic and the anti-miRents. t test was performed for wells from multiplements, and we compared populations of the mimic-d cells with a mimic control and anti-miR–treatedith anti-miR control for each gene vector.omatin immunoprecipitation assay. HepG2 cellsreated with TCDD at 10 nmol/L. Cells were than fixedrepared for chromatin immunoprecipitation (ChIP).munoprecipitation was performed at Genepathway,

he binding of chromatin to the precipitated trans-n factor (TF) was quantified by quantitative reverseription-PCR (qRT-PCR).metrix arrays. RNA was extracted from HepG2 cellsected with anti–miR-191 or negative control anti-miR,om untreated cells. mRNA expression was measuredeneChip Affymetrix arrays at the Biological Serviceseizmann Institute.

ivo orthotopic model. Animal experiments were con-at Harlan Biotech Israel. The study was performed

ing an application form review and approval by theittee for Ethical Conduct in the Care and Use of Lab-y Animals. Mice were provided with ad libitum diet andccess to water. HepG2 cells were mixed with Matrigelent Membrane Matrix (BD Biosciences) and injectedBALB/c nude male mice. Subcutaneous tumors wereted and implanted intrahepatically. Anti-miR adminis-(50 mg/kg) was done by a total of 19 repeated i.p. in-s every other day, starting 2 days after induction andued throughout the entire observation period. At dayr orthotopic tumor implantation, the study was termi-; tumor mass, liver, and spleen were excised anded. The significance of the differences of tumor sizesalculated by a two-sided rank sum test.unohistochemistry. Formalin-fixed, paraffin-ded tumor sections were immunostained using rabbitclonal antibody to Ki67 (Abcam). Three nonoverlappingper section/sample were photographed, and Ki67-e and Ki67-negative tumor cell nuclei were counted.eration index was calculated as the ratio of Ki67-e cells from the total number of cells counted per each

lts

ssion of miRs in HCC, selecting the potentialargetsparing miR expression profiles in biopsy samples ofnd adjacent noncancerous liver tissues from patients1A) revealed several differentially expressed miRs

lementary Fig. S1; Table 1B and C). The miRs that wereulated or highly expressed in tumors were selected for

Cancer Research



Table

A. Pat

Origin

Age, yGende

T1-T2T3-T4Etiolog

B. Upr

miR

hsa-mhsa-mhsa-mhsa-mhsa-mhsa-mhsa-mhsa-mhsa-mhsa-mhsa-lehsa-mhsa-lehsa-mhsa-mhsa-mhsa-mhsa-mhsa-mhsa-mhsa-mhsa-mhsa-mhsa-mhsa-mhsa-mhsa-m

C. Do

miR

hsa-mhsa-mhsa-mhsa-mhsa-mhsa-mhsa-mhsa-m

Table

A. Pat

Origin

Age, yGende

T1-T2T3-T4Etiolog

MicroRNA Inhibition for Cancer Therapy

www.aac

Do


es from HCC patientses from HCC patients and patient information
1. Expression of microRNA in tissu
ient information (37 patients)

1. Expression of microRNA in tissu

ient information (37 patients)

y

egulated miRs

Fold change P

iR-222 3.25 <0.0001iR-221 2.83 <0.0001iR-21 2.81 <0.0001iR-331 1.96 <0.0001iR-15b 1.93 0.0004iR-105 1.93 <0.0001iR-107 1.93 0.0009iR-638 1.91 0.023iR-103 1.85 0.0055iR-93 1.80 0.0001t-7d 1.75 0.0006iR-191 1.72 0.0061t-7a 1.68 0.0108iR-210 1.66 0.0003iR-193a 1.60 0.011iR-181b 1.54 0.0012iR-17-3p 1.54 0.004iR-16 1.53 0.0381iR-30d 1.51 0.003iR-339 1.49 0.0002iR-181a 1.48 0.0381iR-18a 1.43 0.0082iR-345 1.43 0.0004iR-423-5p 1.43 0.0208iR-423-3p 1.43 0.0398iR-185 1.43 0.0049iR-483 1.38 0.0148

wnregulated miRs

Fold change

iR-199a 3.25iR-199a* 2.14iR-22 1.69iR-99a 1.61iR-130a 1.52iR-195 1.45iR-378 1.45iR-497 1.45

81% Southeast Asia19% Caucasians

61, 34–8284% M16% F59%41%

y HBV 70%HCV 11%

No viral infection 19%

rjournals.org

Research. on February 1, 2021. © 2010 Amcancerres.aacrjournals.org wnloaded from

81% Southeast Asia
19% Caucasians
61, 34–82
(average, min–max)r(average, min–max)r 84% M
16% F
59%41%
HBV 70%
HCV 11%
No viral infection 19%

IC50

SNU423 Hep3B

150 250ND >300200 250

>300 >300ND NDND NDND ND250 70

>300 >300>300 ∼300ND ND75 100ND ND300 >300ND ND120 >300

>300 >300>300 ∼300ND NDND ND

>300 >300ND NDND NDND ND50 ∼300

120 >300ND ND

P

<0.00010.00010.00020.01200.00630.00290.02310.0213

Cancer Res; 70(20) October 15, 2010 8079

erican Association for Cancer


screenanti-mcalculHep3Bicant dtial asmiRs bphenoapoptthe prupregucell lin(THLE

In vitThe

testedmiR-1tractecustomtreateof antmentsing d

expresvels wobtainCha

activaare shwith itrol anlowingof a nfect asreageshowSNU42with iapoptTo

reportwhichcloned191 reand th

FiguremiR-19treatednegativnegativ ti–miRnegativ e ratio

Elyakim et al.

Cance8080


ing in in vitro proliferation assays in cell lines usingiRs with MOE chemical modification. IC50 values wereated from proliferation assays in two HCC cell lines:and SNU423 (Table 1B). Among the miRs with signif-ifferential expression, only a few miRs showed poten-drug targets for HCC therapy. The inhibition of thesey MOE-modified anti-miRs caused changes in cellulartype such as reduced proliferation and increasedotic response in a dose-dependent manner. One ofomising miRs was miR-191, which was found to belated in HCC and expressed at a higher level in HCCes compared with immortalized normal hepatocytes-2; data not shown).

ro activity of anti–miR-191reduction of miR-191 level following its inhibition wasin Hep3B cells treated with an anti-miR specific for91. miR expression was studied using total RNA ex-d from anti-miR–treated and control-treated cells by-made miR microarray. Detecting miRs in anti-miR–

d cells or tissues can lead to artifactual results becausei-miR presence. Hence, we performed control experi-

e control–modified plasmid. Cells were cotransfected with plasmid and ane control. Signals were normalized to firefly luciferase and calculated as th

that show that theMOE anti-miR was not simply block-etection of miR-191. Only minor changes in the

anti–respon

r Res; 70(20) October 15, 2010


sion of other miRs were observed, whereas miR-191 le-ere reduced in the treated cells (Fig. 1A). Similar resultsed for SNU423 cells are shown in Supplementary Data.nges of cellular phenotypes such as increased caspasetion and reduced proliferation after miR-191 inhibitionown in Fig. 1B and C. Hep3B cells were transfectedncreasing amounts of anti–miR-191 or a negative con-ti-miR. Cells exhibited reduction in proliferation fol-anti–miR-191 transfection, but not in the presence

egative control anti-miR, indicating no general toxic ef-sociated with anti-miRs of this type or the transfectionnts. The proliferation inhibition of anti–miR-191ed an IC50 of 100 and 75 nmol/L for Hep3B and3, respectively. Caspase-3/7 activation also increasedncreasing concentration of anti–miR-191, indicatingosis induction following miR inhibition.verify that the anti-miR specifically inhibits miR-191, aer assay using dual-luciferase vectors was performed inthe reverse complement sequence of miR-191 wasinto the 3′-UTR of the reporter. Endogenous miR-presses the reporter expression by ∼40% (Fig. 1E),e cotransfection of the reporter vector together with

-191, negative control anti-miR, mimic of miR-191, or a mimicof the unmodified plasmid psiCHECK-2.

1. In vitro activity of anti–miR-191. A, miR microarray data following miR-191 inhibition by anti-miR in Hep3B cells showing a downregulation of1, with small change in all other miRs. B, Hep3B cells treated with anti–miR-191 showed increase in activation of caspase-3/7 compared with cellswith negative control anti-miR. C, cells treated with increasing amounts of anti–miR-191 exhibited reduction in proliferation compared with thee control anti-miR. D, dual-luciferase system using plasmid with modified Renilla 3′-UTR of reverse complement sequence to miR-191 and a

miR-191 causes derepression of the reporter. These is specific because the control anti-miR could not

Cancer Research



abolisdogenporteralteredtem wcomplmimicactivitanti–m

TransTo e

lationtion oTFs thhave sulationrefs. 1Loc

accordCpG isintroncontaiTF bin

the TStranslchr3:4date thtionalenvirotivatoactiva(Fig. 2in thein its pFigu

specifmotertivatiobe regwith Tmicro2.4-folmiR-1nomicmoter

FigureAhR acpositive


www.a


h the miR regulation of the reporter. Moreover, the en-ous miR-191 did not change the expression of the re-transcribed from a control plasmid harboring an3′-UTR with a nonrelevant sequence. The same sys-as also tested with a miR-mimic for miR-191, whichetely repressed reporter expression, whereas a controldid not. These results show the specificity of the miRy and the specificity of the inhibition of miR-191 byiR-191.

criptional regulation of miR-191 by dioxinlucidate possible pathways underlyingmiR-191 upregu-in HCC patients, we studied the transcriptional regula-f this miR by examining its transcription unit and theat can in part govern it transcription. Studies to datehown that mature miR expression can be altered by reg-of its biogenesis steps (e.g., Drosha and Dicer activity;

7, 18), as well as by transcriptional activation (19, 20).ation of the transcription start site (TSS) was predicteding to known transcripts, expressed sequence tags, andlands, and it was found thatmiR-191 is transcribed at anic region of the gene DALR anti-codon binding domain
ning 3 (DALRD3; RefSeq NM_018114). We searched for of this
tivation by TCDD. C, ChIP assay for AhR validated the binding of the TF to the procontrol. D, HepG2 cells treated with 10 nmol/L TCDD exhibited increased miR-19

acrjournals.org


S, and the aryl hydrocarbon receptor (AhR)/AhR nuclearocator (Arnt) TFBS motif (21) was predicted at location9034919-49034937. ChIP assay was conducted to vali-e TFBS and the involvement of this TF in the transcrip-regulation of this miR. TCDD that belongs to a family ofnmental pollutants (dioxins; Fig. 2A) was used as an ac-r for the TF because it is a known ligand for AhR (22) andtes this TF to induce the expression of CYP1 proteinsB; ref. 23). CYP1A1 was chosen as a positive control geneChIP assay. This gene has two TFBS for the AhR/Arnt TFromoter, and therefore, both were tested in the assay.re 2C summarizes the results of the ChIP assay using aic antibody for AhR. AhR was found to bind the pro-of miR-191 transcript, with or without the TCDD ac-n; hence, it is suggested that miR-191 upregulation canulated by this promoter. When HepG2 cells treatedCDD were studied for their miR expression by miRarray, miR-191 expression was shown to be elevatedd in treated cells after 48 hours, as seen in Fig. 2D.81a, miR-181b, and miR-181a*, all found in one ge-cluster, were also upregulated, and studying their pro-revealed an AhR/Arnt TFBS on one of the genomic loci
cluster. This is the first demonstration of miR involve-
ding sites (TFBS) in a region covering ±2,000 bp from ment in the toxicology of dioxins.

2. Transcriptional regulation of miR-191. A, molecular structure of TCDD, activator of the AhR pathway. B, a schematic representation of cytoplasmic
moter of miR-191. Two binding domains for CYP1A1 served as1 and miR-181 cluster expression compared with untreated cells.



PathwRNA

ied fothat incells tuntreacontropressily atupreguplemegenes,fold (PTarget

Weanti–mdual-lof vecstreamative ea negaencedcellulagrowtterminfor hu

Table

Acceso

c ci

ENST0NM_00

yNM_02NM_00 SEU126 N pENST0NM_00 ENM_00 NENST0 8NM_00

NM_14 PNM_00 I

eNM_00NM_00NM_02 mNM_01NM_00 2NM_03 S nNM_00AK023 aNM_02 1 aBC039 1 tNM_00 gNM_02 NNM_00 O oNM_02 F iNM_00 ANM_01 ANM_00 GNM_01 mNM

NM_004925 AQP3 4.1 0.001 Aquaporin 3 (Gill blood group)

Elyakim et al.

Cance8082


ay and miR target modulation by anti–miR-191from cells transfected with anti–miR-191 was stud-

r mRNA changes using GeneChip array (Affymetrix)cludes 28K annotated genes. Upregulated genes fromreated with anti–miR-191 were compared with bothted cells and cells that were treated with a negativel oligonucleotide (both controls showed similar ex-on results). The false detection rate was set stringent-0.05 and resulted with 184 genes significantlylated. The list of upregulated genes is added to Sup-ntary Data. Looking at the top list of upregulated4-fold and up (Table 2), showed enrichment of 8.8-
= 0.0145) for miR-191 predicted targets (predicted byScan).
trol ofinhibi

r Res; 70(20) October 15, 2010


then studied the consequences of treating cells withiR-191 on 10 major cancer-related pathways using a

uciferase reporter system (SABiosciences), consistingtors with regulatory elements for key genes down-in those pathways. Figure 3A shows the reporter rel-

xpression between cells treated with anti–miR-191 andtive control oligonucleotide. The pathways most influ-were mitogen-activated protein kinase (MAPK)/extra-r signal-regulated kinase (P < 0.0007), transformingh factor-β (TGF-β; P < 0.01), and MAPK/c-Jun NH2-al kinase (P < 0.03). Those pathways are importantman hepatocarcinogenesis (24) and are part of the con-

2. Upregulated
genes after miR-191 inh ibition
cellular ption of mi

21. © 201

sion Genesymb
l
Fold
hange P Predifor m
ted target
Description R-191
0000386760 —0499 CYP

151A1 15

.7 0.002

.0 0.001
Cytoc hrome P450, family 1, subfamily A, pol peptide 1
0801 ARR
DC3 9 .8 <0.001 Yes Arrest in domain containing 3 4417 DU P1 9 .4 0.001 Dual s pecificity phosphatase 1 604 KP A7 8 .7 0.002 Karyo herin 7 0000314371 — 8 .4 <0.001 1945 HB GF 7 .4 0.001 Yes Hepar in-binding EGF-like growth factor 2229 JU B 7 .3 0.002 Jun B proto-oncogene 0000379981 LOC31031716 OBF
8022 7C2A 6

.0 0.001

.7 0.002
Yes Oligon ucleotide/oligosaccharide-binding fold con taining 2A
B DNA-binding domains containing 1
5039 CEN2309 L
BD1 6F 6

.7 <0.001

.7 0.001
CENPLeuke mia inhibitory factor (cholinergic
diff
rentiation factor) 1124 AD M 6 .5 <0.001 Adren omedullin 1040619 AT F3 6 .5 0.001 Activa ting transcription factor 3 4847 TM C7 6 .1 <0.001 Yes Trans embrane channel-like 7 9096 GTP BP2 5 .8 0.002 GTP b inding protein 2 3548 HIST H4A 5 .7 0.002 Histon e cluster 2, H4a 1459 SE N2 5 .6 0.002 Sestri 2 1300 KL F6 5 .4 <0.001 Krupp el-like factor 6 048 AK02 3048 5 .1 0.003 SubN me: Full = cDNA FLJ50766; 1724 NR D1 4 .9 0.002 Yes Nucle r receptor subfamily 1, group D, member 1 295 FAM 26B 4 .9 0.001 Hypo hetical protein LOC285172 1964 EG R1 4 .6 0.001 Yes Early rowth response 1 0307 CC L1 4 .5 0.002 Cyclin L1 4040 RH B 4 .4 <0.001 Ras h mologue gene family, member B 0127 TU T1 4 .3 0.002 Tuftel n 1 5904 SM D7 4 .3 0.001 SMAD family member 7 5508 TIP RP 4 .3 <0.001 TCDD -inducible poly(ADP-ribose) polymerase 4723 ARH EF2 4 .3 <0.001 rho/ra c guanine nucleotide exchange factor
otin-like 2
6201 AMO1002914 KCT
TL2 4D11 4

.2 0.002

.2 0.002
Yes Angio
Potas
ium channel tetramerization domain _00 scontaining 11
roliferation and differentiation. Because theR-191 led to changes in those pathways, we

Cancer Research

0 American Association for Cancer


searchpathwtions ohibitiomiR-1genesoverlaSOX4,erase3′ endand fosearchfectedmiR-1

increarelativwas cmap ofor thmentscontroportertreatm(P = 0changanti-m

FigureThe ratgenes ftargetsvectorspathwa


www.a


ed for direct targets among the genes related to thoseays. Figure 3B shows overlap of genes from popula-f mRNA upregulated 2-fold or more after miR-191 in-n (from the Affymetrix GeneChip), predicted targets of91 (from the union of TargetScan and Miranda), andin affected pathways (from KEGG and NetPath). Fourpping genes were found from the three populations:CRK, IRAK2, and PDGFB. We have constructed lucif-plasmids with the complete 3′-UTR of each gene at theof firefly luciferase (SwitchGear), for those four genesr additional potential genes from those populations, tofor a direct miR-191 target. Each plasmid was cotrans-
into cells with either treatment of anti–miR-191 or91 mimetic and relevant controls. Reporter signal that
mimicconsid

harboring full 3′-UTR of selected genes for both anti–miR-191 treatment and miRys and genes after miR-191 inhibition, and the cellular response that leads toward

acrjournals.org


sed with anti-miR and decreased with miR mimetice to the same effect on a negative control plasmidonsidered direct miR-191 targets. Figure 3C is a heatf the results showing fold change in the reporter assaye selected genes, for the mimic and anti-miR treat-, comparing with same treatments with the negativel vector. Of the four overlapping genes, only SOX4 re-was significantly upregulated after anti-miR (P = 0.01)ent and downregulated after miR-mimic treatment.004). However, IL1A and TMC7 were also significantlyed in the same manner (P = 2 × 10−6 and P = 0.004 foriR treatment and P = 0.04 and P = 0.001 for the miR-
treatment, respectively). Those genes are thereforeered to be direct miR-191 target genes.
3. Target modulation by anti–miR-191 by monitoring gene expression. A, reporter assay of key response elements in major cancer-related pathways.io of reporter signals between cells treated with anti–miR-191 and negative control is shown as increased or decreased fold change. B, overlap ofrom three populations of (a) upregulated genes after miR-191 inhibition (upregulated 2-fold and up in Affymetrix GeneChip), (b) predicted miR-191(from union of TargetScan and Miranda), and (c) genes in affected pathways (from union of KEGG and NetPath). C, reporter fold change signals for

-191-mimic treatment. D, schematic representation of the affectedapoptosis and inhibits the survival and proliferation paths.




In vivHCC mAn

test thtentiato creThoseand pito gengery (tday i.peach wcontroafter wweighmass aparisoti-miRdifferementresultianimament

was dwith acant rby Ki(Fig. 4

Discu

miRtargetexpresulatioconditwithinbecauthe mTherein theHCC

predocidenc

Figureis signiweighinby qRTExpressreduced

Elyakim et al.

Cance8084


o efficacy of anti–miR-191 in orthotopicodel

orthotopic liver xenograft model was established toe activity of anti–miR-191 in vivo and evaluate its po-l as a therapeutic agent in HCC. HepG2 cells were usedate subcutaneous xenografts in donor nude mice.subcutaneous tumors were harvested and fragmented,eces were implanted into livers of acceptor nude miceerate orthotopic tumor xenografts. Two days after sur-umor implant), the mice were subjected to every other. injections of oligonucleotide. Two groups of 15 miceere treated with either anti–miR-191 or a negativel anti-miR. The experiment was conducted for 40 days,hich livers, tumors, and spleens were harvested and

ed. Figure 4A shows the significant decrease of tumort day 40 in animals treated with anti–miR-191, in com-n with the group that received the negative control an-. Liver and spleen weights showed no significantnce between the groups (Fig. 4B and C). This experi-was conducted in two independent in vivo studies, bothng with a statistically significant tumor reduction in

t

in tumors taken from anti–miR-191–treated animals (P = 0.026).

ls treated with anti–miR-191 (data of second experi-are added to Supplementary Data). miR-191 expression

pathothe he

r Res; 70(20) October 15, 2010


ecreased in the tumors harvested from animals treatednti–miR-191 (Fig. 4D). These tumors showed a signifi-eduction of the fraction of proliferating cells revealed67 (MKI67; RefSeq NM_002417) immunostainingE; images are added to Supplementary Data).

ssion

s are considered to have great potential as therapeutics because by nature they are master regulators of genesion and therefore of cellular pathways (25, 26). Dereg-n of miRs was shown to be present in different diseaseions. Inhibition of one miR can result in a vast effecta cell and can alter significantly the cellular phenotypese it can change several genes that are direct targets ofiR, as well as genes influenced by those direct targets.fore, miR inhibition or replacement can be a key factortreatment of various disease conditions (26).is the fifth most common cancer worldwide. It occurs

minantly in developing countries, but nevertheless, in-e is on the rise in Western countries as well (27). The

4. In vivo efficacy of anti–miR-191 in an orthotopic xenograft model. A, tumor mass reduction in orthotopic implanted mice treated with anti–miR-191ficant compared with mice treated with negative control anti-miR (P = 0.00014) seen on day 40 of the experiment after organ harvesting andg. B and C, liver and spleen weight are not changed between the two groups, meaning no obvious toxicity is seen. D, miR-191 expression measured-PCR in the harvested tumors shows a significant reduction in miR-191 expression (P = 1.7 × 10−7) in the tumor tissue of the treated mice.ion is calculated as 50 − normalized C . E, proliferation index measured by the ratio of Ki67 positively stained cells from total cells is shown to be

physiology of HCC is not yet fully understood becausepatocarcinogenesis process is complex and HCC has a

Cancer Research



heterothe cato be dtigatedThe

miR-1lines tThe inic. Weactivamentthe dorays pThis isthat shsponsedo noenvirohazardadversimmucinogeAhR lthrougAhR tto forthe Dis respzymesThis rrangeeliminsponseductiochangchangthat Tceptorcitiesthe AhmecharequirThe

to elucthe mway tothoseencesarray191–tranti-mserveddictedproteigene ewithoumajorsay wa

mostpatocaprolifesignales sucand tfoundpathwmostlyof invoAna

ways thibitiofor mgenesusingthe funote tgene eeven jexempin theThereto betion aare inof a vmiR-1and thment.shownSOX

bryonprolifelatedmetasthat Sfor p5nism,inhibiactivithave oIL1A (ing aleukinimmupoiesito bemorpwas fNM_0two pHowegenepredicupreg


www.a


geneous nature. Many pathways may be involved inrcinogenic process of HCC, and as miRs were showneregulated in HCC in many previous studies, we inves-the involvement of miRs in this process.inhibition of one of the upregulated miRs in HCC,

91, was found to induce cellular changes in HCC cellhat triggered proliferation inhibition and apoptosis.hibition of the miR was found to be potent and specif-also found that miR-191 is upregulated after TCDD

tion, a carcinogen from the dioxin family. The involve-of miRs in the mechanism of TCDD activity can explainwnregulation of several genes seen on expression ar-erformed on cells following TCDD treatment (28, 29).in contrast to the study by Moffat and colleagues (30)owed only moderate changes in miR expression in re-to TCDD, in rodent models, and concluded that miRs

t play a role in dioxin toxicity. Dioxins are a family ofnmental pollutants that are known to have multipleous effects. TCDD is a very potent carcinogen, causinge biological responses such as developmental defects,notoxicity, and more (31). The mechanism for the car-nic effect of dioxin is not yet fully understood. It is anigand, and its effects are thought to be mediatedh the activation of AhR (22). On ligand binding, theranslocates to the nucleus and associates with Arntm a heterodimer that binds to an enhancer site onNA designated as xenobiotic-responsive element andonsible for transcriptional activation of a variety of en-involved in xenobiotic metabolism (Fig. 2B; ref. 32).

esponse presumably evolved to be able to detect a wideof chemicals and facilitate their biotransformation andation in the detoxification process. However, toxic re-s are also elicited by AhR activation, either by the pro-n of toxic intermediate metabolites or by aberrantes in global gene expression that lead to adversees in cellular processes. Microarray analysis showedCDD induces changes in epidermal growth factor re-and MAPK pathways that can explain part of its toxi-and carcinogenicity (28, 33). Although the induction ofR by dioxins is well characterized, the function andnism of some of its toxicities are still unknown ande further study.downstream effect of miR-191 inhibition was studiedidate the pathways miR-191 is involved in and to studyechanism in which miR inhibition can alter the path-induce a potential curative effect in HCC. We studiedeffects in several stages. First, we analyzed the differ-in gene expression at the mRNA level using GeneChipby Affymetrix, comparing the expression of anti–miR-eated cells with cells treated with a negative controliR. Extensive changes in gene expression were ob-, with a significant enrichment in genes that are pre-targets of miR-191. We also looked for changes at

n levels using reporter systems because miRs also alterxpression at the protein level by translation inhibitiont major changes in mRNA level (34, 35). To identify the
pathways that are affected by miR-191, a reporter as-s used. TGF-β and MAPK pathways were found to be
did noanti-m

acrjournals.org


affected. These pathways play a significant role in he-rcinogenesis (24). The TGF-β pathway regulates cellration, differentiation, and adhesion (36). The MAPKing pathway is also involved in diverse cellular process-h as cell survival, differentiation, and proliferation (27),he overexpression of members of this pathway wasto be correlated to HCC (37). Interestingly, the MAPKay, altered by anti–miR-191, was the one reported to beinfluenced by dioxins (33), strengthening the findingslvement of miR-191 as a key regulator of this pathway.lyzing the overlapping genes from the affected path-ogether with the mRNA upregulated after miR-191 in-n in the Affymetrix array and predicted target genesiR-191 resulted with a list of potential direct targetfor miR-191. We have tested the genes from this lista luciferase reporter assay with constructs harboringll 3′-UTR of those potential targets. It is important tohat because miRs are considered master regulators ofxpression, the expectation is that more than one orust a few genes would be affected directly. This is alsolified in our enrichment of miR-191 predicted targetsupregulated genes in anti–miR-191–treated cells.

fore, the miR-191 targets that we validated are believedonly part of the complex response to miR-191 regula-nd the first attempt to identify its direct targets thatvolved in HCC. It is our view that the concerted actionast number of genes whose expression is affected by91 inhibition is the cause for the phenotype changee efficacy we are witnessing after anti–miR-191 treat-Among the genes we have tested, three genes wereto be direct miR-191 targets.4 (RefSeq NM_003107) is a TF responsible for em-ic cell development and regulates cell differentiation,ration, and survival. SOX4 was found to be upregu-in many cancers and was even thought to inducetasis in HCC (38). However, it was recently foundOX4 acts as a DNA damage sensor and is required3 tumor suppressor activation (39). By this mecha-SOX4 promotes cell cycle arrest and apoptosis, andts tumorigenesis in a p53-dependant manner. Thisy can be the reason for the beneficial outcome webserved by its upregulation after miR-191 inhibition.RefSeq NM_000575), which was also validated as be-direct target of the miR, is a member of the inter--1 cytokine family. This gene is involved in variousne responses, inflammatory processes, and hemato-s and is known to induce apoptosis. It was foundpolymorphic in many diseases. Interestingly, poly-hism in its miR-122 binding site at the 3′-UTRound to be related to HCC (40). TMC7 (RefSeq24847) belongs to a family of ion channels and hasredicted binding sites for miR-191 in its 3′-UTR.ver, not much is known about the activity of thisin HCC. CRK, IRAK2, and PDGFB, all of which haveted binding sites for the miR and were shown to beulated at the mRNA level after miR-191 inhibition,
t show any reporter expression changes with eitheriR or miR-mimic treatments. We concluded that



thesein an ilar chinhibihow tand thcells intion pThe

els wachanganti-mmodecancerwas santi-mtionssquammiR ichangvirus–effectiIn o

xenogthe liv(i.p.), tstreamhumantions owas oof thetreatemarkea systtherap

Thiupregdiseasmenttion aextenvolvedbe invprogrmiR-1MOE-trialsas a pthe livand ccludemiR is

Discl

All arespecti

Ackn

WePharma

Grant

IsraeThe

of pageaccorda

Refe1. Ba

fun2. Ca

Re3. Lad

toctum

4. Vapropa

5. WaheapCh

6. Jiasioand

7. Kurod20

8. MeMicge647

Elyakim et al.

Cance8086


genes participate in the changes anti–miR-191 inducesndirect way. Hence, the orchestration of all those cellu-anges is the cause of the efficacy achieved by miR-191tion. Figure 3D shows a schematic representation ofhe involvement of both the direct targets of miR-191e genes that are changed indirectly leads the cancerousto apoptotic fate, and how the survival and prolifera-aths are inhibited.effectiveness of in vivo miR inhibition in cancer mod-s already shown, but studies to date showed onlyes in tumor size when cells were transfected withiR ex vivo and then injected to produce the tumorl. Such studies were done in glioma (41) or breast(41, 42). In a model for prostate cancer, miR inhibition

hown to be effective after intratumoral injections ofiR (43). This was also seen with intratumoral injec-of anti–miR-21 in a subcutaneous xenograft of tongueous cell carcinomas (44). In a model of glioblastoma,nhibition was shown to effect angiogenesis, but noe in tumor mass was observed (45). Adeno-associatedmediated replacement of miR-26a was shown to beve in a murine liver cancer model (46).ur study, we established an orthotopic human liverraft model where tumor fragments are implanted iner of mice and the anti-miR is administered systemicallyherefore reaching the tumor after entering the blood-and thus imitating the delivery methods used withcancer therapeutics. We show that with repeated injec-f the anti-miR, a significant inhibition of tumor growthbserved at day 40, without observed toxicity. The levelendogenous miR-191 in the tumors of anti–miR-191–d mice was decreased, as well as the cell proliferationr Ki67. To our knowledge, this is the first study that uses
emic route of administration of an anti-miR to show Rece
roRNA-21 regulates expression of the PTEN tumor suppressorne in human hepatocellular cancer. Gastroenterology 2007;133:–58.

9. Mumino

10. Wocothr

11. Llotoc

12. Xico

13. VoofSc

14. Raof26

15. Gilno

16. Estab87

17. JiafilinAc

r Res; 70(20) October 15, 2010


s study shows the identification of a specific miR that isulated in HCC as a potential therapeutic target for thise. We propose that miR-191 is relevant for HCC treat-because its inhibition caused decreased cell prolifera-nd tumor growth. Furthermore, the study also

ded our understanding on how this miR can be in-in TCDD toxicity. In addition, miR-191 was found toolved in pathways known to be important for tumoression and growth, showing the potential of anti–91 as a cancer therapeutic. There are currently manymodified antisense oligonucleotides in human clinical(47). Therefore, the MOE-modified anti–miR-191 servesotential therapeutic compound, as it passively reacheser and tumor implant, inhibiting miR-191 efficientlyausing no observed toxicity in the animals. We con-that miR-191 inhibition using a MOE-modified anti-of high potential for the treatment of HCC patients.

osure of Potential Conflicts of Interest

uthors are full-time employees of and hold options to equity in theirve companies.

owledgments

thank workers at Rosetta Genomics, Regulus Therapeutics, and Isisceuticals for their assistance and contributions.

Support

l-U.S. Binational Industrial Research and Development Foundation.costs of publication of this article were defrayed in part by the paymentcharges. This article must therefore be hereby marked advertisement innce with 18 U.S.C. Section 1734 solely to indicate this fact.

ived 04/20/2010; revised 07/19/2010; accepted 08/10/2010; published
eutic effects on the growth o f a primary solid tumor. OnlineFirst 10/05/2010.
rencesrtel DP. MicroRNAs: genomics, biogenesis, mechanism, andction. Cell 2004;116:281–97.lin GA, Croce CM. MicroRNA signatures in human cancers. Natv Cancer 2006;6:857–66.eiro Y, Couchy G, Balabaud C, et al. MicroRNA profiling in hepa-ellular tumors is associated with clinical features and oncogene/or suppressor gene mutations. Hepatology 2008;47:1955–63.

rnholt H, Drebber U, Schulze F, et al. MicroRNA gene expressionfile of hepatitis C virus-associated hepatocellular carcinoma. He-tology 2008;47:1223–32.ng Y, Lee AT, Ma JZ, et al. Profiling microRNA expression inpatocellular carcinoma reveals microRNA-224 up-regulation andoptosis inhibitor-5 as a microRNA-224-specific target. J Biolem 2008;283:13205–15.ng J, Gusev Y, Aderca I, et al. Association of microRNA expres-n in hepatocellular carcinomas with hepatitis infection, cirrhosis,patient survival. Clin Cancer Res 2008;14:419–27.

tay H, Bai S, Datta J, et al. Downregulation of miR-122 in theent and human hepatocellular carcinomas. J Cell Biochem06;99:671–8.ng F, Henson R, Wehbe-Janek H, Ghoshal K, Jacob ST, Patel T.

rakami Y, Yasuda T, Saigo K, et al. Comprehensive analysis ofcroRNA expression patterns in hepatocellular carcinoma andn-tumorous tissues. Oncogene 2006;25:2537–45.ng QW, Ching AK, Chan AW, et al. MiR-222 overexpressionnfers cell migratory advantages in hepatocellular carcinomaough enhancing AKT signaling. Clin Cancer Res 16:867–75.vet JM, Ricci S, Mazzaferro V, et al. Sorafenib in advanced hepa-ellular carcinoma. N Engl J Med 2008;359:378–90.Y, Formentini A, Chien M, et al. Prognostic values of microRNAs inlorectal cancer. Biomark Insights 2006;2:113–21.linia S, Calin GA, Liu CG, et al. A microRNA expression signaturehuman solid tumors defines cancer gene targets. Proc Natl Acadi U S A 2006;103:2257–61.ver-Shapira N, Marciano E, Meiri E, et al. Transcriptional activationmiR-34a contributes to p53-mediated apoptosis. Mol Cell 2007;:731–43.ad S, Meiri E, Yogev Y, et al. Serum microRNAs are promisingvel biomarkers. PLoS One 2008;3:e3148.au C, Davis S, Murray SF, et al. miR-122 regulation of lipid me-olism revealed by in vivo antisense targeting. Cell Metab 2006;3:–98.
ng J, Lee EJ, Gusev Y, Schmittgen TD. Real-time expression pro-g of microRNA precursors in human cancer cell lines. Nucleicids Res 2005;33:5394–403.
Cancer Research



18. VisRN

19. Tusio200

20. Dinism200

21. Dorecin v

22. Nebome

23. Mimof

24. Capapa

25. Nepo

26. Liuinte

27. Arahe

28. Frumicexp

29. HaTCco

30. MomicTo

31. Modiomic

32. ScrecTo

33. Matox

34. SeRami

35. MatraeIF

36. Ma37. Hu

ex(Msio

38. Liausmitas

39. Pais c20

40. Gamico20

41. CoShanere

42. Sigro

43. Meexpcin

44. LitonCa

45. Wugroce

46. Kode


www.a


wanathan SR, Daley GQ, Gregory RI. Selective blockade of micro-A processing by Lin28. Science 2008;320:97–100.rner MJ, Slack FJ. Transcriptional control of microRNA expres-n in C. elegans: promoting better understanding. RNA Biol9;6:49–53.g XC, Weiler J, Grosshans H. Regulating the regulators: mechan-s controlling the maturation of microRNAs. Trends Biotechnol9;27:27–36.ng L, Ma Q, Whitlock JP, Jr. DNA binding by the heterodimeric Aheptor. Relationship to dioxin-induced CYP1A1 transcriptionivo. J Biol Chem 1996;271:7942–8.bert DW, Dalton TP, Okey AB, Gonzalez FJ. Role of aryl hydrocar-n receptor-mediated induction of the CYP1 enzymes in environ-ntal toxicity and cancer. J Biol Chem 2004;279:23847–50.ura J, Fujii-Kuriyama Y. Functional role of AhR in the expression

toxic effects by TCDD. Biochim Biophys Acta 2003;1619:263–8.lvisi DF, Pascale RM, Feo F. Dissection of signal transductionthways as a tool for the development of targeted therapies of he-tocellular carcinoma. Rev Recent Clin Trials 2007;2:217–36.lson KM, Weiss GJ. MicroRNAs and cancer: past, present, andtential future. Mol Cancer Ther 2008;7:3655–60.Z, Sall A, Yang D. MicroRNA: an emerging therapeutic target andrvention tool. Int J Mol Sci 2008;9:978–99.valli RN, Steer CJ, Cressman EN. Molecular mechanisms ofpatocellular carcinoma. Hepatology 2008;48:2047–63.eh FW, Hayashibara KC, Brown PO, Whitlock JP, Jr. Use of cDNAroarrays to analyze dioxin-induced changes in human liver generession. Toxicol Lett 2001;122:189–203.nlon PR, Zheng W, Ko AY, Jefcoate CR. Identification of novelDD-regulated genes by microarray analysis. Toxicol Appl Pharma-l 2005;202:215–28.ffat ID, Boutros PC, Celius T, Linden J, Pohjanvirta R, Okey AB.roRNAs in adult rodent liver are refractory to dioxin treatment.xicol Sci 2007;99:470–87.ennikes O, Loeppen S, Buchmann A, et al. A constitutively activexin/aryl hydrocarbon receptor promotes hepatocarcinogenesis ine. Cancer Res 2004;64:4707–10.hwarz M, Buchmann A, Stinchcombe S, Kalkuhl A, Bock K. Aheptor ligands and tumor promotion: survival of neoplastic cells.
xicol Lett 2000;112–113:69–77.rlowe JL, Puga A. Aryl hydrocarbon receptor, cell cycle regulation,icity, and tumorigenesis. J Cell Biochem 2005;96:1174–84.
Ce47. Gle

20

acrjournals.org


lbach M, Schwanhausser B, Thierfelder N, Fang Z, Khanin R,jewsky N. Widespread changes in protein synthesis induced bycroRNAs. Nature 2008;455:58–63.thonnet G, Fabian MR, Svitkin YV, et al. MicroRNA inhibition ofnslation initiation in vitro by targeting the cap-binding complex4F. Science 2007;317:1764–7.ssague J. TGFβ in cancer. Cell 2008;134:215–30.ynh H, Nguyen TT, Chow KH, Tan PH, Soo KC, Tran E. Over-pression of the mitogen-activated protein kinase (MAPK) kinaseEK)-MAPK in hepatocellular carcinoma: its role in tumor progres-n and apoptosis. BMC Gastroenterol 2003;3:19.o YL, Sun YM, Chau GY, et al. Identification of SOX4 target genesing phylogenetic footprinting-based prediction from expressioncroarrays suggests that overexpression of SOX4 potentiates me-tasis in hepatocellular carcinoma. Oncogene 2008;27:5578–89.n X, Zhao J, Zhang WN, et al. Induction of SOX4 by DNA damageritical for p53 stabilization and function. Proc Natl Acad Sci U S A09;106:3788–93.o Y, He Y, Ding J, et al. An insertion/deletion polymorphism atRNA-122-binding site in the interleukin-1α 3′ untranslated regionnfers risk for hepatocellular carcinoma. Carcinogenesis 2009;30:64–9.rsten MF, Miranda R, Kasmieh R, Krichevsky AM, Weissleder R,ah K. MicroRNA-21 knockdown disrupts glioma growth in vivod displays synergistic cytotoxicity with neural precursor cell deliv-d S-TRAIL in human gliomas. Cancer Res 2007;67:8994–9000.ML, Zhu S, Wu H, Lu Z, Wu F, Mo YY. miR-21-mediated tumorwth. Oncogene 2007;26:2799–803.rcatelli N, Coppola V, Bonci D, et al. The inhibition of the highlyressed miR-221 and miR-222 impairs the growth of prostate car-oma xenografts in mice. PLoS One 2008;3:e4029.J, Huang H, Sun L, et al. MiR-21 indicates poor prognosis ingue squamous cell carcinomas as an apoptosis inhibitor. Clinncer Res 2009;15:3998–4008.rdinger T, Tannous BA, Saydam O, et al. miR-296 regulateswth factor receptor overexpression in angiogenic endotheliallls. Cancer Cell 2008;14:382–93.ta J, Chivukula RR, O'Donnell KA, et al. Therapeutic microRNAlivery suppresses tumorigenesis in a murine liver cancer model.ll 2009;137:1005–17.
ave ME, Monia BP. Antisense therapy for cancer. Nat Rev Cancer05;5:468–79.



2010;70:8077-8087. Published OnlineFirst October 5, 2010.Cancer Res Eran Elyakim, Einat Sitbon, Alexander Faerman, et al. Hepatocellular Carcinoma Therapyhsa-miR-191 Is a Candidate Oncogene Target for

Updated version

10.1158/0008-5472.CAN-10-1313doi:

Access the most recent version of this article at:

Material

Supplementary

http://cancerres.aacrjournals.org/content/suppl/2010/10/04/0008-5472.CAN-10-1313.DC1

Access the most recent supplemental material at:

Cited articles

http://cancerres.aacrjournals.org/content/70/20/8077.full#ref-list-1

This article cites 46 articles, 12 of which you can access for free at:

Citing articles

http://cancerres.aacrjournals.org/content/70/20/8077.full#related-urls

This article has been cited by 7 HighWire-hosted articles. Access the articles at:

E-mail alerts related to this article or journal.Sign up to receive free email-alerts

Subscriptions

Reprints and

[email protected] at

To order reprints of this article or to subscribe to the journal, contact the AACR Publications

Permissions

Rightslink site. Click on "Request Permissions" which will take you to the Copyright Clearance Center's (CCC)

.http://cancerres.aacrjournals.org/content/70/20/8077To request permission to re-use all or part of this article, use this link

Research. on February 1, 2021. © 2010 American Association for Cancercancerres.aacrjournals.org Downloaded from


http://cancerres.aacrjournals.org/lookup/doi/10.1158/0008-5472.CAN-10-1313

http://cancerres.aacrjournals.org/content/suppl/2010/10/04/0008-5472.CAN-10-1313.DC1

http://cancerres.aacrjournals.org/content/70/20/8077.full#ref-list-1

http://cancerres.aacrjournals.org/content/70/20/8077.full#related-urls

http://cancerres.aacrjournals.org/cgi/alerts

mailto:[email protected]

http://cancerres.aacrjournals.org/content/70/20/8077


cancer research hsa-mir-191 is a candidate oncogene ......a novel therapeutic for hcc. we also...

Documents