cancer genetics for primary care sara levene registered genetic counsellor

Cancer Genetics for Primary Care

Sara LeveneRegistered Genetic Counsellor

Proportion of cancer that is inherited

Inherited susceptibility to cancer:‘genetic’Single genes

Family history of cancer:‘familial’?multi-factorial origins

No family history of Cancer: ‘sporadic’?multi-factorial origins

Population risk:Breast cancer 1:10Ovarian cancer 1:100Colorectal cancer 1:25 - 35

To make a long story short:

All cancer is genetic

Cancer is rarely inherited

Sporadic cancer

hormonesviruses chemicals

radiationSpontaneous mutations

2 normal genes1 normal gene1 mutated gene 2 mutated genes

cancer

1 normal gene1 mutated gene 2 mutated genes cancer

Inherited cancer

hormonesviruses chemicals

radiationSpontaneous mutations

Inherited Mutations and Cancer

• Inherited mutations relating to cancer do not cause cancer

• Mutations are often found in genes that are ‘tumour suppressors’

• Mutations mean that protection from cancer is lost or reduced

• Mutations lead to increased susceptibility to certain types of cancer

Autosomal dominant inheritance

mother father

child child

Each child has 50:50 chance of inheriting the altered gene.

Genetic testing

Cancer GenesMendelian Inheritance (AD)

• In the last 10 years several genes relating to specific cancer syndromes have been identified

• There are more cancer genes waiting to be ‘discovered’

• It is difficult to locate the exact mutation in a cancer gene for a particular family

Cancer GenesMulti-factorial Inheritance

• More recently the search for other AD genes has led to the discovery of some ‘lower risk’ genes eg. CHEK2 – found in ~2% cases ca br– est doubles risk of ca br

• ? Liability/threshold model with several similar genes (+ env factors)

• This research is not yet applicable to clinical practice

Genetic Testing

• Technically difficult• Can only be offered to high risk families• Can only search small number of high risk

dominant genes• Can take more than a year to search for the

mutation in a family• Often cannot locate the mutation for a

family (?unknown genes)

Searching for the faulty genecgattgaggatcgtacgtattaacggtagctataccagtcgatccattggagtcatcgatgtt

cgattgaggatcgtacgtattaacggtagctataccagtcgatccattggagtcatcgatgtt














a

Genetic Testing

• First test in family always done on person who has had the cancer (mutation search test)

• If no living affected relatives available – cannot offer genetic test for family

• If a mutation is found predictive testing can be offered to at-risk relatives: – If relative doesn’t carry familial mutation they are not

at increased risk of cancer (still at population risk)

– If a person does carry the familial mutation they are at increased risk of developing cancer

Family History of Breast Cancer

High RiskCancer risks associated with

BRCA1 and BRCA2

Breast and ovarian cancer

• Breast cancer risk ~80%• Ovarian cancer risk ~45%• Increased risk of second

primary for women who have already had breast cancer

Other cancers

• Prostate cancer • Male breast cancer • Pancreatic cancer • Colorectal cancer

• Stomach cancer

Recent NICE Guidelines on Familial Breast Cancer

• Women at or near population risk are cared for in primary care.

• Women at moderate risk are cared for in secondary care.

• Women at high risk are cared for in tertiary care.

Breast cancer case study 1

Ca breast, diag 70yDied 85y

Brain tumour, died 67y ? Prev breast cancer in 40s?

68y



Brain tumour, died 67y No record of prev ca br

68y

Can this patient now be reassured?

Population riskScreening and management

• National breast screening from 50y• Breast awareness• Reassure patient:

– For most women, increasing age is the greatest risk factor.– The great majority of women with a family history of breast cancer do not fall into a high-risk category and do not develop breast cancer.


Ca breast, diag 52y

20y

Ca breast, diag 54y Patient is requesting screening and is considering prophylactic mastectomies.

What is her level of risk?

What is appropriate management of her risk?

Patient is also interested in genetic testing. Can this be offered?

Moderate risk Referral to secondary care

Female breast cancers

• One 1st degree relative diagnosed before age 40

• Two 1st degree relatives (or one 1st

degree relative and one 2nd degree relative) diagnosed after average age 50

Moderate riskScreening and management

• Annual breast surveillance from age 40 – 50y

• National Breast Screening from 50y.

• ?Chemoprevention studies

• Breast awareness

Ca breastDiag 32y

Ca breastDied 40y


What can we offer this family?

Considering prophylactic mastecomies

Ca breastDiag 32yBlood taken for BRCA1/2 testing

Ca breastDied 40y


Recommend screening

Recommend screening

Ca breastDiag 32yBRCA1/2 testing on-going

Ca breastDied 40y


Ca breastDiag 35y

Ca breastDiag 32yBRCA1 mutation found

Ca breastDied 40y


Ca breastDiag 35y

Ca breastDiag 32yBRCA1 mutation found

Ca breastDied 40y


Ca breastDiag 35yBRCA1 mutationcarrier

N

BRCA1 mutationcarrier

High risk Referral to secondary care, then tertiary care• Two 1st degree relatives (OR one 1st degree relative

and one 2nd degree relative) with breast cancer, av age <50

• Three or more 1st or 2nd degree relatives with breast cancer at any age

• One 1st degree male relative with breast cancer at any age

• One 1st degree relative with bilateral breast cancer where 1st primary diagnosed <50

• One 1st or 2nd degree relative with ovarian cancer at any age and one 1st or 2nd degree relative with breast cancer at any age

High riskScreening and management

• 30-39y: may be eligible for annual mammograms

• 40-49y: annual mammograms• >50y: NBSP, plus may be eligible for

additional screening• Refer to genetics to discuss genetic testing• ?MRI screening in the future• ?Prophylactic surgery• ?Ovarian screening



Ca breast, diag 41y

Ca ?type

What should we do for this family?



Ca breast, diag 41y

Ca ovary, died 48y

Breast & ovarian screening



Ca breast, diag 41yBlood taken for BRCA1/2 testing

Ca ovary, died 48y

Breast & ovarian screening



Ca breast, diag 41yBRCA1/2 testedNo mutations found

Ca ovary, died 48y

Considering surgery

Other factors to consider:• Paternal history:

two or more breast cancers on father’s side of family

• Unusual cancers:Bilateral breast cancerMale breast cancerOvarian cancerSarcoma <45yGlioma or childhood adrenal cortical carcinomaComplicated patterns of multiple cancers at young age

• Jewish ancestryWomen with Jewish ancestry are around 5–10 times

more likely to carry BRCA1 or BRCA2 mutations than women in non-Jewish populations.

Family History of Colorectal Cancer

FAPFamilial Adenomatous

Polyposis

• 100% affected by 35y• Hundreds/thousands of

polyps in colon• Mutation on APC gene• Accounts for <1% colon

cancers• Other cancer risks:

duodenal, gastric

• Up to 80% lifetime risk • Less than 10 polyps

found• At least 5 genes found• Accounts for up to 5%

of colon cancers• Other cancer risks:

endometrial, ovarian, gastric

HNPCCHereditary Non-Polyposis

Colon Cancer

Familial Adenomatous Polyposis (FAP)

CRC FH Risk categorisationLow riskOne FDR with CRC at > 45(No screening required, bowel awareness)

Low-Moderate riskTwo FDRs with CRC at average age > 60.Screening: One colonoscopy at 35y-40y and one at 55y

High-Moderate riskOne FDR with CRC <45, or three older FDRs i.e. >50.Screening: Begins at 45 or 5yrs prior to youngest diagnosis (not prior to 35). Repeat 5yrly to 75y.

What is High Risk?

• A known polyposis syndrome e.g. FAPBe sure to ask if there is any history of polyposis in the family.

• HNPCC (Amsterdam positive families).

– At least 3 of HNPCC related cancers (CRC, endometrium, ovarian, small bowel, ureter or renal pelvis)

– One should be a FDR of the other two– At least two successive generations affected– At least one cancer diagnosed < 50 years

HNPCC• Colonoscopies from 25y, continuing 2 yearly to 75y• ?Endometrial/ovarian screening annually from 35y (research)

FAP• Colonoscopies annually from teens (or younger depending on

family history)• Prophylactic colectomy offered• ?Upper GI screening annually (research)

High risk screening/management

Summary

• Most cancer is not due to dominant, high-risk genes.• Most patients with a family history of cancer can be

reassured and possibly referred for screening. • For most patients with a family history of cancer, current

genetic testing is not helpful and is not available. • Patients with a high risk of cancer due to family history

can have screening, and genetic testing may be available.• Patients who inherit a mutation in a high risk gene have a

high risk of developing cancer themselves.

Take-home messages• Young diagnoses of cancer (<45y) may be

significant• Three or more cases of the same / related types of

cancer, in one family (even if older ages) may be significant

• Genetic testing may or may not be available / informative for a given family

• Genetic testing must start with a living affected relative

• Screening may be available

If you have enquiries about a family history :

Contact your local Clinical Genetics dept:

Clinical GeneticsGreat Ormond Street Hospital London WC1N 3JH

Tel: 0207 905 2138

Clinics held at Barts and The London.

cancer genetics for primary care sara levene registered genetic counsellor

Documents

cancer mutations

genetic cancer

breast cancer

proportion of cancer

cancer genetics

ovarian cancer

colorectal cancer

cancer inherited mutations