bacterial assisted phytoremediation of crude oil

Kaneez Fatima

2017

Department of Biotechnology

Pakistan Institute of Engineering and Applied Sciences

Nilore, Islamabad, Pakistan

Bacterial Assisted Phytoremediation of

Crude Oil-Contaminated Soil

This page intentionally left blank.

Bacterial Assisted Phytoremediation of

Crude Oil-Contaminated Soil

Kaneez Fatima

Submitted in partial fulfillment of the requirements

for the degree of Ph.D.

2017

Department of Biotechnology

Pakistan Institute of Engineering and Applied Sciences

Nilore, Islamabad, Pakistan

ii

Acknowledgements

I would like to express my appreciation to everyone who helped me during the long

journey of my PhD.

First and foremost, I am most grateful to Dr. Shahid Mansoor (S.I.), Director

NIBGE, who maintained healthy research-oriented environment in this prestigious

Institute. My sincere thanks go to Dr. M. Sajjad Mirza Head, Soil and Environmental

Biotechnology Division and ex Head; Dr. Qaiser M. Khan, for their valued

suggestions and providing flexible and friendly working environment.

I offer my sincerest gratitude to my supervisor, Dr. Muhammad Afzal, for his

constant encouragement, support, understanding, patience, critical inputs and

continuous help during this research work and thesis write up. His presence has always

been a source of inspiration for me. Without his precious support it would not be

possible to conduct this research. There are no proper words to express thanks to my

co-supervisor, Dr. Asma Imran, for her valuable suggestions towards improving my

work and strengthening my self-confidence. Her skillful advices, sincere cooperation,

and guidance enabled me to learn a lot during this period.

There is no way to express how much it meant to me to have been a member of

Wastewater treatment and phytoremediation group. I am grateful to Ms. Razia Tehseen

and Mr. Shabbir for their time to time valuable suggestions. Special thanks must go to

my brilliant lab fellows Khadeeja, Nain Tara, Rabbia and all other present and former

lab students for their coordination and productive discussions. I am also thankful to Mr.

Sajjad and Mr. Ghulam Hussain, who assisted me in performing green house and

field experiments.

I am deeply grateful to Prof. Dr. Gunter Brader for hosting me at Health and

Environment Department, Austrian Institute of Technology (AIT), Austria during

IRSIP fellowship. He gave me the chance to work with highly skilled people and to

learn a lot from them and the long discussions that helped me sort out the technical

details of microbiological and molecular work.

iii

I deeply thank my dear father and loving mother for their unconditional trust,

motivation, and endless patience. It was their love that raised me up again when I got

exhausted. My lovely sisters, Marriam and Bushra, have also been generous with their

love and always cheered me up despite the long distance between us. I am extremely

thankful to family of my Uncle for their affection and care during my stay in

Faisalabad.

I acknowledge the support of my husband, Uzair Ahmed. He has been my best

friend and great companion who always encouraged, entertained, and helped me get

through this agonizing period in the most positive way.

I would like to thank my lovely friends, Dr. Ambrin, Aamna, Faryal, Uzma,

and Mehvish who went through hard times together, cheered me on and celebrated my

accomplishments.

I am thankful to Dr. Imran Amin for his help and expertise during qPCR

analysis. I am grateful to Ali Imran, Muhammad Asif, and Muhammad Iqbal from

university cell for all paper work during the course of study. I am indebted to Dr. Zahid

Mukhtar, Head, Agricultural Biotechnology Division, for his help, expertise and

suggestions during formatting of my thesis.

I would like to thank Higher Education Commission (HEC) for giving me an

opportunity to visit Austrian Institute of Technology under IRSIP fellowship and to

work in highly competititve environment. Finally, I am grateful to Oil and Gas

Development Company Limited (OGDCL) and its staff for allowing us to perform

field experiment.

Kaneez Fatima

iv

This thesis is dedicated to

My Beloved Parents

&

Husband Thank you for endless love, support, prayers

and advices.

v

Declaration of Originality

I hereby declare that the work contained in this thesis and the intellectual content of this

thesis are the product of my own work. This thesis has not been previously published

in any form nor does it contain any verbatim of the published resources which could be

treated as infringement of the international copyright law. I also declare that I do

understand the terms ‘copyright’ and ‘plagiarism,’ and that in case of any copyright

violation or plagiarism found in this work, I will be held fully responsible of the

consequences of any such violation.

____________

Kaneez Fatima 24 October, 2017

NIBGE,

Faisalabad.

vi

Copyrights Statement

The entire contents of this thesis entitled Bacterial Assisted Phytoremediation of

Crude Oil-Contaminated Soil by Kaneez Fatima are an intellectual property of

Pakistan Institute of Engineering & Applied Sciences (PIEAS). No portion of the thesis

should be reproduced without obtaining explicit permission from PIEAS.

vii

Table of Contents

Acknowledgements ...................................................................................................... ii

Copyrights Statement ................................................................................................. vi Table of Contents ....................................................................................................... vii List of Figures ............................................................................................................... x List of Tables .............................................................................................................. xii List of Publications……………………………………………………………….....xv

1 Introduction and Review of Literature ............................................................ 1

1.1 Background .................................................................................................. 1

1.2 Crude Oil and Environmental Pollution ...................................................... 4

1.3 Fate of PHs in Soil Environment ................................................................. 6

1.4 Soil Remediation: Preserving a Precious Resource ..................................... 7

1.4.1 Physicochemical vs. Biological Methods ............................................... 7

Bioremediation: A Natural Method for the Restoration of Polluted Sites .. 7

1.5.1 Biodegradative Bacteria ......................................................................... 8

1.5.2 Concerns Associated with Bioremediation ............................................ 9

Phytoremediation: Using Green Technology to Restore Contaminated

Environment .............................................................................................. 12

1.6.1 Plant Selection for Phytoremediation ................................................... 14

Microbe-Assisted Phytoremediation: An Optimal Approach to Revitalize

Ecosystem ................................................................................................. 15

1.7.1 Rhizoremediation: Use of Rhizobacteria to Enhance Hydrocarbon

Phytoremediation ................................................................................. 17

1.7.2 Endophyte-Assisted Phytoremediation ................................................ 18

Metabolic Pathways for Biodegradation of PHs ....................................... 20

1.8.1 Aerobic Biodegradation ....................................................................... 21

1.8.2 Anaerobic Biodegradation .................................................................... 21

Enzymatic Biodegradation ........................................................................ 24

2 General Materials and Methods...................................................................... 26

Media and Chemicals ................................................................................ 26

Equipment .................................................................................................. 26

Soil Sample Collection .............................................................................. 26

Seeds and Seedlings................................................................................... 27

Bacterial Strains ......................................................................................... 27

Maintenance and Preservation of Bacteria ................................................ 27

Isolation of Rhizobacteria and Endophytes ............................................... 29

viii

Characterization of Isolated Bacteria ........................................................ 29

2.8.1 Colony and Cell Morphology ............................................................... 29

2.8.2 Molecular Characterization .................................................................. 30

Experimental Setup for Crude Oil and n-Alkanes Biodegradation Studies

................................................................................................................... 31

Screening of Alkane Hydroxylase Genes (alkB and CYP 153) in Isolated

Bacterial Strains ........................................................................................ 32

In vitro Plant Growth-Promoting Potential of Rhizospheric and Endophytic

Bacteria ..................................................................................................... 34

Analysis by Confocal Laser Scanning Microscopy (CLSM) for Biofilm

Formation and Root Colonization ............................................................. 36

Plant Inoculation Studies ........................................................................... 37

Analysis of Residual Crude Oil in Soil ..................................................... 37

Persistence and Survival of Inoculated Bacteria ....................................... 38

3 Selection of Crude Oil Tolerant Plants and Their Associated Bacteria ...... 39

3.1 Introduction ............................................................................................... 39

3.2 Materials and Methods .............................................................................. 40

3.2.1 Soil Sampling ....................................................................................... 40

3.2.2 Screening of Crude Oil-Tolerant Plant Species ................................... 40

3.2.3 Isolation and Characterization of Hydrocarbon-Degrading Bacteria ... 41

3.2.4 Growth on Crude Oil, Alkanes and Aromatic Hydrocarbons .............. 41

3.2.5 Detection of Alkane Hydroxylase Genes in Isolated Bacteria ............. 41

3.2.6 In vitro Screening of Plant Growth-Promoting (PGP) Traits ............... 42

3.3 Results ....................................................................................................... 42

3.4 Discussion .................................................................................................. 54

4 Green House Evaluation of Plant-Bacteria Partnership for the Remediation

of Crude Oil-Contaminated Soil ..................................................................... 56

4.1 Introduction ............................................................................................... 56


4.2.1 Bacterial Strains ................................................................................... 57

4.2.2 Tagging of Bacterial Strains with Yellow Fluorescent Protein (YFP) and

Formulation of Bacterial Consortium .................................................. 57

4.2.3 In vitro Biofilm Formation ................................................................... 57

4.2.4 Experimental Setup .............................................................................. 58

4.2.5 Analysis of Crude Oil Residues in Soil and Biostimulant Efficiency .. 59

4.2.6 Persistence of the Inoculated Endophytes ............................................ 59

4.2.7 Quantification of Abundance and Expression of alkB Gene ................ 59

4.3 Results ....................................................................................................... 59

ix

4.4 Discussion .................................................................................................. 69

5 Bacterial Assisted Phytoremediation of Soil Contaminated with Crude Oil

in an Oil Field.................................................................................................... 72

5.1 Introduction ............................................................................................... 72


5.2.1 Site Description .................................................................................... 73

5.2.2 Bacterial Strains ................................................................................... 74

5.2.3 L. fusca and B. mutica .......................................................................... 75

5.2.4 Experimental Design ............................................................................ 75

5.2.5 Quantification of Inoculated Strains .................................................... 77

5.2.6 Quantification of Abundance and Expression of alkB Gene ................ 77

5.2.7 Crude Oil Analysis in Soil ................................................................... 78

5.2.8 Seed Germination Bioassay for Toxicity Evaluation ........................... 78

5.2.9 Statistical Analysis ............................................................................... 78

5.3 Results ....................................................................................................... 79

5.4 Discussion .................................................................................................. 87

6 General Discussion ........................................................................................... 90 7 References ......................................................................................................... 97

8 Appendices ...................................................................................................... 122

x

List of Figures

Figure 1-1 Chemical structure of some crude oil components ................................... 5

Figure 1-2 Concerns due to crude oil contamination of soil ...................................... 6

Figure 1-3 Bacterial species involved in different types of PHs degradation .......... 11

Figure 1-4 Factors influencing the process of bioremediation of soil contaminated

with PHs ................................................................................................. 12

Figure 1-5 Plant-microbe interactions that lead to remediation of soils contaminated

with PHs ................................................................................................. 20

Figure 1-6 Schematic overview of metabolic pathways for hydrocarbons (aliphatic

and aromatic) utilization by aerobic bacteria. ........................................ 23

Figure 3-1 In vitro crude oil degradation potential of isolated bacterial strains. ..... 46

Figure 3-2 Plant growth promoting-potential of some representative strains .......... 51

Figure 4-1 Attachment of Acinetobacter sp. strain BRSI56-yfp on thin cover slip (22

mm). ........................................................................................................ 60

Figure 4-2 Attachment of pseudomonas aeruginosa strain BRRI54-yfp on thin cover

slip (22 mm) ............................................................................................ 60

Figure 4-3 Biofilm formation on thin cover slip (22 mm) by Acinetobacter sp. strain

BRSI56-yfp. ............................................................................................ 61

Figure 4-4 Biofilm formation on thin cover slip (22 mm) by Pseudomonas

aeruginosa strain BRRI54-yfp ................................................................ 62

Figure 4-5 Colonization of yfp-tagged Pseudomonas aeruginosa BRRI54 and

Acinetobacter sp. BRSI56 on the rhizoplane (a), root cortical cells (b), and

leaf mesophyll cells (c) of Brachiaria mutica. ....................................... 64


Acinetobacter sp. BRSI56 inside the roots of L. fusca . ......................... 65

Figure 4-7 Growth responses including root and shoot length (a), fresh and dry

weight (b) of L. fusca and B. mutica, vegetated in crude oil contaminated

soil with and without bacterial augmentation ......................................... 66

Figure 4-8 Effect of bacterial consortia AP (Acinetobacter sp. strain BRSI56 and

Pseudomonas aeruginosa strain BRRI54) inoculation on crude oil

degradation after 93 days of vegetation. ................................................. 68

Figure 4-9 Biostimulant efficiency (%) of treated soil samples collected after 93 days

of bioremediation process ....................................................................... 68

Figure 5-1 Crude oil-contaminated soil in the vicinity of an oil exploration and

production company before start of the experiment ............................... 73

Figure 5-2 Experimental setup for endophyte-assisted phytoremediation of crude oil

contaminated soil in the vicinity of an oil exploration and production

company. ................................................................................................. 76

xi

Figure 5-3 Effect of crude oil contamination and endophytes (Pseudomonas

aeruginosa strain BRRI54, Acinetobacter sp. strain BRSI56, and

Klebsiella sp. LCRI87) inoculation on root and shoot length (a) and fresh

and dry weight (b) of L. fusca and B. mutica. ........................................ 80

Figure 5-4 Effect of vegetation of (L. fusca and B. mutica) and inoculation of

endophytes (Pseudomonas aeruginosa strain BRRI54, Acinetobacter sp.

strain BRSI56, and Klebsiella sp. LCRI87) on crude oil degradation. .. 81

Figure 5-5 Mean values of colony forming unit (CFU), abundance and expression of

alkB gene in rhizosphere, root and shoot interior of B. mutica (a), and L.

fusca (b). ................................................................................................. 83

Figure 5-6 Effect of vegetation (L. fusca and B. mutica) and endophytes inoculation

on the detoxification of crude oil contaminated soil. ............................. 85

Figure 5-7 Correlation between crude oil degradation (%) and colony forming units

(CFU) (g-1 dry weight of soil) (a), gene abundance (copies of alkB g-1 dry

weight of soil) and gene expression (transcripts level of alkB gene g-1 dry

weight of soil) (b), and gene expression and crude oil degradation (%) (c).

................................................................................................................ 86

xii

List of Tables

Table 1.1 Pros and cons of phytoremediation ........................................................... 14

Table 1.2 Bacterial and plant enzymes involved in alkane degradation ................... 25

Table 2.1 List of plants (grasses, trees and edible crops) used in the present work . 28

Table 2.2 Primers used for amplification of alkB and CYP 153 genes in isolated

bacterial strains ......................................................................................... 33

Table 3.1 Physico-chemical properties of soil collected from crude oil-contaminated

site of an oil exploration and production company ................................... 40

Table 3.2 Biomass production of plants vegetated in crude oil-contaminated soil .. 44

Table 3.3 Bacterial strains isolated from rhizosphere (RH), root interior (RI) and

shoot interior (SI) of Brachiaria mutica (BRA), Lolium perenne (LOL),

Leptochloa fusca (LEP), Acacia ampliceps (ACA) and Lecucaena

leucocephala (LEC) .................................................................................. 45

Table 3.4 Degradation abilities of isolated rhizospheric and endophytic bacteria using

different hydrocarbons as substrate ........................................................... 47

Table 3.5 PCR amplification of alkane hydroxylase genes (alkB and CYP 153) ..... 49

Table 3.6 In vitro plant growth-promoting potential of endophyte and rhizosphere

bacterial strains isolated from different grasses and trees ......................... 52

Table 4.1 Experimental design of green house experiment ...................................... 58

Table 4.2 Colony forming unit (CFU), abundance and expression of alkB .............. 69

Table 5.1 Physico-chemical properties of soil from crude oil contaminated site of an

oil exploration and production company where experiment was conducted

................................................................................................................... 74

Table 5.2 Experimental design of field experiment .................................................. 77

Table 5.3 Effect of endophytes (Pseudomonas aeruginosa strain BRRI54,

Acinetobacter sp. strain BRSI56, and Klebsiella sp. strain LCRI87)

inoculation, vegetation (Leptochloa fusca and Brachiaria mutica) and

plant-endophytes partnerships on soil toxicity reduction using wheat

(Triticum aestivum L.) as a model plant ................................................... 84

xiii

Abstract

Petroleum hydrocarbons are recalcitrant compounds and their adverse environmental

and public health effects demand that efficient and eco-friendly remediation

technologies be devised as countermeasures. The synergistic use of plants and bacteria

is considered as one of the efficient technologies for the restoration of crude oil-

contaminated soil. The studies performed in this thesis were aimed to (ⅰ) isolate and

characterize bacteria associated with the plants growing well in crude oil-contaminated

soil, (ⅱ) study the effect of augmentation of hydrocarbon-degrading bacteria on plant

growth and crude oil degradation in vitro and in vivo.

A large number of hydrocarbon degrading bacteria were isolated from the

rhizospheric soil, root and shoot interior of grasses (Lolium perenne, Leptochloa fusca,

Brachiaria mutica) and trees (Leucaena leucocephala and Acacia ampliceps) vegetated

in crude oil-contaminated soil. The rhizospheric soil yielded 22 (59.45%), root interior

yielded 9 (24.32%) and shoot interior yielded 6 (16.21%) hydrocarbon-degrading

bacteria. These bacteria possessed genes encoding alkane hydroxylase and showed

multiple plant growth-promoting activities. Bacillus (48.64%) and Acinetobacter

(18.91%) were dominant genera found in this study.

Green house studies revealed that augmentation with crude oil-degrading

bacteria enhanced plant growth and crude oil degradation. Colonization and metabolic

activity of the endophytes were higher in the rhizosphere and endosphere of B. mutica

than L. fusca. The plant species affected not only colonization pattern and biofilm

formation of the inoculated bacteria in the rhizosphere and endosphere of the host plant,

but also affected the expression of alkane hydroxylase gene, alkB.

The beneficial plant-bacteria partnership was applied in the vicinity of an oil

exploration and production company for the remediation of crude oil-contaminated soil.

Bacterial augmentation improved plant growth, enhanced crude oil degradation, and

reduced soil toxicity and these were significantly (p < 0.05) higher than those where

plants or bacteria were used individually. A positive relationship (r = 0.70) observed

xiv

between alkB gene expression and crude oil reduction indicates that expression of

catabolic gene (alkB) is important for hydrocarbon mineralization.

On the basis of in vitro and in vivo studies, it is concluded that for practical

application, support of potential bacteria combined with the grasses is more effective

approach than the use of plants and bacteria individually. This technology can be

applied for effective remediation of crude oil-polluted sites.

xv

List of Publications

Journal Publications

K. Fatima, M. Afzal, A. Imran, and Q. M. Khan, “Bacterial rhizosphere and

endosphere populations associated with grasses and trees to be used for

phytoremediation of crude oil contaminated soil,” B. Environ. Contam. Toxicol.,

vol. 94, no. 3, pp. 314-320, 2015.

K. Fatima, A. Imran, I. Amin, Q. M. Khan, and M. Afzal, “Plant species affect

colonization patterns and metabolic activity of associated endophytes during

phytoremediation of crude oil-contaminated soil.” Environ. Sci. Pollut. Res., vol.

23, no. 7, pp. 6188-6196, 2016.

K. Fatima, A. Imran, I. Amin, Q. M. Khan, and M. Afzal, “Successful

phytoremediation of crude-oil contaminated soil at an oil exploration and

production company by plants-bacterial synergism” (submitted in Int. J.

Phytorem.)

G. Shabir, M. Arslan, K. Fatima, A. Imran, Q. M. Khan, and M. Afzal, “Effects

of inoculum density on plant growth and hydrocarbon degradation,” Pedosphere,

vol. 26, no. 5, pp. 774-778, 2016.

M. Shehzadi, K. Fatima, A. Imran, M. Mirza, Q. Khan, and M. Afzal, “Ecology

of bacterial endophytes associated with wetland plants growing in textile effluent

for pollutant-degradation and plant growth-promotion potentials,” Plant Biosyst.,

vol. 150, no. 6, pp. 1261-1270, 2016.

M. U. Khan, A. Sessitsch, M. Harris, K. Fatima, A. Imran, M. Arslan, “Cr-

resistant rhizo-and endophytic bacteria associated with Prosopis juliflora and

their potential as phytoremediation enhancing agents in metal-degraded soils,”

Front. Plant Sci., vol. 5, no.1, pp. 755, 2015.

J. Hashmat, K. Fatima, M. A. Haq, Q. M. Khan, M. Afzal, “Characterization of

rhizospheric and endophytic bacteria associated with plants grown in constructed

wetlands to remediate water with crude oil,” (submitted in Ecol. Engg.)

Conference Publications

K. Fatima, M. Afzal, and Q. M Khan, Plant-bacteria partnerships for the

remediation of contaminated soil and water. Oral presentation in 15th

International Congress of Soil Science, National Agricultural Research Centre,

Islamabad, Pakistan, 2014.

M. Afzal, and K. Fatima, Plant-bacteria partnership for the remediation of

hydrocarbon contaminated soil. Poster presented in International Conference on

Biotechnology; Prospects & Challenges in Agriculture, Industry, Health &

xvi

Environment”. National Institute for Biotechnology and Genetic Engineering,

Faisalabad, Pakistan, 2013.

K. Rehman, N. Tara, K. Fatima, S. Ashraf, R. Tahseen, Q. M. Khan, M. Afzal,

Floating wetlands: A new approach to wastewater remediation, poster presented

in 2nd National Students Conference, 2015.

NCBI Submission

K. Fatima, and M. Afzal, “16S rRNA gene sequence submission of 37 bacterial

strains to National Center for Biotechnology Information, 2013.

https://www.ncbi.nlm.nih.gov/

xvii

List of Abbreviations

PHs Petroleum Hydrocarbons

PAHs Polyaromatic hydrocarbons

Kow Octanol/water partition coefficient

CFU Colony forming unit

LB Luria Bertani

mL Milliliter

GI Germination Index

BE Biostimulant efficiency

M9 Minimal medium

O.D Optical Density

EC Electric Conductivity

SI Shoot interior

RI Root interior

RH Rhizosphere

Rpm Revolution per minute

µg Microgram

µL Micro Liter

g Gram

YFP Yellow fluorescent protein

ISR Induced systemic resistance

PCR Polymerase Chain Reaction

qPCR Quantitative Polymerase Chain Reaction

CLSM Confocal laser scanning microscopy

PGPR Plant growth promoting rhizobacteria

DNA Deoxy Nucleic Acid

DMSO Dimethyl Sulfoxide

1

1 Introduction and Review of Literature

1.1 Background

Soil is an essential life-supporting and fundamental constituent of the biosphere which

offers a numbers of advantages to the surroundings including primary production,

control of biogenic gases, water cycling, preservation of life and biodiversity [1, 2]. In

earlier times, it was believed that our land and its resources are in abundance and will

remain available for centuries. Unfortunately, due to excessive use and now misuse,

half of this natural wealth is either destroyed or is at the verge of depletion [3-5]. The

reasons behind continuous exhaustion of healthy soil ecosystem are the use of chemical

fertilizers, release of other anthropogenic chemicals, and dumping of

industrial/domestic wastes into the environment; all these activities are posing a

significant threat to mankind itself [1, 6]. In addition to other prevalent pollutants,

petroleum hydrocarbons (PHs) are of specific concern because of their structural

complexity, hydrophobicity, toxicity, and persistent nature [7, 8]. Once soil is polluted

with PHs, its recovery may take several years [9].

The world's energy source depends greatly on petroleum oil and its products,

and world-wide energy demand is expected to rise steeply over the next twenty years

[10, 11]. Due to their extreme use, there is a chance that these PHs may release in the

environment and cause severe damage to the ecosystem. Environmental contaminants

enter the environment by both natural and manmade sources leading to contamination

of drinking water, diminishing water and air quality, waste of non-renewable resources,

and loss of soil fertility [12-14]. On the other hand, continual contact with high oil

concentrations may have negative effects on human health and all other life forms as

well. Even at low levels of contamination, residual hydrocarbons cause lethal mutations

in genetic material. Thus due to its mutagenic and neurotoxic effects, the United States

Environmental Protection Agency (US EPA) categorizes crude oil as a significant

pollutant [15-17].

Chapter 1 Introduction and Review of Literature

2

Considering the worldwide problem of soil pollution, more suitable treatments

are necessary as compared to the conventionally used more expensive and

environmentally deleterious ex situ techniques. Conventional technologies, based on

physicochemical methods (soil washing, chemical reduction or oxidation of

contaminants, and incineration), are less practicable due to high cost, environmental

invasion, engineering skills, labor administration, and operational management [18].

Keeping in mind the limitation of conventional technologies, a much better method is

needed to destroy the pollutants or to transform them into nontoxic substances. This

can be achieved by the use of efficient microbes in conjunction with suitable plants i.e.,

microbe-assisted phytoremediation [19, 20]. This technique provides a means of in situ

treatment of contaminated land with high efficiency using natural biological activity.

In plant-microbe partnership, plants offer nutrients and habitat to their associated

bacteria and in return, microbes enhance plant growth and detoxify environmental

pollutants [21-25].

Objectives of the Present Study

The studies undertaken in this thesis address the screening of native plants and their

associated bacteria for the restoration of crude oil-contaminated soil. Moreover, the

survival and colonization of the bacteria in the rhizosphere and different interior

compartments of plant were assessed by cultivation-dependent and -independent

approaches. The primary purpose is to further our understanding of plant-bacteria

partnership that facilitate degradation of hydrocarbons in soil. These aims were pursued

as independent studies:

Study 1: Selection of crude oil tolerant plants and their associated bacteria

Study 2: Green house evaluation of plant-bacteria partnership for the remediation of

crude oil-contaminated soil

Study 3: Bacterial assisted phytoremediation of soil contaminated with crude oil in an

oil field

Preface

The present thesis is organized in seven chapters. Chapter one designates the

background and aims of the study and provides a broad overview of the impact of crude

oil contamination on environment, biological mechanisms used in soil remediation,


3

phytoremediation, microbial-assisted phytoremediation, and metabolic pathways

involved in hydrocarbon degradation.

Second chapter describes the specific research procedures used in this study. It

illustrates the general experimental designs, sampling procedures, bacterial isolation

and characterization, and growth analysis studies of plants grown in polluted soil.

Third chapter presents the results from an experiment determining the

phytoremediation efficacy of different trees and grasses growing in crude oil-

contaminated soil. We found that grasses are more tolerant to contaminants than trees

and host a variety of hydrocarbon degrading/plant growth-stimulating bacteria.

In chapter four, the colonization behavior and metabolic activity of two strains,

Pseudomonas aeruginosa BRRI54 and Acinetobacter sp. strain BRSI56, were

investigated after applying these strains to Brachiaria mutica and Leptochloa fusca

(grass species) grown in oil-polluted environment. Culture-dependent and -independent

investigation showed that maximum attachment, abundance, and expression of genes is

present in endosphere and rhizosphere of B. mutica than in the endosphere and

rhizosphere of L. fusca. These results suggest that type of plant host affects the

colonization patterns and metabolic activity of bacteria and ultimately the degradation

of hydrocarbons.

Fifth chapter describes the phytoremediation efficacy of B. mutica and L. fusca

inoculated with bacterial consortium in the vicinity of an exploration and production

company for the restoration of crude oil polluted soil. Both grasses, L. fusca and B.

mutica, showed potential to remediate soil contaminated with crude oil and their

remediation potential was further enhanced by bacterial inoculation. Inoculated bacteria

showed not only persistence but also exhibited significant metabolic activity in the soil

and plant tissues.

Chapter six is the general discussion summarizing the results from all the studies

mentioned above. It also presents the conclusions derived from the overall study, and

future prospects for the collective usage of bacteria and plants for the restoration of

polluted soil. Chapter seven is the literature cited in this thesis.


4

1.2 Crude Oil and Environmental Pollution

Crude oil (naturally occurring raw oil) primarily contains different amounts of carbon,

hydrogen, sulfur, nitrogen, oxygen, and a variety of metal-containing compounds [26-

27]. It is categorized as light, medium, or heavy oil on the basis of heavy molecular

weight components present in it. Its proportion may differ with site, age and depth of

an oil well [28]. On the basis of composition, crude oil is characterized in to four major

elements: 1) aliphatics, 2) aromatics, 3) resins, and 4) asphalthenes. Some of the

constituents of crude oil is shown Fig. 1-1. Each fraction has a distinctive chemical and

physical activity that affects the way it spreads and undergoes biodegradation in the

environment [29]. In structural organization of the aforementioned constituents of

crude oil, aliphatics fraction constitutes the outmost layer while asphalthenes, on the

basis of high molecular weight, constitute the inmost layer of oil [14, 15].

Petroleum hydrocarbon contaminants are one of the most recalcitrant biological

contaminants in the environment. Because of their toxic nature, they cause wide-

ranging and permanent damage to human as well as all other life forms. Although

microbes eradicate soil pollution, when the quantity of impurities surpasses the

buffering capability of soil, it has a lasting adverse effects on its quality and biodiversity

[30].

Contamination of petroleum hydrocarbons is a concern for various reasons (Fig.

1-2). Firstly, once entered into soil, the instability of hydrocarbons can cause fire or

even lethal outbursts, particularly once fumes arrive confined spaces [31]. Furthermore,

pollutants can adsorb on soil and be retained for ages thus leading to land degradation.

Though these waste product may help the soil microflora as source of energy, but they

have lethal and mutagenic effects on microorganisms even at low concentrations [32].

PHs also destroy the aesthetics of land by inducing unpleasant odor, taste in associated

groundwater, or appearance to surroundings. Persistent seepage and continuous runoffs

occur due to their mobile nature which extends their impact to adjacent areas [33].


5

Figure 1-1 Chemical structure of some crude oil components

Cyclo-alkane

n-alkane

C-C-C-C-C

Iso-alkane

Polyaromatic hydrocarbon Naphthenic acid

Aromatic hydrocarbon

Phenol


6

Figure 1-2 Concerns due to crude oil contamination of soil

1.3 Fate of PHs in Soil Environment

It is essential to gain knowledge about the fate of PHs within the surroundings in order

to control and combat pollution. The soil rhizosphere helps in structural rearrangement

of hydrocarbons arriving from several sources [34]. When entered in to the soil, the

intricate amalgam of PHs could detach into distinct composites dependent on their

physicochemical characteristics. The environmental fate of these pollutants might be

altered from that of discrete petroleum hydrocarbons due to the structural arrangements

and interactions among hydrocarbons, soil, and microflora [35, 36]. Resistance of these

impurities to soil microflora in water/soil inclines to surge with the form and molecular

weight of hydrocarbons. Crude oil undergoes several processes, for example sorption,

degradation, emulsification, evaporation, photodestruction, or biodegradation, which

naturally degrade its components [37, 38]. Low molecular weight compounds, e.g.

xylenes, toluene, and benzene, can easily travel in the surroundings and are more

probable to evaporate or penetrate towards the groundwater as compared to

hydrocarbons of higher molecular weight [39, 40]. In general, petroleum copmounds

with straight chains are degraded more easily as compared to those having five or six

rings. Compounds with high molecular weight, such as polyaromatic hydrocarbons

(PAHs), have a high tendency to adsorb on soil elements and stay relatively fixed at the

Impact of oil contamination on

environment

Loss of soil fertility

Restricted nutrient &

water availability

Increased soil toxicity

Threat to biodiversity of

soil

Affect soil quality

Reduction in aesthetic

attraction


7

location where they are trickled till they dispersed into smaller portions and are

degraded by microbes [23, 24, 35, 36].

1.4 Soil Remediation: Preserving a Precious Resource

1.4.1 Physicochemical vs. Biological Methods

Many conventional physical decontamination methods, e.g., soil washing, incineration,

and solvent extraction, are expensive due to excavation and transportation of huge

quantity of polluted material for ex-situ treatment [41]. Other physico-chemical

techniques are the use of dispersants, cleaners, emulsifiers, surfactants, soil oxidizers,

abiotic transformations, and chemical inactivation (potassium permanganate/hydrogen

peroxide are used as chemical oxidants to mineralize non-aqueous hydrocarbons) [42].

But, there is increasing consideration about the usage of these approaches as they have

the possibility to relocate pollutants away from the original site or produce secondary

pollution [43, 44]. Therefore, the increasing cost and limiting efficiency of these

traditional methods have spurred the development of innovative and alternative

technologies for in situ remediation of contaminated lands, particularly based on

biological approaches. On-site operation of biological technology is less expensive and

causes minimal site disruption, therefore, it has greater public acceptance [45-48].

Biological methods are efficient, versatile, cost-effective, and environmentally

safe [49, 50]. Biological methods for soil remediation are: 1) use of microbes

(fungi/bacteria) to decay organic impurities, 2) use of non-edible plants, especially fast-

growing vegetation with huge biomass, 3) soil animals (e.g., earthworms) to gather or

alleviate the recalcitrant contaminants in the soil or in their body, and 4) the combined

usage of plants and bacteria i.e., microbe-assisted phytoremediation [51-53].

Bioremediation: A Natural Method for the Restoration of

Polluted Sites

Bioremediation utilizes biological agents (green plants and microorganisms) or their

metabolic capabilities to degrade or transform many environmental pollutants in both

terrestrial and aquatic ecosystems [54]. Due to the abundance of microorganisms, their

capacity to grow even in anaerobic conditions, and large biomass relative to different

residing organisms inside the earth, they make a suitable means for bioremediation. In

biodegradation, microbes utilize chemical contaminants within soil as sole carbon


8

source and degrade the desired contaminant into carbon through redox reactions [49,

53-55]. Byproducts are released again into the environment usually in a lesser toxic

form. Microorganisms present in contaminated areas adjust themselves to the

surroundings accordingly. Genetic modifications activated in next generations allow

them to emerge as efficient hydrocarbon degraders [56]. It is a well-known fact that

crude oil-degrading bacteria in uncontaminated ecosystem constitute less than 0.1% of

the total microbes. This quantity may rise up to 1-10% of the overall community in PHs

contaminated environment. However, overall microbial diversity in a polluted

environment is declined [26, 43, 57, 58]. Aerobic environment and suitable

microorganisms are necessary for an optimal rate of bioremediation of soils

contaminated with PHs. Therefore, hydrocarbon-degrading bacteria are the best

candidate to be used in bioremediation of soil contaminated with crude oil because they

can adapt rapidly to the contaminated environment and release variety of enzymes to

detoxify pollutants [20].

1.5.1 Biodegradative Bacteria

Hydrocarbons might be degraded completely within couple of hours, days, or months

by action of microorganisms. Several research reports have indicated that low

molecular weight alkanes are degraded most quickly by soil microorganisms [59, 60].

Petroleum is a combination of various compounds and no individual bacterial strain can

utilize all components found inside petroleum because single bacterium can degrade

only a narrow range of hydrocarbons [61, 62]. Bioremediation requires the dynamic

synergy of different microbes to treat wide ranging environmental contaminants such

as pesticides and complex hydrocarbons [63-65]. It has been suggested that certain

microorganisms may make PHs more bioavailable. This could happen through the

development of a bacterial biofilm specifically on PHs [66, 67]. Several microbes have

the tendency to form multi-cellular aggregates joined together to form biofilms [68].

Biofilms can be formed by single type of bacteria or even by different species of

bacteria. The potential of microbial aggregates in the biofilm communities for

bioremediation is always a safer method than free-living microorganisms as the biofilm

protects them during stress giving the bacterial cells a better chance of adaptation to

harsh environments [69, 70].


9

Some microorganisms have the capability to degrade monoaromatics, other can

degrade aliphatics, while others degrade resins. Petroleum hydrocarbon degrading

microorganisms and the type of hydrocarbons degraded by them is enlisted in Fig. 1-3.

1.5.2 Concerns Associated with Bioremediation

Bioremediation of PHs is thought to be a complicated phenomenon due to the lethal

and hydrophobic nature of the contaminants, changes in microbial surroundings, and

certain biotic and abiotic factors of soil including temperature, pH, composition, and

moisture [69, 71]. Certain factors modify the rate of uptake and movement of

contaminant to the bacteria (bioavailability) [42, 70-72]. Important factors that have a

significant impact on the effectiveness of bioremediation process are shown in Fig. 1-

4.

Concentration and Characteristics of Contaminant: The type and concentration of

environmental contaminants have a strong influence on microbial growth and activity.

When the concentration is too high, it may have a toxic effect on bacteria. On the other

hand, low concentrations may prevent induction of pollutant-degrading genes present

in bacteria [73, 74].

Bioavailability of Contaminants: Bioremediation efficiency to a great extent relies

upon the degree of the bioavailability of the contaminant and consequent metabolism

by the microorganisms. It is generally believed that bioavailability of hydrocarbons

decreases with increasing molecular mass. Moreover, the rate of bioremediation in soil

decreases with rise in residence period of PHs. Aging hinders the movement of

pollutants into soil leading to the alteration and/or adsorption of pollutants on soil

particles [75].

Soil Properties: Another significant aspect that affects the rate of biodegradation is the

chemical/physical/biological properties of soil. Due to the hydrophobic nature of PHs,

they become hypothetically inaccessible for microbial degradation. Their degradation

occurs when they come in contact with aqueous material as only small fraction of these

mixtures become in water-dissolved condition. Additionally, the rate of biodegradation

largely depends upon the soil type. Low fractions of clay and slit in soil have been

associated with higher availability of hydrocarbon [76].


10

Temperature: It also influences the biodegradation of hydrocarbons. The rate of

biodegradation generally drops with the diminishing temperature. It also has a major

effect on microbial growth and consequently on microbial activity in the environment

[77].

Nutrients: Nutrients (nitrogen, phosphorus and/or iron) play an essential role in

biodegradation of PHs. Appropriate amounts of these nutrients are already present in

the soil but with high concentrations of pollutants there, they become limiting factors

thus effecting the process of biodegradation. To overcome this limitation, nutrients can

be added in useable form or with organic amendments [78].

Moisture Content: For efficient microbial activity, optimum amount of water in soil

environment is essential. For optimal growth and development, microorganisms require

approximately 25% of moisture contents in the soil [79].

Redox Potential: It is influenced by the presence of electron acceptors including

manganese and iron oxides in soil. It is suggested that redox potential increases the

degradation of PHs by expanding their bioavailability thus increasing microbial

metabolism [34].


11

•Vibrio sp.

•Moraxella sp.

•Pseudomonas sp.

•Bacillus sp.

•Cycloclastics sp.

•Achromobacter sp.

•Pseudomonas sp.

•Acinetobacter sp.

•Rhodococus sp.

•Bacillus sp.

•Halomonas sp.

•Acinetobacter sp.

•Alcanivorax sp.

•Brevibacterium

•Marinobacter sp.

•Pseudomonas sp.

Aliphatics Monoaromatics

ResinsPolyaromatics

Figure 1-3 Bacterial species involved in different types of PHs degradation


12

Phytoremediation: Using Green Technology to Restore

Contaminated Environment

In general, it was believed that plants can only supply fiber, energy, and food. However,

their promising role in eliminating contaminants from environment have been

documented in the past two eras [20]. Phytoremediation is a promising phenomenon

where green plants are used to diminish, eliminate, detoxify, and immobilize toxins

with the purpose of restoration of a site to a condition that can be used for private or

public applications [80]. It provides a solution to the problem of sites contaminated

with organic and inorganic contaminants which includes metals, insecticides, solvents,

explosives, and PHs. Growth of plants and their capacity to tolerate high concentrations

pH

Porosity

Temperature

Soil properties

Moisture content

Availability of nutrients

Organic matter content

Diversity

Substrate range

Substrate affinity

Species abundance

Metabolic pathways

Bioremediation

Toxicity

Structure

Concentration

Bioavailability

Hydrohobicity

Molecular weight

Soil characteristics

Figure 1-4 Factors influencing the process of bioremediation of soil contaminated

with PHs


13

of pollutants are the factors responsible for their efficiency in phytoremediation [81].

The advantages and limitations of phytoremediation are listed in Table 1.1.

Plants use various mechanisms to remove and/or uptake organic and inorganic

contaminants that forms the basis of phytoremediation technology. For removal of

environmental contaminants, they utilize dynamic processes including rhizofiltration,

phytovolatilization, phytostabilization, phytodegradation, and rhizodegradation [82,

83]. The initial step of efficient phytoremediation is plant uptake of hydrocarbons.

Contaminant uptake and transport takes place in the two-vessel system of xylem and

phloem for subsequent accumulation and degradation within the plant [81, 84, 85]. The

pathway by which pollutants enter the plants depends upon their physicochemical

properties including hydrophobicity, water solubility, and vapor pressure.

Hydrophobicity is usually expressed as coefficient of octanol/water partition (Kow),

wherein a log of Kow value (0.5-3.5) make sure take-up of pollutants by plants whereas

higher values mainly result in sorption to roots and insignificant translocation in aerial

parts of plants [86-88].

Once the pollutant enters the plant, it might have several fates: (i) complete

degradation/mineralization of organic pollutant into carbon dioxide and water, (ii)

phytochemical complexation of inorganic pollutant in root cells thus minimizing the

mobility of contaminant to water, soil, and air, (iii) contaminant is detoxified via

number of reactions in plant: conversion, conjugation, and compartmentation [87].


14

Table 1.1 Pros and cons of phytoremediation

1.6.1 Plant Selection for Phytoremediation

Selection of appropriate plant species is critical consideration for implementing

phytoremediation strategies [89]. Common factors for selection of trees or grasses

generally include: 1) resistance to contaminants, 2) tolerance to environmental

conditions, 3) high productivity, 4) low bioaccumulation, 5) suitability for various soil

types, and 6) native to avoid the introduction of invasive species [90-92]. Several

reports indicated that shrubs, grasses, herbs, and trees are suitable candidates that can

be utilized for phytoremediation [93]. Legumes (e.g. alfalfa, clover, peas, and reed

canary grass), grasses (e.g. ryegrass, kallar grass, and para grass), and trees (e.g.

Populus sp., Conocarpus erectus and Acacia nilotica) have been proven to be tolerant

to hydrocarbon pollutants [94].

Benefits of Grasses, Legumes, and Trees in Phytoremediation

Grasses are excellent contenders for phytoremediation because of their widespread

fibrous root structure that result in increased rhizosphere and ultimately abundant area

for microbial activity and growth [93]. Additionally, grasses can proficiently eradicate

Advantages Limitations

In situ, proficient and environment

friendly technology

Technology is limited to shallow ground water

and soils. Highly dependent on soil properties

and environmental conditions

Applicable on moderate and low

levels of contamination

Not applicable in high concentrations of

contaminants

Fast and beneficial for breaking down

diverse organic pollutants

Slower than physico-chemical treatments and

often in need of supplementary treatments such

as nutrient supply

High public acceptance Toxicity and nature of biodegradation products

are not known

Aesthetically pleasant Results are variable

Reduces landfill wastes Effects to food web might be unknown

Harvestable plant material Contaminant fates might be anonymous


15

hydrocarbons from polluted environment. They do not require any nutrient, and show

wide application to the complications that are linked with crude oil pollution [89].

The other important factor to be considered in phytoremediation is the level of

nutrients in polluted soils. Soils polluted with elevated amounts of petroleum are

frequently deficient in nitrogen. Legumes might be utilized in phytoremediation

because of their symbiotic-association with nitrogen fixers (bacteria and fungi) [92, 95].

The root system of leguminous plants generally is not as flourished as grasses to reach

deeper soil layers [96]. Legumes have preference over non-leguminous plants on

account of their inherent capacity. Moreover, legumes do not require to contend with

microbes and different vegetation for accessible soil nitrogen at oil-contaminated sites;

they additionally stimulate attached microorganisms by discharging nutrients into the

rhizosphere [97]. Legumes, such as Vulpia myuros, Medicago sativa, Elymus sp.,

Phalris arundinacea and Trifolium sp. have been effectively used to restore

contaminated places, particularly hydrocarbon-polluted soils [98].

Trees additionally play an essential role in the process of phytoremediation.

Proper selection of tree species and variety/genotype is an important criterion to predict

the phytoremediation efficacy [99, 100]. Trees typically have greater root biomass and

deeper root systems than grasses, thereby occupying a greater soil volume than grasses.

Common reasons behind the excessive use of trees in phytoremediation are their easy

propagation, fast growth, deep root systems that stretch out to the water table, high

water take-up rates, maximum absorption surface areas, perennial growth, and/or

tolerance to contaminants [101]. For instance, poplar and willows have been selected

as prospective candidates in phytoremediation of both organic and inorganic

contaminants [102].

Microbe-Assisted Phytoremediation: An Optimal

Approach to Revitalize Ecosystem

The efficacy of plant-based remediation is often restricted by two factors: (1) the toxic

nature of environmental contaminants, and (2) loss of soil fertility in the form of

unavailability of nutrients and modification of soil texture. In contrast, microbial

degradation often faces difficulty due to the inability of existing microflora to degrade

the contaminants, insufficient nutrients in contaminated soil, and low bioavailability of

pollutants [90, 103]. Therefore, an optimal system is obligatory in order to overcome


16

these constraints. Dynamic synergy between plant roots and soil microorganisms has

received great attention due to the possible role of bacteria in plant development and

degradation of PHs [104, 105]. The inoculation of specific bacteria increases plant

resistance to contaminant stress and enhances plant biomass. In response, vegetation,

through its rhizospheric effects, supports the proliferation of hydrocarbon degrading

microbes, which results in the degradation of recalcitrant biological contaminants [23,

106]. The combined use of phytoremediation and microbial augmentation techniques

develop a more effective strategy for the restoration of recalcitrant pollutants,

predominately polyaromatic hydrocarbons [107-109].

While it is broadly accepted that bacteria and fungi are chief mediators in

hydrocarbon degradation, bacteria have been revealed to be more versatile than fungi

[19, 20, 24]. Bacteria are ubiquitous; residing in the rhizosphere, plant interior

rhizoplane/ phyllosphere, and, thus can be considered active players in the cleanup

strategy for hydrocarbon remediation [110, 111]. Microbes having both hydrocarbon-

degrading and plant growth promoting (PGP) abilities more actively reduce stress

symptoms in plants and detoxify soil pollutants as compared to microorganisms having

just contaminant degrading/PGP capabilities [112]. Plant growth promoting bacteria

actively stimulate the growth via different mechanisms, such as fixation of N2, P-

solubilization, siderophores, and production of 1-amino cyclopropane 1-carboxylate

ACC deaminase, thus assisting plants to overcome stress, enhance plant defense

towards pathogens, and stimulate biodegradation process (Fig. 1-5) [22]. Ethylene

(plant hormone) assumes a vital part in root extension, fruit ripening, and in stress

signaling too. The inhibition of growth that take place as a result of surrounding strain

is the outcome of the plant reaction to elevated amounts of ethylene [113]. However,

bacteria producing ACC deaminase can bring down the levels of ethylene by cleaving

the ACC and mitigate stress in developing plant [114]. Numerous bacteria produce IAA

which shows an essential part in the development of extensive root system and

prompting enhanced uptake of nutrient that, thus, stimulates bacterial propagation in

root zone [114]. It has been recommended that bacteria producing IAA might prevent

the deleterious impacts of stresses. Thus, the combined use of vegetation and such

microorganisms may be an important alternative for remediation of oil-contaminated

soils [115-117].


17

The adequacy of plant-bacteria partnership relies upon to a great extent on the

persistence and metabolic capability of strain harboring catabolic genetic factor

necessary for the enzymatic cessation of PHs [21, 22]. Additionally, it is significant to

screen the expression and abundance of specific DNA during remediation of oil-

polluted soil to acquire proof of metabolic action of the inoculated microorganisms [45,

46, 107]. Culture-dependent techniques are classical means of evaluating microbial

population changes. However, less than 1% of ecological bacteria can be cultured [118].

Metagenomic approaches have opened new horizons for a profounder knowledge of

bacterial population enlightening information about gene abundance and expression

[119]. DNA based approaches provide molecular knowledge of the bacteria existing in

a particular environment at a certain time [120, 121]. Nucleic acids are also analyzed

by way of fingerprinting of functional genes (e.g., alkB gene) or a quantitative PCR

(qPCR) to reveal the presence of specific bacteria in an environment [122].

1.7.1 Rhizoremediation: Use of Rhizobacteria to Enhance

Hydrocarbon Phytoremediation

The usage of vegetation and their root-associated microbes to decontaminate oil-

polluted soils is termed as rhizoremediation. This beneficial association relies on the

fact that bacteria increase the bioavailability and degradation of organic pollutants, in

turn, plants provide residency and food to the bacteria [19, 123]. Despite the fact that

rhizoremediation happens naturally, but through deliberate manipulation (inoculating

the soil with contaminant degrading and/or PGP bacteria) in rhizosphere it can be

enhanced [124, 125].

The rhizosphere is a densely-populated zone wherein enhanced microbial

activities are witnessed and plant roots have interaction with soil-borne microorganisms

by exchange of essential supplements, growth factors and so forth [126, 127]. Increased

biodegradation of persistent pollutants in the rhizosphere is perhaps the outcome of

higher microbial populations around the roots of plants. Growing plants release a

various chemicals in form of root exudates. Following root exudation, the proliferation

of specific group of bacteria is 10-1000 folds more prominent in the plant rhizosphere

as compared to loose soil; this occurs due to excessive level of nutrients found in

exudates [128-130]. The properties, amount and timing of root exudation are critical

for rhizoremediation process [131]. In soil, plants may react to chemical stress with the

aid of changing the composition of nutrients that, thus, adjust the metabolic potential


18

of microorganisms. The microbial activity in the close vicinity of the root seems to offer

a promising environment for degradation of obstinate chemicals [53, 132]. These

activities also increase the bioavailability of soil-bound nutrients and degradation of

phytotoxic soil contaminants in the rhizosphere [133].

Rhizobacteria with plant growth-promoting potential have been conventionally

applied in agricultural science to improve crop yields. Their potential role in the

remediation of environmental pollutants have been explored recently [134-136].

Organic compounds including PHs, pesticides, chlorinated compounds

(polychlorinated biphenyl), explosives, organophosphate insecticides (diazinon and

parathion), and surfactants (detergents) are more rapidly degraded by rhizospheric

bacteria [137, 138].

The successful application of rhizoremediation largely depends upon survival

and establishment of bacteria in the rhizosphere. This phenomenon has been widely

studied, but the complete mechanism is as yet not clear; It has been suggested that it

may be because of the secretion of certain compounds (e.g. polysaccharides) and other

phenomenon such as chemotaxis [107, 139]. It is supposed that a plant and its related

bacteria establish bacterial colonization on root surface through complex chemical

signals which includes hydrogen peroxide, superoxide anion and especially flavonoids

[140-142]. This communication is of extreme significance for the persistence and

establishment of applied microbes in the plant rhizosphere. Numerous studies have

been executed to observe persistence of inoculated bacteria, especially through

labelling of augmented bacteria with a indicator gene, for example gfp encoding green

fluorescent protein, gusA encoding ß-glucuronidase and so forth. [143].

1.7.2 Endophyte-Assisted Phytoremediation

In addition to rhizobacteria, plants are internally colonized by bacteria, fungi, and

actinomycetes. Endophytes can be defined as pathogenic and nonpathogenic microbes

living inside plant organs (root/shoot). They are ubiquitous (found in all plant species),

diverse in nature, and residing in a dormant or active state in the plant tissues [22].

Endophytes interact more closely with the host while savoring a less competitive

environment which has high amount of nutrients and is highly protective against wide-

ranging fluctuations than the environment that rhizo- or phyllospheric bacteria usually

face. Endophytes gain entry in plant tissue through the roots, followed by habitation in


19

the root cortex or aerial parts of plants via plant vascular system. Additionally, cell

wall-degrading enzymes favor the entrance of such microbe into plants. Endophytes

have to proliferate in the rhizosphere before entering the plant [122, 144]. During

endophytic colonization, bacteria travel to the plant interior by soil water oscillations

or dynamically through particular stimulation of flagella. In addition, root exudates, act

as indicators for chemotactic movements and provide a nutrient-rich environment for

active colonization [139, 145].

Despite the fact that rhizoremediation seems promising, the contaminant is not

accessible to the rhizospheric microflora because its residence time is very much lower

in the rhizosphere [146-148]. Here, endophytic bacteria get the chance to breakdown

the contaminants with the assistance of their intracellular enzymes before than the

contaminants are evapotranspired. Additionally, a most important benefit of endophytic

bacteria above rhizobacteria is that they are living inside host plant and consequently

have lesser struggle for nutrients and space [145, 149].

Endophytes assumes a key role in plant’s adaptation to contaminated

surroundings and furthermore improve phytoremediation by transforming

contaminants, stimulating plant growth, subsiding phytotoxicity, and improving overall

plant’s health [150, 151]. Many endophytic bacteria exhibit PGP activities, for example

nitrogen fixation, production of phytoharmones (IAA & ACC deaminase) and

hydrolytic enzymes (HCN & siderophores) [19]. These PGP actions of endophytes

improves the plant health in contaminated soils and eventually phytoremediation

efficiency. Further to modify the growth harmones concentartions in plants, some

endophytes can speed up plant development via biological nitrogen fixation [152]. An

outstanding illustration is the sugarcane isolated nitrogen-fixing bacteria, which

provides ample nitrogen to the host plant and enhance plant progress. Moreover, some

endophytes enhance plant growth by enhancing mineral nutrition or increasing

resilience to biotic and abiotic stresses [153]


20

Metabolic Pathways for Biodegradation of PHs

Most microbial species do not contain all the appropriate enzymes so degradation is a

collective function of a consortium of microorganisms belonging to different genera.

Microorganisms either catabolize organic pollutants to obtain energy or integrate them

into cell biomass [25].

Hydrocarbon-degrading bacteria may be categorized into two groups: 1)

aerobic, and 2) anaerobic. Aerobic conditions facilitate the fastest and complete

degradation of most hydrocarbons because during metabolic activities oxygen is

available as an electron acceptor [29, 154]. Possible peripheral pathways for aerobic

biodegradation of n-alkanes and aromatic hydrocarbons are described in Fig. 1-6.

Figure 1-5 Plant-microbe interactions that lead to remediation of soils

contaminated with PHs


21

1.8.1 Aerobic Biodegradation

In aliphatic hydrocarbons, the crucial step for aerobic degradation involves the addition

of oxygen by oxygenases and peroxidases [8]. Peripheral degradation pathways

(terminal/sub-terminal oxidation) convert activated molecules to intermediates in a

step-by-step process followed by conversion into a fatty acid. This molecule is then

conjugated to coenzyme A which forms an acyl-CoA which is then converted into

acetyl-CoA (final product). Acetyl-CoA enters in the Krebs cycle and eventually

completely oxidized to CO2 [26]. Additional pathways include oxidation of di- and sub-

terminal side of n-alkanes. In di-terminal pathway, by x-hydroxylation, oxidation of

both sides of alkane molecule occurs (x position signifies terminal methyl set) of fatty

acids. It is at that point additionally converted into dicarboxylic acid and processed by

ß-oxidation pathway. Cell biomass is produced from the central precursor metabolites

(acetyl-CoA and pyruvate).

Polyaromatic hydrocarbons such as biphenyls and naphthalene are more

persistent in the environment than saturated hydrocarbons [155]. Due to their toxic

nature, they are the priority pollutants in bioremediation programs. For initial

activation, four different enzymes are involved; 1) the non-heme iron oxygenases, 2)

the soluble di-iron multicomponent, 3) the flavoprotein monooxygenases, and 4) the

CoA ligases [156]. Unlike aliphatic hydrocarbon degradation, activated molecule is not

transformed to alkanol but rather to intermediates of phenol (catechol) [157]. Intradiol

or extradiol dioxygenases will further convert these phenol intermediates to di‐ or tri-

hydroxylated aromatic compounds that may enter into the Krebs cycle and completely

metabolized into CO2 [158]. Hydrocarbon degrading bacteria cleave benzene ring in

diverse ways by appropriate enzymes. In PAHs, benzene rings are degraded one after

the other. But in case of cyclic alkanes, transition from alkane to alcohol takes place

which is further dehydrogenated to ketones by an oxidase system. Alkenes may be

degraded by (a) sub-terminal (b) terminal, and (c) oxidation of double bond to resultant

epoxide/diol [156].

1.8.2 Anaerobic Biodegradation

Microbial degradation of various substrates, specifically obstinate hydrocarbons, is

restricted under anaerobic conditions because O2 is prerequisite for this process [159].

Understanding of the mechanism of anaerobic degradation is more recent as compared


22

to aerobic degradation. Therefore, less information is available about the genes and

enzymes involved in these pathways. During degradation of PHs, anaerobic bacteria

offers nutrients required for the growth of other catabolizing bacteria [34]. A large

variety of microorganisms (bacteria and archaea) have been identified with the

capability to degrade hydrocarbon molecules anaerobically. These bacteria exploit

anaerobic respiration via nitrate, nitrite, and metal ions or fermentation during substrate

catabolism [160, 161].

For anaerobic bacteria, alkanes with smaller chain length are difficult to degrade

than alkanes having mid- to long-chain lengths. In anaerobic conditions, short-length

hydrocarbons (up to n-C17) do not dissipate easily, so these compounds can develop

and exert a harmful effect on the cell wall of bacteria, thus inhibiting their growth.

Moreover, sulphate reducing bacteria degrade branched alkanes more efficiently than

straight chain alkanes [162, 163].

Anaerobic degradation is commonly established in deep and anoxic

environments for example natural oil seeps on land/ocean and the sites polluted with

oil. Likewise, this kind of biodegradation can happen beneath the surface of areas where

aerobic biological activity has been ceased as all the oxygen is used. After oxygen

exhaustion, there may be a consecutive employment of the electron acceptors (nitrate,

ferric iron, sulphate, and hydrogen) to supply energy from the hydrocarbon degradation

[161-164].


23

Figure 1-6 Schematic overview of metabolic pathways for hydrocarbons

(aliphatic and aromatic) utilization by aerobic bacteria. Ortho: ortho cleavage

pathway, meta: meta cleavage pathway, CoA: coenzyme A.


24

Enzymatic Biodegradation

In order to explore functional genes involved in degradation of hydrocarbons, one must

have knowledge about the enzymes involved in biodegradation. Though there are few

bacteria that can fully mineralize the particular organic pollutant, single species usually

do not have the capability to degrade PHs or lack entire degradation pathways [165].

However, consortium of heterogeneous bacterial strains can effectively degrade these

recalcitrant compounds fully. Details of bacterial and plant based degradative enzymes

[161] are depicted in Table 1.2.

The prokaryotic monooxygenases isolated are catalogued into two sets on the

basis of their electron transport system and the microorganisms in which they are

available: (a) enzyme dependent on rubredoxin (2FeO), in most of bacteria this enzyme

is encoded by alkB gene and alkM specifically in Acinetobacter sp., (b) cytochrome

P450 monooxygenase belonging to CYP153 family of microbes. Alkane hydroxylase

enzyme was firstly described in Pseudomonas putida GPo1 where it was positioned on

the plasmid names as OCT and was reported to be organized in two operons:

alkBFGHJKL and alkST [166].

The cytochrome P450 enzymes are set of heme (iron protoporphyrin IX)

comprising monooxygenase enzymes that work in association with sub-atomic oxygen,

and an electron-transfer system to oxidize diverse range of compounds [167]. Rather

than eukaryotes, the bacterial cytochrome P450 are soluble in the cytoplasm. The

structures of these enzymes vary from species to species.

Moving on, with wide-ranging distribution and satisfactory earlier research

findings, alkane hydroxylase (alkB) gene is deliberated a favorable functional

biomarker to monitor potential of bioremediation at a site of oil contamination.

Numerous studies attempted to narrate the degradation processes or contaminant

mineralization, diversity of alkB gene, richness, and its expression in situ [165, 167].


25

Table 1.2 Bacterial and plant enzymes involved in alkane degradation

Enzymes Catalytic action Origin/Reference

Dehalogenase Involved in release of chlorine

and fluorine from halogenated

straight chain and ring

compounds

Xanthobacter autotrophicus,

Populus spp., and

Protobacteria [22]

Lacasse Degrade numerous aromatic

hydrocarbons

Alfalfa, Trametes versicolor

and Coriolopsis polyzona [2,

3]

Dioxygenase Degrade specific aromatic rings Pseudomonas sp.,

Mycobacterium sp. [76]

Peroxidase Involves in degradation of

several aromatic compounds;

dehalogenation of various n-

alkanes

Armoracia rusticana,

Phanerochaete

chrysosporidium,

Phanerochaete laevis,

Medicago sativa [176, 78]

Nitrilase Cleaves cyanide group from

aliphatic and aromatic nitriles

Salix spp., Aspergillus niger

[23, 67]

Nitroreductase Reduces nitro groups on nitro-

aromatic compounds; removes N

from ring structures

Comamonas sp.,

Pseudomonas putida, Populus

spp.[80]

Phosphatase Cleaves phosphate groups from

pesticides

Spirodela polyrhiza [74]

Cytochrome

p450

monooxygenase

Hydroxylation of ring and

straight chain hydrocarbons

Bacteria, fungi and plants

[101]

26

2 General Materials and Methods

Media and Chemicals

Luria Bertani (LB), Dworkin and Foster (DF), M9 minimal medium, Pikovskaya's, LG1

and Sabouraud dextrose agar (SDA) medium were used in present study (appendix A-

E). For solid media preparation, 15 g L-1 agar was used and all media were autoclaved

at 120 °C for 15 minutes before use.

The chemicals were purchased from LAB-SCAN (Thailand), Merck

(Germany), and Sigma (USA) or Sigma-Aldrich (Germany). Molecular biology

chemicals were purchased from Thermo Fisher Scientific (USA), Fermentas Life

Sciences (UK) and Invitrogen (USA). All hydrocarbons, for example hexane (C6),

octane (C8), decane (C10), dodecane (C12), hexadecane (C16), 1-decanol, naphthalene,

phenolphthalein, methanol, ethanol, benzene and toluene, were however 98-99% pure

and procured from Sigma-Aldrich (Germany).

Equipment

All the equipment used in the present work was availed from National Institute for

Biotechnology and Genetic Engineering (NIBGE), e.g., confocal laser scanning

microscope (CLSM), centrifuges, spectrophotometer and thermal cycler. 16s rRNA

gene sequencing of the isolated bacterial strains was done by Macrogen (Seoul, South

Korea).

Soil Sample Collection

Soil was collected from the crude oil-contaminated sites of an oil production company,

Oil and Gas Development Company Limited (OGDCL) situated in Chakwal (32.55 °N

72.51 °E), Pakistan. Soil contamination was a result of accidental release of crude oil

in the environment.

Soil samples were collected from 10 different points at a depth of 0-25 cm, and

mixed together. Subsequently, soil was dried in air and sieved through 2 mm sieve to

Chapter 2 General Materials and Methods

27

remove root debris, pebbles and large fragments. Soil was separated into two portions

for biological and chemical analysis, and stored at 4 °C.

Seeds and Seedlings

The seeds and seedlings of different trees and grasses used in different experimentations

were obtained from local plant market of Faisalabad and Biosaline Research Station

(BSRS), Pakka Anna, Faisalabad, Pakistan (Table 2.1). Seeds of edible crops (Zea

mays, Glycine Max, Helianthus annus L. and Brassica rapa) were obtained from

NIBGE.

Bacterial Strains

Rhizospheric soil, root and shoot interior of the plants (showing better growth in crude

oil-contaminated soil) were used to isolate the hydrocarbon-degrading bacteria.

Biosensor/reporter strain, Chromobacterium violaceum CV026, was used in quorum

sensing bioassay and Escherichia coli (DH5 α) carrying a broad host range plasmid

(pBBRIMCS-4) which comprise yellow fluorescent protein (yfp) was collected from

NIBGE, Faisalabad.

Maintenance and Preservation of Bacteria

Individual culture of hydrocarbon-degrading rhizospheric and endophytic bacteria were

maintained in minimal medium (M9) amended with 1% filter-sterilized diesel. To

prepare the glycerol stocks, bacterial cultures were mixed with 50% sterile glycerol.

The stocks were preserved at -80 °C until used further.


28

Table 2.1 List of plants (grasses, trees and edible crops) used in the present

work

Scientific name Common name Abbreviation Source/origin

Grasses

Axonopus fissifolius Carpet grass AF BSRS, Faisalabad

Brachiaria mutica Para grass BRA BSRS, Faisalabad

Camelina sativa Falseflex CS BSRS, Faisalabad

Hordeum vulgare Barley HV NIBGE, Faisalabad

Leptochloa fusca Kallar grass LEP BSRS, Faisalabad

Lolium perenne Rye grass LOL Local market, Faisalabad

Medicago sativa Alfalfa MS Local market, Faisalabad

Sorghum bicolor Sorghum SB Local market, Faisalabad

Sporobolus indicus Sporobolus SI Local market, Faisalabad

Trifolium alexandrium Egyptian clover TA Local market, Faisalabad

Edibe crops

Brassica rapa Brassica BR NIBGE, Faisalabad

Glycine max Soybean GM NIBGE, Faisalabad

Helianthus annuus L. Sunflower HA NIBGE, Faisalabad

Zea mays Maize ZM NIBGE, Faisalabad

Trees

Acacia ampliceps Acacia ACA BSRS, Faisalabad

Acacia eburnean Pahari kikar AE BSRS, Faisalabad

Acacia nilotica Egyptian thorn AN BSRS, Faisalabad

Azadirachta indica Indian lilac AI Local market, Faisalabad

Bambusa

dolichomerithalla

Bamboo BD Local market, Faisalabad

Conocarpus erectus Conocarpus CE Local market, Faisalabad

Eucalyptus camaldulensis Himalyan poplar EC Local market, Faisalabad

Leucaena leucocephala Ipple ipple LEC BSRS, Faisalabad

Moringa oleifera Horseradish MO Local market, Faisalabad

Pongamia pinnata L. Sukh chain PL Local market, Faisalabad

Populus nigra Popular PN Local market, Faisalabad

Terminalia arjuna Arjun TA Local market, Faisalabad

Terminalia bellirica Bohera TB Local market, Faisalabad


29

Isolation of Rhizobacteria and Endophytes

Rhizosphere, root and shoot interior of Leptochloa fusca, Brachiaria mutica, Acacia

ampliceps, Lolium pernne and Leucaena leucocephala were used for the isolation of

hydrocarbon-degrading bacteria. These plants showed more growth in crude oil-

contaminated soil than other tested plants. After 3 months of vegetation, the plants were

uprooted carefully and mixed to eliminate the excessive soil adhered to roots. Roots

with adhered soil were placed in Erlenmeyer flask containing 10 mL of sterile 0.9%

normal saline (w/v) and centrifuged at 2000 rpm for 40 min. Root samples were

carefully removed and sediment was permissible to resolve down. The supernatant was

serially diluted and plated on M9 medium mixed with 1% filter sterilized diesel as

individual basis of energy that was incubated at 37 ± 2 °C. Prominent single colonies

that appeared after 3 days were picked and streaked two to three times on freshly

prepared M9 medium plates (containing 1% diesel) to obtain the pure colonies.

For endophytic bacterial isolation, stems and roots of each plant were washed

carefully with tap water followed by 2 min wash with sterile distilled water.

Furthermore, plant parts were surface sterilized with 70% ethanol [roots (10 min),

shoots (5 min)]. Afterwards, plant samples were washed with 1% NaOCl for 60s and

formerly a last rinse in autoclaved distilled water (at least 3 times). To check the surface

sterility of plants, water from the final rinse was spread on M9 medium having glucose

as only source of carbon. The plates were placed at 37 ± 2 °C for 72 h, no bacterial or

fungal colonies were observed. One gram of shoots / roots were even out independently

by pestle and mortar and mixed with 0.9% normal saline (NaCl). Dilutions were spread

on M9 medium agar plates comprising 1% filter-sterilized diesel. To avoid any fungal

contamination, medium was mixed with cyclohexamide (100 mg L-1). The plates were

positioned in incubator at 37 °C ± 2 for 2 days [168]. Diesel resistant colonies were

randomly picked and streaked on same media to obtain pure colonies. Bacterial isolates

growing well on sub-culturing were selected and stored at 4 °C for further use.

Characterization of Isolated Bacteria

2.8.1 Colony and Cell Morphology

Isolated strains were differentiated on the basis of their colony size, cell morphology,

shape, pigmentation and motility using standard protocols [169, 170].


30

2.8.2 Molecular Characterization

Genomic DNA Extraction and PCR Amplification of Intergenic Spacer (IGS) Region

Genomic DNA extraction of each pure isolate was performed by genomic DNA

purification kit (Invitrogen) as suggested by the company. The PCR amplification of

IGS region was performed using already published set of primers: pHr_F

(TGCGGCTGGATCACCTCCT) and P23SR01_R (GGCTGCTTCTAAGCCAAC)

[171]. Reaction mixture (20 µL) contained green PCR master mix (Thermo Fisher

Scientific) (10 µL), forward/reverse primer (1 µL), of DNA (2 µL) and of nuclease free

water (6 µL) [171]. Reactions were executed in a thermal cycler (Bio-Rad) with primary

step of denaturation for 5 min at 95 °C, 35 runs of [for 30 s at 95 °C, for 30 s at 53 °C,

for 1.5 min at 72 °C] and ultimate extension for 10 min at 72 °C. Genomic DNA of

Pseudomonas sp. (ITRI22) was used as a positive control [94]. The resulting amplicons

were examined for size (approximately 1500 bp) in 1% agarose (w/v) gel mixed with

ethidium bromide (0.5 µg mL-1). To confirm the size of amplicons, one Kb DNA ladder

(Fermentas) was used.

Analysis of Restriction Fragment Length Polymorphism (RFLP)

IGS PCR product (10 µL) was digested with restriction endonucleases, Hind III and

EcoR1 (Thermo Fischer Scientific), for 3 h at 37 °C. To analyze the digested PCR

products, 2.5% agarose gel (w/v) containing 0.5 µg mL-1 EthBr was used.

Bacterial 16S rRNA Gene Amplification by Conventional PCR

On the basis of RFLP analysis, isolates were separated into different groups, and those

sharing identical restriction profile were classified into the same group. The

representative of each group was recognized by investigation of partial 16s rRNA gene

with respective set of primers, 8f (AGAGTTTGCTCAG) and 1520rev

(AAGGAGGTGATCGGA) [168]. Reaction mixture (50 µL) was consisted green PCR

master mix 2X (25 µL) (Thermo Fisher Scientific), 1 µL of both primer, 2 µL of DNA

and 21 µL of PCR water. Reaction was done in PCR (Bio-Rad) with denaturation at 94

°C for 10 min; 35 cycles [94 °C, 30 s, 54 °C, 1 min, and 72 °C, 90 s] trailed by absolute

extension at 72 °C 10 min [2]. The DNA isolated from Pseudomonas sp. strain ITRI22,

at a concentration of 5-10 ng, was served as a positive control. Amplified PCR products

(≈1500 bp) were then resolved on 1% agarose gel amended with 0.5 µg mL-1 ethidium


31

bromide. The 1 kb DNA ladder (Fermentas) was used to confirm the size of amplified

PCR products.

16S rRNA Gene Sequencing and Nucleotide Accession Numbers

Sequencing of amplified PCR products was done by Macrogen (Seoul, South Korea)

using 8f and 1520rev primers. The 16s rRNA gene sequences were matched to the

previously known nucleotide sequences using BLAST

(https://blast.ncbi.nlm.nih.gov/Blast.cgi) tool in NCBI database and sequences were

submitted in GenBank to obtained accession numbers.

Experimental Setup for Crude Oil and n-Alkanes

Biodegradation Studies

2.9.1 In vitro Crude Oil Biodegradation Assay in Shake-Flask Culture

For initial activation, single colony of each strain was transferred to LB broth and

placed in incubator shaker at 37 °C for 24 h at 120 rpm. Afterwards, 3 mL (about 2

×108 cells/mL) of microbial suspension was added in 100 mL M9 media comprising

2% (w/v) of crude oil. Flasks were placed in incubator shaker at 37 °C and 120 rpm for

10 days. Control culture medium (non-inoculated) containing 2% (w/v) crude oil was

incubated under the same conditions. Later, flasks were taken out and growth of

bacteria was stopped by adding 1% 1.0 N HCl to particular flasks [34].

2.9.2 Residual Crude Oil Estimation

Gravimetric method was used to determine the amount of residual crude oil in soil

samples [172-174]. Briefly, in a separating funnel, bacterial culture was mixed with

equivalent volume of petroleum ether and shaken forcefully to obtain two phases. Top

layer containing oil-solvent mixture was decanted into container. Extraction was

performed twice to ensure complete recovery of residual oil followed by addition of 0.4

g of anhydrous sodium sulfate (Na2SO4) in extracted oil to remove any moisture and

transferred into round bottom flask leaving behind Na2SO4. Oil-solvent mixture was

evaporated to dryness in rotavapour (Büchi, Switzeland) under reduced pressure.

Afterwards, flasks were incubated in an oven (at 60 °C) to take out any remaining

petroleum ether. The flasks were cooled down in desiccators and weighed. The

percentage of oil degradation was calculated by the following formula:


32

Oil biodegradation (%) =Weight of oil (control)−Weight of oil (sample)

Weight of oil (control)× 100 (2-1)

2.9.3 In vitro Utilization of Hydrocarbons

To study the utilization of different hydrocarbons by isolated bacteria, their growth was

tested on various straight chain alkanes and aromatic hydrocarbons (1-decanol,

naphthalene, phenolphthalein, methanol, ethanol, benzene and toluene). The inoculum

of each isolate was prepared and subsequently 10 mL (2×108 cells/ mL) of the inoculum

of individual strain was inoculated into 100 mL M9 medium containing 2% (w/v) of

different hydrocarbons individually. Strains grown on M9 medium having 0.2% (w/v)

glucose were used for instance control. Flasks were placed in an orbital shaker at 120

rpm and 37 °C for 7 days. Experiment was performed in triplicates and all the

hydrocarbons used were 98% pure (Sigma-Aldrich).

Screening of Alkane Hydroxylase Genes (alkB and CYP

153) in Isolated Bacterial Strains

2.10.1 PCR Amplification of alkB and CYP 153 Genes

Diverse set of already reported primers were used to amplify the potential genes

encoding alkane hydroxylases (alkB and CYP 153) in bacterial isolates (Table 2.2). The

PCR reaction mixture (20 µL) contained 1 µL of each alkB-3F/alkB-3R (for alkB gene)

and CYPF/R primers (for CYP 153 gene), 10 µL of PCR master mix (Thermo Fisher

Scientific) 2 µL of template DNA and 6 µL of PCR water. Thermal cycling was

performed (Bio-Rad) using initial denaturation at 95 °C for 4 min, afterwards 30 cycles

of [30s at 94 °C, 30s at 55 °C and 45s at 72 °C] and final extension at 72 °C for 10 min.

For the amplification of alkB and CYP 153 genes, all conditions were same except

annealing temperature, for alkB and CYP 153 were 54 °C and 53 °C for 30 s,

respectively. PCR products were resolved on 1.5 % agarose gel (w/v).


33

Table 2.2 Primers used for amplification of alkB and CYP 153 genes in bacterial

isolates

F specifies forward primer, and R specifies reverse primer.

2.10.2 Real-Time PCR Quantification of alkB Gene

DNA and RNA Extraction from Rhizosphere and Plant Tissues

Rhizosphere soil (0.5 g) was used for the extraction of DNA and RNA (Soil FastDNA

Spin Kit) and FastRNA Spin Kit (MP Biomedical, USA), individually, as designated

by the manufacturer, and were measured photometrically (Nanodrop 2000C

spectrophotometer, Thermo Fisher Scientific). Root and shoot samples were briefly

crushed in liquid N2 and bead-beater was used for the microbial cell lysis [3]. Plant’s

DNA and RNA were extracted with FastDNA Spin Kit and FastRNA Spin Kit for Plant

(MP Biomedical, USA). During RNA extraction, DNA was completely removed by

digestion using enzyme (DNase I) and possible presence of DNA was screened by PCR.

Quantification of Abundance and Expression of alkB Gene

RNA (20 ng) was used for reverse transcription (RT) including alkB-3(f) primer and

Superscript II Reverse Transcriptase (Invitrogen) as suggested by manufacturer. Real-

time PCR was carried out in iCycler (IQ) (Bio-Rad) with initial denaturation for 4 min

at 95 °C trailed by 45x [30 s at 94 °C, 30s at 60 °C, and 45s at 72 °C] and ultimate step

for 10 min at 72 °C. In addition to analysis of melt curve, amplified PCR products were

also checked on 2.5% agarose gel (w/v). No primer-dimers were noticed on gel.

Reaction mixture (25 µL) contained 12.5 µL of SYBER green PCR master

mix(Invitrogen), 2 µL of 10 mg/mL BSA, 1 µL DMSO, 1 µL of each primer, 50-100

ng of template DNA/cDNA and PCR water.

Purified PCR product of alkB gene was cloned in TA vector pTZ57R/T (Thermo

Fisher Scientific). The presence of alkB gene in the plasmid was confirmed by plasmid

digestion via restriction enzymes (PstI and EcoR1). The plasmid DNA concentration

was calculated by using Nanodrop 2000C spectrophotometer (Thermo Fisher

Primer Sequence (5’-3’) Size (bp) /annealing

temp.

Target

gene/Ref.

alkB-3 (F) TCGAGCACATCCGCGGCCACCA 330/54 °C Alkane

hydroxylase

[175]

alkB-3 (R) CCGTAGTGCTCGACGTAGTT

CYP (F) TGTCGGTTGAAATGTTCATYGCNMTGGAYCC 864/53 °C Alkane

hydroxylase

[176, 177] CYP (R) TGCAGTTCGGCAAGGCGGTDCCSRYRCAVCKRTG


34

Scientific). Standard curve was created (with ten-fold serial dilution of plasmid DNA

ranging from 101 to 106 copies per reaction) for relative quantification of alkB gene

[118].

In vitro Plant Growth-Promoting Potential of

Rhizospheric and Endophytic Bacteria

2.11.1 Phosphate-Solubilizing Capacity

Bacterial phosphate-solubilizing capability was tested on Pikovskaya’s agar medium

comprising tri-calcium phosphate as a mineral phosphate source [178]. Test strains

were separately spotted on Pikovskaya’s agar plates and nurtured at 37 ± 2 °C for 7-10

days. Plates were observed for halo zone formation nearby the colonies because of the

inorganic phosphate solubilization by the test bacteria.

2.11.2 Assay for Indole 3-Acetic Acid (IAA) Production

The capability of bacterial strains to secrete IAA was investigated using the method

outlined previously [179]. Briefly, bacteria were fully grown in LB broth inoculated

with 0.1 g L-1 tryptophan as IAA precursor, in an incubator shaker for 7 days at 37 ± 2

°C. After centrifugation, cells were collected and mixed with Salkowski reagent (100

µL) of in 96 well plate culture supernatant was mixed with 100 µL of Salkowski

reagent; placed at room temperature for half hour and checked for production of pink

color as compared to control (bacterial culture grown without tryptophan).

2.11.3 Antagonistic Activity Against Plant Pathogenic Fungus

Antifungal ability of bacterial strains was tested against pathogenic fungus, Fusarium

oxysporum. A 6 mm fungal disc was positioned in the middle of Sabouraud dextrose

agar plates and bacterial strains were streaked around the four corners of disc [180].

Plates were placed at 28 ± 2 °C for 7 days and antifungal activity was tested by

measuring the growth inhibition zone between bacteria and fungus as compared to

control (fungus without any bacterial strain).

2.11.4 Siderophore Production

Bacteria were screened for their siderophore secretion using agar plates amended with

chrome azurol S (CAS) dye as described earlier [181]. Briefly, bacteria were streaked


35

on CAS agar medium and placed for 24 h at 37 ± 2 °C. Orange color around the colonies

was the indicator of siderophore excretion.

2.11.5 Screening of 1-Aminocyclopropane 1-Carboxylate (ACC)

Deaminase Activity

Bacterial ACC deaminase activity was determined on their capacity to consume ACC

as sole source of nitrogen. Test strains were spot inoculated on DF salts minimal

medium containing 0.7 g ACC L-1 [182]. A clear zone around the colonies confirms the

positive ACC deaminase activity. Plates without ACC were used as negative control.

2.11.6 Assay for n-Acyl-Homoserine Lactone (AHL) Production

For the screening of acyl-homoserine lactone (AHL) activity in the strains, a cross

streak bioassay was performed [183]. Chromobacterium violaceum CV026 was used

as biosensor/indicator strain. Test strains were horizontally streaked adjacent to reporter

strain, C. violaceum CV026, on the LB agar plates and placed for 24 h at 28 ± 2 °C.

AHL activity was specified by blue area around the test strains. For positive control,

Rhizobium leguminosarum (pRL1J1) was used and plates without indicator strain

served as negative control.

2.11.7 Zinc Solubilization Assay

To study zinc solubilization activity of the isolated bacterial strains, LG1 medium was

used [184]. Medium was supplemented with zinc compounds (zinc oxide and zinc

carbonate) at a final concentration of 0.1% and 0.2%. The test microorganisms were

inoculated and plates were incubated at 37 ± 2 °C for 48 h. The halo zones around the

bacterial colonies were the indicative of zinc solubilization.

2.11.8 In vitro Compatibility of Bacteria

The growth inhibition by one bacterial specie on the growth of the other bacterial

species was checked as described earlier [185]. Briefly, a loopful of one bacterial strain

was spot inoculated onto the LB plates pre-seeded with test strain. Plates were

incubated at 37 ±2 °C for 48 h. The absence and presence of clearing zone around the

colonies were witnessed for 2 days and antibiosis was confirmed by the presence of

clearing zone.


36

Analysis by Confocal Laser Scanning Microscopy

(CLSM) for Biofilm Formation and Root Colonization

2.12.1 Bacterial Strain, Plasmid, Media and Growth Conditions

A broad host range plasmid PBBRMCS-1 encoding ampR and harboring a yellow

fluorescent protein gene (yfp) was extracted from E. coli by plasmid isolation kit

(Invitrogen) as per manufacturer’s instructions. Plasmid concentration was measured at

wavelength of 260 nm using Nanodrop spectrophotometer (Thermo Fisher Scientific).

Plasmid DNA was separated through electrophoresis on 1% agarose gel.

2.12.2 Preparation of Electro-Competent Cells

The reagent bottles and solutions were pre-chilled to 4 °C before starting this procedure.

A single colony from overnight grown pure bacterial culture was inoculated to LB broth

(20 mL) and placed in incubator shaker for 24 h at 37 °C, 130 rpm. Five mL culture

was transferred to 500 mL LB medium and incubated until optical density reache up to

0.5-0.8 at 600 nm. Afterwards, culture was shifted to pre-chilled falcon tubes (50 mL)

and placed on ice for at least 30 min. Cells were collected by centrifugation (1000 g)

for 10 min at 4 °C and culture supernatant was decanted and cells were gently mixed

with ice cold sterilized distilled water (200 mL). In next step, after centrifugation,

bacterial cells were collected at 4 °C for 5 minutes and supernatant was removed from

culture tubes and pellets were re-suspended in ice cold sterilized distilled water (100

mL). Afterwards, supernatant was removed and bacterial pellet was re-dissolved in ice

cold 10% glycerol (40 mL). After final centrifugation step, pellets were re-dissolved in

1000 µL ice cold glycerol (10%) by tender mixing and cell aliquots (50 µL) were stored

at -80 °C [186].

2.12.3 Transformation by Electroporation

The electro-competent cells were gradually thawed by incubating them on ice. Twenty

ng of plasmid DNA, harboring yfp gene, was added to cells and mixed properly by

gentle pipetting. Mixture was transferred to a pre-chilled electroporation cuvette (0.2

cm electrode gap) aseptically. Electroporation was performed on electroporator with

following parameters: capacitance 25 µF, voltage 12.5 KV/cm field strength and

resistance 129 Ω. Desired pulse length was 5-6 m/sec [186]. Following a short electric

impulse, the aliquot was instantly re-suspended in LB medium (1 mL) and incubated

for 2 h at 37 °C with continual shaking.


37

The suspension was plated on ampicillin containing LB plates and incubated

overnight at 37 °C. Transformants were selected under confocal laser scanning

microscope (CLSM) at 530 nm. In controls, the plasmid DNA was not added, and no

fluorescence was detected under CLSM.

Plant Inoculation Studies

2.13.1 Preparation of Bacterial Consortium

Pure colony of each bacterium was transferred to M9 media containing 1% filter

sterilized diesel (v/v) and flasks were kept for 24 h at 37 ± 2 ºC, 200 rpm. Afterwards,

bacterial cells were gathered at 6000 rpm and re-dissolved in NaCl solution (0.9%) to

have a cell density (OD) of 0.7 via UV-Visible spectrophotometer (Labomed, Inc.

USA) at wavelength set at 600 nm. Bacterial consortium was prepared by mixing equal

concentrations of respective cultures (OD600nm = 0.7) and used in further

experimentations.

2.13.2 Green House Study

Fifty kg crude oil-contaminated soil was air dried, and passed through a 2 mm mesh.

Soil was thoroughly mixed and equal amount (1.5 kg) of soil was transferred to plastic

pots. Before sowing, soil was amended with 3% of bacterial inoculum. Afterwards, ten-

day old seedlings of plants were vegetated in each pot depending upon the treatment.

The plants were grown for 90 days and given equal amount of water when needed. The

details of greenhouse experimental setup are described in chapter 3 and 4.

2.13.3 Field Experiment

Experiment was carried out in situ i.e. at an operational field of an oil exploration and

production company, Oil and Gas Development Company (OGDCL), located in district

Chakwal, (32.55 °N 72.51 °E) Pakistan. Soil contamination was due to accidental

release of oil. The plants were grown for three months (March-May, 2015).

Experimental details of field experiment are stated in chapter 5.

Analysis of Residual Crude Oil in Soil

The concentration of residual oil was estimated gravimetrically by solvent extraction

method [174, 187, 188]. Soil sample (5 g) was mixed with petroleum ether (20 mL) and

shaken vigorously for 30 min at room temperature. This mixture was separated into two


38

layers while the top layer containing oil/petroleum ether mixture was decanted in a

clean flask. The process was repeated twice to ensure the complete recovery of oil. The

extract was passed through 0.4 g anhydrous sodium sulfate (Na2SO4) to remove the

moisture and decanted into round bottom flasks leaving behind Na2SO4. Petroleum

ether was evaporated in rotary evaporator at 60 °C under reduced pressure. The %

biodegradation was determined as described in section 2.9.2.

Persistence and Survival of Inoculated Bacteria

Root, shoot, rhizosphere soil and non-rhizosphere soil were sampled at 90 days after

plant harvesting. The samples were processed as mentioned in section 2.7, and plated

on M9 medium supplemented with 1% diesel. Following incubation, individual

colonies were counted and expressed as log10 of the total number of colony forming

units (CFU/ g-1 dry soil).

Bacteria were selected on the basis of their colony appearance on M9 medium

plates amended with 1% (v/v) filter-sterilized diesel. From each treatment, fifty

colonies were indiscriminately selected and confirmed by RFLP analysis as described

in section 2.8.2.

39

3 Selection of Crude Oil Tolerant Plants and

Their Associated Bacteria

3.1 Introduction

The release of petroleum oil in soil and water, due to various human activities, is posing

serious threats to our environment. Petroleum hydrocarbons are considered very

hazardous to living organisms due to their toxicity, mutagenicity and carcinogenicity

[189, 190]. The collective use of plants and hydrocarbon-degrading microbes is a

promising strategy for the cleanup of environment polluted with petroleum

hydrocarbons [20, 191, 192]. During phytoremediation of soil polluted with

hydrocarbons, plant-associated rhizobacteria largely participate in the mineralization of

these contaminants. The proliferation and activity of pollutant-degrading rhizobacteria

are maintained through the release of root exudates. For instance plants can take up and

gather organic chemicals in their shoots, roots, and leaves, endophytes appear to be the

best candidate for their degradation in planta. Beneficial endophytic bacteria colonize

different parts of without showing any superficial signs of disease [193].

Both grasses and trees have been found to be suitable for the cleanup of crude oil

polluted soil [94, 194]. Grasses have wide-ranging root system which offers a high root

surface capacity for the toxin-degrading bacterial colonization and uptake of nutrients

[195]. Trees show fast growth and high biomass production and also enhance microbial

mineralization of organic pollutants [194]

The microbial ability to degrade hydrocarbons is mainly accredited to enzymes

for instance alkB encoded alkane monooxygenase and CYP 153 encoded by

cytochrome P450 alkane hydroxylase [196]. In addition to degrading organic

pollutants, bacteria can also improve plant growth due to their plant growth-promoting

actions, such as phosphorous solubilization, 1-amino-cyclopropane-1-carboxylic acid

(ACC) deaminase, and siderophore production and [152].

Regarding bacterial-assisted phytoremediation of hydrocarbon polluted soil, less

knowledge exists on the diversity and distribution of rhizospheric and endophytic

Chaper 3 Selection of Crude Oil Tolerant Plants and Their Associated Bacteria

40

bacteria associated with grasses and trees and their hydrocarbon-degrading and plant

growth-stimulating activities. Therefore, the objective of the present study was to assess

whether grasses and trees growing in crude oil-contaminated soil were hosting distinct

hydrocarbon-degrading bacteria, which might affect the phytoremediation efficacy.

Moreover, plant growth stimulating and crude oil utilizing activities were checked.

3.2 Materials and Methods

3.2.1 Soil Sampling

Crude oil polluted samples of soil were collected from an oil pumping site sited in

Chakwal, Pakistan. Soil was homogenized manually by thorough mixing and sieved

with a 2 mm sieve and subsequently transferred into pots. The physico-chemical

characteristics of soil are listed in Table 3.1.

Table 3.1 Physico-chemical properties of soil collected from

crude oil-contaminated site of an oil exploration and

production company

3.2.2 Screening of Crude Oil-Tolerant Plant Species

One hundred seeds of grass/one seedling of tree of 27 different plant species (Chapter

2, Table 2.1) were sown/planted in these pots in triplicates. Seeds/seedlings were also

planted in uncontaminated agricultural soil (pH 7.2, electrical conductivity 3.9 ds m-1,

clay 28.6%, silt 19.3%, sand 52.1%, total bacterial population 6.7 × 105 cfu g-1 soil,

total N 0.033%, P 0.08% and organic matter 0.34%). The biomass of each plant species

Parameters Concentration

pH 7.4

Electrical conductivity (EC) 3.7 ds m-1

Oil content 25.6 g kg-1 soil

Total bacterial population 2.7 × 105 cfu g-1 soil

Clay 26.5%

Silt 19.7%

Sand 53.8%,

Total Nitrogen 0.02%

Available phosphorus 0.02%


41

vegetated in the crude oil-contaminated soil was determined and compared with that

produced in the uncontaminated soil. Grasses and trees were grown for about 3 and 6

months, respectively. The grasses have shorter life span than trees, therefore, the growth

period of grasses was shorter than trees.

3.2.3 Isolation and Characterization of Hydrocarbon-Degrading

Bacteria

The plants were uprooted carefully, the soil closely attached to roots was collected and

the shoots were cut 2 cm above the soil surface. The isolation of hydrocarbon degrading

rhizospheric and endophytic bacteria was performed on minimal medium (1% filtered-

sterilized diesel as only source of carbon) as described previously [94]. Restriction

fragment length polymorphism (RFLP) investigation was used to distinguish among all

the isolates [107]. RFLP analysis showed that 37 isolates were separated and recognized

by sequencing of 16S rRNA gene as described in Chapter 2, Section 2.8.

Nucleotide Sequence Accession Numbers

Sequences were subjected to BLAST analysis with NCBI database and submitted to

GenBank (accession numbers KF478211-KF478226, KF478228-KF478231,

KF478235-KF478236, KF478238-KF478241, KF318035-KF318040, KJ620868-

KJ620869, KJ620860, KJ620863 and KF312211).

3.2.4 Growth on Crude Oil, Alkanes and Aromatic Hydrocarbons

Strains were confirmed for their capacity to use alkanes and crude oil as only carbon

source by growing them in flasks comprising liquid minimal medium mixed with either

2% (w/v or v/v) of crude oil and n-alkanes ranging from C6-C16 and aromatic

hydrocarbons (1-decanol, naphthalene, phenolphthalein, methanol, ethanol, benzene

and toluene). The flasks were placed for one week at 37 ± 2 °C. The amount of residual

hydrocarbons/crude oil was analyzed as described earlier [175].

3.2.5 Detection of Alkane Hydroxylase Genes in Isolated Bacteria

The presence of two different alk genes (alkB and CYP 153) in hydrocarbon-degrading

bacterial strains was determined as demonstrated previously [94]. The details of primers

and PCR conditions are mentioned in Chapter 2, Section 2.10.


42

3.2.6 In vitro Screening of Plant Growth-Promoting (PGP) Traits

Different plant growth-promoting activities were determined using the protocols as

described earlier [152]. Briefly, solubilization of phosphate was detected by

development of clear reigon nearby bacterial colony on Pikovskaya’s agar medium.

Siderophore production was assessed on the Chrome azurol S (CAS) agar medium.

ACC deaminase capability of the isolates was confirmed on minimal medium

comprising 0.8 g ACC L-1 as single source of nitrogen. The IAA production was

checked using Salkowski reagent. The AHL production and Zn solubilzation activity

was determined by the methods explained in Chapter 2, Section 2.11.

3.3 Results

3.3.1 Screening of Crude Oil-Tolerant Plants Species

All plant species tested in the present study exhibited reduced growth and less biomass

production as compared to plants vegetated in uncontaminated soil. Among others,

Sorghum bicolor, Terminalia bellirica, Camelina sativa, Trifolium alexandrium and

Conocarpus erectus plant species showed reduced growth (83.15, 67.69, 62.60, 62.18

and 59.13%, respectively) in hydrocarbon-contaminated soil as compared to plants

vegetated in uncontaminated soil, hence were considered as more hydrocarbon-

sensitive plants. Biomass production of L. perenne, L. fusca, B. mutica, L.

leucocephala, and A. ampliceps was least affected by the crude oil-contamination as

compared to the respective plants vegetated in uncontaminated soil (Table 3.2) and

were selected for the isolation of rhizo- and endophytic bacteria.

3.3.2 Diversity of Crude Oil-Degrading Bacteria

All cultured rhizospheric and endophytic bacterial strains showed 99% sequence

similarity to known 16S rRNA genes when subjected to BLAST analysis. Thirty-seven

different hydrocarbon-degrading rhizospheric and endophytic bacteria were obtained

that can utilize crude oil as sole carbon source. On the whole, the rhizosphere soil

yielded 22 (59.45%), root interior yielded 9 (24.32%) and shoot interior yielded 6

(16.21%) hydrocarbon-degrading bacterial isolates (Table 3.3). The maximum numbers

(29.72%) of the diesel-utilizing bacteria were found to be associated with L. perenne

plant (both rhizo- and endophytes), of which Bacillus species were dominant (54.54%).

Besides Bacillus sp., some Staphylococus and Oceanimonas sp. strains were also


43

detected in the rhizosphere and root/shoot interior of L. perenne. Bacterial population

associated with the other plants was more limited in terms of diversity as compared to

L. perenne. Higher numbers of bacteria were isolated from the rhizosphere, root and

shoot of both B. mutica (24.32%) and L. leucocephala (21.62%) as compared to A.

ampliceps and L. fusca. On the whole, two bacterial genera i.e., Bacillus (48.64%) and

Acinetobacter (18.91%) were found dominant both in the rhizosphere as well as in

endosphere.

3.3.3 Biodegradation Studies and Amplification of alkB and CYP 153

Genes

The highest percentage of crude oil was degraded by Acinetobacter sp. strain BRSI56

followed by Acinetobacter sp. strain ACRH77, Acinetobacter sp. strain LCRH81 and

Pseudomonas aeruginosa strain BRRI54 with 78, 77, 72 and 71%, respectively (Fig.

3-1). Among all isolated bacterial strains, only Acinetobacter sp. strain LCRH81,

isolated from the rhizosphere of L. leucocephala, could utilize all tested alkanes (Table

3.4), and also possessed alkane hydroxylase (alkB and CYP 153) genes (Table 3.5).

However, 8 strains could not utilize any of the tested alkanes although they showed

growth on crude oil. They were possibly involved in the utilization of other crude oil

components such as low molecular weight alkanes and/or aromatic hydrocarbons.


44

Table 3.2 Biomass production of plants vegetated in crude oil-contaminated and

uncontaminated (healthy) soil

Control pots contained agricultural soil whereas treatment pots contained crude-oil contaminated soil.

n = 3; ± indicates the standard error of three replicates. Grasses and trees were harvested after 3 and 6

months, respectively.

Plant name

Biomass (dry weight, g) Oil reduction

(%) Control

(healthy soil)

Contaminated

soil

Trees

Acacia ampliceps 25.13 ± 1.64 22.74 ± 1.38 9.51

Acacia eburnea 8.9 ± 0.56 6.37 ± 0.51 28.42

Acacia nilotica 8.52 ± 0.63 3.56 ± 0.18 58.21

Azadirachta indica 22.24 ± 1.28 13.56 ± 0.62 58.21

Bambusa dolichomerithalla 4.4 ± 0.26 2.83 ± 0.35 35.68

Conocarpus erectus 2.3 ± 0.16 0.94 ± 0.17 59.13

Eucalyptus camaldulensis 30.35 ± 1.47 24.36 ± 1.28 19.73

Leucaena leucocephala 18.48 ± 1.34 16.92 ± 1.08 8.44

Moringa oleifera 1.99 ± 0. 26 1.02 ± 0.13 48.74

Pongamia pinnata L. 10.77 ± 1.02 6.28 ± 0.45 41.68

Populus nigra 30.56 ± 1.08 20.17 ± 1.16 33.99

Terminalia arjuna 21.44 ± 0.89 12.26 ± 0.74 42.81

Terminalia bellirica 4.86 ± 0.18 1.57 ± 0.15 67.69

Grasses

Axonopus fissifolius 17.92 ± 1.17 12.82 ± 0.79 28.45

Brachiaria mutica 17.40 ± 1.46 15.83 ± 1.06 9.02

Camelina sativa 6.98 ± 0.19 2.61 ± 0.15 62.60

Hordeum vulgare 1.18 ± 0.45 0.62 ± 0.09 47.41

Leptochloa fusca 15.30 ± 1.20 13.67 ± 0.94 10.65

Lolium perenne 12.40 ± 0.65 10.52 ± 0.83 15.16

Medicago sativa 1.77 ± 0.25 0.92 ± 0.10 47.45

Sorghum bicolor 7.30 ± 0.64 1.23 ± 0.26 83.15

Sporobolus indicus 10.11 ± 0.73 6.73 ± 0.58 33.43

Trifolium alexandrium 6.40 ± 0.36 2.42 ± 0.14 62.18

Edible crops

Brassica rapa 5.80 ± 0.68 3.62 ± 0.29 37.58

Glycine max 11.52 ± 0.67 7.36 ± 0.68 36.11

Helianthus annuus L. 11.14 ± 0.56 5.85 ± 0.28 47.48

Zea mays 18.45 ± 1.05 10.32 ± 0.71 44.06


45

Table 3.3 Bacterial strains isolated from rhizosphere (RH), root interior (RI) and

shoot interior (SI) of Brachiaria mutica (BRA), Lolium perenne (LOL),

Leptochloa fusca (LEP), Acacia ampliceps (ACA) and Leucaena leucocephala

(LEC)

IGS type Host plant Identification based on 16S

rRNA gene sequencing

Accession number/

homology (%)

ACRH76 ACA / RH Acinetobacter lwofii KF478224 / 99

ACRH77 ACA / RH Acinetobacter sp. KF478226 / 99



ACSI85 ACA / SI Bacillus niabensis KF478230 / 99

BRRI53 BRA / RI Bacillus amyloquefaciens KF478213 / 99

BRRI54 BRA / RI Pseudomonas aeruginosa KJ620860 / 99

BRSI56 BRA / SI Acinetobacter sp. KF318036 / 99

BRSI57 BRA / SI Bacillus cereus KF478211 / 99

BRSI58 BRA / SI Bacillus licheniformis KF478218 / 99

BRRH59 BRA / RH Bacillus megaterium KF478219 / 99

BRRH60 BRA / RH Bacillus sp. KF478225 / 99

BRRH61 BRA / RH Acinetobacter sp. KJ620863 / 99

BRRH63 BRA / RH Shinella granuli KF318040 / 99

LCRI86 LEC / RI Enterobacter cloacae KF478236 / 99

LCRI87 LEC / RI Klebsiella sp. KF478220 / 99

LCRH88 LEC / RH Bacillus sp. KF478212 / 99

LCRH90 LEC / RH Pseudomonas sp. KF478222 / 99

LCRH92 LEC / RH Pseudomonas brassicacearum KF478229 / 99

LCRH93 LEC / RH Bacillus cereus KF478221 / 99

LCRH94 LEC / RH Pseudomonas brassicacearum KF318038 / 99

LCRH81 LEC / RH Acinetobacter sp. KJ620868 / 99

LERI70 LEP / RI Bacillus endophyticus KF318037 / 99

LERI71 LEP / RI Bacillus flexus KJ620869 / 99

LERH73 LEP / RH Bacillus frimus KF478215 / 99

LERH74 LEP / RH Bacillus megaterium KF478217 / 99

LORI64 LOL / RI Bacillus cereus KF478235 / 99

LORI65 LOL / RI Bacillus megaterium KF478214 / 99

LORI66 LOL / RI Bacillus subtilis KF478216 / 99

LOSI67 LOL / SI Staphylococus vitulinus KF318035 / 99

LOSI68 LOL / SI Bacillus pumilus KF318039 / 99

LORH69 LOL / RH Oceanimonas denitrificans KF478223 / 99

LORH95 LOL / RH Bacillus cereus KF478239 / 99

LORH96 LOL / RH Bacillus firmus KF478238 / 99

LORH97 LOL / RH Bacillus cereus KF478239 / 99




46

Figure 3-1 In vitro crude oil degradation potential of isolated bacterial strains. Values with same letter are not

different at 5% level of significance. Comparisons between treatments were carried out by one-way analysis of

variance (ANOVA). Error bar indicates standard error among three replicates.

QR

S

AB

CD

E

A

FGH

IJK

PQ

R

OP

Q

FGH

IJK

HIJK

L LMN

CD

EFGH

BC

DEF

BC

DEF

KL

RS

FGH

IJKL

IJKL

S

GH

IJKL

JKL

DEFG

HI

RS RS

JKL

OP

Q

AB

CD

E

AB

C

B

CD

EFG

EFGH

IJ

AB

CD

CD

EFG

MN

O

CD

EFG

OP

NO

P

KL

AB

CD

0

10

20

30

40

50

60

70

80

90

Cru

de

oil

deg

rad

ati

on

(%

)

Bacterial strains

Figure 3-1 In vitro crude oil degradation potential of isolated bacterial strains.

Values with same letter are not different at 5% level of significance. Assessments among treatments

were performed by one-way analysis of variance (ANOVA). Error bar indicates standard error among

three replicates.


47

Table 3.4 Degradation abilities of isolated rhizospheric and endophytic bacteria using different hydrocarbons as

substrate

Continued…….

Bacterial

strains

Utilization of hydrocarbons

C8 C10 C12 C16 1-dec. Meth. Eth. Ben. Phen. Phenop. Tol. Naph.

BRRI53 - - ++ - - - - - + - + -

BRRI54 - ++ - - + + + - ++ - + -

BRSI56 + ++ - ++ ++ + + + + + + -

BRSI57 - - - - - - - - + - - -

BRSI58 - - ++ - ++ - - - - - + -

BRRH59 + - - - ++ - - - - - - -

BRRH60 - ++ - + - - - - - - - -

BRRH61 + - - ++ - + + + ++ + - ++

BRRH63 - - - - - - - + - - + -

LORI64 - + - - - + + - + - +

LORI65 + - - - - - - - + - - -

LORI66 - + - - - - - - - - +

LOSI67 + - - ++ + - - - + + - -

LOSI68 - - - - - - - - - - - -

LORH69 - ++ - ++ - - - - - - + -

LORH95 - ++ - ++ - - - - + + - -

LORH96 - - ++ - - - - - - - - -

LORH97 + - - - - - - - - - + -

LORH98 - - ++ - - - - - + - - -

LORH99 - ++ - - - - - - - - - -


48

Abbreviations: C6: Hexane, C8: Octane, C10: Decane, C12: Dodecane, C16: Hexadecane, 1-dec: 1 decanol, Meth:

Methanol, Eth: Ethanol, Ben: Benzene, Phen: Phenanthrene, Phenop: Phenolphthalein, Tol: Toluene, Naph:

Naphthalene. + = good activity, ++ = very good activity, -ve = absence of characteristics

Bacterial

strains

Utilization of hydrocarbons

C8 C10 C12 C16 1-dec. Meth. Eth. Ben. Phen. Phenop. Tol. Naph.

LERI70 - - - - - - + - + + + +

LERI71 - - - - - - + - + + - -

LERH73 - - - + - - - - - + - -

LERH74 - + - - - - - - + + + -

ACRH76 - - - ++ - - - - + - + -

ACRH77 - ++ - - - - - - - - - -

ACRH80 - - - - - - - - - - - -

ACRH82 - ++ - - - - - - - - - -

ACSI85 ++ - - - - - - - + + + -

LCRI86 - + - + - - - - + + - -

LCRI87 - + ++ + - - - - - + - -

LCRH88 - - - - - - - - - - + -

LCRH90 - + - + - - - - + + - +

LCRH92 - - - - - - - - - + + -

LCRH93 + ++ - - - - - - + - - -

LCRH94 - + - - - - - - - - + -

LCRH81 + ++ + ++ - + + + ++ + + -

Chapter 3 Selection of Crude Oil Tolerant Plants and Their Associated Bacteria

49

Table 3.5 PCR amplification of alkane hydroxylase genes (alkB and CYP

153)

Presence of gene (+), absence of gene (-)

IGS type Bacterial strains PCR amplification

alkB CYP 153

ACRH76 Acinetobacter lwofii + +

ACRH77 Acinetobacter sp. - +

ACRH80 Acinetobacter sp. - -

ACRH82 Acinetobacter sp. + -

ACSI85 Bacillus niabensis + -

BRRI53 Bacillus amyloquefaciens + +

BRRI54 Pseudomonas aeruginosa + +

BRSI56 Acinetobacter sp. + +

BRSI57 Bacillus cereus - -

BRSI58 Bacillus licheniformis + -

BRRH59 Bacillus megaterium - +

BRRH60 Bacillus sp. + +

BRRH61 Acinetobacter sp. + +

BRRH63 Shinella granuli - -

LCRI86 Enterobacter cloacae + +

LCRI87 Klebsiella sp. - -

LCRH88 Bacillus sp. - -

LCRH90 Pseudomonas sp. - +

LCRH92 Pseudomonas brassicacearum - -

LCRH93 Bacillus cereus + -

LCRH94 Pseudomonas brassicacearum + +

LCRH81 Acinetobacter sp. + +

LERI70 Bacillus endophyticus - +

LERI71 Bacillus flexus + -

LERH73 Bacillus frimus + -

LERH74 Bacillus megaterium + -

LORI64 Bacillus cereus - +

LORI65 Bacillus megaterium + -

LORI66 Bacillus subtilis + -

LOSI67 Staphylococus vitulinus + +

LOSI68 Bacillus pumilus - +

LORH69 Oceanimonas denitrificans - -

LORH95 Bacillus cereus - +

LORH96 Bacillus firmus + +

LORH97 Bacillus cereus - +

LORH98 Oceanimonas denitrificans - -

LORH99 Oceanimonas denitrificans + +


50

3.3.4 Plant Growth-Promoting Potential of Isolated Bacteria

Majority of the isolated rhizo/endophytic bacteria showed the in vitro PGP activities or

mechanisms (Fig. 3-2a-g). Most of the strains showed the ability to produce IAA and

ACC deaminase showing that these two mechanisms are more common among the

hydrocarbon-degrading bacteria. Phosphorus solubilization activity was found to be

relatively less common. One strain, Klebsiella sp. strain LCRI87, isolated from the root

of L. leucocephala exhibited multiple plant growth-promoting activities.


51

Figure 3-2 Plant growth promoting-potential of some representative strains

a: P- solubilization, b: Zn-solubilization, c: Siderophore secretion, d: AHL

production, e: IAA production, f: Antifungal activity, g: ACC deaminase production.

C 1 2 3 4 5 6 7 8 9 10


52

Table 3.6 In vitro plant growth-promoting potential of endophyte and rhizosphere bacterial strains

isolated from different grasses and trees

Continued….

Bacteria IAA Sider. P-solub. ACC Biocontrol Zn- solub. AHL

BRRI53 - - - + - - -

BRRI54 - ++ - - + + +

BRSI56 - - - + - + -

BRSI57 - + - - - - -

BRSI58 - - ++ - + - -

BRRH59 - + - - - - -

BRRH60 + ++ ++ - - - -

BRRH61 - - - ++ - - -

BRRH63 - - - - - - +

LORI64 - - - - - - -

LORI65 - + - - - - -

LORI66 - + ++ - - + -

LOSI67 - + ++ - - - -

LOSI68 - - - ++ - - -

LORH69 - ++ - - - - -

LORH95 - - - - - - -

LORH96 - - - + - - -

LORH97 - - - ++ + - -


53

IAA: Indole 3-acetic acid production, P-solub.: Phosphate solubilization, ACC: 1-aminocyclopropane-1-

carboxylic acid (ACC) deaminase, Zn-solub.: Zinc solubilization, AHL: n-acylhomoserine lactone production

Bacteria IAA Sider P-Solub. ACC Biocontrol Zn-solub. AHL

LORH 98 - - - ++ - - -

LORH99 - - - + - - -

LERI70 - - ++ ++ - - -

LERI71 ++ + - ++ - + +

LERH73 ++ - - - + - -

LERH74 ++ + - + - - -

ACRH76 - - - - - - -

ACRH77 - - ++ - - - -

ACRH80 - - - - - - -

ACRH82 - - - - - - -

ACSI85 ++ - - - + - -

LCRI86 ++ + + + - -

LCRI87 + + ++ + + + -

LCRH88 - - - ++ - - -

LCRH90 ++ + ++ ++ - - -

LCRH92 ++ + - ++ + - -

LCRH93 ++ - - + - - -

LCRH94 ++ + - ++ - - -

LCRH81 ++ - - - - + +


54

3.4 Discussion

Crude oil inhibits plant growth and biomass production due to the toxic nature of its

low molecular weight components. Often, contaminants for example petroleum

hydrocarbons modify the physical and chemical properties of the soil. Hydrophobic

nature of contaminants can alter the water/soil interactions that would normally take

place, thus potentially affecting oxygen transfer, available water uptake, and nutrient

mobility [108, 197].

We observed that grasses and trees vegetated in the crude oil contaminated soil

hosted versatile, heterogeneously distributed rhizospheric and endophytic bacteria,

which may influence the efficiency of plants to stimulate the mineralization of organic

pollutants. Regarding the application of vegetation for phytoremediation of

hydrocarbon-polluted soil, where a large number of hydrocarbon degraders is

essentially needed for the maximum degradation of pollutants, three grass species, L.

perenne, B. mutica and L. fusca and two tree species, L. leucocephala, and A. ampliceps

seem to be more appropriate than other plants investigated in this study.

It has been reported that grasses can host a large number of microorganisms

because of their fibrous root system providing a large surface area for microbial

colonization [94]. The fact that Bacillus sp. strains are frequent colonizers of the

rhizosphere of grasses and trees further shows that the members of this genus might be

dominant among hydrocarbon degrading bacterial community [198]. Root exudates and

other plant metabolites determine the potential, density and diversity of

microorganisms in the rhizosphere or endosphere [199]. Moreover, grasses are known

to release alkanes in soil, which might favor the number of hydrocarbon-utilizing

bacteria in the vicinity [200]. Only Bacillus cereus was found in the root, shoot and

rhizospheric soil of 3 different plants, showing that mostly distinct plant species host

different hydrocarbon degraders. Several reports indicated that the colonization of

diesel-utilizing microbes in the endosphere and rhizosphere depends on plant species

[94, 201]. It was important to note that in the shoot interior and rhizosphere of A.

ampliceps, 4 out of 5 strains were Acinetobacter spp., showing that strains of this

genus form tight endophytic association with A. ampliceps. A large number of bacteria

were unable to proliferate in contaminated soil, and possibly were outcompeted by the

pollutant-degrading bacteria. Moreover, it might be due to the toxicity of low molecular


55

weight alkanes and aromatic compounds present in crude oil [194]. Generally,

endophytic bacteria were different from rhizospheric bacteria and also shoot and root

possessed different hydrocarbon-degrading bacteria. The reason that a higher number

of endophytes were isolated from root than shoot supports the theory that the number

of the endophytic bacteria decreases with the expanse from their entry points such as

root tip and/or the site of the emergence of lateral roots [20]. These endophytes may

play a great role in reducing the toxicity of the hydrocarbons that are taken up by plants

[107].

Many rhizospheric and endophytic bacteria have been reported to be tolerant of

crude oil/ hydrocarbons, and some of these can even utilize them as sole carbon source

[202]. In this study, we observed that majority of bacteria were able to degrade crude

oil/ hydrocarbons (Table 3.4). Though most of the bacterial strains showed potential to

degrade hydrocarbons, only 54.05% of them showed the amplification of alkB and

CYP153 genes with the primers used in this study (Table 3.5). Most of the strains

isolated from the grasses possessed alkB and CYP153 genes, as revealed by PCR. The

occurrence of numerous alkane hydroxylases with overlying substrate series is a

common occurrence among hydrocarbon degraders [196]. Several degrading strains in

which alkane hydroxylase genes could not be identified indicated that these bacteria

might host novel alkane degradation genes.

Plant growth-promoting activities such as ACC deaminase activity plays a key

role in plant-microbe partnerships especially under stress conditions including

contaminant stress. This bacterial ACC deaminase enzyme regulates ethylene levels in

plants and consequently contributes to the production of longer roots [194]. In present

study majority of bacteria showed various PGP activities that facilitate plant growth

and improve phytoremediation efficiency. One strain Klebsiella sp. LCRI87 showed

multiple PGP traits. In most studied cases, a single strain revealed multiple modes of

action including biological control [152, 203, 204].

4 Green House Evaluation of Plant-Bacteria

Partnership for the Remediation of Crude

Oil-Contaminated Soil

4.1 Introduction

The insatiable reliance of the progressing world on oil and petrochemicals has increased

during the past few decades that has resulted in extensive release of hydrocarbon

pollutants in the environment. The adverse ecological and socioeconomic effects of oil

pollution demand that eco-friendly and proficient remediation technologies be devised

as countermeasures. The synergistic use of plants and endophytes has gained

acknowledgment as one of these efficient green technologies [25, 205, 206]. Plants

provide a niche and essential nutrients for habitation and survival of endophytes while

endophytic bacteria improve plant growth directly by producing beneficial metabolites

or indirectly by reducing the amount of pollutants [80, 207].

The association of inoculated bacteria with the host plant can occur in multiple

ways, one of which is the biofilm formation, which is an important mode of microbial

colonization in certain environments, ultimately affecting overall functioning of

microbes [66, 208, 209]. The presence of oil-degrading microorganisms in biofilm

enhances the degradation of toxic hydrocarbon pollutants [210-212]. In addition,

colonization, survival, and activity of inoculated oil-degrading bacterial strains in

rhizosphere and endosphere of host plants are crucial for sustainable growth of the host

and mitigation of recalcitrant hydrocarbon contaminants in its vicinity [20, 132, 213].

The plant hosts employed in this investigation are grasses, B. mutica and L.

fusca, that are well-known for salt tolerance, thus are used for the rehabilitation of saline

soil [80, 214]. However, the potential of B. mutica and L. fusca for remediation of crude

oil-contaminated soil has been rarely evaluated in association with endophytes.

Although several studies showed that plant species affect the community structure in

rhizosphere and endosphere, information on the effect that plants species may incur on

biofilm formation, colonization, and metabolic activity of the inoculated endophytic

Chapter 4 Green House Evalaution of Plant-Bacteria Partnership

57

bacteria is scarce in scientific literature. Therefore, this study evaluates the effect of

plant species on colonization pattern and metabolic activity of the inoculated

endophytes during the phytoremediation of crude oil-contaminated soil. Occurrence of

inoculated endophytes as biofilm in various compartments (rhizoplane, root, and shoot)

of the plants was studied by confocal laser scanning microscope (CLSM). The

persistence and metabolic activity of the inoculated endophytic bacteria in rhizosphere

and endosphere were evaluated by culture-dependent and -independent approaches.


4.2.1 Bacterial Strains

Bacteria used in present work were selected from a wide collection of hydrocarbon-

utilizing bacteria previously isolated (Table 3.3) from plants vegetated in crude oil-

contaminated soil. The strains included Pseudomonas aeruginosa BRRI54 (isolated

from the root of B. mutica) and Acinetobacter sp. strain BRSI56 (isolated from the shoot

of B. mutica). Both strains were able to degrade a variety of straight chain alkanes as

well as aromatic compounds and showed the presence of alkane hydroxylase gene

(alkB). These strains were also positive for plant growth promoting traits e.g.,

siderophore production, and 1-aminocyclopropane-1-carboxylate (ACC) deaminase/

AHL activity, and Zn-solubilization.

4.2.2 Tagging of Bacterial Strains with Yellow Fluorescent Protein

(YFP) and Formulation of Bacterial Consortium

To monitor the colonization patterns, both strains were tagged with yfp gene as

described earlier [215, 216]. These labelled strains were used as inoculum in the form

of consortium AP (Pseudomonas aeruginosa BRRI54 and Acinetobacter sp. BRSI56),

which was prepared by mixing equal portions of pure bacterial cultures (≈108 cells/mL).

4.2.3 In vitro Biofilm Formation

BRRI54-yfp and BRSI56-yfp were first tested for biofilm formation on 22 mm thin

cover slips immersed in 50 mL sterile culture tubes containing 15 mL minimal medium

(M9) with 1% crude oil or glucose [211]. The bacterial strains were inoculated and

incubated for 4 days at 37 °C. The cover slips were removed from the culture tubes

carefully, washed thoroughly with 1X phosphate buffer saline (PBS) solution

aseptically and air-dried [69]. Formation of biofilm was viewed under 100X oil


58

immersion objective lens using CLSM (Fluo view, FV 1000, Olympus). The samples

were excited at 514 nm using argon single laser.

4.2.4 Experimental Setup

Crude oil-contaminated soil (crude oil 25.6 g kg-1 soil) was collected from oil pumping

site located in Chakwal, Pakistan. Soil was sieved through stainless 2 mm screen and

thoroughly mixed. Equal amount (1.5 kg) of soil was transferred into 7 × 3 pots, for

seven treatments to be performed in triplicates. Before sowing, the soil was amended

with 50 mL AP consortium (≈ 108 cfu/mL).

This ex-situ experiment was designed to study: 1) the effect of oil contamination

on plant growth; 2) the effect of vegetation on oil degradation; 3) the effect of bacterial

augmentation on oil degradation; 4) the effect of plant species on colonization pattern

and activity of the inoculated bacterial strains; 5) the effect of colonization pattern and

activity on plant growth and oil degradation.

Table 4.1 Experimental design of green house experiment

Thirty cuttings of L. fusca or B. mutica with similar weight and size were

vegetated in each pot depending upon the treatment. The plants were grown in green

house and given equal amounts of water when needed. Plants were harvested after 3

months of planting and data on growth parameters was recorded. Rhizosphere soil was

obtained by sampling the soil loosely attached to roots while bulk soil (non-

rhizospheric soil) was collected by thoroughly mixing the rest of the soil in pot. Root

Sr. No. Treatments Experimental Design

1 Treatment-1 Agricultural (uncontaminated) soil with vegetation

2 Treatment-2 Crude oil-contaminated soil without vegetation

3 Treatment-3 Crude oil-contaminated soil with AP augmentation

4 Treatment-4 Crude oil-contaminated soil with L. fusca vegetation


and AP inoculation

6 Treatment-6 Crude oil-contaminated soil with B. mutica vegetation


and AP inoculation


59

and shoot length and dry weight were recorded. Samples were than stored at -80 °C

until further analysis. The colonization pattern of inoculated bacteria was also

determined in the rhizosphere and endosphere of the plants using CLSM as described

earlier [66].

4.2.5 Analysis of Crude Oil Residues in Soil and Biostimulant

Efficiency

After plant harvesting, the level of residual crude oil in the soil samples was determined

gravimetrically as described previously [217-219] and biostimulant efficiency (BE%)

was calculated as reported earlier [220].

4.2.6 Persistence of the Inoculated Endophytes

The abundance of inoculated strains in rhizosphere soil, shoot, and root interior of L.

fusca and B. mutica was checked by plate count method [45].

4.2.7 Quantification of Abundance and Expression of alkB Gene

The abundance and expression of catabolic genes encoding alkane hydroxylase (alkB)

were estimated by real-time PCR as explained earlier [46, 118, 150].

4.3 Results

4.3.1 In vitro Attachment and Colonization of Bacteria on Solid

Substratum

The ability of bacterial strains BRRI54-yfp and BRSI56-yfp to attach and colonize to

solid substrate (glass) in the presence of crude oil and glucose (1%) was studied by

biofilm formation. The biofilm formation was observed under CLSM (Fig. 4-1 & 4-2).

The initial occurrence of bacterial attachment occurred in the initial 24 h of

development (Fig. 4-3a). Bacterial cells consequently gathered on the solid slip and

after 48 h of growth, bacteria were surfaced in the form of groups near oil-water

interface (Fig. 4-3b). As the cells grew, the bacteria utilized the oil as energy source

and oil contents reduced with time. After 72 and 96 h of incubation (Figs. 4-3c & d),

bacterial cells were fully grown-up and more gathered to form a precise biofilm with

very few oil droplets visible on the surface of glass. Biofilm formation of strain

Acinetobacter sp. BRSI56-yfp was more obvious as compared to that of BRRI54-yfp

strain under these experimental conditions (Fig 4-4a & b).


60

Figure 4-1 Attachment of Acinetobacter sp. strain BRSI56-yfp on thin

cover slip (22 mm)

12 h (a) and 96 h (b) of growth in minimal medium amended with glucose

as sole energy source (magnification = 100X).

Figure 4-2 Attachment of Pseudomonas aeruginosa strain BRRI54-yfp

on thin cover slip (22 mm)

12 h (a) and 96 h (b) of growth in minimal medium amended with glucose as

sole energy source (magnification = 100X).


61

Figure 4-3 Biofilm formation on thin cover slip (22 mm) by Acinetobacter sp.

strain BRSI56-yfp

24 h (a), 48 h (b), 72 h (c), and 96 h (d) of growth in minimal medium amended

with 1% crude oil as sole energy source (magnification = 100X).

a


62

Figure 4-4 Biofilm formation on thin cover slip

(22 mm) by Pseudomonas aeruginosa strain

BRRI54-yfp

12 h (a) and 96 h (b) of growth in minimal medium

amended with 1% crude oil as sole energy source

(magnification = 100X).


63

4.3.2 Colonization and Distribution of Endophytes within Host Plants

Observations under CLSM confirmed that the inoculated bacteria were efficient plant

colonizers indicating their capacity to inhabit host plants (L. fusca and B. mutica) (Figs.

4-5 & 4-6). Bacteria first colonized the rhizoplane followed by establishment of

aggregates/biofilms on the entire root surface which indicated the possible entry of

these bacteria into roots through these points (Fig. 4-5a). Following rhizoplane

colonization, strains entered the roots and after translocation localized as single cell in

the stems and leaves of the host plants (Figs. 4-5b & c). Maximum colonization of

inoculated bacteria was observed in rhizoplane and inside the root as compared to the

aerial tissues of the plant. No fluorescence was detected in uninoculated (control) plants

(Fig. 4-5d to f).

4.3.3 Plant Growth Responses to Bacterial Inoculation

Growth parameters (root and shoot length, root dry weight, and stem dry mass) were

detected to assess the influence of inoculation of bacteria on plant (Fig. 4-7a & b). In

soil contaminated with crude oil, endophytes inoculation improved root length (21-

26%), shoot length (11-18%), root dry weight (25-38%), and shoot dry weight (11-

18%) of both L. fusca and B. mutica. Among the two types of endophytes inoculated

plants, B. mutica showed more increase in root length (19%), shoot length (39%), root

dry weight (34%) and shoot dry weight (38%) than L. fusca plants. However, oil-

contamination in uninoculated soil significantly reduced root length (32-40%), shoot

length (29-32%), root dry weight (37-46%), and shoot dry weight (26-36%). Of the two

grasses, B. mutica plants were least affected under crude oil-contamination than L. fusca

plants.


64

Figure 4-5 Colonization of yfp-tagged Pseudomonas aeruginosa BRRI54

and Acinetobacter sp. BRSI56 on the rhizoplane (a), root cortical cells (b),

and leaf mesophyll cells (c) of Brachiaria mutica

The root samples of non-inoculated plants of B. mutica (d & e), and leaf (f) do

not show any colonization. Arrow indicates the presence of bacteria. The tissue

was observed (magnification = 100X) under CLSM.


65


Acinetobacter sp. BRSI56 inside the roots of L. fusca (a)

No bacterial colonization was observed inside stem and leaf of inoculated plant.

The root samples of non-inoculated plants of L. fusca (d & e), and leaf (f) do not

show any colonization. Arrow indicates the presence of bacteria. The tissue was

observed (magnification = 100X) under CLSM.


66

c

a

b

a

e

cd

d

cd

d

b

cdc

0

20

40

60

80

100

L. fusca B. mutica L. fusca B. mutica

Root length Shoot length

Root

an

d s

hoot

len

gth

(cm

)

Uncontaminated (healthy) soil

Crude oil-contaminated soil

Crude oil-contaminated soil with bacteria

b

a

ab

a

d d

c c

c c

bb

0

10

20

30

40

50


Root biomass Shoot biomass

Pla

nt

bio

mass

(g)




a

b

Figure 4-7 Growth responses including root and shoot length

(a), fresh and dry weight (b) of L. fusca and B. mutica,

vegetated in crude oil contaminated soil with and without

bacterial augmentation

Values with same letter are not different at 5% level of

significance. Evaluations amongst treatments were done by

analysis of variance (ANOVA). Error bar indicates standard error

among three replicates.


67

4.3.4 Effect of Plant Species on Crude Oil Degradation

B. mutica exhibited 9% more crude oil degradation than L. fusca while synergistic

action of B. mutica and endophytes exhibited maximum (78%) crude oil-degradation.

Maximum crude oil-degradation (71-78%) was observed in treatments having plants

inoculated with endophytes; it was significantly higher than what was observed for

plants and bacteria individually (Fig. 4-8). Vegetated soil exhibited more crude oil

degradation (60-66%) than unvegetated soil, whereas the augmentation of unvegetated

soil with endophytes consortium resulted in 52% crude oil degradation. On the other

hand, least degradation (40%) of crude oil was detected in the control soil that was

uninoculated and unvegetated.

The biostimulants efficiency (BE) analysis showed that the highest BE value

(95%) was observed with B. mutica inoculated with AP consortium while the lowest

BE value (30%) was observed in the unvegetated soil inoculated with hydrocarbon-

degrading consortium (Fig. 4-9).

4.3.5 Effect of Plant Species on Persistence and Metabolic Activity of

Inoculated Endophytes

The ability of inoculated endophytes to colonize unvegetated soil as well as the

rhizosphere and endosphere of B. mutica and L. fusca was estimated. Among the two

types of grasses in this investigation, B. mutica hosted more numbers of the inoculated

bacteria than L. fusca: both in the rhizosphere and endosphere (Table 4.2). Furthermore,

bacterial cell count in the roots of both grasses was significantly greater as compared

to those in rhizosphere and shoots. However, relatively lower numbers of the inoculated

endophytes were recovered from unvegetated soil than the rhizosphere soil.

Likewise, rhizosphere and endosphere of B. mutica showed higher levels of

alkB gene and its expression than that of L. fusca. Maximum alkB gene abundance and

expression were observed within the root tissue of B. mutica; which was significantly

higher than expression and abundance of specific gene and in the rhizosphere and shoot

interior (Table 4.2). Moreover, the inoculated AP consortium showed greater intensities

of alkB gene was detected in the rhizo- and endosphere of the plants where bacteria

were added than in the unvegetated soil.


68

e

dc

bbc

a

0

20

40

60

80

100

Control Bacteria L. fusca L. fusca with

bacteria

B. mutica B. mutica with

bacteria

Cru

de

oil

deg

rad

ati

on

(%

)

Treatments

f

e

d

b

c

a

0

20

40

60

80

100

Control Bacteria L. fusca L. fusca with

bacteria

B. mutica B. mutica with

bacteria

Bio

stim

ula

nt

effi

cien

cy (

%)

Treatments

Figure 4-8 Effect of bacterial consortia AP (Acinetobacter sp. strain

BRSI56 and Pseudomonas aeruginosa strain BRRI54) inoculation on

crude oil degradation after 93 days of vegetation

Values with same letter are not significantly different at 5% level of

significance. Error bar indicates standard error among three replicates. One-

way analysis of variance (ANOVA) was used to differentiate between

different treatments

Figure 4-9 Biostimulant efficiency (%) of treated soil samples

collected after 93 days of bioremediation process

Values with same letter are not significantly different at 5% level of

significance

Error bar indicates standard error among three replicates. Comparisons

between treatments were carried out by one-way analysis of variance

(ANOVA).


69

Table 4.2 Colony forming unit (CFU), abundance and expression of alkB

in the bulk soil, rhizosphere soil and endosphere of Leptochloa fusca and

Brachiaria mutica inoculated with bacterial consortium

Average values in the similar column trailed by the similar letter are not significantly dissimilar at 5%

significance level. In parentheses, the standard error of triplicates are mentioned. One-way analysis of

variance (ANOVA) was used to compare between treatments.

4.4 Discussion

Due to rapid industrialization and increasing anthropogenic activities, contamination of

soil and groundwater with hydrocarbons poses a greater threat not only to microflora

but also to human and animals [109, 221]. Microbial biofilms are highly efficient and

successful ecological communities that may contribute in remediation of oil-

contaminated soils [66, 222, 223]. In this study, we have evaluated the ex-situ potential

of specifically-designed bacterial consortium AP (two endophytes) in association with

two grass species for the restoration of crude oil-polluted environment. CLSM analysis

indicated that the inoculated endophytes were able to form biofilm on solid substratum;

the capability appeared to be maximum in the close proximity of oil-water interface

(Fig. 4-3 & 4-4). Several earlier studies have demonstrated that natural oil degrading

bacteria can accumulate in the vicinity of oil and other pollutants and efficiently evade

the limitation of low bioavailability of hydrocarbons in remediation process [224].

Successful root colonization by hydrocarbon-degrading bacteria is an essential

criterion to ensure beneficial effects of endophytes on phytoremdiation process [22,

Treatments CFU

(g-1 dry weight × 103)

Gene abundance

(copies g-1 dry weight × 103)

Gene expression

(copies g-1 dry weight × 103)

Soil (Bulk) 12g (1.5) 0.79g (0.27) 0.31f (0.11)

Rhizosphere

Brachiaria mutica 910b (24) 23.6b (0.40) 2.1c (0.34)

Leptochloa fusca 327f (14) 10.8d (0.16) 1.4d (0.18)

Root

Brachiaria mutica 1272a (54) 91.8a (1.46) 7.4a (0.15)

Leptochloa fusca 523d (21) 12.3c (1.05) 2.9b (0.37)

Shoot

Brachiaria mutica 656c (34) 6.3e (0.64) 1.5d (0.34)

Leptochloa fusca 460e (10) 4.5f (0.50) 1.0e (0.16)


70

213, 225]. In this study, bacterial cells were visualized as single cell as well as

aggregated colonies on the rhizoplane that later on colonized the interior of the root and

stem cells (Fig. 4-5 & 4-6). Earlier reports corroborate this translocation of bacteria by

indicating that endophytic bacteria are able to translocate through the xylem vessels

from roots to aerial parts of the host plant via transpiration flow or by colonizing

intercellular spaces [150, 151, 226, 227].

In phytoremediation, the foremost issue is development of plant tissue, which

reflects the adaptation of plants to various stresses. In this study, the presence of crude

oil in soil repressed plant development and development. This can be accredited to the

lethal fractions of the crude oil [228, 229]. However, AP augmentation enhanced shoot

and root dimension and tissue development of both grass species (L. fusca and B.

mutica). It might be because of the oil degrading and ACC deaminase action of the

injected endophytes. This activity of microbes lowers the ethylene level in plants during

stress conditions, such as crude oil-contamination in soil, thus improving plant's

adaptation and growth [25, 230, 231].

Uninoculated and unvegetated soil showed lower reduction (40%) of crude oil

(Fig. 4-8) as compared to inoculated and vegetated soil. This degradation of crude oil

is performed by native microbes and/or natural physicochemical processes (e.g.,

volatilization or photo-oxidation) [213, 232]. The augmentation of AP consortium in

the unvegetated soil resulted in 52% reduction in oil concentration. Several earlier

studies demonstrated the same trend, whereby augmentation of hydrocarbon polluted

soil with hydrocarbon-degrading bacteria lead to decline in the contaminant

concentrations [233]. Moreover, vegetation enhanced the mineralization of

hydrocarbons up to 60-66%. Instead of using either plant or bacteria alone, their

bipartite association i.e. augmentation of plants with bacterial inoculation is superior

strategy in the degradation process. Plants provide nutrients to indigenous microbial

population hence improving their capability to degrade organic pollutants [20, 234].

The augmentation of AP consortium in combination with L. fusca and B. mutica

resulted in 71 and 78% of crude oil degradation, respectively, and this degradation was

significantly higher than either sole bacterial augmentation or vegetation. Maximum

(78%) crude oil-degradation was exhibited by B. mutica and the AP consortium. These

results are in agreement with earlier reports that plant-endophyte association is a more


71

effective methodology for the clean-up of soil polluted with petroleum hydrocarbons

than vegetation or microbial augmentation alone [21, 118, 192, 234]

Different plants host different microorganisms in their rhizosphere and

endosphere, but little is known about the colonization patterns and metabolic activities

of the inoculated bacteria in the endosphere and rhizosphere of host plants. Inoculated

bacteria showed not only colonization but also expressed alkane-degrading genes

demonstrating their dynamic character in the mineralization of crude oil (Table 4-2).

Contrary to the high abundance and activity of the endophytes in vegetated soil, rather

less persistence and activity were seen in unvegetated soil. This reveals that vegetation

improved the persistence and activity of the endophytes in the soil. Vegetation offers

nutrients and habitat to associated microorganisms and ultimately the numbers of

pollutant-degrading microorganisms increases in the vicinity of the root as well as the

plant interior [19, 118].

Furthermore, among the two tested plants, higher persistence of inoculated

endophytes and better expression and abundance of gene (alkB) were observed in the

rhizo- and inerior of B. mutica as compared to L. fusca. This shows that diverse plants

host variety of microbes in their rhizosphere and aerial tissues and also stimulate their

activity differently. It might be the reason that dissimilar plants release a variety of

nutrients in different amounts in their rhizosphere and endosphere and subsequently

stimulate a variety of microorganisms in their components [22, 25, 234].

Moreover, maximum concentration of alkB gene and its expression were

witnessed in the roots of both plants as compared to the rhizosphere soil and shoot

interior. Previous studies corroborate that inoculated endophytes exhibit better

persistence and activity inside root as compared to rhizosphere soil or shoot interior

[46, 118, 234]. In our investigation, the presence of alkB exhibited positive

relationships with expression of gene (r = 0.74) and hydrocarbon removal (r = 0.87).

During the phytoremediation of hydrocarbon-contaminated soil, positive relationships

have been formerly described between hydrocarbon-degradation, gene abundance, and

gene expression [20, 234]. This represents that the occurrence and activity of catabolic

genes is directly associated with hydrocarbon degradation.

5 Bacterial Assisted Phytoremediation of Soil

Contaminated with Crude Oil in an Oil

Field

5.1 Introduction

The presence of petroleum hydrocarbons in soil and water is of worldwide concern due

to their high carcinogenic, mutagenic, and deleterious effects on environment and

human health [195, 213, 235]. Phytoremediation, established on the synergistic

activities of plants and their related microorganisms, has been acknowledged as a

powerful method for the restoration of sites contaminated with hydrocarbons [19, 234,

236, 237]. In phytoremdiation, vegetation offers nutrients and habitation; while in

return, the bacteria improve plant health and pollutant tolerance [20, 24, 48, 238].

A crucial constituent of effective phytoremediation of soil contaminated with

organic compounds is the usage of vegetation capable to grow in the extraordinary

concentrations of pollutants, in grouping with favorable plant associated rhizospheric

and endophytic bacteria proficient in degrading organic pollutants [239-241].

Rhizospheric bacteria inhabit the close locality of roots while endophytic bacteria found

in in the root and shoot. It has been presented that plants vegetated in hydrocarbon-

polluted soil can selectively enrich the occurrence of favorable endophytic bacteria

containing enzymes encoding genes liable for hydrocarbon degradation [242, 243].

Endophytes possessing contaminant degradation genes and metabolic actions can

reduce equally evapotranspiration and toxicity of unstable hydrocarbons [118, 234,

242-244]. Furthermore, the use of endophytes keeping plant growth-stimulating events

may improve the plant’s endurance and development in contaminated environment. As

endophytes reside in the plant they can intermingle with their host plant than

rhizobacteria [118, 234]. Quantitative examination of contaminat-degrading genes in

rhizo- and plant’s endosphere provides a valuable means for reviewing the correlation

between a particular bacterial community and the degradation proces [141].

Chapter 5 Bacterial Assisted Phytoremediation of Soil Contaminated with Crude Oil

73

Different plants, Lolium multiflorum, Medicago sativa, Lotus corniculatus,

Cynodon dactylon, Bidens cernua, and Zea mays, have been used to remediate

hydrocarbon-contaminated soil [20]. However, grasses, Brachiaria mutica (Forsk.)

Stapf and Leptochloa fusca (L.) Kunth, have not been estimated for the remediation of

crude oil-polluted soil to date. Furthermore, the potential of combined application of

grasses, L. fusca and B. mutica, and endophytic bacteria has not been assessed for the

remediation of crude oil mixed soil. Thus, the purpose of this study was to evaluate the

effect of inoculation of endophytes on the phytoremediation of crude oil-polluted

topsoil in the surrounding area of oil exploration and production company.

Hydrocarbon degradation and toxicity reduction were observed alongside with

quantitative investigation of functional gene, alkB, which is an important gene in crude

oil degradation.


5.2.1 Site Description

The experiment was performed at an oil production and exploration company situated

in Chakwal district (32.55°N 72.51°E). Contamination of the location was a result of

accidental spill of crude oil (Fig. 5-1). The soil was polluted with high concentration of

crude oil (46.8 g kg-1 soil) and other characteristics are given in Table 5.1.

Figure 5-1 Crude oil-contaminated soil in the vicinity of an oil

exploration and production company before start of the experiment

http://en.wikipedia.org/wiki/Nodding_Bur-marigold


74

Table 5.1 Physico-chemical properties of soil from crude oil

contaminated site of an oil exploration and production company

where experiment was conducted

Every number is the mean of triplicates, the standard error of triplicates is

mentioned in parentheses. *Oil contents were determined before drying the soil.

All analysis data is presented on a dry weight basis unless otherwise stated.

5.2.2 Bacterial Strains

Three endophytic bacterial strains, previously isolated from the endosphere of B. mutica

and L. fusca, were used in this study (Table 3.3). These included Pseudomonas

aeruginosa BRRI54 (isolated from the root of B. mutica), Acinetobacter sp. strain

BRSI56 (isolated from the shoot of B. mutica) and Klebsiella sp. strain LCRI87

(isolated from the root of L. leucocephala). These strains possessed alkane hydroxylase

(alkB) gene. They were grown independently at 37 °C in LB liquid medium

accompanied with 1% raw oil for adaptation. Bacterial cells were collected by

centrifugation at 8,000 × g and re-collected at equal amounts in sterilized 0.9% normal

saline. The quantity of each pure bacterial mixture was determined by a turbidimetric

technique [245] before adding them to the mixture.

Parameters Concentrations

pH 7.4 (0.14)

Electrical conductivity 3.7 (0.12) ds m-1

Oil contents* 46.8 (1.6) g kg-1 soil

Total carbon 50.2 (2.5) g kg-1 soil

Total nitrogen 2.3 (0.04) g kg-1 soil

Available phosphorus 0.2 (0.02) mg kg-1 soil

Available nitrogen 0.2 (0.02) g kg-1 soil

Potassium 0.1 (0.01) g kg-1 soil

Sodium 1.2 (0.06) g kg-1 soil

Clay 26.5%

Silt 19.7%

Sand 53.8%


75

5.2.3 L. fusca and B. mutica

L. fusca can be easily proliferated through stem cutting, seed, rhizomes, or root stumps.

The grass can propagate to a pinnacle of 1-1.5 meters with a great leaf production

percentage. The grass cultivates healthy for the period of March to September with

greatest production during rainy season. The expansion of widespread and thick fibrous

root system has been witnessed. The diffusion of roots in soil can improve organic

matter, hydraulic conductivity, and microbial activity, and [246].

B. mutica is a land-dwelling plant selected from among those that are able to

endure and propagate in the harsh climatic conditions of Pakistan. It is a perennial grass

with long, coarse stolons up to 5 m. Its reproduces generally by vegetative methods.

This fast-growing plant has been used extensively around the globe for restoration of

contaminated soils [247].

5.2.4 Experimental Design

The experimental area was separated into seven plots and further sectioned into three

equal subplots/macrocosms (length = 3 ft., width = 3 ft., height = 1 ft.). Neighboring

plots were divided with polyethylene sheeting/soil to circumvent leaching. Soil (100

kg) was added in each macrocosm equally. The experiment was conducted at ambient

conditions of temperature (average temperature 23, 27 and 32 °C in April, May, and

June, respectively). Plots were covered with plastic sheet in the case of rain.The

experiment was conducted in triplicate with Completely Randomized Design (CRD) in

each.

Seven different treatments were designed to observe 1) the effect of crude oil

contamination on plant health; 2) the influence of vegetation on degradation of crude

oil; 3) the effect of bacterial augmentation on crude oil degradation; and 4) the effect

of bacterial augmentation on crude oil degradation and plant growth.


76

a b

a

c

Figure 5-2 Experimental setup for endophyte-assisted phytoremediation of

crude oil contaminated soil in the vicinity of an oil exploration and

production company.

Vegetation of Leptochloa fusca and Brachiaria mutica (a), inoculation of endophytes

(Pseudomonas aeruginosa strain BRRI54, Acinetobacter sp. strain BRSI56, and

Klebsiella sp. LCRI87) (b), and growth of the plants after 90 days of vegetation (c).


77

Fifteen days old seedlings (100) of these two grass species with similar weight

and size were planted in each macrocosm depending upon the treatment (Fig 5-2).

Immediately after planting the seedlings, approximately 500 ml of 24 h aged inocula

(5.3×108 CFU ml-1) was applied in each macrocosm by spraying. The plants were

watered when needed and allowed to grow for 3 months (10th March-10th June, 2015).

Subsequently, plants were collected and samples of shoot and root were collected. Plant

biomass was detected. After harvesting, the soil of each macrocosm was collected and

thoroughly mixed as bulk non-rhizospheric soil. Rhizosphere soil was attained by

gentle collection of the soil loosely present on roots. Samples were taken to laboratory

and put in storage at -80 °C till further analysis.

Table 5.2 Experimental design of field experiment

5.2.5 Quantification of Inoculated Strains

The survival of inoculated strains in the non-rhizosphere soil, rhizosphere soil, root and

shoot samples was determined as mentioned in Chapter 2, Section 2.15.

5.2.6 Quantification of Abundance and Expression of alkB Gene

Rhizosphere soil was used for the extraction of DNA with the help of FastDNA Spin

Kit for soil (Qbiogene), however FastRNA Pro Soil-Direct Kit (MP Biochemicals) was

used for the isolation of RNA, and were measured photometrically (Nanodrop ND-

Sr. No. Treatments Experimental design

1 Treatment-1 Agricultural (uncontaminated) soil with vegetation

2 Treatment-2 Crude oil-contaminated soil without vegetation

3 Treatment-3 Crude oil-contaminated soil with endophytes



and endophytes



and endophytes


78

1000, Nanodrop Technologies, Wilmington, DE, USA). Plant DNA and RNA were

isolated using the DNeasy Plant Mini Kit and RNeasy Plant Mini Kit (Qiagen),

respectively. Reverse transcription was accomplished with RNA (10-20 ng), the

specific primer alkB-3f and Superscript II Reverse Transcriptase (Invitrogen). Gene’s

(alkB) persistence and expression of gene was calculated by real-time PCR using an

iCycler IQ (Bio-Rad). Standards for qPCR were generated as designated in Chapter 2,

Section 2.10.2.

5.2.7 Crude Oil Analysis in Soil

Soil samples were assessed gravimetrically to determine the remaining crude oil. The

details of method are mentioned in Chapter 2, Section 2.14.

5.2.8 Seed Germination Bioassay for Toxicity Evaluation

Seed germination bioassay was performed with wheat (Triticum aestivum L.), to assess

the toxicity of soil under different treatments. Wheat was selected for this bioassay

because of its agriculture importance and chemical sensitivity. The agricultural

uncontaminated (control) and treated soil (300 g) was put in 180 mm diameter petri

plates and 20 seeds of wheat were placed with equal distance. Seeds were exposed to

12 h light/dark cycles at room temperature (varied from 23 to 25 °C). Soil was kept

moist (50% water holding capacity) by spraying the soil surface with sterilized water.

Seed germination, and root and shoot length were measured after 72 h. The germination

index (GI%) was calculated using below mentioned ormula:

GI% =Gs×Ls

Gc×Lc× 100 … … …(5-1)

Where Gs and Gc are numbers of germinated seeds in the treated and control

(uncontaminated agricultural) soil, separately, and Ls and Lc are the average of root

length in the treated and control soil, respectively [248, 249].

5.2.9 Statistical Analysis

Statistix Version 8.1 (Statistix, Tallahasee, Florida, USA) was used for investigating

the root and shoot length, and plant biomass data. The data (triplicates of each

treatment) was exposed to Analysis of Variance (ANOVA) and post-hoc Tukey test for

multiple comparisons.


79

5.3 Results

5.3.1 Effect of Crude Oil-Contamination and Endophytes Inoculation

on Plant Growth

Growth measurements (root/shoot height, and root and shoot biomass) were estimated

to assess the influence of hydrocarbon pollution and bacterial application on vegetation

(Fig. 5-3a & b). Oil contamination in soil significantly (p < 0.05) reduced root length

(37-46%), shoot length (30-34%), root dry weight (35-39%), and shoot dry weight (37-

39%) than the plants grown in uncontaminated soil. Between the two grasses, crude oil-

contamination inhibited more root and shoot growth (dry weight and length) of L. fusca

than B. mutica. However, endophytes augmentation improved root length (33-39%),

shoot length (18-27%), root dry weight (28-34%), and shoot dry weight (29-31%) of

both grasses. Endophytes augmentation exhibited more increase in root height (6%),

shoot height (9%), root dry mass (6%) and stem dry mass (2%) of B. mutica than L.

fusca.

5.3.2 Hydrocarbon Degradation

The initial crude oil concentration in the soil was 46.8 ± 1.6 g oil kg-1 soil. Very minor

reduction (12%) of crude oil was detected in the control soil (unvegetated and without

endophytes augmentation) (Fig. 5-4). The augmentation of unvegetated soil with

endophytes exhibited 40% crude oil degradation. Only vegetation reduced crude oil

concentration in the soil from 51 to 61%, it was significantly (p < 0.05) higher when

compared to the sole use of bacterial augmentation. B. mutica exhibited more (10%)

crude oil degradation than L. fusca. Maximum crude oil degradation (78-85%) was

observed by the plants inoculated with endophytes; it was significantly higher than what

was observed for plants and bacteria individually. The combined use of B. mutica and

endophytes exhibited 7% more crude oil degradation than the combined use of L. fusca

and endophytes. A positive correlation (r = 0.71) was observed between bacterial

colonization and crude oil removal.


80

Figure 5-3 Effect of crude oil contamination and endophytes

(Pseudomonas aeruginosa strain BRRI54, Acinetobacter sp.

strain BRSI56, and Klebsiella sp. LCRI87) inoculation on root

and shoot length (a) and fresh and dry weight (b) of L. fusca

and B. mutica.

Values with same letters (a, b, c, d, e, f, g, h) are not significantly

different at a 5% level of significance. Treatment comparisons were

performed by one-way analysis of variance (ANOVA). Error bars

indicate standard error of three replicates.

c

a

c

a

f

d

f

d

e

b

e

b

0

20

40

60

80

100


Root length Shoot length

Ro

ot

an

d s

ho

ot

len

gth

(cm

)




d

a

b

a

f

c

d

c

e

b

c

b

0

10

20

30

40

50


Root biomass Shoot biomass

Pla

nt

bio

mass

(k

g)





81

Figure 5-4 Effect of vegetation of (L. fusca and B. mutica) and inoculation of

endophytes (Pseudomonas aeruginosa strain BRRI54, Acinetobacter sp.

strain BRSI56, and Klebsiella sp. LCRI87) on crude oil degradation.

Values with same letters (a, b, c, d, e and f) are not significantly different at a

5% level of significance. Comparisons between treatments were carried out by

one-way analysis of variance (ANOVA). Error bars indicate standard error of

three replicates.

5.3.3 Persistence of the Inoculated Endophytes and Expression of

alkB Gene

The ability of inoculated endophytes to persist in the unvegetated soil as well as in the

rhizosphere and endosphere of B. mutica and L. fusca was assessed using cultivation-

dependent (plate count method) and cultivation-independent (use of real-time PCR for

the quantification of abundance and transcription levels alkB gene in DNA and RNA,

respectively, extracted from soil and plant samples) approaches. The survival of the

inoculated strains was relatively lower in the soil without vegetation as compared to

soil with vegetation (Fig. 5-4). The endophytes showed more persistence in the root of

both plants than in the rhizosphere and shoot interior. Between the two tested plants,

higher numbers of the inoculated endophytes were found in the rhizosphere and

endosphere of B. mutica as compared to L. fusca.

e

d

c

a

b

a

0

20

40

60

80

100

Without

vegetation

Endophytes L. fusca L. fusca with

bacteria

B. mutica B. mutica

with bacteria

Cru

de

oil

rem

oval

(%)


82

The inoculated endophytes showed more alkB gene profusion and expression in

inoculated plant’s rhizo- and endosphere than in the unvegetated soil. Maximum alkB

gene expression and abundance were detected in the roots, which were significantly (p

< 0.05) higher than the alkB gene numbers and expression in rhizosphere and shoot

(Fig. 5-5). Moreover, greater levels of alkB gene number and expression were seen in

the rhizosphere and endosphere of B. mutica than that of L. fusca.

5.3.4 Seed Germination Bioassay and Toxicity Evaluation

The toxicity of the soil was estimated by observing the seed germination, and root and

shoot length of wheat (T. aestivum L.) vegetated in the soil after harvesting plants from

different treatments. The seeds sown in unvegetated soil with no bacterial augmentation

showed significantly (p < 0.05) less germination, root length, and shoot length than the

seeds grown in soil treated with plants and/or bacteria. More seed germination, root and

shoot length were observed in the soil treated with the plants and endophytes in

combination than in the soil treated with plants or bacteria individually. Moreover, the

soil treated with B. mutica in combination with endophytes allowed more seed

germination (8%), root length (17%), and shoot length (28%) of wheat than the soil

treated with L. fusca in the presence of endophytes. Germination index (GI) values

indicated that toxicity of the soil decreased by endophytes augmentation and vegetation

(Fig. 5-6). Maximum GI value (95%) was observed for the soil treated with B. mutica

and inoculated with endophytes.


83

Figure 5-5 Mean values of colony forming unit (CFU), abundance and

expression of alkB gene in rhizosphere, root and shoot interior of B. mutica

(a), and L. fusca (b).

Error bars represent standard error. Means followed by the same letters are not

significantly different according to post-hoc Tukey test (P < 0.05)

.

c

b

a

d

c

b

a

d

c

b

a

d

0.0E+00

4.0E+02

8.0E+02

1.2E+03

1.6E+03

2.0E+03

2.4E+03

Unvegetated soil Rhizosphere Root Shoot

CF

U/a

bu

nd

an

ce a

nd

exp

ress

ion

of

alk

Bg

ene g

-1so

il,

roo

t a

nd

sh

oo

t

CFU Gene abundance Gene expression

a

c

b

a

dcb

a

dcb

a

d

0.0E+00

4.0E+02

8.0E+02

1.2E+03

1.6E+03

2.0E+03

2.4E+03

Unvegetated soil Rhizosphere Root Shoot

CF

U/a

bu

nd

an

ce a

nd

exp

ress

ion

of

alk

Bg

ene

g-1

soil

, ro

ot

an

d s

ho

ot

CFU Gene abundance Gene expression

b


84

Table 5.3 Effect of endophytes (Pseudomonas aeruginosa strain BRRI54, Acinetobacter sp.

strain BRSI56, and Klebsiella sp. strain LCRI87) augmentation, vegetation (Leptochloa fusc

and Brachiaria mutica) and plant-endophytes partnerships on soil toxicity reduction using

wheat (Triticum aestivum L.) as a model plant

Numbers in the identical column followed by the identical letter are not significantly different at a 5% level of

significance. The standard error of each value is documented in parentheses. Comparisons among treatments were

done by ANOVA.

Treatments Germination

(%)

Root length

(cm)

Shoot length

(cm)

Untreated soil

Control (healthy soil) 85a (3) 4.31a (0.30) 4.85a (0.15)

Crude oil contaminated soil 25e (4) 1.66f (0.38) 1.30f (0.16)

Treated soil

Endophytes augmentation 35de (5) 2.60e (0.31) 3.10d (0.21)

Leptochloa fusca 40d (4) 3.13d (0.25) 3.26cd (0.32)

L. fusca with endophytes augmentation 60bc (5) 3.19d (0.72) 3.03e (0.20)

Brachiaria mutica 50c (6) 3.43c (0.32) 3.46c (0.25)

B. mutica with endophytes augmentation 65b (4) 3.86b (0.25) 4.20b (0.26)


85

Figure 5-6 Effect of vegetation (L. fusca and B. mutica) and endophytes

inoculation on the detoxification of crude oil contaminated soil.

The seed germination test was performed with wheat (Triticum aestivum L.) and

germination index (%) was calculated. Comparisons among treatments were done by

one-way analysis of variance (ANOVA). Error bars indicate standard error of three

replicate

f

e

d

b

c

a

0

20

40

60

80

100

Contaminated

soil

Endophytes L.fusca L.fusca and

endophytes

B. mutica B. mutica and

endophytes

Ger

min

ati

on

in

dex

(%

)


86

R² = 0.9888

0

20

40

60

80

100

0 2 4 6 8 10

Hy

dro

carb

on

deg

rad

ati

on

(%

)

Gene expression × 103

R² = 0.7138

0

20

40

60

80

100

0 5 10 15 20

Cru

de

oil

deg

rad

ati

on

(%

)

CFU × 105

R² = 0.9794

0

2

4

6

8

10

0 20 40 60 80 100 120

Gen

e ex

pre

ssio

n ×

10

3

Gene abundance × 103

b

a

Figure 5-7 Correlation between crude oil degradation

(%) and colony forming units (CFU) (g-1 dry weight of

soil) (a), gene abundance (copies of alkB g-1 dry weight

of soil) and gene expression (transcripts level of alkB

gene g-1 dry weight of soil) (b), and gene expression and

crude oil degradation (%) (c).


87

5.4 Discussion

Crude oil-contamination in soil inhibited plant growth and biomass production [234].

The primary inhibiting factors includes toxic nature of low molecular weight

compounds. Hydrophobicity also limit the mobility of water and nutrients to plants

[250-252]. This study showed that in the soil contaminated with crude oil, both L. fusca

and B. mutica showed considerably a reduced amount of root and shoot height and

biomass as compared to plants grown in uncontaminated soil (Fig. 5-3a & b). However,

endophytic bacterial inoculation improved plant growth and biomass production. This

might be due to the plant growth-promotion and ACC-deaminase activities of the

inoculated endophytes. In principle, bacterial ACC deaminase activity reduces the

contaminant induced stress symptoms in developing plants and improves plant health

and development [19, 20, 23, 63].

Unvegetated soil without endophytes inoculation showed less reduction (12%)

of crude oil (Fig. 5-4) as compared to inoculated and vegetated soil. This might be due

to degradation of crude oil by indigenous microorganisms and/or physicochemical

processes (e.g. soil adsorption, volatilization or photo-oxidation of hydrocarbons) [232,

253]. The inoculation of endophytes in the unvegetated soil resulted in 40% reduction

in oil concentration. Several earlier studies also demonstrated that bacterial consortia

containing Pseudomonas sp., Acinobactor sp. and Klebsiella sp. strains degrade crude

oil present in soil [218, 252, 254]. Crude oil is a combination of alkanes and other

combinations, so the consortia of different bacterial strains could work more efficiently

than the sole use of bacteria [254]. However, vegetation in contaminated soil resulted

in 51 and 61% of crude oil degradation by L fusca and B. mutica, respectively, and this

degradation was significantly (p < 0.05) higher than sole bacterial augmentation. Plants

can remove organic pollutants from soil through different mechanisms including

phytoextraction in which plant directly uptake oil components from soil resulting in

sequestration and degradation of pollutants inside the plant [255]. Moreover, vegetation

can enhance the mineralization of hydrocarbons by stimulating indigenous microbial

population to degrade organic pollutants [25, 234, 241, 256]. The maximum crude oil

reduction (85%) was achieved with the endophytes inoculated plants of B. mutica,

which was higher than that found with uninoculated plants. This improved crude oil

degradation was possibly the result of persistence and metabolic events of the

inoculated endophytes in the plant environment. In an earlier study, where Italian


88

ryegrass was grown for 152 days in a diesel-spiked soil (1.8%), hydrocarbons contents

were decreased to 58% of the initial value [257].

In the past few years it has been apprehended to investigate the toxicity and

status of remediated soil [258]. The seeds of wheat sown in crude oil contaminated soil

without vegetation and endophytes augmentation exhibited significantly (p < 0.05) less

growth shoot and root height than the seeds sown in contaminated soil treated using

plants and bacteria (Table 5.3). These outcomes are similar with earlier conclusions,

which reported that the germination of seed, root and shoot growth of Sorghum bicolor

was highly affected by crude oil contamination in soil [248]. The reduction of

germination could be due to damaging of the germinating seeds by the oil or due to

reduction of gaseous exchange by the oil which can lead to death of the seeds. In present

study, seed germination, root and shoot length were significantly (p < 0.05) increased

in soil that was vegetated and/or inoculated with endophytes and maximum values for

these parameters were observed in soil treated with plant-endophyte partnership. In an

earlier study, the collective usage of vegetation and endophytes reduced pollutants level

in soil and also promoted seed development and root and shoot improvement [259].

Many other studies also demonstrated that the inoculation of endophytic bacteria

degrade the organic pollutants and lessen the harmfulness of soil [63, 260, 261].

Inoculated bacteria showed not only colonization but also expressed alkane

degrading genes demonstrating their dynamic character in the mineralization of crude

oil (Fig. 5-5a & b). Contrary to the high abundance (alkB gene copy number) and

activity (alkB gene expression) of the endophytes in the vegetated soil, rather less

survival and activity were seen in the unvegetated soil. It reveals that vegetation

improved the persistence and activity of the endophytes in the soil. Vegetation offers

nutrients and habitat to their associated microorganisms and ultimately the numbers of

pollutant-degrading microorganisms are increased in the rhizosphere and endosphere

[22, 63, 262].

Interestingly, greater levels of alkB gene abundance and expression were seen

in the roots of both plants than in the rhizosphere soil and shoot interior. This might be

due to the reason that these bacteria were endophytic and could colonize more

efficiently in the endosphere of plant than rhizosphere. Previous studies also described

that inoculated endophytes exhibit better persistence and activity in the root than in the


89

rhizosphere soil and shoot interior [46, 118, 263]. The abundance of gene (alkB)

exhibited positive relationship (r = 0.97) with gene expression (Fig. 5-7). Similarly, a

positive correlation (r= 0.9) was also observed between gene expression and

hydrocarbon removal. During the phytoremediation of hydrocarbon-contaminated soil,

strong positive relationships have been reported previously between hydrocarbon

degradation, gene abundance, and gene expression [118, 234].

90

6 General Discussion

Due to rapid industrialization and increasing anthropogenic activities, contamination of

soil and groundwater with crude oil poses a serious threat to health of humans, animals

and plants [264, 265]. Plants can be used to remove, sequester or decontaminate

hydrocarbon pollutants present in soil and water. But, different plant species are not

equally suitable for microbe-assisted phytoremediation; in which they ideally show

better growth and produce significant biomass in crude oil-contaminated soil [257, 266,

267]. The major reasons behind the inhibited growth of plants in hydrocarbon polluted

soil are toxic and hydrophobic nature of PHs. Hydrophobicity can change the water/soil

interfaces that would generally happen, thus affecting aeration, uptake of water, and

mobility of nutrient to plants [268, 269]. In this study, the analysis of phytotoxicity

assay revealed that different plants species showed considerable growth variations in

crude oil-contaminated soil. Among 27 tested plants, three grasses (L. perenne, L. fusca,

and B. mutica), and two trees (A. ampliceps and L. leucocephala) were least effected

by crude oil-contamination in soil, and created additional biomass than other plants

vegetated in crude oil-contaminated soil (Table 3.1). Therefore, it suggested that these

plants might have developed PHs tolerant approaches which enable them to detoxify

hydrocarbons so as to survive and grow in oil-contaminated soils [270].

In this study, the plant species, L. perenne, L. fusca, B. mutica, A. ampliceps and

L. leucocephala, not only showed tolerance towards crude oil but also hosted different

oil degrading rhizo- and endophytes (Table 3.1). Higher numbers of bacteria were

isolated from the root, rhizosphere, and shoot of L. perenne (29.72%), B. mutica

(24.32%) and L. fusca (21.62%) as compared to A. ampliceps and L. leucocephala. It

has been reported that grasses can host a large number of microorganisms due to their

extensive root system provided that a large surface area for microbial establishment

[271, 272]. In this study, we found that hydrocarbon-degrading bacteria belong to eight

different genera. Among them, Bacillus, Acinetobacter and Pseudomonas were

frequent colonizers of the rhizosphere of grasses and trees. Generally, endophytic

bacteria were different from rhizospheric bacteria and more bacteria were found in

Chapter 6 General Discussion

91

rhizosphere and root interior as compared to aerial parts of both plants. The fact that a

higher number of bacterial endophytes were isolated from root as compared to shoot. It

supports the notion that the number of the bacterial population drops with the expanse

from their points such as root tip and/or the spot of the development of lateral roots

[21]. Previous studies have also shown that roots release nutrients and organic

compounds in the form of exudates that facilitate microbial growth in rhizosphere and

inside roots [273, 274].

In present work, selected 37 isolates were capable to grow on crude oil but the

highest (78%) of crude oil degradation was shown by Acinetobacter spp. strain BRSI56

and Pseudomonas aeruginosa strain BRRI54 (Fig. 3-1). Acinetobacter species are

universally dispersed in the environment even isolated from oil-polluted soils and water

where they utilize crude oil as only source of energy [275]. Crude oil consists of various

types of alkanes, aromatic compounds and other substrates [276]. In present study, the

growth of Pseudomonas aeruginosa strain BRRI54 and Acinetobacter sp. strain

BRSI56 on crude oil confirmed that these strains could utilize a broad range of

hydrocarbons for their growth. It was also observed that amongst different hydrocarbon

substrates, straight chain alkanes were the most degradable fractions while aromatic

hydrocarbons were the most recalcitrant. Previous reports also indicated that

hydrocarbons having short chain length (C8-C16) can easily be degraded by most

bacteria when compared to degradation of PAHs [277, 278]. This investigation showed

that Acinetobacter sp. strain LCRH81, was able to utilize various hydrocarbon

substrates even some aromatics. Acinetobacter species strains, able to utilize alkanes

with longer chain lengths (C10 to C44) and aromatics have been described earlier [276].

Some strains although showed growth on crude oil but could not utilize any of the tested

alkanes probably due to the reason that differences in hydrocarbon structure and chain-

length which require different degradative enzymes can also hinder the biodegradation

process [279].

Experimental findings from different research reports revealed that the

degradation of crude oil depend on catabolic genes of hydrocarbon utilizing bacteria

and chemical composition of crude oil [174, 202, 280]. Bacterial hydrocarbon

degradation takes place through complex array of redox mechanisms, which are

catalyzed by set of enzymes such as monooxygenases and dioxygenases. In bacteria


92

these enzymes are encoded by alkB/ alkM and CYP 153 genes [46, 234]. In this study,

majority of the bacterial strains showed potential to degrade crude oil and

hydrocarbons, only 54.05% of them possessed alkB and CYP153 genes. This suggests

that the genes or the mechanism involved in hydrocarbon degradation in bacteria

associated with plants might be different so different set of degenerate primers may be

used for the amplification of genes involved in the phenomenon.

The beneficial effects of rhizospheric and endophytic bacteria on their host plant

have been widely described [20, 151, 281]. This study reveals that many of the isolated

rhizospheric and endophytic bacterial strains showed the in vitro PGP activities or

mechanisms that are behind in plant growth advancement (Table 3.5). It might be one

of the main reasons of the persistence and growth of the five selected plants (L. perenne,

L. fusca, and B. mutica), and two trees (A. ampliceps and L. leucocephala) in oil

polluted soil. Most of the strains showed the ability to produce IAA and ACC

deaminase, and both these mechanisms are more common among the hydrocarbon-

degrading bacteria. One strain, Klebsiella sp. LCRI87, exhibited multiple PGP

activities such as P/Znsolubilization, ACC deaminase, IAA, and production of

siderophore. Earlier studies shows that ACC deaminase shows a chief role in plant-

bacteria partnerships especially under stress conditions including oil-contamination

[109, 282]. This bacterial ACC deaminase enzyme adjusts ethylene concentartions in

plants and consequently contributes to the improved development of root.

Microbial biofilms are highly efficient and successful ecological communities

that may contribute in remediation of oil-contaminated soils [66, 211, 256]. In this

study, CLSM analysis indicated that yfp transformed bacterial strains, Pseudomonas

aeruginosa BRRI54 and Acinetobacter sp. BRSI56, were able to form biofilm on solid

substratum; the capability appeared to be maximum in the close proximity of oil-water

interface (Fig. 4-3 & 4-4). Several previous studies have also demonstrated that

hydrocarbon-degrading microbes can accumulate in the vicinity of oil and other

pollutants and efficiently evade the limitation of low bioavailability of hydrocarbons in

remediation process [66, 224, 283-285].

Successful root colonization by hydrocarbon-degrading bacteria is an essential

criterion to ensure beneficial effects of bacteria on phytoremediation process [286,

287]. CLSM observations also showed the endophytic strains, Acinetobacter sp.


93

BRSI56 and Pseudomonas aeruginosa BRRI54, colonized in the close vicinity of roots

of inoculated plants, L. fusca and B. mutica. Bacterial cells were visualized as single

cell as well as aggregated colonies on the rhizoplane that later on colonized the interior

of the root and stem cells. Earlier reports corroborate this translocation of bacteria by

indicating that bacteria are able to translocate through the xylem vessels from roots to

stem of the host plant via transpiration flow or by colonizing intercellular spaces [25,

152, 213]. In this study, observations under CLSM provided the proof of strong

association between tested bacteria and root system of both grasses (L. fusca and B.

mutica).

In green house experiment of this research work, a significant reduction in

biomass of both plants (L. fusca and B. mutica) was caused by the presence of crude oil

in soil (Fig. 4-7b) which can be attributed to the toxic compounds present in crude oil,

especially low molecular weight components. Hydrocarbons can alter soil properties

because of their hydrophobicity, which may affect availability of nutrient/water and,

therefore, in plant growth [3, 11]. However, inoculation of endophytes (Pseudomonas

aeruginosa strain BRRI54 and Acinetobacter sp. strain BRSI56) with ability to degrade

crude oil along with PGP traits showed potential to increase growth of both grasses (L.

fusca and B. mutica) as compared to uninoculated (control) plants. It might be because

of the crude oil-degrading and ACC deaminase secretion of the augmented bacteria.

ACC deaminase activity decreases stress-induced ethylene and improve adaptation of

plants and growth in contaminated environments [109].

In present work, the inoculation of bacteria in combination with L. fusca and B.

mutica resulted in 71 and 78% of crude oil degradation, respectively, and this

degradation was significantly higher than either sole bacterial augmentation or

vegetation. These findings are similar with former reports that plant-bacteria

association is a more effective method for the clean-up of soil contaminated with

petroleum hydrocarbons than vegetation or microbial augmentation alone [20, 80]. In

this study, un-inoculated and un-vegetated soil showed lower reduction (40%) of crude

oil as compared to inoculated and vegetated soil (Fig. 4-8). This degradation of crude

oil is performed by native microbes and/or natural physicochemical processes (e.g.,

volatilization or photo-oxidation) [109, 217, 220].


94

Field experiment was executed in the surrounding area of an oil exploration and

drilling company. This company is situated in chakwal district. This study showed that

in the soil contaminated with crude oil, both L. fusca and B. mutica showed significantly

lesser biomass, root and shoot length than the plants grown in uncontaminated soil (Fig.

5-3 a & b). However, endophytic bacterial augmentation in the form of consortium had

a positive effect on both plants. Un-vegetated soil without endophytes augmentation

showed less reduction (12%) of crude oil as compared to inoculated and vegetated soil.

Only bacterial augmentation in soil enhanced crude oil degradation (40%) and it was

significantly higher than in the soil without bacterial augmentation. Several earlier

studies also demonstrated that the augmentation of soil with hydrocarbon-degrading

bacterial strains, harbouring broad enzymatic capacities, can degrade hydrocarbons

efficiently [217, 220, 266, 288]. However, vegetation in contaminated soil resulted in

51 and 61% of crude oil degradation by L fusca and B. mutica, respectively, and this

degradation was significantly (p < 0.05) higher than sole bacterial augmentation. Plants

can remove organic pollutants from soil through different mechanisms including

phytoextraction in which plant directly uptake oil components from soil resulting in

sequestration and degradation of the pollutants inside the plant [289, 290]. The

maximum crude oil reduction (85%) was achieved with the bacterial inoculated plants

of B. mutica, which was far higher than those obtained with un-inoculated plants.

Maximum crude oil degradation was probably the consequence of survival and

functional activity of the inoculated bacteria. In previous study, where Italian ryegrass

was grown for 3 months in a diesel-contaminated soil, hydrocarbons contents were

reduced to 58% of the original value [168].

In present investigations, quantitative analysis by qPCR revealed that inoculated

strains expressed alkB gene in rhizosphere, root and shoot of both plants. In green house

and field experiment, contrary to the high abundance and activity of the inoculated

bacteria in vegetated soil, rather less persistence and activity were seen in unvegetated

soil. This indicates that vegetated soils support bacterial population and diversity. This

might be due to the rhizodeposits that are utilized by bacteria as carbon and energy

source [291, 292]. Furthermore, higher persistence of inoculated endophytes was

observed in root interior and rhizosphere as compared to shoot interior of both grasses.

Similarly, for both inoculants, abundance and expression of alkB gene was higher in


95

the roots of both plants as compared to the rhizosphere and shoot interior. This might

be because of the reason that these bacteria were endophytes and could colonize more

proficiently in plant endosphere than rhizosphere. Previous findings also described that

inoculated endophytes exhibited better persistence and activity in the root as compared

to rhizosphere and shoot interior [118]. In this study, the abundance of gene (alkB)

exhibited positive relationship (r = 0.97) with gene expression. Similarly, a positive

correlation (r = 0.7) was also witnessed between hydrocarbon removal and gene

expression. During the phytoremediation of hydrocarbon-contaminated soil, strong

positive relationships have been reported previously between hydrocarbon degradation,

gene abundance, and gene expression [118, 280].

In the previous couple of years, it has been realized to evaluate the

health/condition of remediated soil. In this thesis research work, the seeds of wheat

sown in untreated crude oil-contaminated soil showed considerably (p < 0.05) less

germination and root and shoot length than the seeds sown in the contaminated soil

treated with plants and/ or bacteria. Various earlier findings reported that the seed

germination and growth of Sorghum bicolor was highly affected by crude oil

contamination in soil [293]. The reduction in seed germination and seedlings growth

might be due to the hydrophobicity of hydrocarbons. Hydrocarbons may act as a

physical obstacle around the seeds, thus preventing or reducing both oxygen and water

uptake [294]. In this work, seed germination, root and shoot length were significantly

(p < 0.05) increased in soil that was treated with plants/bacteria and maximum values

for these parameters were observed in soil treated with plant-endophyte partnership.

Many other studies also demonstrated that the augmentation of endophytic bacteria

degraded the organic pollutants and lessen the harmfulness of soil [293, 295]. On the

basis of our findings it can be concluded that the use of bacteria in combination with

grasses is more promising approach than the sole use of plants and bacteria. For

practical applications, the importance of plant type should also be considered in the

design of efficient phytoremediation applications.

Future prospects

Soil contamination might increase in future due to rapid population growth and

consequently a boost in industrialization, urbanization and intensive agriculture world-


96

wide. To alleviate the harsh effects of soil contamination by organic chemicals,

phytoremediation might be an effective and affordable approach to clean-up polluted

soils. However, various aspects still need to be investigated to make this technology

successful. In particular, consideration should be paid to following aspects:

The exploitation of plant-endophyte associations for the restoration of polluted

groundwater and soils is a favorable area. During phytoremediation of organic

pollutants, endophyes containing the suitable degradation pathway(s) can help

their host by degrading toxins that are eagerly taken up by plants.

To investigate the whole microbial diversity in a particular environment, the

isolation and identification of microorganisms is not an appropriate technique.

The modern metagenomic approach facilitate scientists to analyze the entire

microbial popoulation, and the genetic ability for the active metabolic ways

present in a specified location. This procedure is particularly effective for the

study of the micobial population and whole genome examination of composite

environmental samples where microbes cannot be cultivated under normal

laboratory conditions.

97

7 References

[1] C. R. Kuske, L. O. Ticknor, M. E. Miller, J. M. Dunbar, J. A. Davis, S. M.

Barns, and B. Jayne, "Comparison of soil bacterial communities in rhizospheres

of three plant species and the interspaces in an arid grassland," Appl. Environ.

Microbiol., vol. 68, no. 4, pp. 1854-1863, 2002.

[2] M. Alexander, "Introduction to Soil Microbiology," Soil Sci., vol. 125, no. 5, p.

331, 1978.

[3] A. B. Reda and T. Ashraf, "Optimization of bacterial biodegradation of toluene

and phenol under different nutritional and environmental conditions," J. Appl.

Sci. Res., vol. 6, no. 7, pp. 1086-1095, 2010.

[4] M. Balba, N. Al-Awadhi, and R. Al-Daher, "Bioremediation of oil-

contaminated soil: Microbiological methods for feasibility assessment and field

evaluation," J. microbiol. Methods, vol. 32, no. 32, pp. 155-164, 1998.

[5] V. Andreoni, L. Cavalca, M. Rao, G. Nocerino, S. Bernasconi, E. D. Amico, M.

Colombo, and L. Gianfreda, "Bacterial communities and enzyme activities of

PAHs polluted soils," Chemosphere, vol. 57, no. 5, pp. 401-412, 2004.

[6] K. Srogi, "Monitoring of environmental exposure to polycyclic aromatic

hydrocarbons: A review," Environ. Chem. Lett., vol. 5, no. 4, pp. 169-195,

2007.

[7] J. Pinedo, R. Ibanez, J. Lijzen, and A. Irabien, "Assessment of soil pollution

based on total petroleum hydrocarbons and individual oil substances," J.

Environ. Manage., vol. 130, no. 130, pp. 72-79, 2013.

[8] I. Tolosa, S. D. Mora, M. R. Sheikholeslami, J. P. Villeneuve, J. Bartocci, and

C. Cattini, "Aliphatic and aromatic hydrocarbons in coastal Caspian Sea

sediments," Marine Pollut. B., vol. 48, no. 1, pp. 44-60, 2004.

[9] E. Brevik, A. Cerdà, J. M. Solera, L. Pereg, J. Quinton, J. Six, "The

interdisciplinary nature of soil," Soil, vol. 1, no. 1, p. 117, 2015.

[10] R. Siddiqui, "Energy and economic growth in Pakistan," Pak. Dev. Rev., vol.

43, no. 2, pp. 175-200, 2004.

[11] A. Aqeel and M. S. Butt, "The relationship between energy consumption and

economic growth in Pakistan," Asia-Pacific Devel. J., vol. 8, no. 2, pp. 101-110,

2001.

[12] A. Janbandhu and M. Fulekar, "Biodegradation of phenanthrene using adapted

microbial consortium isolated from petrochemical contaminated environment,"

J. hazard. Mater., vol. 187, no. 1, pp. 333-340, 2011.

Chapter 7 References

98

[13] A. Sebiomo, S. Bankole, and A. Awosanya, "Determination of the ability of

microorganisms isolated from mechanic soil to utilise lubricating oil as carbon

source," Afr. J. Microbiol. Res., vol. 4, no. 21, pp. 2196-2201, 2010.

[14] R. C. Prince, K. M. McFarlin, J. D. Butler, E. J. Febbo, F. C. Wang, and T. J.

Nedwed, "The primary biodegradation of dispersed crude oil in the sea,"

Chemosphere, vol. 90, no. 2, pp. 521-526, 2013.

[15] L. W. Robertson and L. G. Hansen, PCBs: Recent Advances in Environmental

Toxicology and Health Effects, 4th edition. USA: The University Press of

Kentucky, 2015.

[16] B. Ordinioha and S. Brisibe, "The human health implications of crude oil spills

in the Niger delta, Nigeria: An interpretation of published studies," Niger. Med.

J., vol. 54, no. 1, pp. 10-16, 2013.

[17] F. Aguilera, J. Méndez, E. Pásaro, and B. Laffon, "Review on the effects of

exposure to spilled oils on human health," J. Appl. Toxicol., vol. 30, no. 4, pp.

291-301, 2010.

[18] V. C. Pandey, P. Abhilash, and N. Singh, "The Indian perspective of utilizing

fly ash in phytoremediation, phytomanagement and biomass production," J.

Environ. Manage., vol. 90, no. 10, pp. 2943-2958, 2009.

[19] N. Weyens, D. V. Lelie, S. Taghavi, and J. Vangronsveld, "Phytoremediation:

Plant-endophyte partnerships take the challenge," Curr. Opin. Biotechnol., vol.

20, no. 2, pp. 248-254, 2009.

[20] S. Khan, M. Afzal, S. Iqbal, and Q. M. Khan, "Plant-bacteria partnerships for

the remediation of hydrocarbon contaminated soils," Chemosphere, vol. 90,

no.4, pp. 1317-1332, 2013.

[21] Q. Chaudhry, M. Blom-Zandstra, S. K. Gupta, and E. Joner, "Utilising the

synergy between plants and rhizosphere microorganisms to enhance breakdown

of organic pollutants in the environment," Environ. Sci. Pollut. Res., vol. 12,

no. 1, pp. 34-48, 2005.

[22] S. Compant, C. Clement, and A. Sessitsch, "Plant growth-promoting bacteria in

the rhizo-and endosphere of plants: Their role, colonization, mechanisms

involved and prospects for utilization," Soil Biol. Biochem., vol. 42, no. 5, pp.

669-678, 2010.

[23] B. R. Glick, "Using soil bacteria to facilitate phytoremediation," Biotechnol.

Adv., vol. 28, no. 3, pp. 367-374, 2010.

[24] A. Sessitsch, M. Kuffner, P. Kidd, J. Vangronsveld, W. W. Wenzel, K.

Fallmann, and M. Puschenreiter, "The role of plant-associated bacteria in the

mobilization and phytoextraction of trace elements in contaminated soils," Soil

Biol. Biochem., vol. 60, no. 2, pp. 182-194, 2013.


99

[25] M. Afzal, Q. M. Khan, and A. Sessitsch, "Endophytic bacteria: Prospects and

applications for the phytoremediation of organic pollutants," Chemosphere, vol.

117, no. 1, pp. 232-242, 2014.

[26] S. Chandra, R. Sharma, K. Singh, and A. Sharma, "Application of

bioremediation technology in the environment contaminated with petroleum

hydrocarbon," Ann. Microbiol., vol. 63, no. 2, pp. 417-431, 2013.

[27] J. G. Speight, The Chemistry and Technology of Petroleum, 5th edition. USA:

Taylor and Francis, 2014.

[28] R. T. Bachmann, A. C. Johnson, and R. G. Edyvean, "Biotechnology in the

petroleum industry: An overview," Int. Biodeter. Biodegr., vol. 86, no. 3, pp.

225-237, 2014.

[29] F. Abbasian, R. Lockington, M. Mallavarapu, and R. Naidu, "A comprehensive

review of aliphatic hydrocarbon biodegradation by bacteria," Appl. Biochem.

Biotechnol., vol. 176, no. 3, pp. 670-699, 2015.

[30] S. Gan, E. Lau, and H. Ng, "Remediation of soils contaminated with polycyclic

aromatic hydrocarbons (PAHs)," J. Hazard. Mater., vol. 172, no. 2, pp. 532-549,

2009.

[31] E. C. Souza, T. C. Vessoni-Penna, and R. P. de Souza Oliveira, "Biosurfactant-

enhanced hydrocarbon bioremediation: An overview," Int. Biodeter. Biodegr.,

vol. 89, no. 1, pp. 88-94, 2014.

[32] C. H. Walker, R. Sibly, S. Hopkin, and D. B. Peakall, Principles of

Ecotoxicology, 4th edition, USA: Taylor and Francis, 2012.

[33] J. Albaigés, Ecotoxicology: Effects of Pollutants on the Natural Environment,

2014 edition, USA: Taylor Francis, 2014.

[34] S. J. Varjani and V. N. Upasani, "Biodegradation of petroleum hydrocarbons by

oleophilic strain of Pseudomonas aeruginosa NCIM 5514," Bioresour.

Technol., vol. 222, no. 32, pp. 195-201, 2016.

[35] J. P. Salanitro, "Bioremediation of petroleum hydrocarbons in soil," Adv.

Agron., vol. 72, no. 1, pp. 53-105, 2001.

[36] R. M. Atlas, "Microbial degradation of petroleum hydrocarbons: An

environmental perspective," Microbiol. Rev., vol. 45, no. 1, p. 180, 1981.

[37] A. A. Al-Majed, A. R. Adebayo, and M. E. Hossain, "A sustainable approach

to controlling oil spills," J. Environ. Manage., vol. 113, no. 3, pp. 213-227,

2012.

[38] G. Wu and F. Coulon, "Modelling the Environmental Fate of Petroleum

Hydrocarbons During Bioremediation," in Hydrocarbon and Lipid

Microbiology Protocols, DE: Springer, 2016. pp. 165-180.

[39] Y. Huang, J. Wei, J. Song, M. Chen, and Y. Luo, "Determination of low levels

of polycyclic aromatic hydrocarbons in soil by high performance liquid


100

chromatography with tandem fluorescence and diode-array detectors,"

Chemosphere, vol. 92, no. 8, pp. 1010-1016, 2013.

[40] S. Li, U. Turaga, B. Shrestha, T. A. Anderson, S. Ramkumar, M. J. Green, S.

Das, and J. E. Canas-Carrell, "Mobility of polyaromatic hydrocarbons (PAHs)

in soil in the presence of carbon nanotubes," Ecotoxicol. Environ. Saf., vol. 96,

no. 2, pp. 168-174, 2013.

[41] S. Kuppusamy, T. Palanisami, M. Megharaj, K. Venkateswarlu, and R. Naidu,

"Ex-situ Remediation Technologies for Environmental Pollutants: A Critical

Perspective," in Reviews of Environmental Contamination and Toxicology,

SUI: Springer, 2016. pp. 117-192.

[42] F. Z. Ferradji, S. Mnif, A. Badis, S. Rebbani, D. Fodil, K. Eddouaouda, and S.

Sayadi, "Naphthalene and crude oil degradation by biosurfactant producing

Streptomyces spp. isolated from Mitidja plain soil (North of Algeria)," Int.

Biodeter. Biodegr., vol. 86, no. 3, pp. 300-308, 2014.

[43] M. T. Bao, L. N. Wang, P. Y. Sun, L. X. Cao, J. Zou, and Y. M. Li,

"Biodegradation of crude oil using an efficient microbial consortium in a

simulated marine environment," Marine Pollut. B., vol. 64, no. 6, pp. 1177-

1185, 2012.

[44] B. Chen, M. Yuan, and L. Qian, "Enhanced bioremediation of PAH-

contaminated soil by immobilized bacteria with plant residue and biochar as

carriers," J. Soils Sedim., vol. 12, no. 9, pp. 1350-1359, 2012.

[45] M. Afzal, S. Yousaf, T. G. Reichenauer, and A. Sessitsch, "The inoculation

method affects colonization and performance of bacterial inoculant strains in

the phytoremediation of soil contaminated with diesel oil," Int. J. Phytorem.,

vol. 14, no. 1, pp. 35-47, 2012.

[46] M. Afzal, S. Yousaf, T. G. Reichenauer, M. Kuffner, and A. Sessitsch, "Soil

type affects plant colonization, activity and catabolic gene expression of

inoculated bacterial strains during phytoremediation of diesel," J. Hazard.

Mater., vol. 186, no. 2, pp. 1568-1575, 2011.

[47] P. Abhilash, J. R. Powell, H. B. Singh, and B. K. Singh, "Plant-microbe

interactions: Novel applications for exploitation in multipurpose remediation

technologies," Trends Biotechnol., vol. 30, no. 8, pp. 416-420, 2012.

[48] P. Abhilash and M. Yunus, "Can we use biomass produced from

phytoremediation?" Biomass Bioenerg., vol. 35, no. 3, pp. 1371-1372, 2011.

[49] S. Banwart, "Save our soils," Nature, vol. 474, no. 3530, pp. 151-152, 2011.

[50] M. E. Hodson, "The need for sustainable soil remediation," Elements, vol. 6,

no. 6, pp. 363-368, 2010.

[51] B. K. Singh, "Organophosphorus-degrading bacteria: Ecology and industrial

applications," Nature Rev. Microbiol., vol. 7, no. 2, pp. 156-164, 2009.


101

[52] E. Z. Ron and E. Rosenberg, "Enhanced bioremediation of oil spills in the sea,"

Curr. Opin. Biotechnol., vol. 27, no. 4, pp. 191-194, 2014.

[53] M. Hassanshahian, G. Emtiazi, and S. Cappello, "Isolation and characterization

of crude oil-degrading bacteria from the Persian Gulf and the Caspian Sea,"

Marine Pollut. B., vol. 64, no. 1, pp. 7-12, 2012.

[54] V. P. Beskoski, S. Miletic, M. Ilic, G. G. Cvijovic, P. Papic, N. Maric, T. S.

Knudsen, B. S Jovancicevic, T. Nakano, and M. M. Vrvic, "Biodegradation of

isoprenoids, steranes, terpanes, and phenanthrenes during in situ bioremediation

of petroleum‐contaminated groundwater," Clean Soil Air Water, vol. 45, no. 2,

pp. 1-8, 2017.

[55] T. N. Nazina, D. S. Sokolova, A. A. Grigoryan, N. M. Shestakova, E. M.

Mikhailova, A. B. Poltaraus, T. P. Tourova. A. M. Lysenko, G. A Osipov, and

S. S. Belyaev, "Geobacillus jurassicus sp. nov., a new thermophilic bacterium

isolated from a high-temperature petroleum reservoir, and the validation of the

Geobacillus species," Sys. Appl. Microbiol., vol. 28, no. 1, pp. 43-53, 2005.

[56] S. Mnif, S. Sayadi, and M. Chamkha, "Biodegradative potential and

characterization of a novel aromatic-degrading bacterium isolated from a

geothermal oil field under saline and thermophilic conditions," Int. Biodeter.

Biodegr., vol. 86, no. 7, pp. 258-264, 2014.

[57] M. S. Fuentes, J. M. Saez, C. S. Benimeli, and M. J. Amoroso, "Lindane

biodegradation by defined consortia of indigenous Streptomyces strains," Water

Air Soil Pollut., vol. 222, no. 4, pp. 217-231, 2011.

[58] A. Hamzah, C. W. Phan, N. F. Abu Bakar, and K. K. Wong, "Biodegradation

of crude oil by constructed bacterial consortia and the constituent single bacteria

isolated from Malaysia," Biorem. J., vol. 17, no. 1, pp. 1-10, 2013.

[59] A. M. Mukred, A. A. Hamid, A. Hamzah, and W. W. Yusoff, "Development of

three bacteria consortium for the bioremediation of crude petroleum-oil in

contaminated water," J. Biol. Sci, vol. 8, no. 4, pp. 73-79, 2008.

[60] M. A. F. Alkhatib, Z. Alam, S. A. Muyibi, and A. Husain, "An isolated bacterial

consortium for crude oil biodegradation," Afr. J. Biotech., vol. 10, no. 81, pp.

18763-18767, 2011.

[61] K. V. Sajna, R. K. Sukumaran, L. D. Gottumukkala, and A. Pandey, "Crude oil

biodegradation aided by biosurfactants from Pseudozyma sp. NII 08165 or its

culture broth," Bioresour. Technol., vol. 191, no. 78, pp. 133-139, 2015.

[62] S. J. Varjani and V. N. Upasani, "Comparative studies on bacterial consortia for

hydrocarbon degradation," Int. J. Inn. Res. Sci. Engg. Technol., vol. 2, no. 10,

pp. 5377-5383, 2013.

[63] A. Mittal and P. Singh, "Isolation of hydrocarbon degrading bacteria from soils

contaminated with crude oil spills," Indian J. Exp. Biol., vol. 47, no. 6, pp. 760-

765, 2009.


102

[64] H. C. Flemming and J. Wingender, "The biofilm matrix," Nature Rev.


[65] R. S. Norman, R. F. Suau, and P. J. Morris, "Variability in Pseudomonas

aeruginosa lipopolysaccharide expression during crude oil degradation," Appl.

Environ. Microbiol., vol. 68, no. 10, pp. 5096-5103, 2002.

[66] D. Dasgupta, R. Ghosh, and T. K. Sengupta, "Biofilm-mediated enhanced crude

oil degradation by newly isolated Pseudomonas species," ISRN Biotechnol.,

vol. 2013, no. 7, pp. 250749, 2013.

[67] B. Klein, P. Bouriat, P. Goulas, and R. Grimaud, "Behavior of Marinobacter

hydrocarbonoclasticus SP17 cells during initiation of biofilm formation at the

alkane-water interface," Biotech. Bioengg., vol. 105, no. 3, pp. 461-468, 2010.

[68] A. W. Decho, "Microbial biofilms in intertidal systems: An overview," Cont.

Shelf Res., vol. 20, no. 10, pp. 1257-1273, 2000.

[69] R. Boopathy, "Factors limiting bioremediation technologies," Bioresour.

Technol., vol. 74, no. 1, pp. 63-67, 2000.

[70] G. Adams, P. T. Fufeyin, and E. Igelenyah, "Bioremediation of spent oil

contaminated soils using poultry litter," Res. J. Eng. Appl. Sci., vol. 3, no. 7, pp.

124-130, 2014.

[71] G. O. Adams, P. T. Fufeyin, S. E. Okoro, and I. Ehinomen, "Bioremediation,

biostimulation and bioaugmention: A review," Int. J. Environ. Biorem.

Biodegr., vol. 3, no. 1, pp. 28-39, 2015.

[72] K. P. Shukla, N. K. Singh, and S. Sharma, "Bioremediation: Developments,

current practices and perspectives," Genet. Engg. Biotechnol. J, vol. 3, no. 8,

pp. 1-20, 2010.

[73] M. Nandal, P. Solanki, M. Rastogi, and R. Hooda, "Bioremediation: A

sustainable tool for environmental management of oily sludge," Nature Environ.

Pollut. Technol., vol. 14, no. 1, p. 181, 2015.

[74] S. Bhatnagar and R. Kumari, "Bioremediation: A sustainable tool for

environmental management, a-review., Ann. Rev. Res. Biol. " vol. 3, no. 9, pp.

974-993, 2013.

[75] J. Tang, M. Carroquino, B. Robertson, and M. Alexander, "Combined effect of

sequestration and bioremediation in reducing the bioavailability of polycyclic

aromatic hydrocarbons in soil," Environ. Sci. Technol., vol. 32, no. 22, pp.

3586-3590, 1998.

[76] S. V. Mohan, T. Kisa, T. Ohkuma, R. A. Kanaly, and Y. Shimizu,

"Bioremediation technologies for treatment of PAH-contaminated soil and

strategies to enhance process efficiency," Rev. Environ. Sci. Biotech., vol. 5,

no. 4, pp. 347-374, 2006.


103

[77] J. Srivastava, R. Naraian, S. Kalra, and H. Chandra, "Advances in microbial

bioremediation and the factors influencing the process," Int. J. Environ. Sci.

Technol., vol. 11, no. 6, pp. 1787-1800, 2014.

[78] J. M. Foght, D. W. Westlake, W. M. Johnson, and H. F. Ridgway,

"Environmental gasoline-utilizing isolates and clinical isolates of Pseudomonas

aeruginosa are taxonomically indistinguishable by chemotaxonomic and

molecular techniques," Microbiology, vol. 142, no. 4, pp. 2333-2340, 1996.

[79] N. Das and P. Chandran, "Microbial degradation of petroleum hydrocarbon

contaminants: An overview," Biotechnol. Res. Int., vol. 2011, no. 2011, pp. 1-

13, 2010.

[80] A. Ijaz, A. Imran, M. A. ul Haq, Q. M. Khan, and M. Afzal, "Phytoremediation:

Recent advances in plant-endophytic synergistic interactions," Plant Soil, vol.

405, no. 1, pp. 179-195, 2015.

[81] Z. X. Chen, H. G. Ni, X. Jing, W. J. Chang, J. L. Sun, and H. Zeng, "Plant

uptake, translocation, and return of polycyclic aromatic hydrocarbons via fine

root branch orders in a subtropical forest ecosystem," Chemosphere, vol. 131,

no. 7, pp. 192-200, 2015.

[82] R. B. Meagher, "Phytoremediation of toxic elemental and organic pollutants,"

Curr. Opin. Plant Biol., vol. 3, no. 2, pp. 153-162, 2000.

[83] X. Liang, C. Guo, C. Liao, S. Liu, L. Y. Wick, D. Peng, Xi. Yi, G. Lu, H. Yin,

and Z. Lin, "Drivers and applications of integrated clean-up technologies for

surfactant-enhanced remediation of environments contaminated with polycyclic

aromatic hydrocarbons (PAHs)," Environ. Pollut., vol. 225, no. 67, pp. 129-140,

2017.

[84] R. Wei, J. Ni, X. Li, W. Chen, and Y. Yang, "Dissipation and phytoremediation

of polycyclic aromatic hydrocarbons in freshly spiked and long-term field-

contaminated soils," Environ. Sci. Pollut. Res., vol. 24, no. 9, pp. 7994-8003,

2017.

[85] R. Patowary, K. Patowary, A. Devi, M. C. Kalita, and S. Deka, "Uptake of total

petroleum hydrocarbon (TPH) and polycyclic aromatic hydrocarbons (PAHs)

by Oryza sativa L. Grown in Soil Contaminated with crude oil," B. Environ.

Contam. Toxicol. vol. 98, no. 1, pp. 120-126, 2017.

[86] K. E. Gerhardt, G. J. MacNeill, P. D. Gerwing, and B. M. Greenberg,

"Phytoremediation of Salt-Impacted Soils and Use of Plant Growth-Promoting

Rhizobacteria (PGPR) to Enhance Phytoremediation," in Phytoremediation,

CA: Springer, 2017, pp. 19-51.

[87] S. Kuppusamy, P. Thavamani, K. Venkateswarlu, Y. B. Lee, R. Naidu, and M.

Megharaj, "Remediation approaches for polycyclic aromatic hydrocarbons

(PAHs) contaminated soils: Technological constraints, emerging trends and

future directions," Chemosphere, vol. 168, no. 7, pp. 944-968, 2017.


104

[88] J. C. Thomas, D. K. Russell, and C. L. Rugh, "Polyaromatic hydrocarbon

phytoremediation stimulated by root exudates," Int. J., vol. 5, no. 1, pp. 1-7,

2017.

[89] H. Yi and D. E. Crowley, "Biostimulation of PAH degradation with plants

containing high concentrations of linoleic acid," Environ. Sci. Technol., vol. 41,

no. 12, pp. 4382-4388, 2007.

[90] A. Patel and D. Patra, "A Sustainable Approach to Clean Contaminated Land

Using Terrestrial Grasses," in Phytoremediation Potential of Bioenergy Plants,

SG: Springer, 2017, pp. 305-331.

[91] L. P. Singha and P. Pandey, "Glutathione and glutathione-S-transferase activity

in Jatropha curcas in association with pyrene degrader Pseudomonas

aeruginosa PDB1 in rhizosphere, for alleviation of stress induced by

polyaromatic hydrocarbon for effective rhizoremediation," Ecol. Engg., vol.

102, no.7, pp. 422-432, 2017.

[92] H. Farraji, N. Q. Zaman, M. A. Zahed, and H. Faraji, "Role of Rhizoremediation

in Decontaminating Some Hazardous Pollutants," in Handbook of Research on

Inventive Bioremediation Techniques, MY: IGI Global, 2017, pp. 213-246.

[93] E. Shahsavari, A. Aburto-Medina, M. Taha, and A. S. Ball, "Phytoremediation

of PCBs and PAHs by Grasses: A Critical Perspective," in Phytoremediation,

USA: Springer, 2016, pp. 3-19.

[94] S. Yousaf, V. Andria, T. G. Reichenauer, K. Smalla, and A. Sessitsch,

"Phylogenetic and functional diversity of alkane degrading bacteria associated

with Italian ryegrass (Lolium multiflorum) and Birdsfoot trefoil (Lotus

corniculatus) in a petroleum oil-contaminated environment," J. Hazard. Mater.,

vol. 184, no. 1, pp. 523-532, 2010.

[95] P. McIntosh, C. P. Schulthess, Y. A. Kuzovkina, and K. Guillard, "Bio-and

phytoremediation of total petroleum hydrocarbons (TPH) under various

conditions," Int. J. Phytorem., doi.org/10.1080/15226514.2017.1284753, 2017.

[96] V. Safronova, G. Piluzza, S. Bullitta, and A. Belimov, "Use of Legume-Microbe

Symbioses for Phytoremediation of Heavy Metal Polluted Soils: Advantages

and Potential Problems," Handbook of Phytoremediation. USA: Nova Science,

Inc, 2011, pp. 443-469

[97] C. Brigido and B. R. Glick, "Phytoremediation Using Rhizobia," in

Phytoremediation, USA: Springer, 2015, pp. 95-114.

[98] S. Minoui, D. Minai-Tehrani, and M. H. Shahriari, "Phytoremediation of Crude

Oil-Contaminated Soil by Medicago sativa (Alfalfa) and the Effect of Oil on its

Growth," in Phytoremediation for Green Energy, NL: Springer, 2015. pp. 123-

129.

[99] S. Hussain, M. Akram, G. Abbas, B. Murtaza, M. Shahid, N. S. Shah, I. Bibi,

and N. K. Niazi, "Arsenic tolerance and phytoremediation potential of

http://dx.doi.org/10.1080/15226514.2017.1284753


105

Conocarpus erectus L. and Populus deltoides L.," Int. J. Phytorem.,

doi.org/10.1080/15226514.2017.1303815. 2017.

[100] J. Luo, S. Qi, L. Peng, and X. Xie, "Enhanced phytoremediation capacity of a

mixed-species plantation of Eucalyptus globulus and Chickpeas," J. Geochem.

Explor., doi.org/10.1016/j.gexplo.2017.01.006, 2017.

[101] V. Iori, F. Pietrini, D. Bianconi, G. Mughini, A. Massacci, and M. Zacchini,

"Analysis of biometric, physiological, and biochemical traits to evaluate the

cadmium phytoremediation ability of eucalypt plants under hydroponics,"I.

Forest, vol. 10, no. 2, p. 416, 2017.

[102] N. Mathur, J. Singh, S. Bohra, A. Bohra, and A. Vyas, "Phytoremediation

potential of some multipurpose tree species of Indian Thar Desert in oil

contaminated soil," Adv. Environ. Biol., vol. 3. no. 1, pp. 131-138, 2010.

[103] M. Noroozi, M. A. Amozegar, R. Rahimi, S. A. S. Fazeli, and G. B. Khaniki,

"The isolation and preliminary characterization of native cyanobacterial and

microalgal strains from lagoons contaminated with petroleum oil in Khark

Island," Biol. J. Microorganism, vol. 5, no. 20, pp. 33-41 2017.

[104] A. Vaziri, E. Panahpour, and M. M. Beni, "Phytoremediation: A method for

treatment of petroleum hydrocarbon contaminated soils," Int. J. Farm. Alli. Sci.,

vol. 2, no. 21, pp. 909-913, 2013.

[105] R. Kamath, J. Rentz, J. L. Schnoor, and P. Alvarez, "Phytoremediation of

hydrocarbon-contaminated soils: Principles and applications," Stud. Surf. Sci.

Catal., vol. 151, no. 20, pp. 447-478, 2004.

[106] I. Kuiper, E. L. Lagendijk, G. V. Bloemberg, and B. J. Lugtenberg,

"Rhizoremediation: A beneficial plant-microbe interaction," Mol. Plant

Microbe. Interact., vol. 17, no. 1, pp. 6-15, 2004.

[107] M. Afzal, S. Khan, S. Iqbal, M. S. Mirza, and Q. M. Khan, "Inoculation method

affects colonization and activity of Burkholderia phytofirmans PsJN during

phytoremediation of diesel-contaminated soil," Int. Biodeter. Biodeger., vol. 85,

no. 1, pp. 331-336, 2013.

[108] S. Khan, M. Afzal, S. Iqbal, M. S. Mirza, and Q. M. Khan, "Inoculum

pretreatment affects bacterial survival, activity and catabolic gene expression

during phytoremediation of diesel contaminated soil," Chemosphere, vol. 91,

no. 5, pp. 663-668, 2013.

[109] M. Arslan, M. Afzal, I. Amin, S. Iqbal, and Q. M. Khan, "Nutrients can enhance

the abundance and expression of alkane hydroxylase CYP153 gene in the

rhizosphere of ryegrass planted in hydrocarbon-polluted soil," PloS One, vol. 9,

no. 10, p. e111208, 2014.

[110] P. Pandey, H. Pathak, and S. Dave, "Microbial ecology of hydrocarbon

degradation in the Soil: A Review," Res. J. Environ. Toxicol., vol. 10, no. 1, p.

1, 2016.

http://dx.doi.org/10.1080/15226514.2017.1303815

http://doi.org/10.1016/j.gexplo.2017.01.006


106

[111] J. Truu, M. Truu, M. Espenberg, H. Nolvak, and J. Juhanson, "Phytoremediation

and plant-assisted bioremediation in soil and treatment wetlands: A review,"

Open. Biotech. J., vol. 9, no. 4, pp. 85-92, 2015.

[112] Y. Ma, M. Prasad, and M. Rajkumar, and H. Freitas, "Plant growth promoting

rhizobacteria and endophytes accelerate phytoremediation of metalliferous

soils," Biotechnol. Adv., vol. 29, no. 8, pp. 248-258, 2011.

[113] A. A. Belimov, V. I. Safronova, T. A. Sergeyeva, T. N. Egorova, V. A.

Matveyeva, and V. E. Tsyganov, "Characterization of plant growth promoting

rhizobacteria isolated from polluted soils and containing 1-aminocyclopropane-

1-carboxylate deaminase," Can. J. Microbiol., vol. 47, no. 2, pp. 642-652, 2001.

[114] M. Saleem, M. Arshad, S. Hussain, and A. S. Bhatti, "Perspective of plant

growth promoting rhizobacteria (PGPR) containing ACC deaminase in stress

agriculture," J. Ind. Microbiol. Biotechnol., vol. 34, no. 10, pp. 635-648, 2007.

[115] V. Spada, P. Iavazzo, R. Sciarrillo, and C. Guarino, "Successful Integrated

Bioremediation System of Hydrocarbon-Contaminated Soil at a Former Oil

Refinery Using Autochthonous Bacteria and Rhizo-microbiota," in

Phytoremediation, USA: Springer, 2017, pp. 53-76.

[116] J. A. Salam, M. A. Hatha, and N. Das, "Microbial-enhanced lindane removal by

sugarcane (Saccharum officinarum) in doped soil-applications in

phytoremediation and bioaugmentation," J. Environ. Manage., vol. 193, no. 56,

pp. 394-399, 2017.

[117] A. Benson, G. Ram, A. John, and M. Melvin Joe, "Inoculation of 1-

aminocyclopropane-1-carboxylate deaminase-producing bacteria along with

biosurfactant application enhances the phytoremediation efficiency of

Medicago sativa in hydrocarbon-contaminated soils," Biorem. J., vol. 21, no. 1,

pp. 20-29, 2017.

[118] V. Andria, T. G. Reichenauer, and A. Sessitsch, "Expression of alkane

monooxygenase (alkB) genes by plant-associated bacteria in the rhizosphere

and endosphere of Italian ryegrass (Lolium multiflorum L.) grown in diesel

contaminated soil," Environ. Pollut., vol. 157, no. 12, pp. 3347-3350, 2009.

[119] L. Yan, H. Sinkko, P. Penttinen, and K. Lindström, "Characterization of

successional changes in bacterial community composition during

bioremediation of used motor oil-contaminated soil in a boreal climate," Sci.

Total Environ., vol. 542, no. 13, pp. 817-825, 2016.

[120] B. Wang, W. Liu, X. Liu, A. E. Franks, Y. Teng, and Y. Luo, "Comparative

analysis of microbial communities during enrichment and isolation of DDT-

degrading bacteria by culture-dependent and-independent methods," Sci. Total

Environ., vol. 590, no. 13, pp. 297-303, 2017.

[121] I. Gandolfi, C. Canedoli, V. Imperato, I. Tagliaferri, P. Gkorezis, J.

Vangronsveld,E. P. Schioppa, M, Papacchini, G. Bestetti, and A. Franzetti,

"Diversity and hydrocarbon-degrading potential of epiphytic microbial


107

communities on Platanus x acerifolia leaves in an urban area," Environ. Pollut.,

vol. 220, no. 67, pp. 650-658, 2017.

[122] J. Li, C. Luo, M. Song, Q. Dai, L. Jiang, D. Zhang, and G. Zhang,

"Biodegradation of phenanthrene in polycyclic aromatic hydrocarbon-

contaminated wastewater revealed by coupling cultivation-dependent and-

independent approaches," Environ. Sci. Technol., vol. 51, no. 12, pp. 3391-

3401, 2017.

[123] A. Y. Muratova, O. Turkovskaya, T. Hübner, and P. Kuschk, "Studies of the

efficacy of alfalfa and reed in the phytoremediation of hydrocarbon-polluted

soil," Appl. Biochem. Microbiol., vol. 39, no. 6, pp. 599-605, 2003.

[124] L. Vergani, F. Mapelli, E. Zanardini, E. Terzaghi, A. Di Guardo, C. Morosini,

G. Raspa, and S. Borin, "Phyto-rhizoremediation of polychlorinated biphenyl

contaminated soils: An outlook on plant-microbe beneficial interactions," Sci.

Total Environ., vol. 575, no. 7, pp. 1395-1406, 2017.

[125] J. C. Hernández-Vega, B. Cady, G. Kayanja, A. Mauriello, N. Cervantes, A.

Gillespie, L. Lavia, J. Trujillo, M Alkio, and A. C. Colon, "Detoxification of

polycyclic aromatic hydrocarbons (PAHs) in Arabidopsis Thaliana involves a

putative flavonol synthase," J. Hazard. Mater., vol. 321, no. 12, pp. 268-280,

2017.

[126] O. Abioye, U. Ijah, and S. Aransiola, "Phytoremediation of Soil Contaminants

by the Biodiesel Plant Jatropha curcas," in Phytoremediation Potential of

Bioenergy Plants, USA: Springer, 2017, pp. 97-137.

[127] Z. Kong and B. R. Glick, "The Role of Bacteria in Phytoremediation," in

Applied. Bioengineering, Germany: T. Yoshida, 2017, pp. 263-278.

[128] M. Adam, "Biodegradation of marine crude oil pollution using a salt-tolerant

bacterial consortium isolated from Bohai Bay, China," Marine pollut. B., vol.

105, no. 1, pp. 43-50, 2016.

[129] N. R. Maddela, R. Burgos, V. Kadiyala, A. R. Carrion, and M. Bangeppagari,

"Removal of petroleum hydrocarbons from crude oil in solid and slurry phase

by mixed soil microorganisms isolated from Ecuadorian oil fields," Int.


[130] M. Wu, X. Ye, K. Chen, W. Li, J. Yuan, and X. Jiang, "Bacterial community

shift and hydrocarbon transformation during bioremediation of short-term

petroleum-contaminated soil," Environ. Pollut., vol. 223, no. 5, pp. 657-664,

2017.

[131] J. W. Kang, "Removing environmental organic pollutants with bioremediation

and phytoremediation," Biotechnol. Lett., vol. 36, no. 6, pp. 1129-1139, 2014.

[132] M. Hassanshahian, M. S. Zeynalipour, and F. H. Musa, "Isolation and

characterization of crude oil degrading bacteria from the Persian Gulf

(Khorramshahr provenance)," Marine Pollut. B., vol. 82, no. 1, pp. 39-44, 2014.


108

[133] P. Gkorezis, M. Daghio, A. Franzetti, J. D. Van Hamme, W. Sillen, and J.

Vangronsveld, "The interaction between plants and bacteria in the remediation

of petroleum hydrocarbons: An environmental perspective," Front. Microbiol.,

vol. 7, no. 1, p. 1836, 2016.

[134] R. Dong, L. Gu, C. Guo, F. Xun, and J. Liu, "Effect of PGPR Serratia

marcescens BC-3 and AMF Glomus intraradices on phytoremediation of

petroleum contaminated soil," Ecotoxicology, vol. 23, no. 4, pp. 674-680, 2014.

[135] C. A. Ajuzieogu, A. A. Ibiene, and H. O. Stanley, "Laboratory study on

influence of plant growth promoting rhizobacteria (PGPR) on growth response

and tolerance of Zea mays to petroleum hydrocarbon," Afr. J. Biotechnol., vol.

14, no. 43, pp. 2949-2956, 2015.

[136] J. Hou, W. Liu, B. Wang, Q. Wang, Y. Luo, and A. E. Franks, "PGPR enhanced

phytoremediation of petroleum contaminated soil and rhizosphere microbial

community response," Chemosphere, vol. 138, no. 12, pp. 592-598, 2015.

[137] P. Pizarro‐Tobias, J. L. Niqui, A. Roca, J. Solano, M. Fernández, F. Bastida, C

Garcia, and J. L Ramos, “Field trial on removal of petroleum‐hydrocarbon

pollutants using a microbial consortium for bioremediation and

rhizoremediation," Environ. Microbiol. Rep., vol. 7, no. 1, pp. 85-94, 2015.

[138] S. Thijs and J. Vangronsveld, "Rhizoremediation," in Principles of Plant-

Microbe Interactions, SUI: Springer, 2015, pp. 277-286.

[139] T. Fester, J. Giebler, L. Y. Wick, D. Schlosser, and M. Kästner, "Plant-microbe

interactions as drivers of ecosystem functions relevant for the biodegradation of

organic contaminants," Curr. Opinion Biotech., vol. 27, no. 12, pp. 168-175,

2014.

[140] S. D. Weert, H. Vermeiren, I. H. Mulders, I. Kuiper, N. Hendrickx, G. V.

Bloemberg, V. Jos, D. M, Rene, and B. J. J. Lugtenberg, "Flagella-driven

chemotaxis towards exudate components is an important trait for tomato root

colonization by Pseudomonas fluorescens," Mol. Plant Microbe Interact., vol.

15, no. 11, pp. 1173-1180, 2002.

[141] B. J. Lugtenberg, L. Dekkers, and G. V. Bloemberg, "Molecular determinants

of rhizosphere colonization by Pseudomonas," Ann. Rev. Phytopathol., vol. 39,

no. 1, pp. 461-490, 2001.

[142] F. Kamilova, L. V. Kravchenko, A. I. Shaposhnikov, T. Azarova, N. Makarova,

and B. Lugtenberg, "Organic acids, sugars, and L-tryptophane in exudates of

vegetables growing on stonewool and their effects on activities of rhizosphere

bacteria," Mol. Plant Microbe Interact., vol. 19, no. 3, pp. 250-256, 2006.

[143] M. K. Swamy, M. S. Akthar, and U. R. Sinniah, "Root Exudates and Their

Molecular Interactions with Rhizospheric Microbes," in Plant, Soil and

Microbes, USA: Springer, 2016, pp. 59-77.

[144] V. Oliveira, N. C. Gomes, M. Santos, A. Almeida, A. I. Lillebø, J. Ezequiel, J

Serôdio, A. M. S., Silva, M. M. Q. Simões, and S. M. Rocha, "Effects of the


109

inoculant strain Pseudomonas sp. SPN31 nah+ and of 2-methylnaphthalene

contamination on the rhizosphere and endosphere bacterial communities of

Halimione portulacoides," Curr. Microbiol., vol. 74, no. 3, pp. 575-583, 2017.

[145] M. Shehzadi, K. Fatima, A. Imran, M. Mirza, Q. Khan, and M. Afzal, "Ecology

of bacterial endophytes associated with wetland plants growing in textile

effluent for pollutant-degradation and plant growth-promotion potentials," Plant

Biosyst., vol. 150, no. 6, pp. 1261-1270, 2016.

[146] P. K. Pandey, S. Singh, A. K. Singh, R. Samanta, R. N. S. Yadav, and M. C.

Singh, "Inside the plant: Bacterial endophytes and abiotic stress alleviation," J.

Appl. Natural Sci., vol. 8, no. 4, pp. 1899-1904, 2016.

[147] X. Zhu, W. Wang, K. Sun, X. Lin, S. Li, M. G. Waigi, and W. Ling, "Inoculating

wheat (Triticum aestivum L.) with the endophytic bacterium Serratia sp. PW7

to reduce pyrene contamination," Int. J. Phytorem.,

doi.org/10.1080/15226514.2017.1284747. 2017.

[148] J. Su, W. Ouyang, Y. Hong, D. Liao, S. Khan, and H. Li, "Responses of

endophytic and rhizospheric bacterial communities of salt marsh plant (Spartina

alterniflora) to polycyclic aromatic hydrocarbons contamination," J. Soils

Sediments, vol. 16, no. 2, pp. 707-715, 2016.

[149] P. Goodwin and W. Gao, "Increased bacterial endophyte populations in

Nicotiana benthamiana with a branched‐chain alkane mixture," Plant Pathol.,

doi.org/10.1111/ppa.12680, 2017.

[150] S. Compant, H. Kaplan, A. Sessitsch, J. Nowak, E. A. Barka, and C. Clément,

"Endophytic colonization of Vitis vinifera L. by Burkholderia phytofirmans

strain PsJN: from the rhizosphere to inflorescence tissues," FEMS Microbiol.

Ecol., vol. 63, no. 1, pp. 84-93, 2008.

[151] S. Compant, B. Reiter, A. Sessitsch, J. Nowak, C. Clément, and E. A. Barka,

"Endophytic colonization of Vitis vinifera L. by plant growth-promoting

bacterium Burkholderia sp. strain PsJN," Appl. Environ. Microbiol., vol. 71,

no. 4, pp. 1685-1693, 2005.

[152] M. Naveed, B. Mitter, S. Yousaf, M. Pastar, M. Afzal, and A. Sessitsch, "The

endophyte Enterobacter sp. FD17: A maize growth enhancer selected based on

rigorous testing of plant beneficial traits and colonization characteristics," Biol.

Fertil. Soils, vol. 50, no. 2, pp. 249-262, 2014.

[153] S. Compant, K. Saikkonen, B. Mitter, A. Campisano, and J. Mercado-Blanco,

"Editorial special issue: Soil, plants and endophytes," Plant Soil, vol. 405, no.

1-2, pp. 1-11, 2016.

[154] A. Pugazhendi, H. Abbad Wazin, H. Qari, J. M. Basahi, J. J. Godon, and J.

Dhavamani, "Biodegradation of low and high molecular weight hydrocarbons

in petroleum refinery wastewater by a thermophilic bacterial consortium,"

Environ. Technol., vol. 38, no. 3, pp.1-11, 2016.

http://dx.doi.org/10.1080/15226514.2017.1284747


110

[155] J. A. Field, A. J. Stams, M. Kato, and G. Schraa, "Enhanced biodegradation of

aromatic pollutants in cocultures of anaerobic and aerobic bacterial consortia,"

Anton. Leeuw., vol. 67, no. 1, pp. 47-77, 1995.

[156] S. F. Nishino, J. C. Spain, and Z. He, "Strategies for Aerobic Degradation of

Nitroaromatic Compounds by Bacteria: Process Discovery to Field

Application," in Biodegradation of Nitroaromatic Compounds and Explosives,

UK: CRC press, 2000, pp. 7-61.

[157] M. Kulkarni and A. Chaudhari, "Microbial remediation of nitro-aromatic

compounds: An overview," J. Environ. Manage., vol. 85, no. 2, pp. 496-512,

2007.

[158] D. A. Abramowicz, "Aerobic and anaerobic biodegradation of PCBs: A

review," Crit. Rev. Biotechnol., vol. 10, no. 3, pp. 241-251, 1990.

[159] S. J. Varjani and V. N. Upasani, "A new look on factors affecting microbial

degradation of petroleum hydrocarbon pollutants," Int. Biodeterior. Biodegr.,

vol. 120, no. 3, pp. 71-83, 2017.

[160] F. S. Portugal, J. M. Dias, H. Ribeiro, C. Magalhães, A. P. Mucha, and A. S.

Danko, "Anaerobic biodegradation of ethylic and methylic biodiesel and their

impact on benzene degradation," Clean Soil Air Water,

doi:10.1002/clen.201600264, 2017.

[161] T. Lueders, "The ecology of anaerobic degraders of BTEX hydrocarbons in

aquifers," FEMS Microbiol. Ecol., vol. 93, no. 1, p. 220, 2017.

[162] P. Arulazhagan, S. Mnif, J. R. Banu, Q. Huda, and M. Jalal, "HC-0B-01:

Biodegradation of Hydrocarbons by Extremophiles," in Biodegradation and

Bioconversion of Hydrocarbons, Germany: Springer, 2017, pp. 137-162.

[163] A. K. Ghattas, F. Fischer, A. Wick, and T. Ternes, "Anaerobic biodegradation

of (emerging) organic contaminants in the aquatic environment," Water Res.,

vol. 116, no. 3, pp. 268-295, 2017.

[164] D. F. Aktas, K. R. Sorrell, K. E. Duncan, B. Wawrik, A. V. Callaghan, and J.

M. Suflita, "Anaerobic hydrocarbon biodegradation and biocorrosion of carbon

steel in marine environments: The impact of different ultra-low sulfur diesels

and bioaugmentation," Int. Biodeter. Biodegr., vol. 118, no. 2, pp. 45-56, 2017.

[165] R. Peixoto, A. Vermelho, and A. Rosado, "Petroleum-degrading enzymes:

Bioremediation and new prospects," Enzyme Res., vol. 2011, no. 1, pp. 1-7,

2011.

[166] M. Throne-Holst, A. Wentzel, T. E. Ellingsen, H. K. Kotlar, and S. B. Zotchev,

"Identification of novel genes involved in long-chain n-alkane degradation by

Acinetobacter sp. strain DSM 17874," Appl. Environ. Microbiol., vol. 73, no.

10, pp. 3327-3332, 2007.

[167] C. Muangchinda, S. Chavanich, V. Viyakarn, K. Watanabe, S. Imura, A.

Vangnai, and O. Pinyakong, "Abundance and diversity of functional genes

http://www.sciencedirect.com/science/journal/00431354/116/supp/C


111

involved in the degradation of aromatic hydrocarbons in Antarctic soils and

sediments around Syowa station," Environ. Sci. Pollut. Res., vol. 22, no. 6, pp.

4725-4735, 2015.

[168] S. Yousaf, K. Ripka, T. Reichenauer, V. Andria, M. Afzal, and A. Sessitsch,

"Hydrocarbon degradation and plant colonization by selected bacterial strains

isolated from Italian ryegrass and birdsfoot trefoil," J. Appl. Microbiol., vol.

109, no. 1, pp. 1389-1401, 2010.

[169] M. C. Deng, J. Li, F. R. Liang, M. Yi, X. M. Xu, J. P. Yuan, C. F. Wu, and J.

H. Wang, "Isolation and characterization of a novel hydrocarbon-degrading

bacterium Achromobacter sp. HZ01 from the crude oil-contaminated seawater

at the Daya Bay, southern China," Marine Pollut. B., vol. 83, no.1, pp. 79-86,

2014.

[170] M. Udgire, N. Shah, and M. Jadhav, "Enrichment, isolation and identification

of hydrocarbon degrading bacteria," Int. J. Curr. Microbiol. Appl. Sci, vol. 4,

no. 6, pp. 708-13, 2015.

[171] F. Rasche, H. Velvis, C. Zachow, G. Berg, J. D. Van Elsas, and A. Sessitsch,

"Impact of transgenic potatoes expressing anti‐bacterial agents on bacterial

endophytes is comparable with the effects of plant genotype, soil type and

pathogen infection," J. Appl. Ecol., vol. 43, no. 3, pp. 555-566, 2006.

[172] A. K. Yadav, S. Manna, K. Pandiyan, A. Singh, M. Kumar, H. Chakdar, P. L.

Kashyap, and A. K. Srivastava, "Isolation and characterization of biosurfactant

producing Bacillus sp. from diesel fuel-contaminated site," Microbiology, vol.

85, no. 1, pp. 56-62, 2016.

[173] T. Ichor, P. Okerentugba, and G. Okpokwasili, "Biodegradation of total

petroleum hydrocarbon by a consortium of cyanobacteria isolated from crude

oil polluted brackish waters of Bodo Creeks in Ogoniland, Rivers State," Res.

J. Environ. Toxicol., vol. 10, no. 1, pp. 1-16, 2016.

[174] R. Tahseen, M. Afzal, S. Iqbal, G. Shabir, Q. M. Khan, Z. M. Khalid, and I. M.

Banat, "Rhamnolipids and nutrients boost remediation of crude oil-

contaminated soil by enhancing bacterial colonization and metabolic activities,"

Int. Biodeter. Biodegr., vol. 115, no. 4, pp. 192-198, 2016.

[175] M. Hassanshahian, M. Ahmadinejad, H. Tebyanian, and A. Kariminik,

"Isolation and characterization of alkane degrading bacteria from petroleum

reservoir waste water in Iran (Kerman and Tehran provenances)," Marine

Pollut. B., vol. 73, no. 1, pp. 300-305, 2013.

[176] S. Min, L. Qun, S. Xian-rong, H. Deng-yong, H. Ying, and S. Zhan, "Isolation

and identification of biodegradation ability of alkane-degrading bacteria:

Molecular detection and analysis of alkane hydroxylase genes," Afr. J.

Microbiol. Res., vol. 6, no. 17, pp. 3936-3943, 2012.

[177] D. Hou, Z. Shi, X. Shen, Y. He, M. Sun, and Q. Wang, "Isolation, identification

and alkane hydroxylase genes detection of a marine diesel-degrading bacterial

strain (F9)," Afr. J. Microbiol. Res., vol. 7, no. 3, pp. 2794-2802, 2013.


112

[178] R. Pikovskaya, "Mobilization of phosphorus in soil in connection with vital

activity of some microbial species," Mikrobiologiya, vol. 17, no. 362, p. e370,

1948.

[179] S. A. Gordon and R. P. Weber, "Colorimetric estimation of indoleacetic acid,"

Plant Physiol., vol. 26, no. 1, pp. 192-5, 1951.

[180] A. K. Reddy, R. Ashok, M. Majety, M. Chitta, and N. Narayen, "Fungal keratitis

due to Schizophyllum commune: An emerging pathogenic fungus," Mycoses.

vol. 59, no. 12, pp. 757-759, 2016.

[181] B. Schwyn and J. B. Neilands, "Universal chemical assay for the detection and

determination of siderophores," Anal. Biochem., vol. 160, no. 1, pp. 47-56,

1987.

[182] M. Dworkin and J. W. Foster, "Experiments with some microorganisms which

utilize ethane and hydrogen," J. Bacteriol., vol. 75, no. 5, pp. 592-603, 1958.

[183] A. Imran, M. J. A. Saadalla, S. U. Khan, M. S. Mirza, K. A. Malik, and F. Y.

Hafeez, "Ochrobactrum sp. Pv2Z2 exhibits multiple traits of plant growth

promotion, biodegradation and N-acyl-homoserine-lactone quorum sensing,"

Ann. Microbiol., vol. 64, no. 4, pp. 1797-1806, 2014.

[184] V. A. Cavalcante and J. Dobereiner, "A new acid-tolerant nitrogen-fixing

bacterium associated with sugarcane," Plant Soil, vol. 108, no. 1, pp. 23-31,

1988.

[185] J. M. Wilkinson and H. Cavanagh, "Antibacterial activity of essential oils from

Australian native plants," Phytother. Res., vol. 19, no. 7, pp. 643-646, 2005.

[186] M. F. Gonzales, T. Brooks, S. U. Pukatzki, and D. Provenzano, "Rapid protocol

for preparation of electrocompetent Escherichia coli and Vibrio cholerae," J.

Vis. Exp., vol. 8, no. 80, pp. e50684-e50684, 2013.

[187] R. S. Al-Wasify and S. R. Hamed, "Bacterial biodegradation of crude oil using

local isolates," Int. J. Bacteriol., vol. 2014, no. 12. pp. 1-8, 2014.

[188] W.T. Chen, Y. Zhang, J. Zhang, L. Schideman, G. Yu, P. Zhang, M. Minaric,

"Co-liquefaction of swine manure and mixed-culture algal biomass from a

wastewater treatment system to produce bio-crude oil," Appl. Energy, vol. 128,

no. 23, pp. 209-216, 2014.

[189] J. H. Cohen, L. R. McCormick, and S. M. Burkhardt, "Effects of dispersant and

oil on survival and swimming activity in a marine copepod," B. Environ.

Contam. Toxicol., vol. 92, no. 4, pp. 381-387, 2014.

[190] J. A. Anderson, A. J. Kuhl, and A. N. Anderson, "Toxicity of oil and dispersed

oil on juvenile mud crabs, Rhithropanopeus harrisii," B. Environ. Contam.

Toxicol., vol. 92, no. 4, pp. 375-380, 2014.

[191] X. Lin, X. Li, P. Li, F. Li, L. Zhang, and Q. Zhou, "Evaluation of plant-

microorganism synergy for the remediation of diesel fuel contaminated soil," B.

Environ. Contam. Toxicol., vol. 81, no. 1, pp. 19-24, 2008.


113

[192] M. Afzal, S. Yousaf, T. G. Reichenauer, and A. Sessitsch, "Ecology of alkane-

degrading bacteria and their interaction with the plant," Mol. Microbial. Ecol.

Rhizosphere, vol. 2, no. 5, pp. 975-989, 2013.

[193] A. Sessitsch, B. Reiter, U. Pfeifer, and E. Wilhelm, "Cultivation-independent

population analysis of bacterial endophytes in three potato varieties based on

eubacterial and Actinomycetes-specific PCR of 16S rRNA genes," FEMS

Microbiol. Ecol., vol. 39, no. 1, pp. 23-32, 2002.

[194] M. Tesar, T. G. Reichenauer, and A. Sessitsch, "Bacterial rhizosphere

populations of black poplar and herbal plants to be used for phytoremediation

of diesel fuel," Soil Biol. Biochem., vol. 34, no. 12, pp. 1883-1892, 2002.

[195] A. Frank and W. Dugas, "Carbon dioxide fluxes over a northern, semiarid,

mixed-grass prairie," Agric. For. Meteorol., vol. 108, no. 4, pp. 317-326, 2001.

[196] J. B. Van Beilen and E. G. Funhoff, "Alkane hydroxylases involved in microbial

alkane degradation," Appl. Microbiol. Biotechnol., vol. 74, no. 1, pp. 13-21,

2007.

[197] E. O. Nwaichi, E. N. Onyeike, and M. O. Wegwu, "Characterization and safety

evaluation of the impact of hydrocarbon contaminants on ecological receptors,"

B. Environ. Contam. Toxicol., vol. 85, no. 2, pp. 199-204, 2010.

[198] A. Peng, J. Liu, Y. Gao, and Z. Chen, "Distribution of endophytic bacteria in

Alopecurus aequalis Sobol and Oxalis corniculata L. from soils contaminated

by polycyclic aromatic hydrocarbons," PloS One, vol. 8, no. 12, p. e83054,

2013.

[199] R. Costa, M. Götz, N. Mrotzek, J. Lottmann, G. Berg, and K. Smalla, "Effects

of site and plant species on rhizosphere community structure as revealed by

molecular analysis of microbial guilds," FEMS Microbiol. Ecol., vol. 56, no. 2,

pp. 236-249, 2006.

[200] F. Marseille, J. Disnar, B. Guillet, and Y. Noack, "Alkanes and free fatty acids

in humus and A1 horizons of soils under beech, spruce and grass in the Massif‐

Central (Mont‐Lozère), France," Eur. J. Soil Sci., vol. 50, no. 3, pp. 433-441,

1999.

[201] S. D. Siciliano, N. Fortin, A. Mihoc, G. Wisse, S. Labelle, D. Beaumier, D.

Ouellette, R. Roy, L. G. Whyte, M. K. Banks, "Selection of specific endophytic

bacterial genotypes by plants in response to soil contamination," Appl. Environ.


[202] T. Tourova, D. S. Sokolova, E. Semenova, E. Shumkova, A. Korshunova, T.

Babich, A. B. Poltaraus, and T. N. Nazina, "Detection of n-alkane

biodegradation genes alkB and ladA in thermophilic hydrocarbon-oxidizing

bacteria of the genera Aeribacillus and Geobacillus," Microbiology, vol. 85, no.

6, pp. 693-707, 2016.

[203] J. K. Vessey, "Plant growth promoting rhizobacteria as biofertilizers," Plant

Soil, vol. 255, no. 2, pp. 571-586, 2003.


114

[204] M. Ahemad and M. Kibret, "Mechanisms and applications of plant growth

promoting rhizobacteria: Current perspective," J. King Saud Univ. Sci., vol. 26,

no. 2, pp. 1-20, 2014.

[205] H. S. Auta, U. Ijah, and M. Mojuetan, "Bioaugumentation of crude oil

contaminated soil using bacterial consortium," Adv. Sci. Focus, vol. 2, no. 2,

pp. 26-33, 2014.

[206] C. Jidere, F. Akamigbo, and J. Ugwuanyi, "Phytoremediation potentials of

cowpea (Vigina unguiculata) and maize (Zea mays) for hydrocarbon

degradation in organic and inorganic manure-amended tropical typic

paleustults," Int. J. Phytorem., vol. 14, no. 4, pp. 362-373, 2012.

[207] F. P. Moore, T. Barac, B. Borremans, L. Oeyen, J. Vangronsveld, D. Van der

Lelie, C. D. Cambell, and R. B. E. Moore, "Endophytic bacterial diversity in

poplar trees growing on a BTEX-contaminated site: The characterisation of

isolates with potential to enhance phytoremediation," Syst. Appl. Microbiol.,

vol. 29, no. 7, pp. 539-556, 2006.

[208] D. B. Kearns, F. Chu, S. S. Branda, R. Kolter, and R. Losick, "A master

regulator for biofilm formation by Bacillus subtilis," Mol. Microbiol., vol. 55,

no. 3, pp. 739-749, 2005.

[209] T. Das, H. Gohel, M. Panchal, S. Ghosh, and V. Braganza, "Determination of

crude oil degradation efficiency of glass biofilm of isolated bacterium and

fungus," Int. Res. J. Biol. Sci, vol. 3, no. 2, pp. 67-69, 2014.

[210] S. J. Pamp and T. Tolker-Nielsen, "Multiple roles of biosurfactants in structural

biofilm development by Pseudomonas aeruginosa," J. bacteriol., vol. 189, no.

6, pp. 2531-2539, 2007.

[211] P. M. Tribelli, C. Di Martino, N. I. López, and L. J. R. Iustman, "Biofilm

lifestyle enhances diesel bioremediation and biosurfactant production in the

Antarctic polyhydroxyalkanoate producer Pseudomonas extremaustralis,"

Biodegradation, vol. 23, no. 5, pp. 645-651, 2012.

[212] R. Singh, D. Paul, and R. K. Jain, "Biofilms: Implications in bioremediation,"

Trends Microbiol., vol. 14, no. 9, pp. 389-397, 2006.

[213] K. Sun, J. Liu, Y. Gao, L. Jin, Y. Gu, and W. Wang, "Isolation, plant

colonization potential, and phenanthrene degradation performance of the

endophytic bacterium Pseudomonas sp. Ph6-gfp," Sci. Rep., vol. 4, pp. 345-

352, no. 1, 2014.

[214] M. Y. Ashraf, A. R. Awan, and K. Mahmood, "Rehabilitation of saline

ecosystems through cultivation of salt tolerant plants," Pak. J. Bot., vol. 44, no.

3, pp. 69-75, 2012.

[215] M. Shahid, S. Hameed, A. Imran, S. Ali, and J. D. V. Elsas, "Root colonization

and growth promotion of sunflower (Helianthus annuus L.) by phosphate

solubilizing Enterobacter sp. Fs-11," World J. Microbiol. Biotechnol., vol. 28,

no. 8, pp. 2749-2758, 2012.


115

[216] N. Wu, K. Matand, B. Kebede, G. Acquaah, and S. Williams, "Enhancing DNA

electrotransformation efficiency in Escherichia coli DH10B electrocompetent

cells," Electron. J. Biotechnol., vol. 13, no. 5, pp. 21-22, 2010.

[217] S. J. Varjani, D. P. Rana, A. K. Jain, S. Bateja, and V. N. Upasani, "Synergistic

ex-situ biodegradation of crude oil by halotolerant bacterial consortium of

indigenous strains isolated from on shore sites of Gujarat, India," Int.

Biodeterior. Biodegr., vol. 103, no. 1, pp. 116-124, 2015.

[218] K. Das and A. K. Mukherjee, "Crude petroleum-oil biodegradation efficiency

of Bacillus subtilis and Pseudomonas aeruginosa strains isolated from a

petroleum-oil contaminated soil from North-East India," Bioresour. Technol.,

vol. 98, no. 7, pp. 1339-1345, 2007.

[219] S. Shankar, C. Kansrajh, M. Dinesh, R. Satyan, S. Kiruthika, and A.

Tharanipriya, "Application of indigenous microbial consortia in bioremediation

of oil-contaminated soils," Int. J. Environ. Sci. Technol., vol. 11, no. 2, pp. 367-

376, 2014.

[220] A. A. Burghal, N. A. Al-Mudaffarand, and K. H. Mahdi, "Ex situ

bioremediation of soil contaminated with crude oil by use of actinomycetes

consortia for process bioaugmentation," Eur. J. Exp. Biol., vol. 5, no. 5, pp. 24-

30, 2015.

[221] Y. Hong, D. Liao, J. Chen, S. Khan, J. Su, and H. Li, "A comprehensive study

of the impact of polycyclic aromatic hydrocarbons (PAHs) contamination on

salt marsh plants Spartina alterniflora: Implication for plant-microbe

interactions in phytoremediation," Environ. Sci. Pollut. Res., vol. 22, no. 9, pp.

7071-7081, 2015.

[222] T. J. McGenity, B. D. Folwell, B. A. McKew, and G. O. Sanni, "Marine crude-

oil biodegradation: A central role for interspecies interactions," Aquat. Biosyst.,

vol. 8, no. 1, pp. 10.-12, 2012.

[223] U. Deppe, H. H. Richnow, W. Michaelis, and G. Antranikian, "Degradation of

crude oil by an arctic microbial consortium," Extremophiles, vol. 9, no. 6, pp.

461-470, 2005.

[224] P. S. Stewart and M. J. Franklin, "Physiological heterogeneity in biofilms,"

Nature Rev. Microbiol., vol. 6, no. 3, pp. 199-210, 2008.

[225] E. Benizri, E. Baudoin, and A. Guckert, "Root colonization by inoculated plant

growth-promoting rhizobacteria," Biocontrol Sci. Technol., vol. 11, no. 5, pp.

557-574, 2001.

[226] K. L. Newman, R. P. Almeida, A. H. Purcell, and S. E. Lindow, "Use of a green

fluorescent strain for analysis of Xylella fastidiosa colonization of Vitis

vinifera," Appl. Environ. Microbiol., vol. 69, no. 12, pp. 7319-7327, 2003.

[227] T. C. Lin, P. T. Pan, and S. S. Cheng, "Ex situ bioremediation of oil-

contaminated soil," J. Hazard. Mater., vol. 176, no. 1, pp. 27-34, 2010.


116

[228] N. Tara, M. Afzal, T. M. Ansari, R. Tahseen, S. Iqbal, and Q. M. Khan,

"Combined use of alkane-degrading and plant growth-promoting bacteria

enhanced phytoremediation of diesel contaminated soil," Int. J. Phytorem., vol.

16, no. 12, pp. 1268-1277, 2014.

[229] F. Fernández-Luqueño, C. Valenzuela-Encinas, R. Marsch, C. Martínez-Suárez,

E. Vázquez-Núñez, and L. Dendooven, "Microbial communities to mitigate

contamination of PAHs in soil-possibilities and challenges: A review," Environ.

Sci. Pollut. Res., vol. 18, no. 1, pp. 12-30, 2011.

[230] B. Mitter, A. Petric, M. W. Shin, P. S. Chain, L. Hauberg-Lotte, B. Reinhold-

Hurek, J. Nowak, and A. Sessitsch, "Comparative genome analysis of

Burkholderia phytofirmans PsJN reveals a wide spectrum of endophytic

lifestyles based on interaction strategies with host plants," Front. Plant Sci., vol.

4, no. 12, p. 120, 2013.

[231] X. Sheng, X. Chen, and L. He, "Characteristics of an endophytic pyrene-

degrading bacterium of Enterobacter sp. 12J1 from Allium macrostemon

Bunge," Int. Biodeterior. Biodegr., vol. 62, no. 2, pp. 88-95, 2008.

[232] E. Joner, S. Corgie, N. Amellal, and C. Leyval, "Nutritional constraints to

degradation of polycyclic aromatic hydrocarbons in a simulated rhizosphere,"

Soil Biol. Biochem., vol. 34, no. 6, pp. 859-864, 2002.

[233] G. Shabir, M. Afzal, F. Anwar, R. Tahseen, and Z. M. Khalid, "Biodegradation

of kerosene in soil by a mixed bacterial culture under different nutrient

conditions," Int. Biodeter. Biodegr., vol. 61, no. 2, pp. 161-166, 2008.

[234] S. Yousaf, M. Afzal, T. G. Reichenauer, C. L. Brady, and A. Sessitsch,

"Hydrocarbon degradation, plant colonization and gene expression of alkane

degradation genes by endophytic Enterobacter ludwigii strains," Environ.

Pollut., vol. 159, no. 10, pp. 2675-2683, 2011.

[235] F. Ghazisaeedi, M. M. Zamani, S. Ghadbeigi, S. H. Mortazavi, M. Fallahpour,

H. Ghazisaidi, M. Zamani, A. Bakhtiarian, N. A. K, Sima, and M. Amini,

"Bioremediation of the crude oil contamination of soil by the indigenous,

herbaceous Slant salicorniaeuropea in Iran," Thrita, vol. 3, no. 2, p. e17409,

2014.

[236] M. Andreolli, S. Lampis, M. Poli, G. Gullner, B. Biró, and G. Vallini,

"Endophytic Burkholderia fungorum DBT1 can improve phytoremediation

efficiency of polycyclic aromatic hydrocarbons," Chemosphere, vol. 92, no. 6,

pp. 688-694, 2013.

[237] R. Marecik, Ł. Chrzanowski, A. Piotrowska-Cyplik, W. Juzwa, and R.

Biegańska-Marecik, "Rhizosphere as a tool to introduce a soil-isolated

hydrocarbon-degrading bacterial consortium into a wetland environment," Int.


[238] X. Zhu, X. Ni, J. Liu, and Y. Gao, "Application of endophytic bacteria to reduce

persistent organic pollutants contamination in plants," Clean Soil Air Water,

vol. 42, no. 3, pp. 306-310, 2014.


117

[239] J. Pandey, A. Chauhan, and R. K. Jain, "Integrative approaches for assessing

the ecological sustainability of in situ bioremediation," FEMS Microbiol. Rev.,

vol. 33, no. 2, pp. 324-375, 2009.

[240] M. Tyagi, M. M. R. da Fonseca, and C. C. D. Carvalho, "Bioaugmentation and

biostimulation strategies to improve the effectiveness of bioremediation

processes," Biodegradation, vol. 22, no. 2, pp. 231-241, 2011.

[241] A. S. Roy, R. Baruah, M. Borah, A. K. Singh, H. P. D. Boruah, N. Saikia, M.

Deka, N, Dutta, and T. C. Bora, "Bioremediation potential of native

hydrocarbon degrading bacterial strains in crude oil contaminated soil under

microcosm study," Int. Biodeter. Biodegr., vol. 94, no. 2, pp. 79-89, 2014.

[242] C. B. Smith, B. B. Tolar, J. T. Hollibaugh, and G. M. King, "Alkane hydroxylase

gene (alkB) phylotype composition and diversity in northern Gulf of Mexico

bacterioplankton," Front. Microbiol., vol. 4, no. 1, p. 370, 2013.

[243] G. F. Enrique, F. T. Wakida, D. D. Rodríguez-Mendivil, and H. Espinoza-

Gomez, "Polycyclic aromatic hydrocarbons in road deposited sediments and

roadside soil in Tijuana, Mexico," Soil Sedim. Contam., vol. 25, no. 3, pp. 235-

239, 2016.

[244] L. A. Farahat and N. S. El-Gendy, "Biodegradation of Baleym mix crude oil in

soil microcosm by some locally isolated Egyptian bacterial strains," Soil Sedim.

Contam., vol. 17, no. 3, pp. 150-162, 2008.

[245] S. Sutton, "Measurement of microbial cells by optical density," J. Validation

Technol., vol. 17, no. 1, p. 46, 2011.

[246] F. Ahmad, "Leptochloa fusca cultivation for utilization of salt-affected soil and

water resources in Cholistan Desert," Soci. Nature, vol. 22, no. 1, pp. 141-149,

2010.

[247] M. Mohanty and H. K. Patra, "Phytoremediation potential of para grass: An in

situ approach for chromium contaminated soil," Int. J. of Phytorem, vol. 14, no.

1, pp. 796-805, 2012.

[248] J. Tang, M. Wang, F. Wang, Q. Sun, and Q. Zhou, "Eco-toxicity of petroleum

hydrocarbon contaminated soil," J. Environ. Sci., vol. 23, no. 3, pp. 845-851,

2011.

[249] J. P. Salanitro, P. B. Dorn, M. H. Huesemann, K. O. Moore, I. A. Rhodes, L. M.

Rice Jackson, T. M. Vipnod, M. M. Western, and H. L. Wisniewski, "Crude oil

hydrocarbon bioremediation and soil ecotoxicity assessment," Environ. Sci.

Technol., vol. 31, no. 6, pp. 1769-1776, 1997.

[250] L. A. Phillips, J. J. Germida, R. E. Farrell, and C. W. Greer, "Hydrocarbon

degradation potential and activity of endophytic bacteria associated with prairie

plants," Soil Biol. Biochem., vol. 40, no. 12, pp. 3054-3064, 2008.


118

[251] J. L. Kirk, J. N. Klironomos, H. Lee, and J. T. Trevors, "The effects of perennial

ryegrass and alfalfa on microbial abundance and diversity in petroleum

contaminated soil," Environ. Pollut., vol. 133, no. 3, pp. 455-465, 2005.

[252] B. Gogoi, N. Dutta, P. Goswami, and T. K. Mohan, "A case study of

bioremediation of petroleum-hydrocarbon contaminated soil at a crude oil spill

site," Adv. Environ. Res., vol. 7, no. 4, pp. 767-782, 2003.

[253] N. J. Pino, L. M. Muñera, and G. A. Peñuela, "Bioaugmentation with

immobilized microorganisms to enhance phytoremediation of PCB-

contaminated soil," Soil Sedim. Contam., vol. 25, no. 3, pp. 419-430, 2016.

[254] Y. Xu and M. Lu, "Bioremediation of crude oil-contaminated soil: Comparison

of different biostimulation and bioaugmentation treatments," J. Hazard. Mater.,

vol. 183, no. 1, pp. 395-401, 2010.

[255] T. G. Reichenauer and J. J. Germida, "Phytoremediation of organic

contaminants in soil and groundwater," ChemSusChem, vol. 1, no. 1-2, pp. 708-

717, 2008.

[256] K. Fatima, M. Afzal, A. Imran, and Q. M. Khan, "Bacterial rhizosphere and

endosphere populations associated with grasses and trees to be used for

phytoremediation of crude Oil contaminated soil," B. Environ. Contam.

Toxicol., vol. 94, no. 3, pp. 314-320, 2015.

[257] E. Kaimi, T. Mukaidani, and M. Tamaki, "Screening of twelve plant species for

phytoremediation of petroleum hydrocarbon-contaminated soil," Plant Prod.

Sci., vol. 10, no. 2, pp. 211-218, 2007.

[258] B. Kołwzan, "Effect of bioremediation on genotoxicity of soil contaminated

with diesel oil," Environ. Prot. Engg., vol. 35, no. 1, pp. 95-103, 2009.

[259] K. J. Germaine, E. Keogh, D. Ryan, and D. N. Dowling, "Bacterial endophyte-

mediated naphthalene phytoprotection and phytoremediation," FEMS

Microbiol. Lett., vol. 296, no. 2, pp. 226-234, 2009.

[260] J. M. Ayotamuno, R. B. Kogbara, E. A. Agele, and O. S. Agoro, "Composting

and phytoremediation treatment of petroleum sludge," Soil Sedim. Contam.,

vol. 19, no. 6, pp. 686-695, 2010.

[261] K. Fatima, A. Imran, I. Amin, Q. Khan, and M. Afzal, "Plant species affect

colonization patterns and metabolic activity of associated endophytes during

phytoremediation of crude oil-contaminated soil," Environ. Sci. Pollut. Res.,

vol. 23, no. 7, pp. 6188-6196, 2016.

[262] S. H. Lee, W. S. Lee, C. H. Lee, and J. G. Kim, "Degradation of phenanthrene

and pyrene in rhizosphere of grasses and legumes," J. Hazard. Mater., vol. 153,

no. 1, pp. 892-898, 2008.

[263] M. Rosenblueth and E. Martínez-Romero, "Bacterial endophytes and their

interactions with hosts," Mol. Plant Microbe. Interact., vol. 19, no. 8, pp. 827-

837, 2006.


119

[264] A. S. Costa, L. Romão, B. Araújo, S. Lucas, S. Maciel, and A. Wisniewski,

"Environmental strategies to remove volatile aromatic fractions (BTEX) from

petroleum industry wastewater using biomass," Bioresour. Technol., vol. 105,

no. 3, pp. 31-39, 2012.

[265] B. Anifowose, D. Lawler, D. van der Horst, and L. Chapman, "A systematic

quality assessment of environmental impact statements in the oil and gas

industry," Sci. Total Environ., vol. 572, no. 1, pp. 570-585, 2016.

[266] M. Smith, T. Flowers, H. Duncan, and J. Alder, "Effects of polycyclic aromatic

hydrocarbons on germination and subsequent growth of grasses and legumes in

freshly contaminated soil and soil with aged PAHs residues," Environ. Pollut.,

vol. 141, no. 3, pp. 519-525, 2006.

[267] P. A. Kulakow, A. Schwab, and M. Banks, "Screening plant species for growth

on weathered, petroleum hydrocarbon-contaminated sediments," Int. J.

Phytorem., vol. 2, no. 4, pp. 297-317, 2000.

[268] I. M. Banat, A. Franzetti, I. Gandolfi, G. Bestetti, M. G. Martinotti, and L.

Fracchia, "Microbial biosurfactants production, applications and future

potential," Appl. Microbiol. Biotech., vol. 87, no. 2, pp. 427-444, 2010.

[269] W. W. Wenzel, "Rhizosphere processes and management in plant-assisted

bioremediation (phytoremediation) of soils," Plant Soil, vol. 321, no. 1-2, pp.

385-408, 2009.

[270] S. M. Nardeli, C. F. Saad, P. de Barros Rossetto, V. S. Caetano, M. Ribeiro-

Alves, and J. E. S. Paes, "Transcriptional responses of Arabidopsis thaliana to

oil contamination," Environ. Exp. Bot., vol. 127, no. 3, pp. 63-72, 2016.

[271] J. Rezek, C. I. D. Wiesche, M. Mackova, F. Zadrazil, and T. Macek, "The effect

of ryegrass (Lolium perenne) on decrease of PAH content in long term

contaminated soil," Chemosphere, vol. 70, no. 9, pp. 1603-1608, 2008.

[272] S. Gaskin, K. Soole, and R. Bentham, "Screening of Australian native grasses

for rhizoremediation of aliphatic hydrocarbon-contaminated soil," Int. J.

Phytorem., vol. 10, no. 5, pp. 378-389, 2008.

[273] A. Hartmann, M. Schmid, D. Van Tuinen, and G. Berg, "Plant-driven selection

of microbes," Plant Soil, vol. 321, no. 1-2, pp. 235-257, 2009.

[274] M. S. Olson, R. M. Ford, J. A. Smith, and E. J. Fernandez, "Quantification of

bacterial chemotaxis in porous media using magnetic resonance imaging,"

Environ. Sci. Technol., vol. 38, no. 14, pp. 3864-3870, 2004.

[275] C. Zou, M. Wang, Y. Xing, G. Lan, T. Ge, and X. Yan, "Characterization and

optimization of biosurfactants produced by Acinetobacter baylyi ZJ2 isolated

from crude oil-contaminated soil sample toward microbial enhanced oil

recovery applications," Biochem. Engg. J., vol. 90, no. 2, pp. 49-58, 2014.

[276] S. J. Varjani, "Microbial degradation of petroleum hydrocarbons," Bioresour.

Technol., vol. 223, no.2, pp. 277-286, 2017.


120

[277] A. Rajasekar, S. Maruthamuthu, Y. Ting, R. Balasubramanian, and P. K.

Rahman, "Bacterial Degradation of Petroleum Hydrocarbons," in Microbial

Degradation of Xenobiotics, USA: Springer, 2012, pp. 339-369.

[278] M. Nurul, "Microbial Degradation of Petroleum Hydrocarbon," Banglad. Soci.

Microbiol. vol. 27, no. 4, pp. 10-13, 2011.

[279] F. Ahamed, M. Hasibullah, J. Ferdouse, and M. N. Anwar, "Microbial

degradation of petroleum hydrocarbon," Banglad. J. Microbiol., vol. 27, no. 1,

pp. 10-13, 2010.

[280] H. Long, Y. Wang, S. Chang, G. Liu, T. Chen, and G. Huo, "Diversity of crude

oil-degrading bacteria and alkane hydroxylase (alkB) genes from the Qinghai-

Tibet Plateau," Environ. Monitor., vol. 189, no. 3, p. 116, 2017.

[281] J. Gurska, W. Wang, K. E. Gerhardt, A. M. Khalid, D. M. Isherwood, and X.

D. Huang, "Three-year field test of a plant growth promoting rhizobacteria

enhanced phytoremediation system at a land farm for treatment of hydrocarbon

waste," Environ. Sci. Technol., vol. 43, no. 12, pp. 4472-4479, 2009.

[282] H. Saleem, "Plant-bacteria partnership: Phytoremediation of hydrocarbons

contaminated soil and expression of catabolic genes," B. Environ. Stud. J., vol.

1, no. 1, p. 19, 2016.

[283] C. E. Morris and J. M. Monier, "The ecological significance of biofilm

formation by plant-associated bacteria," Ann. Rev. Phytopathol., vol. 41, no. 1,

pp. 429-453, 2003.

[284] J. Wimpenny, W. Manz, and U. Szewzyk, "Heterogeneity in biofilms," FEMS

Microbiol. Rev., vol. 24, no. 5, pp. 661-671, 2000.

[285] H. Al-Awadhi, R. Al-Hasan, N. Sorkhoh, S. Salamah, and S. Radwan,

"Establishing oil-degrading biofilms on gravel particles and glass plates," Int.


[286] X. Zhu, W. Wang, D. E. Crowley, K. Sun, S. Hao, and M. G. Waigi, "The

endophytic bacterium Serratia sp. PW7 degrades pyrene in wheat," Environ.

Sci. Pollut. Res., vol. 24, no. 4, pp. 6648-6656, 2017.

[287] N. P. Blain, B. Helgason, and J. Germida, "Endophytic root bacteria associated

with the natural vegetation growing at the hydrocarbon contaminated

Bitumount Provincial Historic site," Can. J. Microbiol., doi/10.1139/cjm-2017-

0039, 2017.

[288] K. Rahman, T. J. Rahman, Y. Kourkoutas, I. Petsas, R. Marchant, and I. Banat,

"Enhanced bioremediation of n-alkane in petroleum sludge using bacterial

consortium amended with rhamnolipid and micronutrients," Bioresour.

Technol., vol. 90, no. 1, pp. 159-168, 2003.

[289] B. Cai, J. Ma, G. Yan, X. Dai, M. Li, and S. Guo, "Comparison of

phytoremediation, bioaugmentation and natural attenuation for remediating


121

saline soil contaminated by heavy crude oil," Biochem. Engg. J., vol. 112, no.

4, pp. 170-177, 2016.

[290] B. Basumatary and S. Bordoloi, "Phytoremediation of Crude Oil-Contaminated

Soil Using Cynodon dactylon (L.) Pers," in Phytoremediation, SUI: Springer,

2016, pp. 41-45.

[291] M. Guo, Z. Gong, R. Miao, D. Su, X. Li, and C. Jia, "The influence of root

exudates of maize and soybean on polycyclic aromatic hydrocarbons

degradation and soil bacterial community structure," Ecol. Engg., vol. 99, pp.

22-30, 2017.

[292] M. Balseiro-Romero, P. Gkorezis, P. S. Kidd, J. Vangronsveld, and C.

Monterroso, "Enhanced degradation of diesel in the rhizosphere of after

inoculation with diesel-degrading and plant growth-promoting bacterial

strains," J. Environ. Qual., vol. 45, no. 3, pp. 924-932, 2016.

[293] H. Ikeura, Y. Kawasaki, E. Kaimi, J. Nishiwaki, K. Noborio, and M. Tamaki,

"Screening of plants for phytoremediation of oil-contaminated soil," Int. J.

Phytorem., vol. 18, no.1, pp. 460-466, 2016.

[294] S. Ambreen, M. Javed, M. Hina, S. Rasul, Z. U. Zafar, and H. Manzoor,

"Influence of sub-lethal crude oil concentration on growth, water relations and

photosynthetic capacity of maize (Zea mays L.) plants," Environ. Sci. Pollut.

Res., vol. 23, no. 18, pp. 18320-18331, 2016.

[295] H. S. Alotaibi, A. R. Usman, A. S. Abduljabbar, Y. S. Ok, A. I. Al-Faraj, and

A. S. Sallam, "Carbon mineralization and biochemical effects of short-term

wheat straw in crude oil contaminated sandy soil," Appl. Geochem.,

doi.org/10.1016/j.apgeochem.2017.02.017, 2017.

http://doi.org/10.1016/j.apgeochem.2017.02.017

122

8 Appendices

Appendix A: Luria Bertani medium

Tryptone 5g/L, Yeast extract 2.5 g/L, Sodium cholride 2.5 g/L, Agar 15g/L

Appendix B: M9 medium

KH2PO4 100 mL/L, Na2HPO4. 2H2O 40 mL/L, Agar, 15 g/L, NaCl 5 mL/L, NH4Cl 5

mL/L, 1M CaCl2 100 µL/mL, 1000x Fe. EDTA 1000 µL/mL, 1000x Trace elements

1000 µL/mL, 1000x Vitamins 1000 µL/mL, Crude oil/ diesel 1 mL/mL,

Cyclohexamide 1 mL/mL

Appendix C: Sabouraud Dextrose agar

Peptone 10 g/L, Glucose 20 g/L, Agar 15 g/L

Appendix D: LG1 medium

Sucrose 5.0 g/L, K2HPO4 0.2 g/L, KH2PO4. 0.6 g/L, MgSO4. 7H2O 0.2 g/L, CaCl2.

2H2O 0.02 g/L, Na2MoO4. 2H2O 0.002 g/L, Fe (III) EDTA (1.64%) 4.0 mL/L, Vitamin

solution 1.0 mL/L

Appendix E: DF salts minimal medium

KH2PO4 10.8 g/L, K2HPO4, 42 g/L, MgSO4. 7H2O 7.5 g/L, CaCl2. 2H2O 0.6 g/L, NaCl

6.0 g/L, FeCl3. 6H2O 1.1 g/L, EDTA 15 mg/L, Glucose 10 mL/L, Agar 15 g/L, ACC

0.7 g/L

bacterial assisted phytoremediation of crude oil

Documents