asia pacific dental students journal

Volume 1 | Number 1 |August 2010

APDSJAsia Pacific Dental Students Journal

1

Asia Pacific Dental Students Journal

Asia Pacific Dental Students

JournalAugust 2010 Vol. 1 No.1

Editorial Editors-in-chief:

Melissa YapStanley Kamadjaja

PublisherAsia Pacific Dental Students

Association (APDSA)

International Executive Committee

APDSA 2009/2010

President: Rumi SatoGeneral Secretary: Chong Jun Ai

Treasurer: Karen Voon Editor: Stanley Kamadjaja

International Liaison Officer: Jack Ji Chao

SRC Coordinator: Melissa Yap President Elect: Peerapat

KaweewongprasertCountry Representatives:

South Korea: Koo Seung HwanTaiwan: Meng-Hsuan TuSingapore: Syazwan Lim

Cambodia: Sok Chenh Chhean

The Asia Pacific Dental Students Journal is the official scientific journal for the Asia Pacific Dental Students Association (APDSA). Copyright: All rights reserved. No part of this publication may be produced, stored in a retrieval system or transmitted, in any form or by any means (electronic, mechanical, photocopying, recording or otherwise, without the written persion of the publisher.

© 2010 Asia Pacific Dental Students Association

Manusript of Papers presented at the Scientific Research Competition (SRC), 37th Asia Pacific Dental Students Association (APDSA) Congress, Japan.

Oral Presentation3. Ultrasonic wave as an alternative technology to measure the elastic modulus of nano hybrid composite resinEka Sabaty Shofiah, Nina Djustiana, Renny Febrida, Amoranto Trisnobudi15. Dental pulp stem cells, recombinant human bone morphogenetic protein-2, hydroxyapatite-chitosan and their combination: effect on odontoblastic activity in rats (an in vivo study)Aimee Monica Santoso, Alexandra Karman, Linda Puspita22. Effect of the orientation of polyaromatic polyamide fibers on denture base resinJangwon Lee, Ji-Myung Bae, Seung-Han Oh35. Chemopreventive effect of hydrazone derivative on tongue cancer cells via inhibition of proliferation and apoptosis inductionKaren Voon Kai Rou, Nur Ayunie Zulkepli, Ban Tawfeek Shareef, Abdussalam Salhin, Bahruddin Saad, Azman Seeni45. Increased glutathione level in saliva of moderate gingivitis patients after lemongrass (Cymbopogon citratus) essential oil garglingStephanie Adelia Susanto, Theresia Anggita Oktavianti, Yessica Wijaya, Veni Wira, Vincentia Adya Paramitta53. Investigation of tooth development by using multiphoton microscopeChi h -Liang Ting ,Pei-Yu Pan, and Min-Huey Chen64. Curcuma zedoaria ethanol extract as antibacterial agent (in-vitro study)Andrew Laurent, Tira Catherine, Anindya Kamaratih Gunarso69. Peneaus monodon shrimp shell waste extract as therapy in mandibular osteoporosis wistar ratsCindy J. S, Melina W. H, Stephanie D., Attika B., Titik H.75. Increased gingival epithelial cell maturity of moderate gingivitis subjects after clove essential oil garglingLidya Noviana Arfiadi, Ardiny Andriani, Regina TC. Tandelilin, Alma Linggar Jonarta84. Bioactive and surface-functionalized robotic dispensing 3D scaffolds for bone reconstructionJooho Lee, Youngjin Hong91. Effects of oolong tea on the prevention of tooth demineralizationTao Chih Yun, Yu Shan Huey, Chiang Yu Chih, Lin Chen Ming, Lin Han Wei95. Effect of casting systems on castability and surface properties of chrome cobalt alloyKueh TS, Fazal Reza, Chee HT106. Effect platelet rich plasma (PRP) on bone regeneration and soft tissue healing following tooth extraction in rabbitsHaritzah Lazuardi Izzati, Dica Nilam Putri, Shinta Leo, Evie Lamtiur118. Inflammatory cytokines profile of stem cells from human extracted deciduous teeth (SHED)Tan S. J., Norliana G., Asiah A. B., Shamsuria O. and Nurul A. A.127. Physical and biological affect of fibronectin on GDP-treated titanium surfaceW u, S hih- H ui, Lee, Yi-Lun, Lee, Kuan-Han, Tsai, Pei-Yu135. The efficacy of lime calcium hydroxide from local product towards Enterococcus faecalisHilmanda, Wazillah Nasserie, Mieke Hemiawati Satari

2


1. ULTRASONIC WAVE AS AN ALTERNATIVE TECHNOLOGY TO MEASURE THE ELASTIC MODULUS OF NANO HYBRID COMPOSITE RESIN

Eka Sabaty Shofiah, Nina Djustiana, Renny Febrida, Amoranto Trisnobudi

Objective :To develop an ultrasonic method and find its accuracy as an alternative technology to measure the elastic modulus of nano hybrid composite and to know the effect of different sample thickness to the elastic modulus of nano hybrid composite. Methods:This research is an experimental study using 30 samples of nano hybrid composite (Grandio), divided into five groups of thickness which are 2 mm, 3 mm, 4 mm, 5 mm, and 6 mm. Every sample was given ultrasonic wave test based on the attenuation of ultrasonic wave propagating through resin and elastic modulus test using Universal Testing Machine according to ADAS No. 27 (1993). The empirical equation obtained showing correlation between both results is then tested statisically to find its accuracy. ANOVA test is used to show the effect of different sample thickness to the elastic modulus value.Results :The ultrasonic wave attenuation of the calibration samples has the range of 1,88 Nepper to 2,48 Nepper whereas elastic modulus has the range of 387,25 MPa to 239,59 MPa. By using regression analysis, the obtained empirical equation is E = -289,2αx2 + 1055αx -569. The validation measurement using other samples gives an accuracy of more than 95%. Statistically, the equation is significant and able to measure wider population. ANOVA test for the elastic modulus using UTM shows different sample thickness gives a significant effect to the value of elastic modulus. Conclusion:Ultrasonic wave method can be used directly as an alternative technology to measure the elastic modulus of nano hybrid composite with sufficient accuracy without breaking the sample and different sample thickness affects its elastic modulus.

INTRODUCTION

It is very important to know about mechanical properties from restoration materials to see their ability to adapt and work together with the tooth. Modulus of elasticity is one of the most important mechanical properties for restoration material. The value of modulus elasticity can tell us about the stiffness of material.16,17 The bigger intermolecular interaction force inside a material, the bigger modulus elasticity of the material, and so is the stiffness. Restoration material has to be stiff enough so when it is placed under force, the elastic deformation will be very small.12,17

In early 2003, nano hybrid composite was introduced. The combination between nanofiller and glass-ceramic microfiller higher than 87% weight in this composite creates an excellent mechanical properties and stability, especially its modulus of elasticity, tensile strength, and abrasive strength which make this material can be used for posterior restoration.8,13,16,17 Those properties can be achieved optimally by using an adequate polymerization process. Many factors can affect polymerization, such as the composite thickness.17 The reflection, scattering, and absorption process happened during polymerization can cause limited light penetration inside the composite, and this can affect the depth of cure.24

On the other hand, the search of an ideal restoration material will always been conducted. Particularly for restorations with high load application, its elastic modulus is hopefully high enough to counter deformation. Nowadays, the measurement of elastic modulus for brittle materials like composite still use a conventional method with direct mechanical test which cause a crack on the sample because of the direct force applied. So that one sample can only be used once only.1,12

In physics science, they have an ultrasonic wave theory which can be used for measuring any kind of mechanical properties of materials. By finding out the wave’s properties such as velocity and

3


attenuation, mechanical properties can be measured. The measurement process is very easy, fast and non-destructive. So, after samples being measured for one mechanical property, it still can be measured for other kind of mechanical properties needed.12,23

Considering this background, the aim of this study was to develop an ultrasonic method and find its accuracy as an alternative technology to measure the elastic modulus of nano hybrid composite and to know the effect of different sample thickness to the elastic modulus of nano hybrid composite.

MATERIALS AND METHODS

This experimental study using Grandio, nano hybrid composite from VOCO (Batch no.: +E22118121/$$08120910138E1O, expired date: 2012/08), was conducted in two laboratories in two different universities. The making of samples and the modulus of elasticity measurement using universal testing machine (Lloyd) based on ADAS No. 27 (1993) was done in dental material laboratory at Padjadjaran University while the ultrasonic measurement was done in ultrasonic laboratory at Bandung Institute of Technology. A total of 30 samples were divided into five groups of thickness which are 2 mm, 3 mm, 4 mm, 5 mm, and 6 mm.

Each group was given both ultrasonic and modulus elasticity testing, and the result from each tests were processed using Mathlab software. The empirical equation obtained showing correlation between both results was then tested statisically to find its accuracy. ANOVA test was used to show the effect of different sample thickness to the elastic modulus value.

Figure 1. Properties used to make specimens (1) Metal Mould (2) Mylar Strip (3) Plastic Spatula (4) Visible Light Curing Unit, Bluelight Mini (5) Vernier Caliper, Mitutuy

4

4

1 2 3

54


Figure 2. Devices used for ultrasonic wave method (1) 4001 pulse generator, Globas Specialities Coorporation and amplifier, Function Generator LFG 1310 (2) Specimen Holder (3) Transducer A & B (4) ETC M621 Digital Oscilloscope

(5) Computer and ultrasonic wave reader software

Figure.3 Device used for conventional mechanical test: Universal Testing Machine, Lloyd - Single Column Bench Mounted

RESULTS

During this experiment, problems found while testing the 2 mm and 6 mm samples. The 2 mm sample was not able to be tested with conventional mechanical test because it is too thin to resist compression load from the crosshead inside the universal testing machine. The 6 mm sample was not able to be polymerized successfully because of the use of same curing time for all sample thickness. The unpolymerized area of the composite in this sample causes disability for the ultrasonic wave to be transmitted through the sample. Considering those obstacles, this experiment was done only by using

5

5

1 2 3

4


data from 3 mm, 4 mm, and 5 mm samples.

The result from ultrasonic wave method test (attenuation and velocity) is as seen in Table 1, Diagram 1 and 2, and the result from modulus elasticity testing using universal testing method can be seen in Table 2 and Diagram 3.

Table 1. Average Result from Ultrasonic Wave Method Test

Sample Attenuation (Nepper)

Velocity (m/s)

3 mm 1.67 4051.81

4 mm 2.12 4022.52

5 mm 2.56 3973.62

Diagram 1. The Average of Attenuation Variations from Each Sample Thickness

Diagram 2. The Average of Velocity Variations from Each Sample Thickness

From those data we found that attenuation value varies more than velocity value. Based on this situation, the attenuation value was chosen to be a base for a new formula formation for the elastic modulus of nano hybrid composite.

6


Table 2. Average Result from Ultrasonic Wave Method Test

Sample Modulus of Elasticity (MPa)

3 mm 387.25

4 mm 368.73

5 mm 239.59

Diagram 1. The Average of Modulus of Elasticity from Each Sample Thickness

Those data of modulus elasticity value were tested statistically using ANOVA method, to see if there is any significant difference in the value of modulus elasticity between those samples subjected to different variables. From the test, we found the p value is 0,047 whish is smaller than significance value (0,05). It means that there is a real effect from different sample thickness with same curing time to the value of modulus elasticity using universal testing machine in nano hybrid composite.Both data (from ultrasonic method and from conventional mechanical test) were mergered, as can be seen in Graph 1. The correlation between them showed as a formula which then can be used to predict the modulus of elasticity value of nano hybrid composite without conducting a mechanical test. The formula is: y = -289,25x2 + 1055,8x – 569,05Where: y = Modulus of elasticity of nano hybrid composite (MPa)

x = Attenuation (Nepper)

7


Graph 1. Correlation between Attenuation and Modulus of ElasticityNext step is to test the validity of the formula to see how big is the error using 3 validation samples (different from previous). Every validation sample was measured using ultrasonic wave test to know its attenuation value, and the modulus of elasticity value was calculated using the new formula. After the modulus of elasticity value from the formula determined, we also did the conventional mechanical test using universal testing machine to know the real modulus of elasticity value. And next, both values were compared to see the error rate. Descriptively, the comparison between the modulus of elasticity value from the formula and from the conventional mechanical test were shown in Graph 2. In this graph we can see that both modulus elasticity value were almost appear as one line. This showed that the error rate from the formula was extremely small, only about 5,7%.

Graph 2. Result of Descriptive Valisity TestStatistic test using F test was also done to see if the formula can or cannot be used for other nano hybrid composite beside those samples used during the formation and the validity test of the formula

8


(wider population). The test was conducted using Statistica software with quadratic regression model test, both overall and partial. All test shows the result of p value was - < 0,05 alpha which means the formula is significant and can be used for wider population.

DISCUSSION

According to the data from table of measurement result of both wave quantities: attenuation and velocity, indicates the velocity data has smaller variation among the three treatment groups given. Based on this condition, the selected data to be the reference for the making of prediction formula for modulus elasticity will be the attenuation value. The small variation of ultrasonic wave velocity on nano hybrid composite material is presumably due to the ultrasonic wave velocity which is relatively susceptible to the porous in a material. The most suitable example for the case will be the research conducted by Djustiana and colleagues in 2008 concerning the usage of ultrasonic wave to measure the content of heat-cured acrylic resin porosity. The research shows that ultrasonic wave velocity when passing through acrylic resin and air existing in the porosity is extremely different.5 The bigger porosity of a material is, the lower of the ultrasonic wave velocity will be.22

According to the data of ultrasonic wave attenuation propagating through sample of nano hybrid composite as shown in Table 1, it indicates that attenuation value increased as the sample thickness increased. As the making of those three sample groups was conducted by using the same curing time, the polymerization depth occurred in those three groups was considered the same, as illustrated in Figure 4.

As illustrated in Figure 4, we can see that there are two formed composited areas; the more perfect polymerized composite (gray area) and the less perfect polymerized one (white area). This can eventually gives the idea about the different reaction occurred during the process of ultrasonic wave propagation passing through the sample. According to the theory and formula on wave energy absorption by medium, one of the components that has an important role is distance (noted as x) or called as sample thickness in this research. In short, the thicker the sample is, the more lost ultrasonic wave energy absorbed by medium will be. In addition, the process of wave reflection and transmission took place in consequence of the existence of two different composite areas was also influence the attenuation value. The composite area with longer wave transmission will have bigger attenuation value.3,12,21

Figure 4. Illustration of depth of polymerization took place in each sample

9


In sample with 3 mm in depth, the process of wave reflection and transmission were not happen, as the wave only passed through the area with perfect polymerized composite. Therefore, the formula for 3

mm sample will be . In sample with 4 mm in depth, on the other hand, there is a small

number of less perfect polymerized composite area; thus, ultrasonic wave undergoes transmission

process in distance x2. Hence, the formulation for 4 mm sample will be . In

sample with 5 mm in depth, the less perfect polymerized composite area is wider than was found in 4

mm sample (x3 > x2); hence, the formulation for sample 5 mm will be .

Figure 5. Illustration of ultrasonic wave attenuation phenomena and Transmission and Reflection process took place in each sample group (Ao = attenuation before entering the material, A1 = attenuation after entering sample 3 mm, A2 = attenuation after entering sample 4 mm, A3 = attenuation after entering sample 5 mm, x1= travelled distance of wave in/such as in sample 3 mm, x2= travelled distance of wave in the less perfect polymerized composite area in sample 4 mm, x3= travelled distance of wave in the less perfect polymerized composite area in sample 5 mm, α1= coefficient of attenuation along the travelled distance in/such is sample 3 mm, α2= coefficient of attenuation along the less perfect polymerized composite area in sample 4 mm, α3= coefficient of attenuation along the less perfect polymerized composite area in sample 4 mm)

Based on the modulus elasticity test with diametral tensile strength as mentioned in Table 2, it indicates a significant difference if compared with the elasticity modulus value of nano hybrid composite in several sources or literatures, such as in Grandio product review issued by VOCO who stated that the modulus elasticity value of nano hybrid composite is 17100 Mpa.9 This is particularly caused by the

10

x1x2

x1

Sample 3 mmα1

T

α1

x1

T

A3

Sample 5 mm

R

Ao

A2R

Ao

α3

α1A1

Ao

x3

Sample 4 mm

α2


different modulus elasticity testing technique applied. In the review of such product, three-point bending test was applied to determine modulus elasticity value of nano hybrid composite, so that such value may not be compared with testing result value in this research.

After the test using Universal Testing Machine is completed, then the stress-strain graph will appear on the screen of the computer. This graph shows several markers, including the greatest slope of point # 1. This marker shows the point where the sample begins to change in plastic deformation, so the measurement stopped in this moment. The ability to mark the greatest slope points # 1 on the graph through the diametral tensile strength test proves that although the tests performed until the sample destroyed, the value of modulus of elasticity using the diametral tensile strength was found convincing enough to be used as a reference for the formation of the prediction formula . As is also done by Junior and his colleagues in their research in 2007, they tried to measure the value of flexural strength and modulus elasticity of resin-based composite. In obtaining a second value of their mechanical properties, they used the three-point bending test until the samples were destroyed.11 Figure 6 shows stress-strain graphs appeared after the test was completed.

Other factors also affect the value of the test results of modulus elasticity is the condition of when the test was performed, such as exposure time, sample dimension, temperature, delay of measurement, etc.10 As mentioned in the literature, the delay of measurement on the composite will cause post-irradiation polymerization and thereby increased its modulus elasticity.2,10,19 This was caused by changes of conversion degree in light-cured composite that can still occur until 24 hours after the process began to take place due to polymerization reactions in the composite group of methacrylate.18

In this research, the delay was about 30 hours, it is because before the test, specimens were immersed in 37oC distilled water for 24 hours and there was a lapse of time happened since the ultrasonic test and measurement using the UTM test conducted at two different locations.

The different value of modulus elasticity from the value in product reviews could be caused by temperature difference when the test was performed. As stated by El-Mahallawy and colleagues in 2009 in their research on the mechanical properties of cement, the modulus elasticity at the test using temperature of 23o C and 37o C have different.6 In this research, the sample first soaked in distilled water with a temperature of 37o C. Temperature of 37o C is the temperature of the oral cavity.6

Figure 6. Stress-Strain Graph appeared after the test was doneIn the data related to the measurement of modulus elasticity of nano hybrid composite using UTM, there are a few samples values which were outside the standard deviation in each group of sample. This

11


was apparently due to the cylindrical sample shape which was not achieved perfectly, so that the contact point between the sample and the crosshead at the top and bottom samples using diametral tensile strength test was not successfully obtained. Imperfection of this condition resulted a vertical compression force which should have resulted in pressure drop with the direction perpendicular to the vertical plane through the center does not occur perfectly, so that the values obtained could not be used as reference data for the making prediction formula.1 Therefore, the result of data measurement of modulus elasticity by using UTM only based on few samples, for the 3 mm sample 4 data used, 4 mm sample 3 data used, and for 5 mm sample 4 data used.

From the results of modulus elasticity test of nano hybrid composite, the statistical test concluded there was a significant effect of those treatments (3 mm, 4 mm, 5 mm) to the modulus of elasticity value with UTM. As noted by Sakaguchi and colleagues in 2002 that the change of modulus of elasticity for resin-based material related to the degree of polymerization, or also known by the degree of conversion.20

The degree of conversion in composite is influenced by the thickness of the composite, exposure time, the composition of light-cured composite, and the cure intensity.7 If the thickness of the composite increased, the distance between the tip of light curing unit and the deepest part of the composite also increased. Due to a decrease in light intensity between the top and bottom surface of the composite, the degree of conversion will also decreased.17 Based on the study by Osman and colleagues in 1990 suggested that the mechanical properties of resin-based restoration materials are not only determined by the natural character of the monomer molecules in it but is also influenced by the degree of conversion in double chains, and this will affect the increase bond cross-links in the polymer resin.14

Based on data in Table 2, shows the modulus of elasticity decreases as the thickness of the sample increased. This condition occurs because of the same exposure time on all three types of treatment, resulted the differences degree of conversion in each type of thickness. In addition, granting the same time radiation exposure produces nearly the same depth in all samples. The result shows the thicker sample, the more composite parts that are not polymerized. As noted by David and colleagues in 2007, the composite parts which were not polymerized will make the value of modulus elasticity become smaller due to the difference in bond forming cross-links in composite areas which exposed to light and not exposed to light.4 So was the study conducted by Oudshoorn and colleagues in the year 2007 had noted, regarding methacrylate polymer polymerization of hyaluronic acid chains, they declared that the more methacrylate groups attached to the hyaluronic acid chain, the more bond cross-links occurred, resulting the increase of the value of modulus of elasticity.15 Another study conducted by Gardel and his colleagues in 2004 also concluded that the mechanical stiffness values may vary due to a slight difference in the concentration of cross-linking bonds inside the material.8

Polymerization process starts and continues to take place when there is sufficient light intensity to stimulate camphorquinone (CQ). CQ is a photoinitiator that interacts with the amine to form free radicals to initiate the polymerization process.1 If the thickness of the composite increases, the number of available photons from the light irradiation to activate CQ become limited. It is also influenced by the factors on the molecular absorption and scattering of the composite material compilers. These limitations result less chance of interaction that occurs between CQ with amines. Therefore, additional exposure time is required on a thicker composite restoration.4

There is a little difference in the value of modulus elasticity of composite samples with 3 mm and 4 mm thickness when compared with the modulus elasticity in the sample with a 5 mm thickness. This is probably due to the exposure time used on all samples is actually a sufficient exposure time for the composite with 3 mm thickness which is 40 seconds. In the guide for the use of nano hybrid composite,

12


the recommended exposure time for polymerization was 20 seconds for 2 mm thick composite.9 Thus, the degree of polymerization occurred in the 3 mm and 4 mm sample in relatively the same. However, different things happen in the 5 mm thick sample because in this sample, there are more composite areas that are not polymerized and cause lower modulus elasticity value.4 So, to get a composite with good mechanical properties, the incremental curing technique should be conducted.17

From the explanation of the theory of attenuation and modulus of elasticity of materials, both of them were actually related to each other indirectly. However, from a graph of attenuation relations with the modulus of elasticity (E), it was concluded that the higher value of modulus elasticity of the nano hybrid composite, the lower attenuation value will be. Relations between them are defined by the formula y = -289.25 + 1055.88 x x2 - 569.05 which is about 94.2% accurate based on validity test. This indicates that the formula can be used to calculate the value of modulus elasticity for nano hybrid composite without doing a conventional mechanical test with a Universal Testing Machine. Significant results from the quadratic regression showed that the formulation can be used to measure the modulus elasticity of nano hybrid composite with any conditions of such samples without breaking them.

REFERENCES

1. Anusavice, K.J. 2003. Phillip’s Science of Dental Materials. 11th ed. Philadelphia. W. B. Saunders Company. 80-83, 399-440 pp.

2. Braem, M., P. Lambrechts, V. van Doren, and G.Vanherle. 1986. The impact of composite structure on its elastic response. Journal of Dental Research. 65(5):648-653.

3. Cheekee and J.N David., 2002. Fundamental and Application of Ultrasonic Waves. Washington, USA. CRC Press LLC. 261-265 pp.

4. David, J.R., Osnara M.G., Joao C.G., Alessandro D.L., and Alessandra R. 2007. Effect of exposure time on curing efficiency of polymerizing units equipped with light-emitting diodes. Journal of Oral Science. 49(1):19-24.

5. Djustiana, N., R. Febrida, A. Trisnobudi, dan Ilmilda. 2008. Porosity analysis using ultrasonic waves of nylon thermoplasic and heat cured acrylic resins with different thickness. Proceeding AOHC and 2ndAMDPH. Bandung. Sono Offset. 214-222 pp.

6. El-Mahallawy, S., Fatma E.H., and Amani M.K. 2009. Influence of stimulated oral condition on the mechanical properties of luting cements, bases, and liners. Egypt Dental Journal. 55(3.1):1991.

7. Emami, Nazzanin. 2004. Variables affecting stress development and conversion in dental light-cure composites during photo-polymerization. Available online at http://epubl.luth.se/1402-1544/2004/08/index-en.html

8. Gardel, M.L., J.H. Shin, F.C. MacKintosh, L. Mahadevan, P. Matsudaira, and D.A. Weitz. 2004. Elastic behaviour of cross-linked and bundled actin networks. Science Magazine. 304(5675):1301-1305.

9. Grandio. 2006. Grandio scientific documentation. Voco GmbH. Available online at: http://www.voco.com/en/products/products/grandio/index.html

10. Helvatjoglu-Antoniades, M., Y. Papadogiannis, R.S. Lakes, P. Dionysopoulos, and D. Papadogiannis. 2006. Dynamic and static elastic moduli of packable and flowable composite resins and their development after initial photo curing. Dental Materials. 22:450-459.

11. Junior, S.A.R, C.H. Zanchi, R.V. de Carvalho, and F.F. Demarco. 2007. Flexural strength and modulus of elasticity of different types of resin-based composites. Brazilian Oral Research. 21(1):16-21.

12. Kinsler, L.E., A. Frey, A.B Coppens and J.V. Sanders. 2000. Fundamentals of Acoustics. New York. John Wiley & Sons, Inc. 315-316 pp.

13. Levine. E., H.H.K. Xu, J.L. Moreau, and H. Strassler. 2009. Dental nanocomposites: mechanical properties in long-term water-aging. IADR 87th General Session and Exhibition Paper. Available online at: http://iadr.confex.com/iadr/2009miami/Paper120295.html

14. Osman, E., El-Kady, and Kandil S.H. 1990. Effect of residual monomer on the strength of restorative resins. The Saudi Dental Journal. 2(1):3-6.

15. Oudshoorn, M.H.M., Robert R., Joke A.B., and Wim E.H. 2007. Synthesis of methacrylated hyaluronic acid with tailored degree of substitution. Polymer. 48(7):1915-1920.

13

Asia Pacific Dental Students Journal 16. Powers, J.M. and R.L. Sakaguchi. 2006. Craig’s Restorative Dental Materials. 12th ed. St. Louis. Mosby Inc. 55-71,

189-212 pp.17. Roberson, T.M., H.O. Heymann, and E.J. Swift. 2006. Sturdevant’s Art and Science of Operative Dentistry. 4th ed. St.

Louis. Mosby, Inc. 133-226, 500-512 pp.18. Ruyter, I.E. and Svendsen, S.A. 1978. Remaining methacrylate groups in composite restorative materials. Acta

Odontolgica Scandinavica. 36(2):75-82.19. Sabbagh, J., J. Vreven, and G. Leloup. 2002. Dynamic and static moduli of elasticity of resin-based materials. Dental

Materials. 18(1):64-71.20. Sakaguchi, R.L., Nilam C.S., Bum-Soon L., Jack L.F., and Svenn E.B. 2002. Dynamic mechanical analysis of storage

modulus development in light-activated polymer matrix composites. Dental Materials. 18(3):197-202.21. Trisnobudi, A. 2000. Teori Ultrasonik. Bandung. Penerbit ITB. 10-13 pp.22. Trisnobudi, A. dan B. Sunendar. 1991. Korelasi empiris antara kecepatan gelombang ultrasonik dan porositas resin

akrilik yang digunakan sebagai bahan pembuat dasar geligi tiruan. Bandung. Laporan Penelitian ITB. Available online at: http://www.tf.itb.ac.id/penelitian-dip-itb

23. Trisnobudi, A., Herda, E. dan Parangtopo. 1996. Aplikasi Uji Tak Merusak Ultrasonik Untuk Menentukan Modulus Elastisitas Dari Paduan Ag-Sn Dan Co-So Yang Digunakan Sebagai Bahan Pencampur Untuk Membuat Amalgam. Available online at: http://digilib.batan.go.id

24. van Noort, R. 2007. Introduction to Dental Materials. 3rd ed. London. Mosby Elsevier. 99-126 pp.

14


2. DENTAL PULP STEM CELLS, RECOMBINANT HUMAN BONE MORPHOGENETIC PROTEIN-2, HYDROXYAPATITE-CHITOSAN AND THEIR COMBINATION: EFFECT ON ODONTOBLASTIC ACTIVITY IN RATS (AN IN VIVO STUDY)

Aimee Monica Santoso, Alexandra Karman, Linda Puspita

Background: Pulp-capping has been undertaken using various materials, each with their own advantages and disadvantages. To overcome the disadvantages, other alternative materials which are of biological nature have been studied. It is known that Dental Pulp Stem Cells (DPSC), Bone Morphogenetic-2 (BMP-2) and Hydroxyapatite-Chitosan (HA-C) have the ability to induce odontoblastic activity, hence resulting in reparative dentin formation. Objectives: to compare the efficiency of DPSC, BMP-2, IHA-C and their combination as bioengineered pulp-capping materials on rats. Methods: Twenty Sprague-Dawley rats (3 months old) were kept in Animal House Facility Faculty of Medicine University of Indonesia. They were divided into 5 groups: Control (A), DPSC (B), DPSC+IHA-C (C), DPSC+BMP-2 (D) and DPSC+IHA-C+BMP-2 (E). Access cavity as far as the pulp was made on the incisors of each rat; to be then was exposed with lipopolysaccharide (LPS) to induce mild pulp inflammation and sealed using ZnOE. After 6 hours, the restorations of group B to E were removed and the tested materials were applied to each rat according to its group. Sampling of rat’s pulp cells was done by extracting the incisors of two rats of each group after 7 days, followed by the rest after 14 days. All of these procedures were undertaken under ether anesthesia. Alkaline Phosphatase (ALP) levels were then measured and the data were analyzed statistically using Kruskal-Wallis test. Result: The highest ALP level was found on the 14th day. On average, the highest ALP level was reached by the combination of DPSC and BMP-2, followed by DPSC, DPSC+IHA-C and finally DPSC+IHA-C+BMP-2. However, the differences were statistically not significant. Conclusion: DPSC, IHA-C, BMP-2, and their combination may induce odontoblastic activity in vivo. The combination of DPSC and BMP-2 appear to be the combination with better result.

INTRODUCTION

Irritation of pulpal tissues will result in an inflammation, generally referred as pulpitis. The irritants range from living to nonliving irritants. However, they tend to have one similarity: they reach the dental pulp through the coronal caries.1,2 According to the Department of Health of Indonesia, in 2004, 90.05% cases of oral pathology are caries. A research stated that even from incipient carious lesions, without cavity on the enamel surface, the microorganism could reach the pulp through the dentinoenamel junction.2,3

By definition, reversible pulpitis is inflammation of the pulp that is not severe.1 By eliminating the irritant, the pulp will return to an asymptomatic and uninflamed state.4 One of the treatment choice for reversible pulpitis is pulp capping. Pulp capping is the protection of a slightly exposed healthy pulp to recover and maintain its normal vitality and function.5

In the effort of finding better materials with ideal properties, researchers are developing other possible materials for pulp capping: Dental Pulp Stem Cells (DPSC), Bone Morphogenetic Protein-2 (BMP-2), and Hydroxyapatite-Chitosan (HA-C). These materials are of biological nature; hence it is addressed as bio-engineered pulp capping.

DPSC is a multi-potent progenitor cell that can differentiate into a number of cells, one of them is odontoblast. DPSC also has the ability to induce odontoblastic activity of the pulp. This activity will result in regenerative dentin formation, which is the aim of the pulp capping procedure.7

15


Bone Morphogenetic Protein (BMP) is a genetically produced protein that can generate bone reproduction.8 Specifically, BMP-2 plays an important role in the development of bone and cartilage. In vivo, these BMPs stimulate mesenchymal cells into cartilage and bone-forming cells.9

Hydroxyapatite is used in Orthopedics due to its similarity to the mineral constituent of hard tissues. Chitosan is a natural polymer known for its biocompatibility and regenerative properties. The combination of these two materials offers a promising localized bone regeneration.10

In this research, the effect of DPSC, BMP-2, HA-C, and their combination as pulp capping materials to form regenerative dentin will be analyzed carefully. It is expected that a certain combination of materials with the purpose of optimally inducing odontoblasts in pulp capping procedure will be discovered.

METHOD

This study was done on 3 months old rats in Animal House Facility of Medical Faculty University of Indonesia and Oral Biology Laboratory, University of Indonesia. A total of 20 Sprague-Dawley rats were chosen for this study. They were divided into 5 groups: control (A), DPSC (B), DPSC+HA-C (C), DPSC+BMP-2 (D) and DPSC+HA-C+BMP-2 (E).

During all procedures, the rats were under ether anesthesia. In order to induce mild pulp inflammation, 10 mg/ml of LPS (lipopolysaccharide) was introduced to the pulp. An access cavity was drilled on each rats’ incisor and the LPS was injected. The cavity was then sealed with ZnOE.

After 6 hours, the access cavity was re-opened to expose the inflamed pulp. The respective materials were then injected with a micropipette into the cavity of rats in group B through E. The access cavity was sealed again with ZnOE.

Data was collected on day 7 and day 14. At those days, the incisors of 10 rats were extracted (two rats from each group). The teeth were then weighed individually, and crushed to powder by mortar and pestle. These samples were then resuspended in PBS (Phosphatase Buffer Saline) solution and kept at -20°C.

After the data was collected, the samples were analyzed using ALP test. This test was carried out using spectrophometer with 405 nm absorbance level. Statistical analysis was performed by Shapiro-Wilk and Kruskal-Wallis test using SPSS version 17.0.

Ethical clearance was obtained from Ethical Committee, Faculty of Dentistry University of Indonesia.

RESULT

Alkaline phosphatase level was measured on day 7 and 14. The highest ALP level was found on day 14 (p=0.256). On average, the ALP level was higher on the combination of DPSC + rhBMP-2, followed by DPSC, DPSC + HA-C, DPSC + HA-C + rhBMP-2 and control (p=0.363). However, these differences were statistically not significant (Kruskal-Wallis test).

16


Table 1 Alkaline phosphatase level on day 7

Control DPSC DPSC+HA-C DPSC+rhBMP-2

DPSC+rhBMP-2+HA-C

Day 7 1.865 1.818 1.868 1.905 1.744

1.74 1.772 1.797 1.871 1.778

1.821 1.791 1.768 1.685 1.731

1.837 1.841 1.863 1.767 1.694Table 2 Alkaline phosphatase level on day 14


DPSC+rhBMP-2+HA-C

Day 14 1.749 1.899 1.607 1.931 1.777

1.818 1.892 1.831 1.76 1.712

1.673 1.865 1.847 1.923 2.054

1.75 1.763 1.87 1.907 1.954Table 3 Average alkaline phosphatase level


DPSC+rhBMP-2+HA-C

Mean day 7 1.81575 1.8055 1.824 1.807 1.73675

Mean day 14

1.7475 1.85475 1.78888 1.88025 1.87425

MEAN 1.78163 1.83013 1.80644 1.84363 1.8055

17


Chart 1. Alkaline phosphatase level

Data distribution was analyzed with normality test Shapiro-Wilk, because the sample size was small. As the result shows that the data are not normally distributed, a non-parametric test was then performed (Kruskal-Wallis).Statistic 1 Normality test Shapiro-Wilk

Statistic 2 Kruskal-Wallis test day 7 and 14

18


Statistic 3 Kruskal-Wallis test group A, B, C, D and E

DISCUSSION

According to Department of Health Republic of Indonesia in 2003, pulpitis was one of ten major illnesses in Indonesian hospitals.11 Pulpitis may lead to loss of vitality of the tooth. But while it is still reversible, one of the procedures that can be done is pulp capping. The main purpose of pulp capping is to seal the pulp from bacteria and to induce reparative dentin formation.12

Currently, pulp capping has been undertaken using various materials, each has their own advantages and disadvantages. For example, MTA (Mineral Trioxide Aggregate) and Ca(OH)2. Although MTA has the ability to form dentin bridge rapidly, it does not degrade. Meanwhile, Ca(OH)2 excels in inducing reparative dentin formation, but forms necrotic layer of the pulp.

Lately, regenerative endodontic procedures are the highlight of dentistry. This procedure can also be used to replace conventional pulp capping materials in the future. To achieve good tissue regeneration, three key materials are required: stem cell, growth factor and scaffold.13 In our study DPSC, rhBMP-2, and HA-C act as these three key materials respectively. These materials are of biological nature, therefore biocompatible.

Several studies have demonstrated each of the materials capability. Among them are Gronthos et al16, who stated that it was possible to induce dentin formation from DPSCs placed subcutaneously in mice; Nakashima et al17, whose result showed the importance of BMP as growth factor in tissue engineering; and Berger et al18 that suggested that chitosan can be a scaffold for cell culture.

Although studies have been performed on these materials, their comparison to each other or combined are not yet understood. Our study suggested that DPSC+rhBMP-2 is the combination with a better result. This is not in accordance with our hypothesis. Our hypothesis was that DPSC+rhBPM-2+HA-C would be the better combination. It turns out that material with the better result was DPSC+rhBMP-2, followed by DPSC, DPSC+HA-C and finally DPSC+HA-C+BMP-2.

This is probably due to the characteristics of reparative dentin. When the pulp is exposed and infection takes place, odontoblasts at the site of injury will die. This will induce differentiation of DPSC into new

19


odontoblast with the help of rhBMP-2. These odontoblasts will lay down atubular dentin called osteodentin or dentin bridge which acts as a scaffold. Therefore, when we add HA-C into the combination, it heightens the cell burden. As a result, the cells will be less likely to proliferate.

However, all of the test group results were still better than control group. This result is in line with the individual studies by d’Aquino et al13, Iohara et al14 and Pramanik et al15. Other information that we discovered was that the highest ALP level was found on day 14. This is in harmony with cell growth curve theory that ascertains the relationship between cell growth and time.Chart 2. Cell growth curve19

CONCLUSION

This study suggested the use of DPSC, rhBMP-2, HA-C and their combination can induce odontoblastic activity in vivo. We believe that in the future these materials will finally be able to replace conventional pulp capping materials and endodontic treatment, and also enhance tissue engineering knowledge in clinical dentistry.

REFERENCES1.Walton RE, Torabinejad M. Principles and Practice of Endodontics. 3rd ed. Philadelphia: W.B. Saunders 2002; p. 28-35.

2.Ingle JI, Bakland LK. Endodontics. 5th ed. Hamilton: BC Decker Inc 2002; p. 96.

3.Departemen Kesehatan. Pelayanan Medik.

4.Cohen S, Burns RC. Pathways of the Pulp. 8th ed. St. Louis: Mosby 2004; p. 27, 423-429, 804-811.

5.Grossman, LI. Endodontic Practice International Edition. 8th ed. Philadelphia: Lea & Febiger 1974; p.93.

6. Modena KCS, Casas-Apayco LC, Atta MT, et al. Cytotoxicity and Biocompatibility of Direct and Incirect Pulp Capping Materials. Journal of Applied Oral Science 2009; 544-54.

7.Murray PE, Garcia-Godoy F, Hargreaves KM. Regenerative Endodontics: A Review of Current Status and a Call for Action. Journal of Endodontic 2007; 33:377-390.

8.Sandhu HS. Bone Morphogenetic Protein (BMP): The Latest in Bone Growth Ehancement for Spinal Fusion.

9.Issa JPM, do Nascimento C, Barbosa RES, et al. Morphogenetic Protein rhBMP-2 and New Bone Formation. International Journal of Morphology 2006; 323-330.

10.Granja PL, Silva AIN, Borges JP, et al. Preparation and Characterization of Injectable Chitosan-Hydroxyapatite Microspheres. Key Engineering Materials 2004

20

Volume 1 | Number 1 |August 201011.Kesehatan Masyarakat dan Lingkungan.

12.Seltzer S, Bender IB. The Dental Pulp Biologic Considerations in Dental Procedures. Philadelphia: J.B. Lippincott Company 1965; p. 51-63.

13.d’Aquino R, de Rosa A, Laino G, et al. Human Dental Pulp Stem Cells: From Biology to Clinical Applications. Journal of Experimental Zoology 310B 2008.

14.Iohara K, Nakashima M, Ito M, et al. Dentin Regeneration by Dental Pulp Stem Cell Therapy with Recombinant Human Bone Morphogenetic Protein 2. Journal of Dental Research 83(8) 590-595, 2004.

15.Pramanik N, Mishra D, Banerjee I, et al. Chemical Synthesis, Characterization, and Biocompatibility Study of Hydroxyapatite/Chitosan Phosphate Nanocomposite for Bone Tissue Engineering Applications. International Journal of Biomaterials 2009.

16.Gronthos S, Mankani M, Brahim J, et al. Postnatal Human Dental Pulp Stem Cells (DPSCs) in vitro and in vivo. Proceedings of the National Academy of Sciences of the United States of America 97(25) 13625-13630, 2000.

17.Nakashima M, Reddi AH. The Application of Bone Morphogenetic Proteins to Dental Tissue Engineering. Nat Biotechnol 21(9) 1025-32, 2003.

18.Berger J, Reist M, Mayer JM, et al. Structure and Interactions in Covalently and Ionically Crosslinked Chitosan Hydrogels for Biomedical Applications. Europian Journal of Pharmaceutics and Biopharmaceutics 57 19-24, 2004.

21


3. EFFECT OF THE ORIENTATION OF POLYAROMATIC POLYAMIDE FIBERS ON DENTURE BASE RESIN

Jangwon Lee, Ji-Myung Bae, Seung-Han Oh

Introduction :Clinically, dentures are susceptible to fracture, due to fatigue or impact failure. Therefore, many kinds of fibers have been tried to reinforce denture base resins. Among them, polyaromatic polyamide(aramid) fiber with high elastic modulus was chosen. The objective of study was to evaluate the effect of orientation(unidirectional, bidirectional and random) of aramid fibers on denture base resin. Materials & Methods: Heat-curing resin(Vertex RS, Dentimax, Netherlands) was used as denture base resin. Aramid fiber(Heracron, Kolon Industries, Inc, Gumi, Korea) was used to reinforce the denture base resin. The orientation of fibers were unidirectional, bidirectional and random orientation(non-woven and sheet type). The flowable state heat-curing resin was applied to pre-impregnate the fibers. All fibers were located at the bottom of the specimens, and the compressive molding technique was used to cure the resins. According to ISO 1567, specimens were cut to the size of 65 × 10 × 3.3 mm. To measure them, the three-point bending test was performed using universal testing machine(Z020, Zwick) at a crosshead speed of 5 mm/min.Statistical analysis was done by one-way ANOVA and Duncan’s multiple range tests(α=0.05).Result: The flexural strengths, modulus, and toughness were unidirectional > bidirectional > non-woven and sheet(p<0.05). In flexural strength and toughness, only unidirectional and bidirectional reinforced the denture base resin significantly, while in flexural modulus, all fiber orientations increased the denture base resin significantly(p<0.05). Conclusion:Unidirectional was most effective in reinforcing denture base resin in the flexural strength, modulus, and toughness. Because bidirectional type is less technique sensitive, it could be applied in denture as well as unidirectional type. Non-woven and sheet type with random orientation were not effective in reinforcing denture, while they may be useful in fixed partial denture, where multi-directional forces are applied.

INTRODUCTION

Dental fractures are one of the most common clinical problems in the field of prosthodontics and are mainly expressed by two patterns, fatigue failure and the impact failure [1]. Fatigue failure occurs as a consequence of the repeated flexing of dentures under mastiatory forces [2-4]. This type of failure can be cuased by the development of microscopic cracks in the areas of stress concentration [5]. Impact failure occurs as a reult of a sudden blow to a denture or accidental dropping of a denture during cleaning, coughing or sneezing [4,5]

The conventional method of fortifying denture base resin is the addition of metal wires or plates to the denture base. However, metal reinforcing materials are problematic in terms of the lack of their bond strength with the resin matrix and stress localisation [6]. To solve these problems and to enhance the mechanical properties of denture base resin itself, the addtion of cross-linking agents, rubber particles and fillers in the resin matrix have been suggested [7-9]. Recently, various kinds of fibres have been used to reinforce the denture base resin [10,11]. Fibre-reinforced composite (FRC) is composed of the matrix and the dispersed phase, which includes materials such as fibres. Each phase is chemically different and separated by a distinct interface. FRC is employed to improve the mechanical properties of resin by embedding fibres into the resin matrix [12,13]. Carbon, glass, ultra high molecular weight polyethylene (UHMWPE), and polyaromatic polyamide (polyphenylene terephthalamide; aramid) fibres can be used as the reinforcing fibres for FRC. Among these, carbon fibre is difficult to use in denture base due to its aethetically unappealing dark color [10]. Therefore, glass of UHMWPE fibres

22


might be the materials aethetically better suited for this purpose. Many studies have examined glass fibre reinforments because glass fibres have good aethetic properties and favourable mechanical properties [10, 14-16]. Glass fibre has a high strength, but its elastic modulus is not so high, whereas aramid fibre is strong and stiff [12]. Aramid fibre has a high tensile strength (3.6-4.1 GPa) and elastic modulus (131 Gpa), and can be used in bulletproof vests, aircraft wings, tires and other materials [13,17]. It has been reported that aramid fibres have been shown to increase the impact strength of polymethyl methacrylate (PMMA) resin significantly and to enhance the fracture resistance of acrylic resin [17-19]

The fibre type, the diameter and length of fibre, the weight ratio of resin to fibre, the location and orientation of fibres in the resin matrix, the adhesion between fibres and the resin matrix, and the pre-impregnation of fibres play a crucial role in reinforcing the resin matrix [20-22]. There have been many studies on the effects of the concentration and orientation of glass fibres on the reinforcement of denture base resin [23-26]. For aramid fibres, there are several studies that have tested the effect of fibre concentration on the reinforcement of denture base [10,11]. However, to the author's knowledge, studies addresing the effect of the orientation of aramid fibres on denture base reinforcement have not yet been published.

The goal of this research was to determine which orientation of aramid fibres, unidirectional, bidirectional, non-woven or paper-type, is most effective in reinforcing denture base resin. The tested null hypothesis was that the reinforcing effects of aramid fibres with unidirectional, bidirectional, non-woven, and paper orientations are not different in the reinforcement of denture base resin interms of flexural properties.


Specimen preparation

In this study, heat-polymerised denture base resin (Vertex RS, Vertex Dental B. V., Zeist, Netherlands) was used as the denture base resin. The aramid fibres were provided by Kolon Inc. (Gumi, Korea) (Table 1). Three orientations of aramid fibres were tested: unidirectional, bidirectional, and random orientations. The random orientation was subdivided into the non-woven and paper-type groups. Each group of fibres was prepared with a similar volume percentage, and the volume percentage of each fibre is listed in Table 1. Using the density determination kit (YDK01, Sartorius AG, Goettingen, Germany), the density and weight of each fibre were measure. The volume percentage of each fibre was calculated from the data of fibre density and weight. In preparing the unidirectional group, aramid fibres were aligned unidirectionally on a polytetrafluoroethylene (PTFE)-coated glass fabric (Biscor-Tex 13-260, Biscor, West Yorkshire, UK) and fixed by heat-polymerised denture base rein with a low P/L ratio (3g/9g). Then, these fibres were cut to the size of 64 x 50 mm. The bidirectional and non-woven groups, both of which are pre-fabricated fibre types, were cut into the same size as that of unidirectional group. The paper-type of fibres were fabricated by our laboratory using the wet-laid non-woven process [27]. Briefly, aramid fibres were cut into small pieces of 3-4mm and then ground three times for five minutes each by an ultra fine friction grinder (Supermasscolloider, Model MKZA 10-15J, Masuko Sangyo Co. Ltd. Japan) at 900-1000 rpm to fibrillate the surfaces of the fibres. One and a half grams of ground fibres were added to 2000mL of water with 0.1g/L polyacrylamide (PAM) and 0.2 g/L

23


diallyldimethyl ammonium chloride (DADMAC) as cohesive and dispersing agents, respectively. The fibre dispersion was filtered with stainless steel mesh and then dried until a paper of approximately 0.35-0.4 mm thickness was formed. The paper cut the same way as those of the other experimental groups.

Table 1.

According to ISO 20795-1: 2008 (Dentistry-Base polymers-Part 1: Denture base polymers), dental stone negative moulds (65 x 50 x 5mm) were prepared in denture flasks using a brass metal die (Fig. 1a) [28]. A mixture of polymer and monomer with a low P/L ratio (4g/ 8g) was applied in the mould to pre-impregnate the fibres. Then, each fibre layer prepared was dipped into the resin of the mould. After a mixture of polymer and monomer with the P/L ratio (12.9g/ 5.7g) recommended by the manufacturer was allowed to reach the dough stage, it was kneaded for 30 seconds and packed over the fibres in the mould. The flask was then immersed in a water bath (M-9, MESTRA, Bilbao, Spain). The temperature was raised to 74 °C with maintenance for two hours and then increased to 100 °C with sustension for one hour. After the completion of the polymerisation cycle, the flask was allowed to cool at room temperature for 30 minutes and was then placed under flowing water for 15 minutes. After deflasking, the thickness of the specimens were reduced to 3.3 mm with a series of abrasive papers (200, 400, 600, 800, 1200 grit) using a grinder-polisher (METASERV, Buehler, Coventry, England). According to ISO 20795-1, the specimens were then cut to the final size of 64 mm x 10 mm x 3.3 mm using a low-speed saw (ISOMET, Buehler, Lake Bluff, Ill) (Fig. 1b). As a control group, heat polymerised denture base resin alone was used. Ten specimens for each group were prepared. Before testing, the specimens were stored in a water bath at 37 °C for 50 hours according to ISO 20795-1.

Figure 1.

Three-point bending testThe flexural strength, flexural modulus, and toughness of each specimen were measured in a three-point bending mode using a universal testing machine (Z020, Zwick, Ulm, Germany) at a crosshead speed of 5 mm/min. The span of the supports was 50mm. The flexural strength, modulus and toughness were calculated by a program (testXpert 11.0, Zwick, Ulm, Germany) in the universal testing machine. The flexural strength (σ) and the flexural modulus (E) were calculated using the following formulas:

where F is the maximum load (N) applied at the highest point of the stress-strain curve, l is the span length (mm), b is the width of the test specimen (mm), h is the thickness of the test specimen (mm), and d is the deflection (mm) corresponding to a load F1 at a point in the linear portion of the trace to provide the stiffness value.

24


The toughness corresponds to the area under the stress-strain curve, which was automatically calculated by the program mentioned above

.Failure mode analysisThe fracture sites were observed by the naked eye and were classified into three groups. In group A, both the fibres and resin were completely fracture into two parts. In group B, the denture base resin was completely fractured, while the fibres were partially fractured. In group C, the resin was completely fracture, and there was a delamination between the resin and the fibre layers (Fig. 2)

Figure 2.

Scanning electron microscopic observation

A fractured section of a specimen in each group was embedded in acrylic resin (Ortho-Jet, Lang Dental, Wheeling, West Virginia) with the broken surface exposed. The surface was finished with a series of abrasive papers (200, 400, 600, 800, 1200, and 2000 grit) followed by polishing with a pan cloth with 5 μm aluminium oxide and suede cloth with a 0.3 μm aluminium oxide.

The cross section of the fibre alignment and the interface between the fibre and resin were observed by scanning electron microscopy (JSM-6360, Jeol Ltd., Tokyo, Japan) at the magnification of 200X.

Statistical analysis

The data were analysed with the SPSS statistical software program (SPSS 12.0; SPSS Inc. Chicago, Ill). The flexural properties of the control group and four experimental groups were analysed by one-way analyses of variance (ANOVA) and the Duncan's multiple range test at the 95% confidence level to assess the statistical significance.

RESULTSFlexural strengthAs shown in Fig. 3, the unidirectional and bidirectional groups showed significant reinforcing effects on the denture base resin (p <0.001), while the non-woven and paper groups did not. The flexural strengths of the unidirectional group were significantly higher than the bidirectional group (p<0.001). Figure 3.

Flexural modulusFor the flexural modulus in Fig. 4, all experimental groups had reinforcing effects on the denture base resin (p<0.001). The flexural moduli of the unidirectional and bidirectional groups were significantly higher than those of the non-woven and paper groups, with the highest flexural moduli in unidirectional group (p<0.001)Figure 4.

Toughness

25


Toughness in Fig. 5 showed similar results to those of the flexural strength. The unidirectional and bidirectional groups demonstrated significant reinforcing effects on the denture base resin, with the highest toughness in unidirectional group (p<0.001). Figure 5.

Failure mode

The failure modes of all specimens are listed in Table 2. The specimens of the unidirectional, non-woven, and paper groups showed mainly the completely fracture of both the resins and fibres (pattern A). However the bidirectional group predominantly demonstrated the complete fracture of the resin and the partial fracture of fibres (pattern B). In addtion, delaminations between the resin and the fibre layers were observed in bidirectional group (pattern C).Table 2.

Scanning electron microscopic observationFig. 6 presents the cross-sectional SEM views of fibre-reinforced denture base resins of each group. In the unidirectional group, all of the fibres were aligned perpendicular to the fracture surface, showing round shapes. Hoever, the bidirectional group showed approximately 50% of fibres aligned perpendicular to the fracture surface. The paper and non-woven groups demonstrated random fibre alignments.Figure 6.

DISCUSSION

The aim of this study was to determine which orientation of aramid fibres is most effective in reinforcing denture base resin. The unidirectional and bidirectional groups were significantly higher than the non-woven and paper groups in flexural strength, modulus and toughness. In addition, the unidirectional group showed the highest reinforcing effect among all experimental groups. Therefore, the null hypothesis was rejected because the flexural properties of denture base resin showed significant differences dependent upon the orientation of aramid fibres.

Vallittu et al. reported that unidirectional glass fibres showed a higher reinforcing effect on denture base resin than woven glass fibres [26]. The load of the three-point bending in this study was directed perpendicular to the alignment of the unidirectional fibres in the denture base resin, resulting in the highest flexural properties. In the bidirectional group, only 50% of fibres were aligned perpendicular to the load, rendering its flexural properties lower than those of the unidirectional group. In the random orientations, the non-woven and paper groups showed lower flexural properties than the unidirectional and bidirectional groups due to the disorientation of the fibres in the specimens. From the results of the flexural modulus, all experimental groups showed significant reinforcing effects on the control group. The effects of the flexural modulus in this study were similar to those obtained by Uzun et al., in which the inclusion of glass, aramid and polyethylene fibres incread the flexural moduli of denture base resin [10].

The non-woven and paper groups showed no reinforcing effect on the flexural strength and toughness. The random orientation of the fibres in these two groups was not effective in the three-point bending

26


mode. However, the non-woven and paper groups would show different results in prostheses in the mouth, where multi-directional forces are applied. The paper group was prepared by grinding short aramid fibres, and the fibrils were formed on the surfaces of ground aramid fibres. If the fibres had been ground for a longer period, more fibrillation would have occured, which might have lead to better flexural properties. Although the non-woven and paper groups showed lower flexural properties, they seemed to have some advantages over the unidirectional and bidirectional groups. During the pre-impregnation process of fibres with diluted resin, the non-woven and paper groups were soaked with resin very well. When we observed the fracture site of these two groups, they seemed to have better bonding than the unidirectional and bidirectional groups. Some of the fibres were pulled out from the denture base resin at the fracture sites of all unidirectional specimens, and there were some delaminations between the fibre layer and the resin in the bidirectional group. On the other hand, the non-woven and paper groups did not show any protruding fibres or any delamination, showing perfect bonding between the fibre layer and the resin. Further investigations are ongoing to form more fibrils on the surface of the aramid fibre using various grinding methods. If more fibrils are formed, they could also enhance the bonding between the aramid fibres and the resin matrix.

Of the different failure modes, total fractures of the resin matrix and fibres were mainly observed in the unidirectional, non-woven, and paper groups. However, the bidirectional group showed various failure patterns. In the unidirectional group, most fibres were torn and twisted; we speculate that unidirectional fibres resisted against the forces until they are torn, resulting in the highest sustainability. In cross-sectional views of SEM images, all of the unidirectional fibres were aligned perpendicular to the load, which means that 100% of fibres participated in resisting the load in the three-point bending mode.

The unidirectional group showed the highest flexural strength, modulus, and toughness. However, at the same time, the standard deviations were also the largest. This variability reflects the fact that aligning individual unidirectional aramid fibres evenly at the bottom of the specimen is technically difficult. The fixation of unidirectional fibres with diluted resin is necessary to align the fibres uniformly. This step is important but also difficult, thus preparation of the unidirectional group is very technically sensitive compare to the other groups. Therefore, the bidirectional group may be useful clinically because it is very convenient to apply, and forces are applied not only in one direction in the mouth, but also in other directions.

Denture base is a good model on which to simulate the three-point bending mode. Within the limitations of this study, the unidirectional group was the most effective in reinforcing the denture base resin. However, the bidirectional group is less technique sensitive to prepare than the unidirectional group, meaning that this type of reinforcent can be useful clinically. The non-woven and paper groups with random orientations could be also useful in reinforcing the fixed partial denture in situation, where multi directional loads are applied. Further studies are necessary using the combination of unidirectional fibres with bidirectional and/or random orientations and the combination of aramid fibres with other fibres such as glass fibres.

CONCLUSIONS

In summary, the flexural strengths, moduli and toughness of the unidirectional and bidirectional groups were significantly higher than those of the random orientations, namely the non-woven and paper

27


groups. In addtion, the reinforcing effect of the denture base resin was highest when the alignment of aramid fibres was perpendicular to the load of the three-point bending mode. Even though the unidirectional group showed the highest flexural properties, the bidirectional group might be useful in reinforcing denture base resin due to the ease of its application and the resistance to the forces applied from multiple directions. In conclusion, the flexural properties of aramid fibres were determined by the orientation of fibres in three-point bending mode. Among the four kinds of fibre orientation, the unidirectional and bidirectional group were effective in reinforcing the denture base resin.

ACKNOWLEDGEMENTSWe thank the Kolon Company for providing the aramid fibres and valuable advice for this study. This paper was supported by Wonkwang University in 2010.

28


29


30


31


32


33


REFERENCES

1. Darbar UR, Huggett R, Harison A. Denture fracture-A survey. Br Dent J, 1994; 176: 342-45.2. Stafford GD, Smith DC. Flexural fatigue test of some denture base polymers. Br Dent J. 1970;128: 442-45.3. DeBoer J, Vermilyea SG, Brady RE. The effect of carbon fiber orientation on the fatigue resistance and bending

properties of two denture resins. Journal Prosthet Dent, 1984;51:119-21.4. Dogan OM, Bolayir G, Keskin S, Dogan A, Bek B, Boztug A. The effect of Estheic fibres on impact resistance of a

conventional heat cured denture base resin. Dent Mater J, 2007;26:232-395. Jagger DC, Harrison A, Jandt KD. The reinforcement of dentures. J Oral Rehabil, 1999;26:185-946. Craig RG, Farah JW, el-Tahawi HM. Three-dimensional photoelastic stress anaylsis of maxillary complete dentures. J

Prosthet Dent, 1974;31:122-29.7. Harrison A, Huggett R, Jagger RC. The effect of a cross-linking agent on the abrasion resistance and impact strength of

an acrylic resin denture base material. J Dent, 1978;6:299-304.8. Rodford RA. Further development and evaluation of high-impact strength denture base materials. Journal of Dentistry,

1990;18:151-57.9. Marei MK. Reinforcement of denture base resin with glass fillers. J Prosthodon, 1999;8:18-26.10. Uzun G, Hersek N, Tincer T. Effect of five woven fibre reinforcement on the impact and transverse strength of a

denture base resin. J Prosthet Dent 1999;81:616-2011. John J, Gangadhar SA, Shah I. Flexural strength of heat-polymerised polymethyl methacrylate denture resin reinforced

with glass, aramid, or nylon fibres. J Prosthet Dent, 2000;86:424-2712. Bae JM, Kim KN, Hattori M, Hasegawa K, Yoshinari M, Kawada E, Oda Y. Fatigue strengthes of particulate filler

composites reinforced with fibres. Dent Mater J 2004;23:166-7413. Callister WD. Materials science and engineering: an introduction. Wiley Asia student edition, 7th ed. Asia: John Wily&

Son; 2007. p. 595-607.14. Narva KK, Lassila LV, Vallittu PK. The static strength and modulus of fiber reinforced denture base polymer. Dent

Mater, 2005;21:421-28.15. Kanie T, Arikawa H, Fujii K. Impact strength of acrylic denture base resin reinforced with woven glass fibre. Dent

Mater J, 2003;22:30-816. Vallittu PK, Narva K. Impact strenth of a modified continuos glass fiber-poly(methyl methacrylate). Int J Prosthodont,

1997:10:142-4817. Berrond JM, Weed RM, Young JM. Fracture resistance of Kevlar-reinforced poly(methyl methacrylate) resin: a

preliminary study. Int J Prosthodont, 1990;3:391-9518. Mullarky RH. Aramid fiber reinforcement of acryllic appliances. J Clin Orthod, 1985;19:655-5819. Pourdeyhimi B, Robinson HH, Schwartz P, Wagner HD. Fracture toughness of Kevlar 29/poly(methyly methacrylate)

composite materials for surgical implantations. Ann Biomed Eng, 1986;14:277-9420. Bae JM, Kim KN, Hattori M, Hasegawa K, Yoshinari M, Kawada E, OdaY. The flexural properties of fiber-reinforced

composite with light-polymerised polymer matrix. Int J Prosthodont, 2001;14:33-9.21. Garoushi S, Vallittu PK, Lassila LVJ. Fracture resistance of short, randomly oriented, glass fiber-reinforced composite

premolar crowns. Acta Biomater, 2007;3:779-8422. Tanimoto Y, Nishiwaki T, Nemoto K. Numerical failure analysis of glass-fibre-reinforced composites. J Biomed Mater

Res A, 2004;68:107-13.23. Dyer SR, Lassila LV, Jokinen M, Vallittu PK. Effect of fiber position and orientation on fracture load of fiber-reinforced

composite. Dent Mater, 2004;20:947-55.24. Kanie T, Fujii K, Arikawa H, Inoue K. Flexural properties and impact strength of denture base polymer reinforced with

woven glass fibers. Dent Mater, 2000;16:150-58.25. Karacaer O, Polat Tn, Tezvergil A, Lassila LV, Vallittu PK. The effect of lenth and concentration of glass fibers on the

mechanical properties of an injection- and a compression-molded denture base polymer. J Prosthet Dent, 2003;90:385-93.

26. Vallittuu PK. Flexural properties of acrylic polymers reinforced with unidirectional and woven glass fibres. J Prosthet Dent, 1999;81:318-26

27. Latifi M, Tafreshi HV, Pourdeyhimi B. A note on an optincal method to evaluate fiber dispersion in wet-laid nonwoven process. Textile Research J, 2008;78:518-23

28. International Standard Organization. ISO 20795-1:2008(E). Dentistry-Base polymers-Part 1: Denture base polymers. Geneva: ISO; 2008

34


4. CHEMOPREVENTIVE EFFECT OF HYDRAZONE DERIVATIVE ON TONGUE CANCER CELLS VIA INHIBITION OF PROLIFERATION AND APOPTOSIS INDUCTION

Karen Voon Kai Rou, Nur Ayunie Zulkepli, Ban Tawfeek Shareef, Abdussalam Salhin, Bahruddin Saad, Azman Seeni

Introduction: The conventional treatments available for cancer disease, such as chemotherapy or radical surgery, eventually fail to exert control. Metastatic disease frequently develops even after these treatments and may cause death. Therefore, interest has focused on chemoprevention which is suppressing, delaying or reversing carcinogenesis by pharmacologic intervention with naturally occurring or synthetic agents. In this study, we elucidated the chemopreventive effects of synthesized Hydrazone derivative by using human tongue squamous cell carcinoma (SCC-15) cells as in vitro model. Materials and methods: This preliminary in vitro experimental study was undertaken to examine the effects of the compound on the SCC-15 cells’ growth, cell cycle modulation and apoptosis induction. Alterations in cell morphology were ascertained by inverted microscope. Results: The results showed that the compound inhibited the viability of the SCC-15 cells in a concentration- and time-dependent manner (IC50 0.01 mg/ml), which was correlated with altered cell cycle arrest and apoptosis induction. Consequently, the exposure of the SCC-15 cells to the compound resulted in alterations of cell morphology including cellular shrinkage and vacuolization. Further study demonstrated that the compound has no cytotoxic effects on normal mouse skin fibroblast (L929) cells. Conclusion: In conclusion, the findings in this preliminary in vitro study suggested that the synthesized Hydrazone derivative showed the potentiality as chemopreventive agent, which could be attributed, in part, to its proliferation inhibition, cell cycle arrest and apoptosis induction of the SCC-15 cells.

INTRODUCTION

Cancer is a leading cause of death throughout the world and Malaysia is of no exception. However, the conventional treatments available for cancer disease, such as chemotherapy or radical surgery, eventually fail to exert control on the disease. Metastatic disease frequently develops even after these treatments and may cause death.

Therefore, interest has focused on chemoprevention which aims at suppressing, delaying or reversing carcinogenesis by pharmacologic intervention with naturally occurring or synthetic agents.1,2 Cancer chemoprevention has been an active area of research for several decades and the use of retinoids to prevent cancer of the head and neck is a notable example.3 Despite this, to date, relatively little research has been done on oral cancer chemoprevention.

Scientists from School of Chemical Sciences, Universiti Sains Malaysia (USM) have synthesized a number of new organic compounds in the class of compounds known as the Hydrazones. This is an important class of compounds for new drug development and some of the Hydrazone derivatives have shown to exhibit anti-cancer properties.4

For example, (2,6-Dimethyl-N’-(2-hydroxyphenylmethylidene)imidazo[2,1-b][1,3,4]thiadiazole-5-carbohydrazide demonstrated the most marked effects on the ovarian cancer cell line5, 3-[[(6-Chloro-3-phenyl-4(3H)-quinazolinone-2-yl)mercaptoacetyl]hydrazono]-5-fluoro-1H-2-indolinone showed most favorable cytotoxicity against the renal cancer cell line6, 5-Chloro-3-phenylindole-2-carboxylic acid(4-nitrobenzylidene)hydrazide was found to be highly active in a standard growth inhibition assay in breast cancer cells7 and 6-Amino-4-aryl-2-oxo-1-(1-pyrid-3-yl- or 4-yl-ethylidene-amino)-1,2-

35


dihydropyridine-3,5-dicarbo-nitrile series exhibited a high percentage of tumor growth inhibition in all cancer cell lines.8

However, the Hydrazone derivatives synthesized by scientists from our university have not been studied on their chemopreventive activity. Furthermore, previous chemopreventive studies have not focused on the head and neck region. Therefore in this preliminary study, we have chosen one of the Hydrazone derivatives, 1-[(Bromomethyl)(phenyl)methyl]-2-(2,4-dinitrophenyl)hydrazine [Figure 1] to investigate its chemopreventive effect using tongue cancer cells as in vitro model.


Chemical

The Hydrazone derivative [Figure 1] was prepared in stock concentration of 30 mg/ml with dimethyl sulphoxide (DMSO) and stored at 4°C. The stock solution was further diluted with the appropriate culture medium immediately before use.

Cell line and cell culture

All of the cell lines were purchased from the American Type Culture Collection in Manassas, Virginia, United States and grown at 37°C in a 5% CO2 atmosphere. Cells were cultured in Dulbeco’s Modified Eagle’s Medium (DMEM). Human tongue squamous cell carcinoma (SCC-15) cells were maintained in DMEM/F12 and normal mouse skin fibroblast (L929) cells were maintained in DMEM-HG. All media were supplemented with 10% fetal bovine serum (FBS), 100µg/ml penicillin and 100µg/ml streptomycin.

Determination of inhibitory concentration (IC50)Tongue cancer cells were seeded at a density of 1x105 cells per well in 6-well plates. After 24 hours of incubation in the appropriate medium, cells were treated with various concentrations of the Hydrazone derivative for another 72 hours of culture. Number of viable cells was counted under an inverted microscope using hemocytometer by Trypan Blue Exclusion Assay. The inhibitory concentration (IC50) was defined as concentration of drug causing 50% inhibition in absorbance compared with untreated control cells and was determined from the graph plotted. All of the experiments were done in triplicate.

Cell proliferation assay

Tongue cancer cells were seeded in 6-well plates at a density of 1x105 cells per well. After 24 hours, the Hydrazone derivative at the inhibitory concentration (IC50) was added to the wells. Untreated control cells were exposed to appropriate culture medium without the compound. Cell incubation was extended for eight days and the number of viable cells was counted under an inverted microscope using

36

Figure 1 The molecular structure of 1-[(Bromomethyl)(phenyl)methyl]-2-(2,4-dinitrophenyl)hydrazine

C N

HN

O2N

NO2

CH2Br


hemocytometer by Trypan Blue Exclusion Assay on Day 1, Day 3, Day 6 and Day 8. The growth pattern of the untreated control and treated cells was determined from the graph plotted. All of the experiments were done in triplicate.

Cell morphological alterations and live-death analysis

Untreated control and the Hydrazone derivative treated tongue cancer cells were examined for morphological changes by inverted phase contrast microscope during the determination of inhibitory concentration (IC50) and cell proliferation assay. For identification of live and dead cells, cells were stained with ethidium homodimer-1 and calcein AM and examined under confocal laser scanning microsope. Calcein is well retained within live cells, producing a green fluorescence in live cells. Ethidium enters cells with damaged membranes, thereby producing a red fluorescence in dead cells.

Flow cytometric analysis

Exponentially growing cells were treated with the Hydrazone derivative at the inhibitory concentration (IC50) for 72 hours. Specimens were collected and prepared in triplicate by FITC Annexin V Apoptosis Detection Kit I for apoptosis analysis and by Cycle TEST PLUS DNA Reagent Kit for cell cycle analysis and analyzed by flow cytometer (BD FACSCanto II) immediately.

Cytotoxicity test

Approximately 1x105 normal mouse skin fibroblast cells were seeded in each well of 6-well plates. After incubation overnight, the Hydrazone derivative at the inhibitory concentration (IC50) was added and cells incubated for 72 hours. Untreated control and treated cells were examined for morphological changes by inverted phase contrast microscope. Number of viable cells was counted under an inverted microscope using hemocytometer by Trypan Blue Exclusion Assay. The viability of the untreated control and treated cells was compared and the cytotoxicity of the compound on the cells was determined.


Data values were expressed as means ± SD. Differences were compared by one-way analysis of variance (ANOVA) followed by Bonferroni correction. P values were considered to be statistically significant when P < 0.05

RESULTS

Determination of inhibitory concentration (IC50)The Hydrazone derivative showed a dose-dependent inhibitory effect on the growth of tongue cancer cells with inhibitory concentration (IC50) value of 0.01 mg/ml. The result of inhibitory activity of the compound against tongue cancer cells was shown in Figure 2.

37


Figure 2 Inhibitory concentration (IC50) determination with value of 0.01 mg/ml

Cell proliferation assay

Treatment with the Hydrazone derivative at inhibitory concentration (IC50) suppressed significantly the viability of the cells in a time-dependent manner until eight days. As shown in Figure 3, the compound was an anti-proliferative agent on the tested cell line.

Cell morphological alterations & live-death analysis

38

Figure 3 Anti-proliferative effect of the Hydrazone derivative until eight days of treatment

Figure 2 Inhibitory concentration (IC50) determination with value of 0.01 mg/ml


Exposure of the tongue cancer cells to the Hydrazone derivative resulted in alterations of cell morphology including vacuolization and cellular shrinkage. [Figure 4] On live-death analysis under confocal microscopy using Calcein and Ethidium staining, it was confirmed that the compound exerted cell death. [Figure 5] Presence of numerous dead cells which were stained red was observed in the sample treated with the compound.

39

Figure 4 Effect of the Hydrazone derivative on the tongue cancer cell morphology


Flow cytometric analysisThe apoptosis-inducing activities of the Hydrazone derivative in tongue cancer cells were characterized by the flow cytometric analysis assay shown in Table 1. The compound was identified as an inducer of apoptosis in the cells, as shown in Figure 6 by a two-fold increase of apoptotic activity in the early and late apoptosis stages in cells treated with the compound. The cell cycle patterns were also analyzed by flow cytometry. An increase in the G0G1 phase and decrease in the G2M phase DNA content in cells treated with the compound were observed as shown in Figure 7. The results showed that treatment of cells by the compound resulted in DNA arrest in the G0G1 phase. Table 1 Distribution of cells in various stages in apoptosis analysis

Percentage of cells (%)

Q1

Debris

Q3

Viable

Q4

Early apoptosis

Q2

Late apoptosis

Control 1.20 89.57 3.10 6.20

Treatment 1.67 76.73 7.73* 13.87**

40

Figure 5 Identification of live and dead cells by confocal microscopy

*vs Control: p < 0.05, ANOVA, Bonferroni**vs Control: p < 0.01, ANOVA, Bonferroni


41

Figure 6 Two-fold increase of apoptotic activity in the early and late apoptosis stages in treated cell


Cytotoxicity testThe cytotoxic activity of the Hydrazone derivative was determined on normal mouse skin fibroblast cells. A viability of 97.53% of cells treated with the compound was observed as shown in Figure 8 (A), which is not significantly different from the viability of untreated control cells. Absence of effect of the compound on the cell morphology and cell number is also shown in Figure 8 (B). The results clearly showed that the compound is non-cytotoxic to the normal cells at its inhibitory concentration (IC50).

(A)

(B)

42Figure 8 Non-cytotoxic effect of the Hydrazone derivative on normal mouse skin fibroblast cells (A) Viability of

normal mouse skin fibroblast cells with and without treatment with the Hydrazone derivative (B) Absence of effect of the Hydrazone derivative on normal mouse skin fibroblast cell morphology and number


DISCUSSION

Oral cancer is the eleventh most common cancer worldwide and in south-central Asia, it ranks among the three most common types of cancer. Over 90 percent of all oral malignancies are squamous cell carcinoma, which arise from the oral mucosal lining. Oral cancer causes considerable morbidity and is associated with a 5-year survival rate of less than 50%. Furthermore, the survival rate for oral cancer has remained essentially unchanged over the past three decades. These alarming statistics on oral cancer has led to our interest in investigating the effectiveness of this newly synthesized Hydrazone derivative in oral cancer chemoprevention by using tongue cancer cells as in vitro model. Our results showed that the compound exhibited strong anti-proliferative activity on the tested cell line (IC50 value, 0.01 mg/ml). Induction of cellular shrinkage and vacuolization to the cells are significant features of apoptotic cell death. The mechanism of cytotoxicity is through apoptosis induction, as shown by the two-fold increase of apoptotic activity from flow cytometry analysis. The results also showed that the compound delayed cell transition from the G0G1 phase and prolonged the duration of the G0G1 phase, thus inducing a G0G1 phase cell cycle arrest and G2M phase reduction. Previous studies have addressed the role of Hydrazone derivatives on apoptosis induction and cell cycle modulation. 5-chloro-3-methylindole-2-carboxylic acid(4-nitrobenzylidene)hydrazide showed arrest of breast cancer cells (T47D) in G2M phase of the cell cycle and induction of apoptosis as measured by the flow cytometry analysis while 5-methyl-3-phenylindole-2-carboxylic acid(4-methylbenzylidene)hydrazide and 5-chloro-3-phenylindole-2-carboxylic acid(4-nitrobenzylidene)hydrazide showed a 20-fold increase of apoptotic activity in the cells.7 This shows that our study is in line with the previous studies done. Besides, it has been known that defects of apoptosis pathways and the ability to evade cell death is one of the hallmarks of cancers, which results in uncontrollable tumor cell growth, as well as tumor resistance to chemotherapeutic treatment.9 Therefore, the discovery and development of apoptosis inducers as new chemotherapeutic agents is a promising approach and has been a focus of research recently.

CONCLUSION

In conclusion, the Hydrazone derivative is a potent anti-proliferative agent in the tongue cancer cells. The findings suggested that the compound exhibited anti-cancer activity via apoptosis induction and cell cycle regulation pathway. This research has led to real progress in oral cancer chemoprevention, as previous chemopreventive studies have not focused on the head and neck region. Nonetheless, much work still needs to be done to assess the signaling pathway involved, systemic anti-proliferative effect and potential therapeutic promise of the compound in vivo. Continuing research of the potentiality of the Hydrazone derivative as chemopreventive agent offers hope that, in the future, even more people with this disease will be treated successfully and people with oral cancer can look forward to a better quality of life.

ACKNOWLEDGEMENT

The authors acknowledge the fine technical support given by authority and staff of Craniofacial Laboratory, School of Dental Sciences and Department of Immunology, School of Medical Sciences, Universiti Sains Malaysia.

REFERENCES1. Sporn MB, Suh N. Chemoprevention: An essential approach to controlling cancer. Nat Rev Cancer 2002; 2: 537-432. Tsao AS, Kim ES, Hong WK. Chemoprevention of Cancer. CA Cancer J Clin 2004; 54: 150-80

43


3. Khuri FR, Lippman SM, Spitz MR, Lotan R, Hong WK. Molecular epidemiology and retinoid chemoprevention of head and neck cancer. J Natl Cancer Inst 1997; 89: 199-211

4. Rollas S, Kucukguzel SG. Biological Activities of Hydrazone Derivatives. Molecules 2007; 12: 1910-395. Terzioglu N, Gursoy A. Synthesis and anticancer evaluation of some new hydrazone derivatives of (2,6-Dimethyl-N’-

(2-hydroxyphenylmethylidene)imidazo[2,1-b][1,3,4]thiadiazole-5-carbohydrazide. Eur J Med Chem 2003; 38: 781-66. Gursoy A, Karali N. Synthesis and primary cytotoxicity evaluation of 3-[[(6-Chloro-3-phenyl-4(3H)-quinazolinone -2-

yl)mercaptoacetyl]hydrazono]-5-fluoro-1H-2–indolinone. Eur J Med Chem 2003; 38: 633-43 7. Zhang H, Drewe J, Tseng B, Kasibhatla S, Cai SX. Discovery and SAR of indole-2-carboxylic acid

benzylidenehydrazides as a new series of potent apoptosis inducers using cell based HTS assay. Bioorg Med Chem 2004; 12: 3649-55

8. Gursoy E, Guzeldemirci-Ulusoy N. Synthesis and primary cytotoxicity evaluation of new imidazo [2,1-b]thiazole derivatives. Eur J Med Chem 2007; 42: 320-26

9. Thompson CB. Apoptosis in the pathogenesis and treatment of disease. Science 1995; 267: 1456-62

44


5. INCREASED GLUTATHIONE LEVEL IN SALIVA OF MODERATE GINGIVITIS PATIENTS AFTER LEMONGRASS (Cymbopogon citratus) ESSENTIAL OIL GARGLING

Stephanie Adelia Susanto, Theresia Anggita Oktavianti, Yessica Wijaya, Veni Wira, Vincentia Adya Paramitta

Objectives: To determine the glutathione level of moderate gingivitis patients’ saliva after gargling lemongrass essential oil. Methods: This study involved 50 moderate gingivitis subjects that were randomly divided into 2 groups, treated and controlled group. The treated group gargled with 0.5% lemongrass essential oil (10 subjects), 1% (10 subjects), 2% (10 subjects) and 4% (10 subjects). In controlled group, 10 subjects gargled using hexetidine 0,1%. Each subject gargled twice a day, morning and night, for 5 days consecutively. On the first day before the serial treatment as well as the next day after the serial treatment, samples of saliva were taken and the GSH level was measured using a spectrophotometer at 412 nm wave length and analyzed using ANOVA. Results: The glutathione level in saliva of moderate gingivitis subjects increased after the treatment, along with the increase of lemongrass essential oil concentrations. The data was analyzed using ANOVA (p=0.00) showed that lemongrass essential oil was significantly effective to enhance glutathione level in subjects’ saliva. Moreover, Post hoc LSD test was conducted and suggested that 2% and 4% lemongrass essential oil had the similar potent with 0.1% hexetidine. Conclusions : Gargling lemongrass essential oil with 2% concentration is best to enhance the GSH level in saliva of moderate gingivitis patients than compared to the other level of essential oil concentrations and 0.1% hexetidine. Thus, lemongrass essential oil solution can accelerate gingivitis healing process. However, the optimum concentration has not yet been determined.

INTRODUCTION

Gingiva is a part of the oral mucosa that surrounds the teeth and covers the alveolar ridge1. The oral mucous is more prone to injuries or wounds due to its functions. The most frequent inflammatory case that occurs in the field of dentistry is gingival inflammation or gingivitis. Widespread prevalence of gingivitis in the world takes more than 82% of American adults and ensues by gingival bleeding. It is also said that as many as 75% of the population suffer moderate gingivitis2. Gingivitis is an inflammatory process of the gingival, in which its intensity fluctuates and is reversible. Clinically, gingivitis shows symptoms as redness, swelling, bleeding, exudate release, and in some cases is followed by pain3.

Inflammatory cells in the gingivitis condition will produce reactive oxygen species (ROS)4. The formation of ROS normally occurs due to a variety of important biochemical processes5. Compounds and chemical reactions that tend to produce ROS (potentially toxic oxygen species) are called pro-oxidants6. Oxidative stress that is caused by ROS is responsible for most diseases. However, the presence of antioxidants with their binding ability of ROS can inhibit the formation of oxidative stress7.

Glutathione, also known as SulphHydril Glutathione (GSH), is one of the nonenzymatic antioxidant in the body that is found in every cell and plays an important role in protection against oxidative stress and toxic xenobiotic because of its ability to scavenge ROS. GSH level decreases along with ROS production during oxidative stress due to diseases, infections, and toxins that are found in our surrounding environment8. GSH levels in saliva can be an indicator of the need for antioxidants provision9. Arana et al.10 states that the changes in antioxidant enzymes and GSH concentration in saliva can be used to determine the prognosis and evaluation of a disease and oral manifestation.

Measurement of the total glutathion level, which is amount of GSH and GSSG, indicates oxidative

45


stress that occurs in inflammatory tissue11. The presence of antioxidant on gingival crevicular fluid can be an important indication to determine the inflammation process caused by bacterial infection, but the retrieval and analysis of gingival crevicular fluid sample is a complex process that requires a certain skill and level of specialization. According to Sculley and Langley-Evans12, saliva contains more simple indicators for oxidative processes measurement and it can be used to develop and monitor new treatment strategies. Saliva sampling is an easy, non-invasive, inexpensive, and patient-friendly method13.

Antioxidants have the ability to inhibit oxidative stress14. Drugs that contain relatively affordable and easily obtained antioxidant compounds can be developed from traditional herbal medicines. Lemongrass (Cymbopogon citratus) is one of Indonesian plants that can be used as herbal medicine. Lemongrass is a variety of plant that is easily found in Indonesia and has been used as herbs or insect repellent 15. In addition, there are many more benefits of lemongrass stated by Agusta16, as an antiseptic, analgesic, antidepressant, astringent, diuretic, deodorant, antipyretic, insecticide, nervina, tonic, anti-inflammatory, antioxidant, fungicide, and antiparasit. One of lemongrass essential oil compounds is citral (75-85%), which is the largest component and has proven to have antioxidant activity in vitro17.

According to Hammer et al.18, at a concentration less than or equal to 2%, lemongrass essential oil could inhibit the growth of several kinds of microorganisms. Research in vitro by Koba et al.19 showed that at the concentration of 1.3% and 1.6%, lemongrass essential oil has bright yellow color. This is related to the antioxidant activity of various content in lemongrass plants, such as citral (neral and geranial) and citronellal. This study is aimed to determine the glutathione level in saliva of moderate gingivitis patients after gargling using lemongrass essential oil.


Lemongrass essential oil is obtained from distillation using ethanol, mixed with aquabidest until reaching 0.5%, 1%, 2% or 4% concentration. Subjects consisting of 50 patients with moderate gingivitis20 were randomly divided into two groups, treated and controlled group. Forty subjects in treated groups were divided into 4 sub-groups, each group containing 10 subjects which gargled with 0.5%, 1%, 2%; and 4% lemongrass essential oil. The controlled group (10 subjects) gargled with 0.1% hexetidine. This procedure was done for 5 days consecutively, twice a day, morning and night. On the first day, before the serial treatment as well as the next day after the serial treatment, saliva sample was taken and GSH level was measured using a spectrophotometer at 412 nm wave length and analyzed using ANOVA.

GSH was made according to the standard concentration (Table I) in tubes that were incubated at room temperature for 1 hour. GSH standard was read with spectrophotometer at 412 nm wave length and GSH standard curve was created.

46


Table I. Preparation of solution for GSH standard curve

One and half mililiters of saliva samples were centrifuged at 3500 rpm for 10 minutes with the temperature of -4 ° C to obtain supernatant. Supernatant was transferred into another microcentrifuge tube and protein in the supernatant was subsequently removed by adding 200 μL 5% TCA and then centrifuged again. Supernatant was divided into three tubes, each 400 μl, then 1600 μL of PBS 0.1 M pH 8.0 was added and vibrated using vortex for 30 seconds. Subsequently 25 μL DTNB solution added to each tube and then vibrated again for 30 seconds and storaged at room temperature for 1 hour. Triplication was made for each sample then its absorbance was read. The reaction between GSH and DTNB will produce acid product 5-Thio acid 2-nitrobenzoat (TNB), which is yellow in colour. The solution’s absorbance was read using a spectrophotometer at 412 nm wave length. Increase of GSH level in the saliva is obtained by looking at the differences of GSH level before and after gargling. Data was analyzed using ANOVA (p <0.05) and followed by LSD multiple comparison test (p <0.05)

RESULTS

Means and standard deviations of GSH level in moderate gingivitis patients’ saliva, before and after gargling using lemongrass essential oil, are resumed in Figure 1. It suggests that the highest increase of GSH level is found in the treated subgroup who gargled with 4% lemongrass essential oil solution.

00.5

11.5

2

2.5

3

3.54

4.5

5

0.5 1 2 4 ControlLem ongrass Essential Oil Concentration (%)

GSH Level(m g/m Lbefore garglingafter garglingdifference

47

Standard

concentration(mg/ml)

GSH Standard

2mg/mL (μL)

PBS 0,1 M

pH 8 (μL)

TCA 5 %

(μL)DTNB (μL)

0 - 2000 200 251 1 1999 200 252 2 1998 200 254 4 1996 200 255 5 1995 200 2510 10 1990 200 25

Asia Pacific Dental Students Journal Figure 1. Means and standard deviations of GSH level before and after gargling with its difference in various treated groups and controlled.

Data analysis of the GSH level before gargling with lemongrass oil or hexetidine 0,1% shows a homogeneity (p=0.145) indicating all subjects had the same variances condition before being treated. Kolmogorov-Smirnov normality test shows that data are equally and normally distributed with significance numbers, consecutively, as 0.053, 0.114, 0.200, 0.107, 0.200. Moreover, ANOVA test was conducted (Table II) and the result shows that GSH level has no significant difference between each others (p=0.965). Therefore, it can be concluded that subjects had same GSH level before given the treatment, then continued to the ANOVA test of GSH level after gargling

Table II. ANOVA test result of GSH level before gargling in various concentration and controlled (p<0.05)

Sum of Squares df Mean Square F Sig.

Between Groups .351 4 .088 .140 .967

Within Groups 28.233 45 .627

Total 28.584 49

ANOVA test results of GSH level after gargling using lemongrass essential oil solution explains that there is a significant difference between concentrations (p=0.0). This indicates that both of hexetidine 0.1% and lemongrass essential oil are able to increase the GSH level in patients’ saliva (Table III).

Table III. ANOVA test result of GSH level after gargling in various concentration and controlled (p<0.05).

Sum of Squares df Mean Square F Sig.

Between Groups 22.773 4 5.693 9.937 .000**

Within Groups 25.782 45 .573

Total 48.555 49

Moreover, to acknowledge the effectivity of lemongrass essential oil concentrations, a Post Hoc LSD test was done and resumed in Table IV. The analysis result shows that 2% and 4% lemongrass essential oil have the same ability with hexetidine 0.1% to increase GSH level. It then indicates further that 2% lemongrass essential oil solution is the best concentration to increase GSH level of moderate gingivitis subjects’ saliva compared to other percentages of concentration.Table III. Post Hoc LSD test result of GSH level after gargling in various concentration and controlled (p<0.05).

DISCUSSION

The result of this study indicates that lemongrass essential oil of 2% concentration significantly increases the GSH level in the saliva of moderate gingivitis subjects’. The low GSH level in patient’s saliva before the serial treatment indicates the high amount of free radicals inside the body. This opinion is also encouraged by Sen21, who said that the low GSH level in the cell correlates with the excess production of free radicals. However, the balance between the two aforementioned can shift,

48


with the prooxidant being more dominant, when there is an extreme elevated production of free radical or when the level of antioxidant decrease22. The excess of free radical will react with lipid, protein and celluler nucleic acid, so that local damages can be occur and cause some organ disfunctions.

The harm that is caused by reactive oxygen species (ROS) can be overcome by antioxidants. GSH as an endogenous antioxidant and immune function modulator in an inflammation process like gingivitis, takes a role in reactive oxygen and nitrogen species detoxification by acting directly as free radical scavengers. Increase of GSH level can avoid ROS activation and evade proinflammation cytokine production23,24,25.

Winarsi26 added that GSH, as a co-substrate of glutathione peroxidase enzyme, is potent to reduce more than 90% of H2O2. The chemical reaction can be seen as below:

H2O2 + 2 GSH GSSG + 2 H2O

glutahthione peroxidase

2 GSH + NADP GSSG + NADPH + H

glutathione reductaseIn an inflammation, free radical configuration in the body is getting higher, requiring cells for an increase of electrons to balance the free radical and oxidative stress. The electrons used against oxidants are acquired from antioxidants, especially GSH, that will be altered by glutahthione peroxidase becoming glutathione disulfide (GSSG) and water. GSH will be reformed from GSSG through glutathione reductase’s reaction that depends on NADPH’s presence22. Glutahthione peroxidase enzyme catalyzes H2O2 and lipid hydroperoxide dissociation by GSH in erythrocyte and some tissues, thus metHb formation can be shunned27. In some conditions that free radical level is so high, GSH can not compensated the balance among prooxidants and antioxidants, therefore the reduction of GSH level is indicated in saliva.

The results of this study shows that there was an increase of GSH level within the treated and controlled groups with 2% and 4% lemongrass essential oil that have the same ability to hexetidine 0.1%. This illustrates that lemongrass has the same ability as natural antioxidants sources19,28,29. This is supported by Sachetti et al.30 who said that lemongrass essential oil can reduce the number of free radical. Chemical components of lemongrass essential oil are reported can prevent lipid peroxidate inside the erythrocyte membran31, hence the decrease of free radical concentration and oxidative stress.

Citral, as the main constituent in lemongrass essential oil, has a high antioxidant activity with avoiding oxidative process that are involved in free radical configuration17. Another opinion was stated by Nakamura et al.32 that citral, consists of steroisomer geranial and neral, is noteworthy able to suppress oxidative stress through GSH’s antioxidant system induction.

The other citral’s antioxidant mechanism was suggested by Shahidi and Wanasundara33, by giving hydrogen to free radical so the chain reaction of lipid oxidation can be terminated. Besides that, citral is a main component in vitamin A and C formation. Vitamin A and C themselves are secondary antioxidants to scavenge free radicals and also prevent a chain reaction, thus further damage can be prevented34.

According to Crawford et al.35, lemongrass also has various chemical components, one of them is

49


flavanoid. Phenol and flavanoid substances were reported to be able to show many in vitro and in vivo biology activities; such as antioxidants, antiinflammation, antimicroba, antimutagenic and antitumor effect. Flavanoid is a natural antioxidant and has an activity that can evade assorted oxidation reaction, also acting as a hydroxil radical, superoxyde and peroxyl radical reducer36.

Yoo et al.37 stated that some of phenolic compounds inside herbal medicines have the capacity to reduce lipid peroxyde, prevent oxidative DNA and inhibit ROS formation. Orientin and isoorientin are flavanoid substance of lemongrass that can directly free radical clearing process38,39. Brand-Williams et al.40 said that phenolic group’s hydroxil amount and structural conformation implicate the effeciency of free radical scavenge processes.

Beside citral and flavanoid, antioxidant activity of lemongrass is also supplied from alcoholic compounds, other aldehyde substances, terpene, saponin and alkaloid. Those substances can give hydrogen to free radical molecules, consequently stopping the lipid oxidation chain reaction33,35. The results of this study shows that hexetidine 0.1% could increase GSH level in saliva of moderate gingivitis patients with same ability as 2% and 4% lemongrass essential oil. Hexetidine’s aptitude in increasing GSH level is suggested by the antibacterial effect that it possesses. Pathogen microorganism and bacterial toxin invasion to gingiva can cause inflammation and connective tissue destruction. Those will generate toxic free radical and gingival inflammation to become more severe41.

Prijantojo42 said that hexetidine as a mouthwash can lessen gingival inflammation. This mouthwash is known to prevent dental plaque accumulation and the gingivitis with its antimicrobial and antioxidant constituents, such as phenolic compounds, are thymol, eucalyptol and menthol43,44,45. According to Bergenholtz and Hanstrom46 , as well as Prijantojo42 , hexetidine can avoid plaque accumulation with its ability to bind protein in oral mucous up to 7 hours after gargling. Therefore, the protein binding will inhibit metabolism of microorganisms that stay on oral mucous surface and dental plaque. The use of this mouthwash can evade bacterial plaque formation so that plaque accumulation and maturation will not occur.

CONCLUSIONS

Based on this study, it can be concluded that gargling lemongrass essential oil of 0.5%, 1%, 2% and 4% concentration increase GSH level. 2% and 4% lemongrass essential oil have the same potent with hexetidine 0.1% in enhancing GSH level of moderate gingivitis patients’ salive. Therefore, it is deduced that 2% lemongrass essential oil solution can accelerate gingivitis healing process better than other concentrations.

REFERENCES1. Eley BM, Manson JD: Periodontics 5th ed., St. Louis, 2004, Mosby Elsevier.2. Harville. 20033. Grant DA, Stern LB, Lisgarten MA: Periodontics 6th ed., St. Louis, 1988, The CV Mosby Company.4. Phuong NTM, Nghia PT, Marquis RE: Zinc Effect on Oxidative Physiology of Oral Bacteria, Advances in Natural

Sciences. 7(1.2): 131-138, 2006.5. Czeczot H, Ścibior D, Skrzycki M, Podsiad M: Glutathione and GSH-Dependent Enzymes in Patients with Liver

Cirrhosis and Hepatocellular Carcinoma, Communication. 53 (1): 237–241, 2006.6. Mayes PA: Structure & Function of The Lipid-Soluble Vitamins dalam: Murray KM, Granner DX, Mayes PA, Rodwell

VW. Harpers Biochemistry. 23rd ed., Connecticut, 1993, Appleton & Lange. 7. Mandal S, Hazra B, Sarkar R, Biswas S, Mandal N: Assessment of the Antioxidant and Reactive Oxygen Species

Scavenging Activity of Methanolic Extract of Caesalpinia crista Leaf. Oxford Journals, 2009.

50


8. Sanchez A dan Medina MA: Glutamine, as A Prekursor of Gluthatione, and Oxidative stress. Mol Genet Metab. 67(2): 100-5, 1999.

9. Beeh KM, Beier J, Haas IC, Kornmann O, Micke P, Buhl R: Gluthathione Deficiency of The Lower Respiratory Tract in Patients with Idiopatic Pulmonary Fibrosis, European Respiratory Journal 19:1119-1123, 2002.

10. Arana C, Cutando A, Ferrera MJ, Gomez MG, Worf CV, Bolanos MJ, Escames G, dan Acuna CD: Parameters of Oxidative Stress in Saliva from Diabetic and Parenteral Drug Addict Patients, Journal of Pathology and Medicine 35(9): 554-559, 2006.

11. Moskaug J, Carlsen H, Myhrstad MC, dan Blomhoff R: Polyphenols and Glutathione Synthesis Regulation, Am.Jour of Clin Nutrition 81(1): 277-283, 2005.

12. Sculley DV dan Langley-Evans SC: Periodontal Disease is Associated with Lower Antioxidant Capacity in Whole Saliva and Evidence of Increased Protein Oxidation, Clin Sci 105: 167-172, 2003.

13. Nagler RM, Klein I, Zarzhevsky N, Drigues N, Reznick AC: Characterization of the Differentiated Antioxidant Profile of Human Saliva, J.Free Radical Biology and Medicine 32(31): 268-27, 2002.

14. Kaur G, Tirkey N, Chanana V, Pishi P, Chopra K: Inhibition of Oxidative Stress and Cytokine Activity by Curcumin in Amelioration of Endotoxin-induce Experimental Hepatoxicity in Rodents, Clin Exp Immunol. 145(2): 313-21, 2006.

15. Guenther E: Tanaman Minyak Atsiri Jilid I (terj.), Jakarta, 1987, Penerbit Universitas Indonesia (UI-Press).16. Agusta A: Minyak Atsiri Tumbuhan Tropika Indonesia, Bandung, 2000, Penerbit ITB.17. Rabbani SI, Devi K, Khanam S, Zahra N: Citral, a Component of Lemongrass Oil Inhibits the Clastogenic Effect of

Nickel Chloride in Mouse Micronucleus Test System, Pak. J. Pharm. Sci. 19(2): 108-113, 2006.18. Hammer KA , Carson CF, Riley TV: Antimicrobial Activity of Essential Oils and Other Plant Extracts, J Appl

Microbiol. 86(6): 985-990, 1999.19. Koba K, Sanda K, Guyon C, Raynaud C, Chaumont JP, Nicod L: In vitro Cytotoxic Activity of Cymbopogon citratus

L. and Cymbopogon nardus L. Essential Oils from Togo, Bangladesh J Pharmacol. 4: 29-34, 2009.20. Loe and Sillness. 1963. 21. Sen CK: Oxidants and Antioxidants in Exercise, J Appl Physiol : 79; 675-86, 1995.22. Murray R, Granner D, Mayer P, Rodwell V: Biokimia Harper (terj.), Jakarta, 2000, Penerbit Buku Kedokteran EGC.23. Kevil CG, Pruitt H, Kavanagh TJ, Wilkerson J, Farin F, Moellering D, Darley-Usmar VM, Bullard DC, Patel RP:

Regulation of Endothelial Glutathione by ICAM-1: Implication for Inflammation, The Faseb Journal: 18(11): 1321-3, 2004.

24. Tredger JM, Neuberger JN, Williams R. 1988. Drugs in Acute Hepatic Necrosis dalam Testa B and Perissoud D. 1998. Liver Drugs: from Experimental Pharmacology to Therapeutic Application; 15-29.

25. Schreck R, Rieber P, Baeuerle PA: Reactive Oxygen Intermediates as Apparently Widely Used Messengers in the Activation of the NF-kappa B Transcription Factor and HIV-1, EMBO J; 10: 2247, 1991.

26. Winarsi H: Antioksidan Alami dan Radikal Bebas, Yogyakarta, 2007, Kanisius27. Lautan J: Radikal Bebas pada Eritrosit dan Leukosit, Cermin Dunia Kedokteran; 116: 49-52, 1997.28. Burt S: Essential Oils: Their Antibacterial Properties and Potential Applications in Foods—A Review, Int J Food

Microbiol; 94 (3) : 223-53, 2004.29. Ojo OO, Kabutu FR, Bello M, Babayo U: Inhibition of Paracetamol-Induced Oxidative Stress in Rats by Extracts of

Lemongrass (Cymbopogon citratus) and green Tea (camellia sinensis) in Rats, African Journal of Biotechnology; 5(12): 1227-32, 2006.

30. Sacchetti G, Maietti S, Muzzoli M, Scaglianti M, Manfredini S, Radice M, Bruni R: Comparative Evaluation of 11 Essential Oils of Different Origin as Functional Antioxidants, Antiradicals and Antimicrobials in Foods, Food Chemistry; 91: 621-32, 2005.

31. Orrego R, Leiva E, Cheel J: Inhibitory Effect of Three C-glycosylflavanoids from Cymbopogon citratus (Lemongrass) on Human Low Density Lipoprotein Oxidation, Molecules; 14: 3906-13, 2009.

32. Nakamura Y, Miyamoto M, Murakami A, Ohigashi H, Osawa T, Uchida K: A Phase II Detoxification Enzyme Inducer from Lemongrass: Identification of Citral and Involvement of Electrophilic Reaction in the Enzyme Induction, Biochem Biophys Res Commun; 302: 593-600, 2003.

33. Shahidi F dan Wanasundara PKJPD: Phenolic Antioxidants: Critical Review, Critical Reviews in Food Science and Nutrition; 32: 67-103. 1992.

51

http://www.ncbi.nlm.nih.gov/pubmed?term=




34. Kumalaningsih S. 2007. Antioksidan, Sumber dan Manfaatnya. http://antioxidantcentre.com diunduh 16 Januari 2010.35. Crawford M, Hanson SW, Moustapha ES, Koker A: The Structure of Cymbopogon, A Novel Trterpenoid from

Lemongrass, Tetrahedron Letter; 35: 3099-128, 1975.36. Harun N dan Syari W: Aktivitas Antioksidan Ekstrak Daun Dewa dalam Menghambat sifat Hepatotoksik Halotan

dengan Dosis Subanestesi pada Mencit, Jurnal Sains dan Teknologi Farmasi; 7(2): 63-70, 2002.37. Yoo KM, Lee KW, Park JB, Lee HJ, Hwang IK: Variation in Major Antioxidants and Total Antioxidants Activity of

Yuzu (Citrus Junos Sieb ex Tanaka) During Maturation and Between Cultivars, J Agric Food Chem; 52(19): 5907-13, 2004.

38. Cheel J, Theoduloz C, Rodriquez J, Schmeda-Hirschmann G: Free Radical Scavengers and Antioxidants from Lemongrass, J Agric Food Chem; 53(7): 2511-7, 2005.

39. Jaganath IB, Crozier A: Dietary Flavanoid and Phenolic Compounds, USA, 2010, Wiley & Sons Inc.40. Brand-Williams W, Cuvelier ME, Berset C: Use of A Free Radical Method to Evaluate Antioxidant Activity,

Lebensmittel-Wissenschaft und-Technologie; 28: 25-30, 1995.41. Hersh T. 2000. Healthy Gums and Healthy Heart: The Role of Glutathione and Its Antioxidant Partners.

http://www.thione.com/pubs/pub01faa00.html. Diunduh 23 Februari 2010.42. Prijantojo: Antiseptik Sebagai Obat Kumur Peranannya terhadap Pembentukan Plak Gigi dan Radang Gusi, CDK; 113:

28-32, 1996.43. Roberts WR dan Addy M: Comparison of the In Vivo and In Vitro Antibacterial Properties of Antiseptic Mouthrinses

Containing Chlorhexidine, Alexidine, Cetylpyridium Chloride and Hexetidine, J Clin Periodontol; 8(4): 295-310, 1981.44. Harper PR, Milsim S, Wade W, Addy M, Moran J, Newcombe RG: An Approach to Efficacy Screening of Mouthrinses:

Studies on A Group of French Product (II): Inhibition of Salivary bacteria and Plaque In Vivo, J Clin Periodontol; 22: 723-7, 1995.

45. Elworthy AJ, Greenman FM, Doherty RG, Newcombe, Addy M: The Substantivity of a Number of Oral Hygiene Products Determined by The Duration of effects on Salivary Bacteria, J Periodontol; 67: 572-6, 1996.

46. Bergenholtz A dan Hanstrom L: The Plaque-inhibiting Effect of Hexetidine (Oraldene) Mouthwash Compared to That of Chlorhexidine, Comm Dent Oral Epidemiol; 2: 70-4, 1974.

52

http://www.thione.com/pubs/pub01faa00.html. Diunduh 23 Februari 2010

http://antioxidantcentre.com/


6. INVESTIGATION OF TOOTH DEVELOPMENT BY USING MULTIPHOTON MICROSCOPE

Chi h -Liang Ting ,Pei-Yu Pan, and Min-Huey Chen

Multiphoton laser microscope is a popular study tool recently. In traditional atom theory, a specific photon can excite an electron to a higher energy level. With multiphoton laser technology, multiple photons can excite an electron at once. Different signal responses from different tissue components can be obtained. Traditionally, tooth germ is observed by H&E stain. Multiphoton laser microscope is non-invasive and less time consuming. Most importantly, different tissue component result in different signal responses, which is convenient for image processing. Objectives: The purposes of this study were to set up a multiphoton microscope database of tooth germ and help discover new findings of tooth germ development. Materials and Methods: Tooth germs were isolated from a series of embryonic and newborn mice, including E14.5, E16.5, E18.5, D1 and D3. After dissection, multiphoton microscope was applied for investigating the molar tooth germs in multiple depths, both auto-fluoresce signals and second harmonic generation signals were acquired. In addition, H&E stain in the same stage of samples were also prepared for comparison. Results: Image data from different stages of tooth germs including bud stage, cap stage (E14.5) and bell stage (E16.5, E18.5) were demonstrated. Various signals from different tissue structure, such as IEE, OEE, SI, SR, dentin, and enamel were also found. It was found that enamel has a strong AF signal, while other tissue contains different ratio of AF and SHG signals. The H&E stain of tooth germs in different stages were also demonstrated. Conclusions: In this study, a novel complete multiphoton laser microscope database of tooth germ development in mice with scanning depths and precise 3D images was set up. It is confirmed that multiphoton laser microscope is a powerful tool for investigating tooth germ development. It is worthy for further study and applied for application in the study of tooth regeneration.

INTRODUCTION

Multi-photon fluorescence microscopyIn 1990, Denk et al. develop the foundation of multi-photon fluorescence microscopy. It is widely used in biomedical research ever since then [1]. Multi-photon fluorescence excitation and multi-harmonic signals are non-linear optical phenomena. The non-linear quality enhance the contrast between focal region and background, thus making the “optical dissection” possible. For the same reason, the multi-photon microscopy image can be acquired without dissecting and staining of the sample.

In a multi-photon image, the green color stands for auto-fluorescence (AF) signal, and the blue color represent for second-harmonic generation (SHG) signal. In recent years, multi-photon microscopy is applied on biomedical research, even including clinical application in the future. In year 2003, P. J. Campagnola et al. use multi-photon microscopy to observe cell, tissue, and organ; while E. Brown et al. use it to study the collagen fiber of tumor [2, 3]. In year 2004, J. Michael et al. use it to observe brain tissue [4]. As in dentistry, A. Hall and J. M. Girkin mention that multi-photon would be a diagnostic tool for caries in the future in a review article published in 2004 [5]. Szu-Yu Chen et al. observe the anomaly of enamel using multi-photon fluorescence microscopy in 2008 [6].

Observing tooth structure using multi-photon microscopy

In oral embryology, the growth and development of tooth have always been a core study issue. The most concerned part is the development of tooth germ. In the study of mice embryo development, there are still some questions to be answered, such as the growth and connection of nerves in mandible,

53


maxilla, and tooth germ.

In a previous thesis of professor Min-Huey Chen, it is proved that we can distinguish dentin, enamel, and periodontal ligaments by AF and SHG signals, and acquire clear image of tooth structure [7]. Besides, the multi-photon image is comparable with section image. Multi-photon laser is a popular research tool; it can be used to observe soft and hard tissue in living organism, and the damage is very mild. If we use multi-photon laser fluorescence microscopy to observe the tooth development of embryonic and newborn mice, we could acquire many brand new data and information.

The current study of tooth development is mainly conducted by tissue section. However, the tissue is fixed after sectioning; hence we cannot get the continuous development data. Moreover, the interaction information between tooth organ and other tissue is also scarce.

The main purpose is to set up a multi-photon microscopy tooth germ development database, and to prove it is comparable with tissue section. Furthermore, we want to acquire the dynamic changing images of tooth germ.

Figure 1. Multi-photon laser fluorescence microscope

MATERIALS AND METHODS [8]

ICR mice

We acquire E14.5 embryonic mice and P1, P3, P5, and P7 newborn ICR mice from National Taiwan University birthatory animal center. (Fig. 2)

E stands for embryonic, E14.5 means 14.5 days after conception. P stands for post-natal, P1 means one day after birth.

Multi-photon laser microscopy

Under dissecting microscope, we dissect embryonic and newborn mice (Fig. 3, 4), separate the tooth germ (Fig. 5), place it on the slides and apply multi-photon laser fluorescence microscopy to observe

H&E staining comparison For comparison, we also obtained histology image by section and H&E staining for each stage.

Dynamic observation

We also apply organ culture technique. We prepare a square well on the slide, place the tooth germ along with alveolar bone in the well, and fill it with DMEM. With the nutrition in DMEM, the cells are

54


able to continue making movement and changes. The sample is place under multi-photon microscope, and we take one image every 4 minutes. This process continues for 80 minutes.

Figure 2 Post-natal ICR mice . Figure 3 Mandible of mice.

Figure 4 Tooth germ in mandible. Figure5 Molar tooth germ with alveolar bone.

RESULTS

The comparison between multi-photon microscopy image and histology image

E14.5 (14.5 days after conception) (Fig. 6, 7)

The histology image reveals that the tooth germ is in early cap stage. The dental epithelium cells start to unfold, and the mesenchymal cells aggregate to form a dental follicle.

55

TG


The multi-photon microscopy image is similar to the histology image. In this stage, there is no SHG signal to be found. We can differentiate different cell types by their morphology.Figure 6(a) E14.5 tooth germ histology. TG: tooth germ, ME: mesenchyme, EPI: epithelium.

Figure 6(b) E14.5 tooth germ multi-photon microscopy.

Figure 7(a) E14.5 tooth germ histology local area. Figure 7(b) E14.5 multi-photon microscopy local area.

P1 (1 day after birth) (Fig. 8, 9)

In histology image, we can see that the tooth germ is in its bell stage. The mesenchymal cells are gathering and the enamel organ is formed.

The multi-photon image is a match to histology. At this stage, there is some SHG signal (blue color) in region under the enamel. It is the sign of pre-dentin is being formed.

56


Figure 8(a) P1 tooth germ histology. DP: dental papilla, SR: stellate reticulum.

Figure 8(b) P1 tooth germ multi-photon microscopy.

Figure 9(a) P1 tooth germ histology local area. Figure 9(b) P1 tooth germ multi-photon microscopy local area.

P3 (3 days after birth) (Fig. 10, 11)

In histology image, the shape of the enamel organ is changing. The molar tooth germ enters its bell stage.

57


The multi-photon image matches the histology. The SHG signal (blue color) is clearer than that of P1, which means the dentin is thickening.

Figure 10(a) P3 tooth germ histology. D: dentin, AM: ameloblast.

Figure 10(b) P3 tooth germ multi-photon microscopy.

Figure 11(a) P3 tooth germ histology local area. Figure 11(b) P3 multi-photon microscopy local area. E: enamel, OD: odontalblast.


58


In histology image, we can see the structure of enamel, dentin, and pre-dentin. There is clear morphology of ameloblast and odontoblast.

Multi-photon image and histology image are matched. There layers of ameloblast, enamel, dentin, pre-dentin, and odontoblast is easily recognized. The morphology is very clear.

Figure 12(a) P5 tooth germ histology. Figure 12(b) P5 tooth germ multi-photon microscopy.

Figure 13(a) P5 tooth germ histology local area. Figure 13(b) P5 multi-photon microscopy local area.


59


In histology image, we can see that the tooth germ is in its late bell stage. The layers of enamel, dentin, pre-dentin is thicker than P5. The size of the tooth germ is much larger than P5.

The multi-photon image is a match. Layers of different signal can be recognized. The SHG signal of dentin is very strong.

Figure 14(a) P7 tooth germ histology. Figure 14(b) P7 tooth germ multi-photon microscopy.

Figure 15(a) P7 tooth germ histology local area. Figure 15(b) P7 multi-photon microscopy local area.

Dynamic changes through time course

60


We scan the sample continuously, and we are able to see the cell behavior and movement. Figure 16 is on the region outside the enamel, as time pass by, the shape of multiple cells are changing continuously. Figure 17 is on the surface of enamel. We can see a clear cell move toward the enamel gradually. The results will be present as movie.

Figure 16 cell behavior: the shape of each cell is changing gradually.

Figure 17 Cell movement: a cell is moving toward tooth germ.

DISCUSSION

We found that dentin and pre-dentin can be imaged by multi-photon SHG signal, whereas other structures such as enamel, IEE, OEE, SI, SR, odontalblast, and ameloblast can be imaged by multi-

61


photon AF signal. The morphological structure is very clear under multi-photon microscopy. (Fig. 18)

Figure 18 A very clear multi-photon microscopy image of enamel rod.

We proved that we can obtain exactly identical image compared to histology section, with even more precise information. For example, we can scan for different penetration depth, reconstruct it and get a 3-dimentional image. Most importantly, we demonstrated that we can culture living tissue, and observed the dynamic development and tissue interaction of tooth germ, which is a breakthrough in oral embryology study.

We can conclude that multi-photon fluorescence microscopy has three main advantages. First of all, fresh tissue sample can be scanned without being sectioned, so we can keep the complete 3-dimentional information. Second, the there are AF signal SHG signal response, hence the different tissue components of tooth germ can be easily identified without using staining technique, which can save us some time. Last but not least, the multi-photon microscopy can be applied to living organism, so we can observe the development and cell interaction of tooth germ continuously. This amazing quality of multi-photon microscopy makes it a very promising study tool of tooth germ development.

We also look into many references to check whether the development stage of each sample is correct or not. As a result, the development stage of each sample is found to be match to that of the previous researches. [9, 10] The mice tooth germ is in cap stage at E14.5, in bell stage at P1 to P3, and in late bell stage at P5.

During the experiment of observing dynamic changes, we found an interesting phenomenon. As we scan the sample continuously using multi-photon laser, the AF signal of the region being scanned became stronger and stronger. (Fig. 19) The mechanism of this phenomenon can be further studied, and the effect may be eliminated by parameter adjustment through time.

62


Figure 19 The central scanning region becomes brighter after a continuously scanning time course.

We think that when the tissue sample is being scanned continuously under multi-photon microscope, we should provide it with more suitable conditions for cell growth. We hope we can design a miniature culture system, located on the multi-photon microscope, which provides thermal control and adjusts the oxygen and carbon dioxide concentration. If the system works, hopefully we can observe the tooth germ development and tissue interaction for a longer time course.

ACKNOWLEDGMENTSThe authors thank the Core Facility from NTUH Medical Research Center, for assistance in multi-photon laser fluorescence microscope. We also like to thank Wesley Chen, Rung-Shu Chen, and Yong-Chong Lin for their endeavor and technical support to the experiment.

REFERENCES1. Chien-Rei Guo (2005). Differentiation of basal cell carcinoma from the adjacent normal tissue by of non-linear

microscopy : Implication for surgical guidance 2. P. J. Campagnola and L. M. Loew (2003). Second-harmonic imaging microscopy for visualizing biomolecular arrays in

cells, tissues and organisms. Nat. Biotechnol. 21(11) 1356–1360 3. E. Brown, T. McKee, E. di Tomaso, A. Pluen, B. Seed, Y. Boucher, and R. K. Jain (2003). Dynamic imaging of

collagen and its modulation in tumors in vivo using second-harmonic generation. Nat. Med. 9(6),796–800 4. Michael J. et al.(2004). In Vivo Multiphoton Microscopy of Deep Brain Tissue. J Neurophysiol. 91: 1908–1912, 5. Hall and J. M. Girkin (2004). A review of potential new diagnostic modalities for Caries lesions. IADR, pp. 89–94 6. Szu-Yu Chen, Chin-Ying Stephen Hsu, and Chi-Kuang Sun (2008). Epi-third and second harmonic generation

microscopic imaging of abnormal enamel. Optics Express 21 Vol. 16(15) 11679 7. Min-Huey Chen, Wei-Liang Chen, Yen Sun, Peter Tramyeon Fwu and Chen-Yuan Dong (2007). Multiphoton

autofluorescence and second-harmonic generation imaging of the tooth. Journal of Biomedical Optics 12(6)8. J. K. Avery, P. F. Steele, and N. Avery (2001). Oral Development and Histology. Thieme Medical Publishers Inc., New

York 9. María Angélica Torres-Quintana, Marcia Gaete, Marcela Hernandez, Marcela Farías and Nelson Lobos(2005).

Ameloblastin and amelogenin expression in posnatal developing mouse molars. Journal of Oral Science, Vol. 47, No. 1, 27-34

10. Yael Greunbaum-Cohen, et al. Amelogenin in Cranio-facial Development (2009). The Tooth as a Model to Study the Role of Amelogenin During Embryogenesis. Journal Of Experimental Zoology 312(B):445–457

63


7. CURCUMA ZEDOARIA ETHANOL EXTRACT AS ANTIBACTERIAL AGENT (IN-VITRO STUDY)

Andrew Laurent, Tira Catherine, Anindya Kamaratih Gunarso

Objective: The aim of this research was to investigate the antibacterial effect of Curcuma zedoaria ethanol extract. Methods: This research used white turmeric or Curcuma zedoaria in form of powder (10 g) which was mixed with 95% ethanol (100 mL), then centrifuged and dried up to get the extract. The antibacterial effect of Curcuma zedoaria on Streptococcus mutans, Staphylococcus aureus, and Candida albicans was evaluated by inhibition zone method measurement within blood and chocolate agar, nutrient agar, and Sauboraud Dextrose Agar (SDA) media cultures respectively (N=12). Three drops of Curcuma zedoaria ethanol extract was added in each media cultures then incubated for 24 hours and measured the inhibition zone.Results: The antibacterial effect on Streptococcus mutans showed higher than those on Staphylococcus aureus while there was no antifungal effect on Candida albicans. The antibacterial effect on Streptococcus mutans in chocolate agar media culture showed higher than those in blood agar media culture. ANOVA showed significant antibacterial effect differences (p<0.05) among inhibition zone diameters of Streptococcus mutans in both of media cultures. Conclusion: Curcuma zedoaria ethanol extract has antibacterial effects on Streptococcus mutans and Staphylococcus aureus.

INTRODUCTION

Nowadays, traditional treatment has been introduced after medical treatment. It is using various plants of traditional herb that are believed can be a medicine. Traditional herb is treatment media which is using plants with natural ingredients as its basic material. The tendency of increasing traditional treatment usually because of increasing the medicine’s price from the manufacturer. Therefore, people have found the alternative medicine which is cheaper and easier to get than the patent medicine. The side effects that are caused by traditional medicine are less than the patent medicine. In developing countries, approximate 80% of individuals depend primarily on natural products to meet their healthcare needs1.

White turmeric is one of traditional herb that can be used as traditional medicine. The Latin’s name of this herb is Curcuma zedoaria. This herb can be found easily and can grow only in cold places in Indonesia, especially in farms and fields. White turmeric is not as popular as yellow turmeric. It is because of the bitter taste and smaller size compared to yellow turmeric but both of them have distinctive and strong smell because of their essential oil2.

The chemical contains of Curcuma zedoaria are curcuminoid (diarilheptanoid), essential oil, polysaccharide and the other groups. There are from Diarilheptanoid group such as curcumin, demetoxicurcumin, bisdemetoxicurcumin, and 1,7 bis (4-hidroxyphenil)-1,4,6-heptatrien-3-on. Essential oil is thick golden yellowish liquid which contains monotherpen and sesquitherpen. Monotherpen of Curcuma zedoaria consists of monotherpen hydrocarbon (alpha pynen, D-camphene), monotherpen alcohol (D-borneol), monotherpen ketone (D-campher), monotherpen oxyde (sineol). Sesquitherpen, as a content of Curcuma zedoaria, consists of various groups and based on that groups, there are bisabolen, elema, germakran, eudesman, guaian, and spironolactone group. The other contents are ethyl-p-metoxycinamate, 3,7-dimethyl indan-5-carboxylate acid. The essential oil of Curcuma zedoaria showed antimicrobial activities on Staphylococcus aureus, Vibrio comma and Escherichia coli. The extract showed antifungal effect if it is combined with Ethyl-P-MetoxyCinamate (EPMC)3.

64


Ethanol, also called ethyl alcohol, pure alcohol, or drinking alcohol, is a volatile, flammable and colorless liquid. Ethanol is a straight-chain alcohol and its molecular formula is C2H5OH. Its empirical formula is C2H6O. It is a constitutional isomer of dimethyl ether. Ethanol is often abbreviated as EtOH. Ethanol has widespread use as a solvent of substances intended for human contact or consumption, including scents, flavorings, colorings, and medicines. In chemistry, it is both an essential solvent and a feedstock for the synthesis of other products4.

Therefore, the hypothesis in this research was Curcuma zedoaria ethanol extract had antibacterial effects on Streptococcus mutans and Staphylococcus aureus. The objective of this research was to investigate the antibacterial effect of Curcuma zedoaria ethanol extract.

MATERIALS AND METHODSThis research was done in the Biochemistry Laboratory and Microbiology Laboratory, Faculty of Medicine, Trisakti University, Indonesia. This research used white turmeric or Curcuma zedoaria in form of powder (10 g) which was mixed with 95% ethanol (100 mL) in an erlenmeyer tube. The mixture was shook to get a homogeneous solution and then left it for 24 hours. After forming sediment layer, the mixture was poured into small reaction tubes. Each tube was centrifuged to get the separated sediment from the solution. The solution was dried up to get the extract.

Reaction tubes which contained Brain Heart Infusion (BHI) liquid were used for mixing the bacteria. After 24 hours, the bacteria were mixed in reaction tubes to get bacteria suspension. The suspension was rubbed with sterilize cotton on the agar media culture.

Streptococcus mutans, Staphylococcus aureus and Candida albicans were inoculated in blood and chocolate agar, nutrient agar, and Sauboraud Dextrose Agar (SDA) media cultures respectively. Plastic pipette was used to make three tiny holes. Each hole has 0.5 cm diameter in agar media cultures. Then put 0.5 mg Curcuma zedoaria extract into each hole with micro pipette. The media cultures were incubated for 24 hours. After the incubation, the inhibition zone can be measured in the media cultures using vernier caliper.

The other solvent used in this research was Dimethyl Sulfoxide (DMSO). DMSO can dissolve the extract completely5. The extract was dissolved by 10 mL DMSO with serial dilution and then inoculated in nutrient agar, blood and chocolate agar. The media cultures were incubated for 48 hours at 37oC and the inhibition zone can be measured using vernier caliper. This diameter of inhibition zone was compared to the diameter inhibition zone of Ciprofloxacin as positive control and Aquadest as negative control. Data was analyzed using one-way ANOVA.

RESULTSCurcuma zedoaria ethanol extract showed the inhibition effect (positive result) on Streptococcus mutans (blood and chocolate agar media cultures) and also on Staphylococcus aureus (nutrient agar media culture).

There was no inhibition effect (negative result) of Curcuma zedoaria ethanol extract on Candida albicans in Sauboraud Dextrose Agar (SDA) media culture. It means that Candida albicans is resistance to Curcuma zedoaria ethanol extract.

65

http://en.wikipedia.org/wiki/Dimethyl_ether

http://en.wikipedia.org/wiki/Isomer

http://en.wikipedia.org/wiki/Oxygen

http://en.wikipedia.org/wiki/Hydrogen

http://en.wikipedia.org/wiki/Carbon

http://en.wikipedia.org/wiki/Empirical_formula

http://en.wikipedia.org/wiki/Empirical_formula

http://en.wikipedia.org/wiki/Chemical_formula

http://en.wikipedia.org/wiki/Flammability

http://en.wikipedia.org/wiki/Volatility_(chemistry)

0

0.5

1

1.5

2

2.5

Zone 1

Zone 2

Zone 3


Types of BacteriaExtract Weight (mg)

Φ Pipette’s Hole (cm)

Diameter of Inhibition Zone (cm)

1 2 3

Average

(cm)

Streptococcus mutans (Blood agar media culture)

0.5 0.5 1.41 1.25 0.91 1.19

Streptococcus mutans (Chocolate agar media culture)

0.5 0.5 2.38 2.32 2.20 2.30

Staphylococcus aureus (Nutrient agar media culture)

0.5 0.5 0.42 0.38 0.12 0.31

Candida albicans (Sauboraud Dextrose Agar media culture)

0.5 0.5 0 0 0 0

Table 1. Comparison Diameter of Inhibition Zone

Table 1 shows the comparison diameter of each media culture. Each drop of extract (0.5 mg) was inoculated in media cultures using micro pipette (0.5 cm). Significant antibacterial effect was only seen in blood, chocolate and nutrient agar media cultures. It means that Curcuma zedoaria ethanol extract only could inhibite Streptococcus mutans and Staphylococcus aureus.

Curcuma zedoaria ethanol extract had antibacterial effect on Streptococcus mutans and Staphylococcus aureus (Figure 1). The antibacterial effect on Streptococcus mutans showed higher than those on Staphylococcus aureus while there was no antifungal effect on Candida albicans. The antibacterial effect on Streptococcus mutans in chocolate agar media culture showed higher than those in blood agar media culture (Table 2). ANOVA showed significant antibacterial effect differences (p<0.05) among inhibition zone diameters of Streptococcus mutans in both of media cultures.

Figure 1. Inhibition zone diameter of Curcuma zedoaria ethanol extract on types of bacteria

66


Streptococcus mutans

Zone 1 Zone 2 Zone 3

Blood AMC 1.41 cm 1.25 cm 0.91 cm

Chocolate AMC 2.38 cm 2.32 cm 2.20 cm

Table 2. Comparison Diameter of Inhibition Zone on Streptococcus mutans in Blood and Chocolate Agar Media Cultures

To find out the Minimal Inhibitory Concentration (MIC), DMSO was used as dissolving solution of Curcuma zedoaria ethanol extract. Ciprofloxacin and aquadest were used as positive and negative control. In blood agar media, the diameter inhibitory zone of Curcuma zedoaria ethanol extract (100%) was less than those of positive control. ANOVA test showed that there was significant differences (p<0.05) among inhibitory zone diameters of Curcuma zedoaria ethanol extract (100% and 20%) and positive control on Streptococcus mutans. The post-hoc test showed that there was significant differences between diameter inhibition zone of Curcuma zedoaria ethanol extract (100% and 20%) and those of positive control (p<0.05). It means that the antibacterial effect of Curcuma zedoaria ethanol extract on Streptococcus mutans was lower than Ciprofloxacin as the positive control. However, it was higher than the negative control.

The result of this study showed that nutrient agar was a sensitive media culture for Staphylococcus aureus. In nutrient agar, the diameter inhibition zone of Curcuma zedoaria ethanol extract on Staphylococcus aureus showed less than those of positive control. ANOVA test showed that there was significant differences of diameter inhibition zone among concentrations of Staphylococcus aureus and those of positive control (p<0.05). The post-hoc test showed there was significant differences between 90%, 60%, 30%, 20%, 10% of Curcuma zedoaria ethanol extract compared to positive control. However, no significant differences between 100% Curcuma zedoaria ethanol extract and positive control.

DISCUSSION

This research showed that Curcuma zedoaria ethanol extract had inhibitory growth effect both on Streptococcus mutans and Staphylococcus aureus. The antibacterial effect of Curcuma zedoaria ethanol extract were sensitive to Staphylococcus aureus and Streptococcus mutans in nutrient agar, and both of blood and chocolate agar media cultures respectively that can be seen by inhibition zone. Streptococcus mutans in blood and chocolate agar media cultures were sensitive to Curcuma zedoaria ethanol extract because it showed inhibition zone. The inhibition zone on Streptococcus mutans in chocolate agar media culture was relatively higher than those in blood agar media culture. In this research, there was no inhibition zone on Candida albicans which was inoculated in Sauboraud Dextrose Agar (SDA) media culture.

According to Faculty of Pharmacy UGM (2009), the essential oil of Curcuma zedoaria showed antimicrobial activities on Streptococcus mutans and Staphylococcus aureus. Curcumin content in white turmeric had been proven has antiinflammation effect on acute and chronic inflammation. However, the study of Faculty of Pharmacy UGM (2009) showed that Curcuma zedoaria ethanol extract had antifungal effect if combined with Ethyl-P-MetoxyCinamate (EPMC).

67


This study used DMSO as dissolving solution to find out MIC by using serial dillution. The result showed that Curcuma zedoaria ethanol extract was sensitive for Staphylococcus aureus only in nutrient agar. In nutrient agar, the concentration 100% of Curcuma zedoaria ethanol extract showed no significant differences against Staphylococcus aureus compared to those with ciprofloxacin as positive control. It means that at concentration 100%, Curcuma zedoaria ethanol extract has antibacterial effect against Staphylococcus aureus almost as high as ciprofloxacin.

This research showed that no MIC of Curcuma zedoaria ethanol extract either on Streptococcus mutans or Staphylococcus aureus which were inoculated in different media cultures, because their antibacterial effects on those bacteriae were still lower than those of ciprofloxacin as positive control.

CONCLUSION

This research proved that Curcuma zedoaria ethanol extract has antibacterial effects on Streptococcus mutans and Staphylococcus aureus but still lower than those of ciprofloxacin as positive control.

Curcuma zedoaria ethanol extract was effective as anti-Staphylococcus aureus in concentration of 100%.

REFERENCES1. Hembing, H. M. The benefit of traditional medicine. In Complete Herbal Drugs Diseases Killer. Pustaka Bunda.

Jakarta. 2008: 1-3.2. Hendita,L.K.http://www.kompas.com/index.php/read/xml/2008/03/11/04321144/tolak.angin.si.white.turmeric. Tuesday,

11st March 2008.3. Curcuma zedoaria. Faculty of Pharmacy, University of Gadjah Mada.

http://ccrcfarmasiugm.wordpress.com/ensiklopedia-anti-cancer-plantation/t/Curcuma-zedoaria/. on line. 2009.4. Alcohol. http://id.wikipedia.org/wiki/Alcohol. on line. 2009.5. American Chemical Society. Dimethyl Sulfoxide (DMSO) A “New” Clean, Unique, Superior Solvent. Washington.

USA. 20th-24th August 2000.6. Hart, Tony and Shears, Paul. Bacteria and Diseases. In Colour Atlas Medical Microbiology. Sugiarto Komala and

Alexander H. Santoso (editor). Hipokrates. Jakarta. 1997: 71-226.7. Roeslan, B. and Erawwan, R. Glucan synthesis by GT-ase Streptococcus mutans: mechanism of dental plaque

formation. Scientific Journal Faculty of Dentistry Trisakti University. Third Years. Trisakti University. Jakarta. 1988.8. Todar, K. Staphylococcus. University of Wisconsin-Madison, Department of Bacteriology. http://www.bact.wisc.edu/.

2002.9. Gibson, J. M. Bacteria. In Microbiology and Modern Pathology for Nursing. Yasmin Asih (editor). Medical Book EGC.

Jakarta. 1996: 11-32.10. The Characteristic of Candida albicans. http://www.smallcrab.com/health/25-healthy/415-characteristic-Candida-

albicans/. on line. 2008.11. Kastanya,Y.L.Antibacteria.http://yongkikastanyaluthana.wordpress.com/category/literature-food/antibacteria/. on line.

2008.12. Greenwood. Antibiotics Susceptibility (Sensitivity) Test Antimicrobial and Chemoterapy. 1995.13. Michalek, S. M., Mc Ghee J. R. Dental Microbiology. Fourth Edition. Harper & Raw Publisher, Philadelphia. 1982.

68


8. PENEAUS MONODON SHRIMP SHELL WASTE EXTRACT AS THERAPY IN MANDIBULAR OSTEOPOROSIS WISTAR RATS

Cindy J. S, Melina W. H, Stephanie D., Attika B., Titik H.

Objectives: Osteoporosis is a skeletal systemic disease, characterized by the presence of bone mass resorption. It is manifested in mandible by effecting the osteoblast cell, thus decreasing its vertical dimension. Women who are in the post-menopause cycle have the greater risk to suffer from osteoporosis. Peneaus monodon shrimp shell waste extract contains high calcium which is good for osteoporosis therapy. The aim of this study is to investigate the effect of Peneaus monodon shrimp shell waste extract to the amount of osteoblast cell and the vertical dimension of mandible bone in osteoporosis Wistar rats. Materials and Methods: Thirty female Wistar rats were divided into five groups. Group one (K0) as the negative control group was normal rats. And other groups (K1-K4) were osteoporosis rats induced by ovariectomy. K1 as the positive control group was given the standard dietary. K2-K4 were treated for 9 weeks by giving standard dietary pellet mixed with Peneaus monodon shrimp shell waste extract in various doses: K2 (0,4 mg/gBW/day), K3 (0,7 mg/gBW/day), and K4 (1,1 mg/gBW/day). After treatments, the rats were sacrificed. The amount of osteoblast cell was counted by image tool method using light microscope and the vertical dimension of mandible bone was measured by digital Caliper. Results: The data was analyzed by using MANOVA and LSD test (p<0,05). Result showed that the amount of osteoblast cell and the vertical dimension of mandible bone likewise in K1 was significantly lower than in K0 and it was higher in K4 compared with K2, K3. Conclusions: Peneaus monodon shrimp shell waste extract can be used as mandibular osteoporosis therapy, proved by the increasing amount of osteoblast cell and the vertical dimension of mandible bone in osteoporosis Wistar rats.

INTRODUCTIONOsteoporosis is a skeletal systemic disease, characterized by the presence of bone mass

resorption, so the bone becomes brittle and porous27. There is no sign of osteoporosis in early stage, but after some period of times, fracture and pain in vertebra, hip, humerus, and tibia will appear as its clinical symptoms35. Oral condition in individuals, such as tooth loss, less of gingival attachment, and unstable denture can also be used as an indicator2 because osteoporosis affects the osteoblast cell in mandible, then the vertical dimension will decrease.

Osteoporosis is a chronic and complex interaction between genetic and lifestyle, like severe malnutrition, vitamin C deficiency, hypersecretion of glucokortikoid, low secretion of estrogen and growth hormone in old ages29. There are numerous risk factors involved in osteoporosis and women who are in the post-menopause cycle have the greater risk34.

In normal condition, estrogen has some important roles in osteoblast activity through its receptors which located inside the cytosol. It decreases the secretion of some cytokines: interleukin-1 (IL-1), interleukin-6 (IL-6), and tumor necrosis factor-alpha (TNF-α) that have a contribution in bone resorption. Besides, estrogen will increase the secretion of transforming growth factor β (TGF- β ) and osteoprotegerin (OPG) which function are inhibiting the bone resorption and increasing the osteoclast’s apoptosis13.

The proper therapy for osteoporosis is an adequate intake of minerals, such as calcium (1200 mg/day) and phosphor as the main components of the bone, and also protein collagen. Vitamin D with a doze of 800-1000 IU also recommended because of its role in calcium absorption. However, other factors, like calcitonine, parathyroid hormone, estrogen, and daily exercise are also important in keeping the bone density39.

Penaeus monodon which is well known as shrimp or tiger drawn37, usually found in Pacific

69


ocean, Hindi ocean, South Africa, Japan, and Australia3, consists of vitamin B complex and some minerals: calcium, phosphor, and iodium30. The shrimp shell as well has a composition of protein (25-40%), CaCO3 (30-50%), chitin (15-20%)30, protein, fat, fiber, and some minerals which are good for bone density28.

METHOD This experimental study was conducted in biochemical laboratory of Hang Tuah University. A

total of 30 female Wistar rats with 3 months in age and 150-200 gram in weight, which were then divided into five groups (K0 - K4). One group (K0) was normal and the other four groups (K1-K4) were osteoporosis induced by ovariectomy. Ovariectomy was chosen because it had lower death risk compared with other techniques.

The osteoporosis rats were then given Penaeus monodon shrimp shell waste extract that was mixed with their food in different dozes. Some procedures were obtained to make the extract, from washing, boiling, drying, and milling as the final step.

K1 as the positive control group was given the standard dietary. K2-K4 were treated for 9 weeks by giving standard dietary pellet mixed with Penaeus monodon shrimp shell waste extract in various doses: K2 (0,4 mg/gBW/day), K3 (0,7 mg/gBW/day), and K4 (1,1 mg/gBW/day). ). After treatments, the rats were sacrificed. The amount of osteoblast cell was counted by image tool method using light microscope and the vertical dimension of mandible bone was measured by digital Caliper.

The results were then analyzed using SPSS version 17.0. ANOVA and LSD test with a significant value 95% (p<0,05) were performed to find the differences in total amount of osteoblast cell and vertical dimension in every group.

RESULTThere were a significant difference in the total amount of osteoblast cell and the vertical

dimension which can be seen in distribution tables below:

Table 1. Distribution table of osteoblast cell and mandible vertical dimension in each group

From the table we could see that the amount of osteoblast cell and the mandible vertical dimension

70


were decrease significantly in group K1. It showed that the rats are suffered from osteoporosis after given an ovariectomy. In group K2- K4, osteoblast cell and mandible vertical dimension were increased in stages due to each doze of Penaeus monodon shrimp shell waste.

Table 2. LSD test for osteoblast cell and mandible vertical dimension

Graphic 1. Osteoblast Cell

71


Graphic 2. Mandible Vertical Dimension

DISCUSSIONAccording to the results above, there are a significant difference between K0 as the positive

control group and K1 group with ovariectomy in the amount of osteoblast cell and the mandible vertical dimension. It happens because ovariectomy confuses estrogen secretion which is important for bone metabolism by affecting osteoblast and osteoclast’ activities. Besides, estrogen has a role in facilitating calcium absorption and inhibiting calcium loss from the bone.

The decrease of estrogen secretion causes calcium rate in plasma becomes lower and stimulates the secretion of parathyroid hormone. Parathyroid hormone will increase osteoclast activity in bone resorption and automatically decrease the osteoblast. In other words, the stability of osteoblast and osteoclast is needed for osteoporosis therapy which can be achieved with adequate intake of calcium.

Peneaus monodon shrimp shell waste extract which is mixed in rats’ food with various dozes, K2 (0,4 mg/gBW/day), K3 (0,7 mg/gBW/day), and K4 (1,1 mg/gBW/day), results in the increase of osteoblast cell and mandible vertical dimension. It proves that this extract can be consumed to fulfill the need of calcium (1000-1500 mg/day is recommended).

Other contents of Peneaus monodon shrimp shell waste extract also have roles in inhibiting the decrease of mandible vertical dimension. They are protein as the basic structural of bone connecting tissue, astaxanthine as an anti-oxidan, chitin and chitosan as an anti-cholestrol, magnesium which is important in preventing osteoporosis, ion to restrain bone mineral density, and mangan for bone remodeling.

CONCLUSIONThe osteoporosis treatment by using Peneaus monodon shrimp shell waste extract can increase

72


the amount of osteoblast cell and mandible vertical dimension, although it cannot reach the same level with the normal condition.REFERENCES1. Ali Baziad, 2003. Menopause dan andropause. Edisi I. Jakarta. Yayasan Bina Pustaka Sarwono Prawiroharjo. h 1-6. 2. American Dental Association, 2004. Osteoporosis and Oral Health:The Mouth-Body Connection. Academy of General

Dentistry.3. Amrin K, 2003. Budidaya Udang Windu Secara Intensif. Tangerang: Agromedia Pustaka.4. Anonim. 2008. Protein. http://www.wikipedia.com. diakses tanggal 12 Oktober 2008).5. Aubin JE, Bonnelye E. Osteoprotegerin and its ligand a new paradigm for regulation of osteogenesis and bone

resorption. Available from: http://www.medscape.com/viewarticle/408911.com/content/8/1/201. Acessed on: Sept 12th

2008.6. Banks WJ. 1993. Applied Veterinary Histology. Mosby, London.7. British Nutrition Foundation. 2004. Calcium. British Nutrition Foundation, London.8. Cashman KD. 2002. Calcium intake, calcium bioavailability and bone health. British J.Nutr, 87, Suppl. 2, S169-S177.9. Ciapara I, dkk, 2006. Astaxanthin: a Review of Its Chemistry and Applications. Crit Rev Food Sci Nutr Vol 46: p

185-196.10. Dawson, Hughes B., 1996, Calcium and Vitamin D Nutritional Needs Of Elderly Women. J. Nutr. 126: 165S-1167S.11. Eklou-Kalonji, E., E. Zerath, C. Colin, C. Lacroix, X. Holy, I. Denis & Pointtilart. 1999. Calcium regulating hormones,

bone mineral content, breaking load and trabecular remodeling are altred in growing pigs fed calsium deficient diets. J. Nutr. 129: 188-193.

12. Flynn A, Cashman KD. 1999. Calcium Fortification of Foods. In Mineral Fortification of Foods, pp. 18-53 (R. Hurrel, edit.). Surrey : Leatherhead Food RA.

13. Ghozali, 2007. Sistem Muskulusketal. Yogyakarta: Fakultas Kedokteran Universitas Gajah Mada.14. Guyton AC, Hall JE. 2000. Fisiologi Kedoteran 9th. Jakarta: EGC.15. Irfanto Djaenal, 2002. Peranan Osteoklas dalam Proses Resorbsi tulang Alveol. Skripsi, Universitas Airlangga

Surabaya, h 3-26.16. Junaidi I, 2007. Osteoporosis. Jakarta: Bhuana Ilmu Populer.17. Masyitha D. 2003. Struktur Mikroskopik Tulang Ischium pada Tikus Ovarektomi dan Pemberian Pakan Rasio

Fosfat/Kalsium Tinggi. Media Kedokteran Hewan 19 (1): 21 -24.18. MerckMedicus Modules: Osteoporosis Epidemiology. Merck & Co., Inc. Diakses pada 13 Juni 2008.19. Monroe DG, Secreto FJ, Spelsberg TC. 2003. Overview of estrogen action in osteoblasts: Role of the ligand the

receptor and the co-regulators. J Musculoskel Neuron Interact;3(4):357-62.20. Muhilal, Sulaeman A. 2004. Angka Kecukupan Gizi Vitamin Larut Lemak. Widyakarya Nasional Pangan dan Gizi VIII,

Jakarta.21. Mundy GR.. Bone remodeling and its disorders. Philadelphia: Martin Dunitz Ltd; 1999. p.172-207.22. National Institute of Health. 2005. Optimal Calcium Intake. NIH Consensus Statement 12 : 4. Bethesda, MD : NIH.23. Nieves JW. 2005. Osteoporosis : the role of micronutrients. Am J Clin Nutr ; 81: 1232S-1239S.24. Noer Saifoellah, dkk. 2004. Buku Ajar Ilmu Penyakit Dalam. Jilid I edisi III. Jakarta: balai penerbit FKUI.25. Prabowo RP. 1997. Osteoporosis pada wanita posmenopause. Maj Obstet dan Gynekol; 6: 1-9. 26. Raisz L, 2005. Pathogenesis of Osteoporosis: Concepts, Conflicts, and Prospects. Journal of Clinical Investigation Vol

115 No 12: 3318–3325. DOI:10.1172/JCI27071.27. Rahmana, Mansur and Jadwiga Bloniarz. 2004. Changes of the calcium metabolism in mineralized tissue of rats during

experimental postmenopausal osteoporosis. Polandia Journal of Dental and Maxillofacial Surgery, p 467-470.28. Rekso GT, 2001. Polimer Alam Khitin yang Berasal dari Limbah Kulit Udang dan Kepiting. Pelatihan Pemanfaatan

Limbah Perikanan di Balai Pendidikan dan Pelatihan Perikanan, Tegal.29. Rosyid, Muzaini. Patofisiologi Osteoporosis. www.indoskripsi.com. Diakses 2008.30. Santoso J, dkk, 2006. Seminar Nasional Kitin-Kitosan 2006. Bogor: Departemen Teknologi Hasil Perairan, Fakultas

Perikanan dan Ilmu Kelautan, Institut Pertanian Bogor.31. Shah D et al., 2002. Effects of calcitriol on spine and femoral neck.

73


32. Stevenson JS, Marsh MS, 2007. An atlas of Oateoporosis. New Jersey. Parthenon Pub., New Jersey, USA. Sites Cynthia K, Calles Jorge, 2000. Relation of regional fat distribution to insulin sensitivity in postmenopausal women. Fertility and sterility; 73:61-65.

33. Sloane, E. 2004. Anatomi dan Fisiologi untuk Pemula. Penerbit Buku Kedokteran EGC : Jakarta.34. Sumintarti S, 2005. Hubungan Antara Penyakit Osteoporosis dan Penyakit Periodontal pada Wanita Menopaise;

Dental Journal Edisi Khusus Temu Ilmiah Nasional IV, Makasar. P.81-4.35. Sudoyo, Setiyohardi, Alwi, Simadibrata, Setiati, 2006. Buku Ajar Ilmu Penyakit Dalam. Jilid II. Edisi IV. Jakarta:

FKUI.36. Suryono, 2007. Pengaruh Susu berkalsium Tinggi terhadap Kadar Klasium Darah dan Kepadatan Tulang Remaja

Pria. Institut Pertanian Bogor. Bogor.37. Suyanto S.R. dan Mudjiman A. 1999. Budidaya Udang Windu. Penebar Swadaya. Jakarta.38. Tamura H, 2008. Recent Research in Biomedical Aspects of Chitin and Chitosan. India: Research Signpost.39. Tosteson, dkk. Effective Osteoporosis Treatment Threshold. The U.S. Perspective from the National Osteoporosis

Foundation Guide Committee. Osteoporosis Int. 2008, 19(4) : 437-447.40. Tsang G, 2004. Is Calcium Citrate better than Calcium Carbonate. Tersedia dari

http://www.healthcastle.com/calciumcarbonate-calciumcitrate.shtml. Diakses 1 Februari 2009. 41. Odeberg M, dkk, 2003. Oral Bioavailability of the Antioxidant Astaxanthin in Humans is Enhanced by Incorporation

of Lipid Based Formulations. Eur J Pharm Sci Vol19: p 299-304.42. Vigorita VJ, 1999. Orthopaedic Pathology. Philadelphia: Lippincott Williams & Wilkins, p 115. 43. Wardlaw GM, Insel PM, Seyler MF. 2006. Contemporary Nutrition, Issues and Insight. Mosby Year Book, Toronto.44. Welten D, Kemper HCG, Post GB, Van Staveren W. 1995. A meta analysis of the effectof calcium and bone mass in

young and middle aged females and males. J Nutr,125 ; 2802-2813.Wirakusumah ES, 2008. Mencegah Osteoporosis: Lengkap dengan 39 Jus dan 38 Resep Makanan. Jakarta: Penebar Plus

45. Ziegler R, Scheidt-Nave, Scharla. 1995. Pathophysiology of osteoporosis: Unresolved problems and new insights. J. Nutr. 125: 2033S-2037S.

74


9. INCREASED GINGIVAL EPITHELIAL CELL MATURITY OF MODERATE GINGIVITIS SUBJECTS AFTER CLOVE ESSENTIAL OIL GARGLING

Lidya Noviana Arfiadi, Ardiny Andriani, Regina TC. Tandelilin, Alma Linggar Jonarta

Objectives: To determine the alteration of gingival epithelial cell maturity of moderate gingivitis subjects after gargling various concentrations of clove essential oil solutions. Methods: The subjects involved in this study were 35 subjects suffering moderate gingivitis. These subjects were randomly divided into 2 groups: treated and controlled. The subjects in treated group gargled clove essential oil solutions with the concentrations of 3% (7 subjects), 4% (7 subjects), 5% (7 subjects) and 6% (7 subjects). The controlled group subjects (7 subjects) gargled 0.12% chlorhexidine gluconate. All subjects gargled the solutions every morning and night within 5 consecutive days. Gingival swabs were taken before and after the serial treatment. The swab samples were stained by papanicolaou technique and observed under light microscope. Observation was done within 100 gingival epithelial cells and cell types (basal, intermediate, superficial cells) were identified and counted. The result of various gingival epithelial cells identification were then analyzed with one way ANOVA (p<0.05).Results: The gingival superficial cells in all groups increased after the serial treatment. This indicates an increase of gingival epithelial cell maturity in moderate gingivitis subjects. The obtained Maturation Index (MI) after gargling 0.12% chlorhexidine gluconate, and 3%, 4%, 5% and 6% concentrations of clove essential oil solutions were : 0:38:62; 0:41:59; 0:36:64; 0:34:66; and 0:38:62. Conclusions: Gargling clove essential oil solutions with the concentrations of 3%, 4%, 5% and 6% has the ability to increase gingival epithelial cells maturity in moderate gingivitis subjects. This ability is equivalent to the ability of 0.12% chlorhexidine gluconate.

INTRODUCTION

Gingivitis is an inflamed condition of the gingiva1. According to Nubatonis2 the prevalence of moderate gingivitis in Semarang local clinic is 55% out of all the gingivitis. Gingiva is a part of the oral mucous which covers the alveolar bone and surrounds teeth to the cervix3. Anatomically, gingiva is divided into three main parts: marginal gingiva, attached gingiva, and interdental gingiva4. Gingiva is covered by a keratinized stratified squamous epithelium which undergoes a constant regeneration5. The cell structure in keratinized epithelium will undergo a change from basal cells in the basal layer to pre keratins in the intermediate layer and then to keratins in the superficial layer6. This process of cell movement toward the surface is called maturation7. This keratin layer of the epithelium is important in maintaining cellular integrity against mechanical forces3.

The process of epithelial cell maturation in oral mucous can be observed through exfoliative cytology using papanicolaou staining. A normal oral mucosal swab can contain cells from superficial layer, intermediate layer and a few from the basal layer8. Gingival inflammation can be a factor for an incomplete maturation process3. Inflammation can cause increased shedding of superficial cells which results in an increased mitotic activity of basal cells to replace them9. As the level of inflammation increases, the number of basal cells observed in gingival smears increases while the number of non nucleated superficial cells decreases10.

Various medications have been used to cure gingivitis. One of the most popular medications is the use of chlorhexidine gluconate mouthwash. Chlorhexidine gluconate contains antiseptic agent which can hamper the formation of dental plaque which is also known as a local factor of gingivitis11. Many natural resources have been developed to cure gingivitis. Clove (Syzygium aromaticum (L.)) is one of the promising natural resource which has the ability in healing gingivitis.

75


Clove is well known by its history to be one the most sought after medication to treat various illnesses by the locals as clove oil gives pharmacological effects as a stimulant, local anesthetic, anti emetic, antiseptic, anti spasmodic12, and also as a cure for toothaches13. According to Sudarsono et al.14 clove can reduce oral mucous and throat inflammation. The main product of crelove is the flower which contains 15-20% essential oil15. Clove essential oil has been known to heal minor oral ulcer and as an analgesic for oral and oropharynx infections16.

Clove essential oil consists of eugenol (80-90%), eugenyl acetate (2-27%), β-caryophyllene (5-10%), methyl salicylate, methyl eugenol, benzaldehyde, methyl amyl ketone, and α-ylangene13. Eugenol in clove essential oil is an active ingredient which is widely used in drugs and medications as it has an anti bacterial effect to Streptococcus mutans and S. viridans12. Meridian17 reported that 0.625% clove essential oil is the Minimal Inhibitory Concentration (MIC) towards Salmonella typhi, whereas 2.5% clove essential oil is the Minimal Bactericidal Concentration (MBC). The concentration of clove essential oil that can inhibit hyphal growth is 0.2 mg/ml18. Nesda19 reported that clove flower extracts with the concentration of 0.5-4% has the same effect in inhibiting the growth of Streptococcus alpha.

The antibacterial effect of clove essential oil is believed to have the ability to reduce bacterial accumulation in the gingival sulcus which leads to a minimized gingival inflammation. With the lessening of gingival inflammation, the number of keratinized superficial cells increases. The purpose of this study was to determine the alteration of gingival epithelial cell maturity in moderate gingivitis subjects in response to gargling clove essential oil solutions with various concentrations. The clove essential oil concentrations used in this study are 3, 4, 5, and 6% which are based on previous researches. At present there is no recorded study that was carried out on the alteration of gingival epithelial cell maturity of moderate gingivitis subjects in response to gargling clove essential oil solutions.

MATERIALS AND METHODSThis research was carried out after receiving an Ethical Clearance (KE/FK/568/EC, December 9, 2009) from the Ethical Commission for Medical and Health Research from the Faculty of Medicine Universitas Gadjah Mada. The clove essential oil solutions were made in Laboratorium Pengembangan dan Penelitian Terpadu (LPPT) Universitas Gadjah Mada. The solutions were diluted with aquadest to the concentrations of 3, 4, 5, and 6%. Propylene glycol was added to the solutions as a solvent for the mixture of aquadest and oil.

The subjects in this study consist of 35 subjects suffering moderate gingivitis with Gingival Index (GI) ranging from 1.1 to 2 according to Eley and Manson (2004) classification. The subjects’ exclusion criteria were as the following: currently taking antibiotic, anti inflammatory drugs, anti epileptic (phenytoin) drugs, hormonal contraception pills, and cigarette smoker. The 35 subjects were divided into two groups, namely controlled and treated group. The controlled group consists of seven subjects and were instructed to gargle 0.12% chlorhexidine gluconate. The treated group was divided further into four sub groups. Each sub group consists of seven subjects and were instructed to gargle 3, 4, 5, or 6% clove essential oil solutions. The subjects from both the groups were instructed to gargle the mouthwash solutions in the morning and night after brushing teeth for a period of 5 consecutive days.

Gingival swabs were taken twice from each subject, before and after the serial treatment. Each sample was taken in the morning, before the subjects brush their teeth and on the night prior to the scheduled

76


sampling the subjects were only allowed to consume plain water after 10 pm. The swabs were taken using a cytobrush on the gingiva area with the highest GI. The swabs were then fixated on glass slides using 96% alcohol and stained by papanicolaou staining technique. Observation and identification of gingival epithelial cell types were done within 100 cells using a light microscope with 400× magnification. Gingival epithelial cell types were counted based on the classification of Naib (1970). Basal-parabasal cells are blue in color with a round or ovoid nucleus, and the ratio of nucleus and to cytoplasm 8:10 (basal cells) or 5:10 (parabasal cells). Intermediate cells can either be stained blue or pink, the size of the cells are slightly larger than basal cells with a ratio of nucleus and to cytoplasm 2:10. Superficial cells are orange colored cells with a round or picnotic nucleus and at times without one, and the ratio of nucleus and to cytoplasm 1:10. The Maturation Index (MI) which is the ratio of different epithel cell types (basal cells : intermediate cells : superficial cells) were also analysed. The obtained data was compared and analyzed with one way ANOVA (p<0.05) using SPSS Statistics 17.0.

RESULTSThe data obtained from this research shows that before the treatment in all groups, the most dominant cell type is the intermediate cells, followed by superficial and basal cells being the fewest cell type found. However, after five days of treatment, the most dominant cell type is the superficial cells, followed by intermediate and subsequently basal cells. The highest mean value of superficial cells is found in the group treated with 5% clove essential oil solution, while the lowest mean value is found in the group treated with 3% clove essential oil solution. Basal cells were the least cell type found in all the groups (Table 1).

Table 1. Distribution of various gingival epithelial cell types

Groups Cell types ± SD

Before After

Controlled

Basal-parabasal 0.29 ± 0.49 0 ± 0

Intermediate 57.86 ± 4.56 38.29 ± 5.71

Superficial 43.29 ± 2.98 61.71 ± 5.71

77


Treated

3% clove essential oil


Intermediate 54.29 ± 4.03 41.14 ± 5.18

Superficial 45.29 ± 4.19 58.86 ± 5.18



Intermediate 56.57 ± 7.11 36.43 ± 6.95

Superficial 43.14 ± 7.08 63.57 ± 6.95



Intermediate 53.86 ± 2.03 34 ± 5.14

Superficial 46 ± 2.16 66 ± 5.13



Intermediate 52.57 ± 9.20

38.43 ± 11.73

Superficial 47.29 ± 9.25

61.43 ± 11.50

78


The result obtained by ANOVA test for the means of various cell types in all the groups (Table 2) showed no statistical significance. This reveals that before receiving the treatment, the number of each gingival cell types is the same in all the subjects.

Table 2. ANOVA test result of each gingival cell type before treatment

Sum of Squares Df Mean Square F Sig.

BasalA Between Groups

.400 4 .100 .292 .881

Within Groups

10.286 30 .343

Total 10.686 34

IntermediateA Between Groups

119.029 4 29.757 1.441 .245

Within Groups

619.714 30 20.657

Total 738.743 34

SuperfisialA Between Groups

80.171 4 20.043 1.078 .385

Within Groups

557.714 30 18.590

Total 637.886 34

ANOVA test was done to determine the effect of different concentrations of essential clove oil on the mean value of various cell types after five days of treatment. The result of ANOVA test is summarized in Table 3.

79

Asia Pacific Dental Students Journal Table 3. ANOVA test result of each gingival cell type after treatment

Sum of Squares Df Mean Square F Sig.

BasalB Between Groups .000 4 .000 . .

Within Groups .000 30 .000

Total .000 34

IntermediateB Between Groups 196.171 4 49.043 .903 .475

Within Groups 1629.714 30 54.324

Total 1825.886 34

SuperfisialB Between Groups 197.829 4 49.457 .929 .461

Within Groups 1597.714 30 53.257

Total 1795.543 34

The result on Table 3 shows that there are no statistical significance of the mean value of intermediate and superficial cells between the controlled and the treated groups. In other words, the number of intermediate and superficial cell types in both groups are same. Since basal-parabasal cells were not found in all the groups, therefore the number of basal-parabasal cells are the same in both controlled and treated groups. The result above reveals that the ratio of basal-parabasal, intermediate, and superficial cells are the same in all the groups. This result indicates that clove essential oil solutions is able to alter the maturity of gingival epithelial cells and this ability is equivalent to 0.12% chlorhexidine gluconate. The alteration of gingival epithelial cells Maturation Index (MI) in all groups before and after the treatment is shown in Table 4.

Table 4. Maturation Index (MI) before and after treatment

Groups MI

Before After

Controlled 0 : 57 : 43 0 : 38 : 62

Treated 3% clove essential oil 0 : 55 : 45 0 : 41 : 59

4% clove essential oil 0 : 57 : 43 0 : 36 : 64



DISCUSSION

The Maturation Index (MI) shows a shift to the middle in all the groups before the treatment. This indicates a dominating pattern of intermediate cells. The increased number of intermediate cells is due to the gingivitis condition of the subjects. Inflammation (gingivitis) can lower the degree of keratinization as a result of the irritating effects of bacteria20,21. Moreover, the existence of bacteria can

80


hamper the complete differentiation of epithelial cells22. Inflammation can induce basal cells to increase its ability to proliferate, however this respond is quickly followed by cell death21,3.

Inflammation can increase the shedding of superficial cells. The shedding of the superficial layer is called desquamation which is also known as a gingival mechanism in responding to irritating factors. Desquamation occurs to limit the colonization and invasion of pathogenic microrganism on epithelial surface. The mechanism of desquamation is described as an enzymatically programmed destruction of fat and protein7. In an inflammatory condition, the turn over rate of gingival epithelial cells increases. This is due to the increased rate of cell proliferation in the basal layer, followed by increased cell death in the superficial layer. The process above is to limit the number of defected cell and invasion of bacteria into deeper tissues3.

The above result differs after five days of treatment where MI in all groups showed a shift to the right. The shift of MI to the right indicates an increased maturation of gingival epithelial cells with a dominating number of superficial cells. Chung et al.23 stated that 1 mm of keratinized attached gingiva is essential in maintaining gingival health. According to Lainson and Mackenzie20 the number of superficial cells in a healthy gingiva is higher than intermediate cells. In a normal condition the percentage of superficial cells in maxillary regio is 86.1% and in mandibular regio is 78.7%. This number decreases due to inflammation (67.2% in maxillary regio and 60.6% in mandibular regio). Similar research found that the percentage of superficial cells in a normal gingiva to be 89.4%24 and 75%25. The increased number of superficial cells found in this research indicates a normal leading pattern of maturation.

ANOVA test results (Table 3) shows that the ratio of gingival epithelial cells after treatment between both groups was not significant. Thus, clove essential oil solutions with the concentrations of 3, 4, 5, and 6% has the same ability as 0.12% chlorhexidine gluconate in inducing gingival epithelial cell maturity. The increasing number of superficial cells in both groups after treatment can be assumed that clove essential oil and 0.12% chlorhexidine gluconate are able to reduce gingival inflammation indirectly, by means of reducing the bacteria that cause local irritation in gingiva. The reduced number of bacterial irritants can balance the proliferation of basal cells and the shedding of superficial cells thus leading to a normal cell turnover rate22.

Chlorhexidine gluconate has the ability to increase epithelial cell maturity as it can reduce irritating bacteria in the gingiva. Chlorhexidine gluconate in low concentration shows a bacteriostatic effect and in high concentration exhibit a bactericidal effect. At low concentrations, antiseptic molecules binds to the phosphate groups in LPS and carboxy groups in bacterial cell wall proteins. These activities disrupts cell transports and metabolic processes. Thus, chlorhexidine gluconate indirectly affects the enzymatic functions of the dehydrogenase and ATPase contained bacterial cell wall. At high concentrations, chlorhexidine gluconate can cause destruction to the bacteria cell membrane that can result in osmotic imbalance, the release of cytoplasmic components and cell death26.

Based on previous studies clove essential oil is known to have the antibacterial and anti inflammatory effects. These effects are believed to be the contributing factor in the increasing number of superficial cells in all groups after the treatment. The antibacterial effect of clove essential oil is largely due to its contents of eugenol and phenol. Eugenol inhibits bacterial colonization by sensitizing the phospholipid bilayer of cytoplasmic membrane resulting in increased permeability, loss of vital intracellular constituents, and damaging bacterial enzymes systems27.

According to Parwata and Dewi28 phenol derivatives can interact with bacterial cells by adsorption

81


involving hydrogen bonds. At low concentration, phenol can penetrate into bacterial cell and cause precipitation and denaturation of proteins. At high concentration phenol can cause protein coagulation and lysis of bacterial cell membrane resulting in bacterial cell death. Therefore, in this study, the antibacterial mechanism of clove essential oil is expected to reduce bacteria which is the local factor of gingivitis and subsequently increase the degree of keratinization.

The anti inflammatory effect of clove essential oil is due to eugenol and kaempferol as stated by Daniel et al.29 and Santangelo et al.30. According to Daniel et al.29, the ability of eugenol as an anti-inflammatory agent is influenced by its ability to inhibit the formation of prostaglandins by prostaglandin H synthase (COX, or cyclooxigenase). Santangelo et al.30 stated that some flavonoids like kaempferol has the ability to modulate the immune system and has a potential as an anti-inflammatory agent. Kaempferol has the ability to reduce the expression of pro-inflammatory cytokines, including TNFα, IL-1β, IL-6, IL-8, and MCP-1. Several cytokines such as IL-1β, IL-6 and prostaglandin can enhance the proliferation of epithelial keratinocytes by stimulating the production KGF (Keratinocyte Growth Factor). Over expressions of these cytokines can stimulate basal cell proliferation3. Decreased expression of pro-inflammatory cytokines can reduce the excessive cell division in the basal layer so that cell turnover rate leads to normal.

The turn over time for attached gingiva is 10 days31, but in this research, an observation of epithelial maturity was done after 5 days of intervention. The reason behind this was to observe the different effects of various concentrations of clove essential oil to epithelial cell maturity before a full cycle of epithelial regeneration. Epithelial maturity is affected by increased levels of progesterone32. With this in mind, one of the subjects’ criteria in this study is free from hormonal contraception pills.

CONCLUSIONClove essential oil solutions with the concentration of 3, 4, 5, and 6% has the ability to increase gingival epithelial cell maturity which is equivalent to the ability of 0.12% chlorhexidine gluconate.

REFERENCES1. Summers A. 2009. Gingivitis : Diagnosis and Treatment. Emergency Nurse. 17(1):18-202. Nubatonis MO. Survei Prevalensi Gingivitis Ditinjau dari Perilaku Pencegahan dan Pengobatan pada Pengunjung

Puskesmas Padangsari Banyumanik Kota Semarang. Skripsi. Fakultas Kedokteran Masyarakat Universitas Diponegoro. 2002.

3. Garrant PR. 2003. Oral Cells and Tissues. Canada. Quintessence Publishing Co, Inc4. Carranza FA. 1990. Carranza’s Clinical Periodontology. Los Angeles. Saunders Elseviers5. Fawcett DW. 1994. A Textbook of Histology Twelfth Edition. New York. Chapman & Hall6. Junquiera LC, Carneiro J, Keller RO. 1995. Histologi Dasar (terj.). Edisi VIII. Jakarta. EGC7. Nanci A. 2003. Ten Cate’s Oral Histology : Development, Structure, and Function Sixth Edition. Missouri. Elsevier Ltd8. Burzlaff JB. Bohrer PL, Paiva RL, Visioli F, Filfo MS, Da Silva VD, Rados PV. 2007. Exposures to Alcohol or Tobacco

Effects The Pattern of Maturation in Oral Mucosa Cell : A Cytohistological Study. Cytopathology. 18:367-759. Davis WC. 1986. Oral Histology Cell Structure and Function. Philadelphia. W.B. Saunders Company10. Kazuyoshi O. 2005. A Study of Exfoliative Cytology in Periodontal Disease. The Relation Between Degree of

Inflammation, Cytological Findings and Histopathological Findings. The Japanese Society of Periodontology. 18(2):189-206

11. Jones CG. 1997. Cholrhexidine : Is it Still The Gold Standard?. Periodontology 2000.15:55-6212. Nurdjannah N. 2004. Diversifikasi Penggunaan Cengkeh. Perspektif. 3(2):61-7013. Newal CA, Anderson LA, Phillipson JD. 1996. Herbal Medicines : A Guide for Health-care Professionals. London.

The Pharmaceutical Press

82


14. Sudarsono PN, Gunawan D, Wahyuono S, Donatus IA, Purnomo. 2002. Tumbuhan Obat II (Hasil Penelitian, Sifat-sifat, dan Penggunaan). Yogyakarta. Pusat Studi Obat Tradisional UGM

15. Kemala S. Hasanah M, Djisbar A, Asman A, Nurdjannah N. 1997. Monograf Tanaman Cengkeh. Bogor. CV Visco Printers

16. Elujoba AA, Odelleye OM, Ogunyemi CM. 2005. Review : Traditional Medicine Developement for Medical and Dental Primary Health Care Delivery Sytem in Africa. Afr J Trad. 2:46-61

17. Meridian E. 2009. Perbandingan Kepekaaan Bakteri Salmonella typhi terhadap Minyak Atsiri Cengkeh. http://medicine.uii.ac.id. diunduh 11/10/2009

18. Park M, Gwak K, Yang I, Choi W, Jo H, Chang J, Jeung E, Choi I. 2007. Antifungal Activities of the Essential Oils in Syzygium aromaticum (L.) Merr. Et Perry and Leptospermum petersonii Bailey and their Constituents against Various Dermatophytes. J Microbiol. 45(5):460-5

19. Nesda AS. Efektivitas Kumur Ekstrak Bunga Cengkeh (Eugenia aromaticum) terhadap Pertumbuhan Streptococcus alpha haemolytic pada Plak Gigi Penderita Gingivitis Ringan. Skripsi. Fakultas Kedokteran Gigi UGM. 2005

20. Lainson PA, Mackenzie IC. 1976. An Examination of the Cytology of Uninflammed and Inflammed Gingiva Using a Filter Imprint Technique. J Periodontol. 47(8):477-80

21. Carro OM, Evans SA, Leone CW. 1997. Effect of Inflammation of the Proliferation on Human Gingiva Epithelial Cells In Vitro. J Periodontol. 68(11):1070-5

22. Squier C. 1981. Keratinization of the Sulcular Epithelium – A Pointless Pursuit? J Periodontol. 52(8):426-923. Chung DM, Oh TJ, Shotwell JL, Misch CE, Wang H. 2006.Significance of Keratinized Mucosa in Maintenance of

Dental Implants with Different Surfaces. J Periodontol. 77(8):1410-824. Miller SC, Soberman A, Stahl SS. 1951. A Study of Cornification of the Oral Mucosa. J Dent Res. 30:1225. Montgomery PW, Von Haam E. 1951. A Study of Exfoliative Cytology of Oral Leukoplakia. J Dent Res. 30(12):260-426. Dąbrowska E, Letko M, Roszkowska-Jakimiec W, Letko R, Sadowski J. 2006. Effest of Chlorhexidine Mouthrinse on

Cathepsin C Activity in Human Saliva. Ad Med Sci. 51(1):96-927. Gupta C, Garg A, Uniyal L, Gupta S. 2009. Comparison of Antimicrobial Activities of Clove Oil and its Extracts On

Some Food Borne Microbes. The Internet J Microbiol. 7(1): 469-7128. Parwata I, Dewi P. 2008. Isolasi dan Uji Aktivitas Antibakteri Minyak Atsiri dari Rimpang Lengkuas (Alpinia galaga

L.). J Kim 2(2):100-10429. Daniel AN, Sartoretto SM, Schimdt G, Capparoz-Assef SM, Bersami-Armado CA, Cuman RKN. 2009. Anti-

inflammatory and Antinociceptive Activities of Eugenol Essential Oil in Experimental Animal Models. Res Bras Farmacogn. 19(1b):103-17

30. Santangelo C, Varí R, Scazzocchio B, Di Benedetto R, Filesi C, Masela R. 2007. Polyphenol, Intracellular Signaling and Inflammation. Ann Ist Super Sanita. 43(4):394-405

31. Bath-Balogh M, Fehrenbach MJ. 2006. Dental Embryology, Histology, and Anatomy. Missouri. Elsevier Inc.32. Machtei E, Mahler D, Sanduri, H, Peled M. 2004. The Effect of Menstrual Cycle on Periodontal Health. J Perio 75:

408-12

83

http://medicine.uii.ac.id/


10. BIOACTIVE AND SURFACE-FUNCTIONALIZED ROBOTIC DISPENSING 3D SCAFFOLDS FOR BONE RECONSTRUCTION

Jooho Lee, Youngjin hong, Yuna KimPurpose : Our study aim is to fabricate 3-dimensional scaffolds for bone reconstruction, such as alveolar bone augmentation and craniofacial replacement. To develop the scaffold, bioactive and degradable composite was used as a material and a robotic dispensing method was applied to engineer pore structure.Materials and Methods 1)Preparation of initial materials, such as bioactive glass powders and composite solutions-Polymer solution and bioactive glass were homogenized to a composite solution with appropriate viscosity for the dispending processing.2)Fabrication of 3D scaffolds by using Robotic Dispensing equipment -Fabrication of scaffolds with different shapes and porosities.3)Surface coating of the 3D composite scaffold-In situ coating was made by means of dissolution-and-reprecipitation process with immersion in Ca-P saturated solution(coated with hydoxyapatite) prepared.4)Evaluation of the 3D scaffolds-The morphology and structure of the scaffold were observed by scanning electron microscopy.-Surface coated phase was evaluated by energy dispersive spectroscopy5)Cell affinity test-Preliminary cell viability test was made by observation of the cell morphology grown on the scaffold after culturing for 3 and 7 days.Results :1)3D scaffolds with controlled pore geometry were produced by using robotic dispensing method.2)The scaffolds were observed to consist of uniformly distributed bioactive glass particles and around polymeric matrix.3)The surface of the 3D scaffold could be coated evenly under immersion in Ca-P-saturated solution for a few days.4)Bone cells were shown to grow actively through on the produced scaffolds.Conclusion :Our scaffolds are considered to find a variety of uses in bone reconstruction area, which is mainly due to the benefits of the scaffolds shown as below:-Large porosity which improve osteoconduction.-Controllable pore geometry by the robotic dispensing processing.-Controllable scaffold shape which is tunable to defect size and shape.-Bioactive and degradable composition made of bioactive glass and degradable polymer.

INTRODUCTION

Our study aim is to fabricate 3-dimensional scaffolds for bone reconstruction, such as alveolar bone augmentation and craniofacial replacement. To develop the scaffold, bioactive and degradable composite was used as a material and a robotic dispensing method was applied to engineer pore structure. In particular, the surface of the scaffold was coated with bone mimetic hydroxyapatite phase to improve biological compatibility.


1) Preparation of initial materials, such as bioactive glass powders and composite solutions

- Bioactive glass powders were produced by a sol-gel method

- Polymer solution and bioactive glass were homogenized to a composite solution with appropriate viscosity for the dispending processing.

84


2) Fabrication of 3D scaffolds by using Robotic Dispensing equipment

- Control over and optimization of dispensing parameters: dispensing speed, temperature, solution concentration and evaporation conditions.

- Fabrication of scaffolds with different shapes and porosities.

3) Surface coating of the 3D composite scaffold

- The surface of the robotic dispensed scaffold was coated with hydroxyapatite which is equivalent to the inorganic phase of bone.

- In situ coating was made by means of dissolution-and-reprecipitation process with immersion in Ca-P saturated solution prepared.

4) Evaluation of the 3D scaffolds

- The morphology and structure of the scaffold were observed by scanning electron microscopy.

- The porosity and pore configuration of the scaffolds were measured.

- Surface coated phase was evaluated by energy dispersive spectroscopy

5) Cell affinity test

- Preliminary cell viability test was made by observation of the cell morphology grown on the scaffold after culturing for 3 and 7 days.

RESULTS

1) 3D scaffolds with controlled pore geometry were produced by using robotic dispensing method.

85


2) The scaffolds were observed to consist of uniformly distributed bioactive glass particles and around polymeric matrix.

3) The surface of the 3D scaffold could be coated evenly under immersion in Ca-P-saturated solution for a few days, which was possible by the ionic dissolution and reprecipitation process.

86


87


4) Bone cells were shown to grow actively through on the produced scaffolds.

88


DISCUSSION AND CONCLUSIONS

It is of special importance to develop 3D scaffolds in the reconstruction of bone tissues. The robotic dispensing technique has gained much interest as a new way of producing scaffolds with well-defined pore geometry. In this work, we used the robotic dispensing method to produce bioactive and degradable composite scaffold for bone regeneration. The control of dispensing parameters revealed successful generation of composite layer-by-layer assembly to construct 3D geometry. The surface of the scaffold was tailored by coating with hydroxyapatite phase after treatment in a Ca-P saturated solution, and the coated layer is expected to provide favorable conditions for cells to adhere and bone tissue formation. The currently developed scaffolds are considered to find a variety of uses in bone reconstruction area, such as direct bone filling material and 3D scaffold for bone tissue engineering, which is mainly due to the benefits of the scaffolds shown as below:

- Large porosity and pore size which improve osteoconduction.

- Controllable pore geometry by the robotic dispensing processing.

- Controllable scaffold shape which is tunable to defect size and shape.

- Bioactive and degradable composition made of bioactive glass and degradable polymer.

REFERENCES1. JOURNAL OF MATERIALS SCIENCE 37 (2002) 3107 – 3116. Fabrication of soft tissue engineering scaffolds by means of rapid prototyping techniques. R. LANDERS, A. PFISTER, U. HU¨ BNER, H. JOHN, R. SCHMELZEISEN, R. MU¨ LHAUPT∗2. J Mater Sci: Mater Med DOI 10.1007/s10856-008-3573-4. 3D polycaprolactone scaffolds with controlled pore structure using a rapid prototyping system. SuA Park Æ GeunHyung Kim Æ Yong Chul Jeon Æ YoungHo Koh Æ WanDoo Kim3. Biomaterials 23 (2002) 1169–1185. Fused deposition modeling of novel scaffold architectures for tissue engineering applications. Iwan Zeina, Dietmar W. Hutmacherb, Kim Cheng Tanc, Swee Hin Teoha4. Biomaterials 28 (2007) 5291–5297. Fabrication of three-dimensional polycaprolactone/hydroxyapatite tissue scaffolds and osteoblast-scaffold interactions in vitro. Lauren Shor, Selc-uk Gu¨ c- eri, Xuejun Wen, Milind Gandhi, Wei Sun

89

Asia Pacific Dental Students Journal 5. Widmer MS, Mikos AG. Fabrication of biodegradable polymer scaffolds for tissue engineering. In: Patrick Jr CW, Mikos AG, McIntire LV, editors.Frontiers in tissue engineering. New York: Elsevier, 1998. p. 107–20.6. Hutmacher DW. Polymeric scaffolds in tissue engineering bone and cartilage. Biomaterials 2000;21:2529–43.7. Giordano RA, Wu BM, Borland SW, Cima LG, Sachs EM, Cima MJ. Mechanical properties of dense polylactic acid structures fabricated by three dimensional printing. J Biomater Sci Polym Edn 1996;8(1):63–75.8 Kim SS, Utsunomiya H, Koski JA, Wu BM, Cima MJ, Sohn J, Mukai K, GriffithLG, Vacanti JP. Survival and function of hepatocytes on a novel three-dimensional synthetic biodegradable polymer scaffold withan intrinsic network of channels. Ann Surg 1998;228(1):8–13.9. Hollister SJ, Maddox RD, Taboas JM. Optimal design and fabrication of scaffolds to mimic tissue properties and satisfy biological constraints. Biomaterials 2002;23:4095–103.10. Hutmacher DW. Scaffolds in tissue engineering bone and cartilage. Biomaterials 2000;21:2529–43.11. Sun W, Lal P. Recent development on computer aided tissue engineering—a review. Comput Meth Programs Biomed 2002;67: 85–103.12. Sun W, Darling A, Starly B, Nam J. Computer-aided tissue engineering: overview, scope and challenges. Biotechnol Appl Biochem 2004;39:29–47.

90


11. EFFECTS OF OOLONG TEA ON THE PREVENTION OF TOOTH DEMINERALIZATION

Tao Chih Yun, Yu Shan Huey, Chiang Yu Chih, Lin Chen Ming, Lin Han Wei Objective: The purpose of this study is to test whether Oolong tea exhibits anti-erosion effect on enamel surface. Methods:24 enamel slcies were prepared and exposed with a 2 mm × 3 mm treating area each. The specimens were then rinsed/treated in Oolong tea for 0.5, 2, 24 hr, whereas the Oolong tea was brewed by 1-min and 15-min steeping time. We soaked tea-treated specimens in the demineralization solution (Lactic acid 50mM, pH=2.55) to test the anti-erosion capability by measuring the release of Calcium (ppm) (Metrohm® 861 Compact IC). We defined the anti-erosion capability of enamel (AECE) as [(CaT-CaN)/CaN] x 100%. CaT: Ca2+

release of treated group; CaN: Ca2+ release of non tea-treated group.The results were statistically analyzed by two-way ANOVA (i.e., the duration of tea-treatment vs. concentration of tea) and by the post hoc Tukey’s test with the statistical significance set at α =0.05.Results: All groups showed the significant anti-erosion capability of tea-treated enamel surface (p<0.05) except the group of 24hr treated in15-min steep tea solution. When treating in 1-min steep tea solution, the AECE would increase by 24.5% from 0.5hr treated group (29.6%) to 24hr treated group (54.1%). However, the AECE decreased following the increasing treated time in 15-min steep tea solution. Conclusions: Our study indicated Oolong tea has great potential in anti-erosion of enamel. The steeping time of Oolong tea and the treating time of tea solution may be crucial factors to affect the tooth demineralization. In order to explore the mechanism of tooth anti-erosion with tea treatment, further studies are being conducted to analyze the tea organic component which may contribute to tooth protection from demineralization and effects on remineralization.

INTRODUCTION

In recent days, some tea relating products claim to have positive effect on health 1.2, and Taiwanese folklore have long been discussing the benefits of drinking tea on human body more than on dentistry. Therefore, the perspective of tea’s benefit on oral health has evolved researches into tea’s effect on teeth. In Kato et al 3, they concluded that the component of green tea is able to reduce the wear of dentin under erosive/abrasive conditions and that tea has the ability to inhibit bacteria or enzymes which will accelerate dentin matrix degradation. In regard to enamel, H. Yu et al 4 indicates that the organic components possess the property of increasing the acid resistance of tooth enamel.

This study is to find whether tea has direct effect on human tooth in spite of studying the bio-chemical effect of certain components. While most studies are based on green tea, Oolong tea is selected in this paper because of the unique culture of tea drinking in Taiwan. The tea is of different steeping time and the enamel specimens are soaked in the tea for different drenching time to determine whether Oolong tea has any effect on tooth-demineralization.


Enamel specimens preparation

The total 51 enamel specimens were prepared from freshly extracted intact human permanent molars and are stored in 8% thymol solution to sterilize and eliminate the influence of microorganisms. The non-carious enamel labial/lingual/interproximal surfaces were cut into slices by teeth microtome low speed saw (ISOMETTM, BUEHLER), and ground to the standardized thickness of 11 mm by polisher (LTD. MINIMET® BUEHLER). Each slice was exposed a 2 mm × 3 mm area by using nail polish to cover the unexposed area of the slices. Every specimen was then coded in sequence and stored in 3.5% saline solution.

91


Oolong tea preparation

The Oolong tea leaf used in this experiment is a product from Ten Ren Tea Cooperation. Following the product instructions, 15g of the Oolong tea leaves were infused into 200mL at 90 distilled water for℃ 1 min and 15 min and the tea leaves were removed. The tea was cooled to room temperature before next procedure

Tea treatment and Demineralization

The encoded specimens were divided into 9 groups and soaked in the saline, 1 min, or 15 min-brewed Oolong tea for 0.5, 2, or 24 hr. After treated with saline and tea, these specimens were soaked in the demineralization solution (Lactic acid 50mM, Cacl2 1.5mM, KH2PO4 0.9mM, pH=2.55) for 24 hr. These procedures were always conducted on a shaker(Firstek, model:S-101) at the speed of 130 rpm/time to avoid biofilm forming.

Released calcium measurement

To determine the effect of tea treatment, calcium released after demineralization was measured with Metrohm® 861 Compact IC. The standard 10, 25, 50 ppm calcium solution was prepared by diluting the standard 1000 ppm calcium solution.

Analysis

We defined the anti-demineralization capability of enamel (AECE) as following equation: [(CaT-CaN)/CaN] x 100%.

where CaT is Ca2+ release of treated group; CaN is Ca2+ release of non tea-treated group. The results were statistically analyzed by two-way ANOVA (i.e., the duration of tea-treatment vs. concentration of tea) and by the post hoc Turkey’s test with the statistical significance set at α =0.05.

RESULTS

The means and standard deviations of the released calcium and are shown below (Table. 1) to observe the tendency of released calcium. Simultaneously, the AECE is also calculated to reveal the trend of released calcium in different tea preparing and drenching time (Fig. 1.)Table. 1. Mean and SD of released calcium(ppm)

Brewing time 0 min (saline) 1 min 15 min

Soaking time mean SD Mean SD mean SD

0.5 hr 229.49 27.8 299.11 72.4 225.82 72.0

2 hr 194.47 168.6 327.34 59.9 306.12 100.6

24 hr 331.18 20.4 342.68 65.6 289.86 77.5

92


-20

-15

-10

-5

0

5

0.5 2 24

Tea soaking time(hr)

Cal

cium

cha

ge(%

)

1MIN

15MIN

Figure. 1. calcium change (%) of different tea brewing and soaking time

Through Turkey’s test, it shows no significant difference both among the brewing time of 0, 1, and 15 min and the soaking time of 0.5, 2, and 24 hr. One-way ANOVA was also used, and there is no significant difference either.

Considering the interaction between the two factors and the factors may have non-linear relationship with the released calcium, the multiple regression analysis was conducted and indicates that when the soaking time is controlled, there is significant difference between saline and 1 min-brewing-time groups. And when the brewing time is controlled, there is difference between 0.5 hr-soaking time and 24 hr-soaking time groups. (P <0.1)

DISCUSSION

In our study, the purpose is to measure the calcium releasing from the teeth specimens, which is as we concerned as an indicator to the capability to resist demineralization. There are several factors that will influence the outcome of this research. The following we will discuss the factors that will be influenced: First, the tea that we brewed using distilled water but we did not sterilize it to exclude the effect that might cause from the breed of microorganisms that will effect demineralization of the enamel surface probably more likely to result into increasing the calcium releasing. Second, we expose equal area for soaking into tea each time by using the method of covering the remaining area by nail polish. The component of the nail polish that we apply on the remaining surface is not clear. It might have compositions dissolve into the demineralization solution which we may concern as a factor that will affect the outcome. Third, each tooth can only be prepared into four specimens and obviously that will not be sufficient for dispatched into all of the different timing and immersing groups. Different teeth may show different content of calcium that surreptitiously influences the outcome.

93


REFERENCES

1. Shizuka Sasazuki, MDet al. Relation between Green Tea Consumption and the Severity of Coronary Atherosclerosis among Japanese Men and Women. Annals of epidemiology 2000;10:401-408.

2. Chung S. Yang3, Jee Y. Chung, Guang-yu Yang, Saranjit K. Chhabra and Mao-Jung Lee. Tea and Tea Polyphenols in Cancer Prevention.

3. Melissa Thiemi KATO1, Ana Carolina MAGALHAES2, Daniela RIOS3, Angelica Reis HANNAS4, Thomas ATTIN5, Marilia Afonso Rabelo BUZALAF6. Protective Effect of Green Tea on Dentin Erosion and Abrasion.

4. H. Yu, T. Oho and L. X. Xu. Effects of several tea components on acid resistance of human tooth enamel.

94


12. EFFECT OF CASTING SYSTEMS ON CASTABILITY AND SURFACE PROPERTIES OF CHROME COBALT ALLOY

Kueh TS, Fazal Reza, Chee HT

Objectives. The aims of this study were to compare the casting accuracy of Cr-Co alloys using centrifugal and vacuum systems and to determine the loss of metal structure from cast specimens due to polishing. Methods. Two types of casting systems; centrifugal type (Fornax G/GU) and vacuum type (Nautilus CC plus) were used. Castability was evaluated using mesh pattern (25x25 mm) and was determined from the number of completed holes filled by the cast alloy. Phosphate-bonded investment (Ecovest PM) was used for investing purpose. To analyze the mass loss, acrylic plates (10x20 mm) were prepared and cast. The cast specimens were weighed before and after polishing with 320-1000 grit sandpaper. The polished surface of cast plates was assessed with atomic force microscopy (AFM) until clinically acceptable surface roughness value (100 ± 20nm) was achieved. The loss of mass (in %) was used as the parameter for surface properties evaluation. Hardness of polished cast specimens was measured with vicker’s hardness tester. Five specimens were cast using each of the casting system. The results were analyzed by Mann-Whitney test (α= 0.05).Results. Significantly (p<0.05) improved castability was observed with centrifugal system (74.12 ± 25.84%) than vacuum system (0.29 ± 0.66%). The loss of mass was 5.32 ± 1.15% and 4.49 ± 1.05% for centrifugal and vacuum systems respectively which was not significantly different (p>0.05). Significantly (p<0.05) higher hardness value was observed with polished surfaces of cast specimens using vacuum system. Conclusions. Within the limitations of the study, mould filling with centrifugal system was found to be more accurate. The loss of mass was equal with both casting systems. Differences in hardness of polished surfaces suggest further elemental analysis.

INTRODUCTIONBase metal alloys, such as cobalt-chromium (Co-Cr) have been widely used in fabrication of fixed and removable partial denture (FPD and RPD) frameworks since being introduced to dentistry in 1929.1,2)

Co-Cr alloys have effectively replaced the Type IV gold alloys for the construction of RPD frameworks, primarily due to their relatively low cost, which is a significant factor with these large castings.3) The other primary physical-chemical properties of base metal alloys include a lower density than gold alloys, a particularly useful feature in fabricating bulky or extensive prostheses; and a modulus of elasticity that is nearly twice that of gold alloys, providing FPD and RPD with the advantage of maintaining rigidity with less bulk.4) These properties allow improved aesthetics and physiological contouring and the development of a suitable occlusion with less tooth structure reduction.4) However, technical shortcomings, such as the increased difficulty of grinding and polishing procedures with conventional chair side and laboratory instruments restricted the use of base metal alloys in dental practice.4,5) More recently, improvement in alloy composition and development of new manufacturing technique have optimized the use of these alloys.5) Several types and designs of casting machines are used to make dental castings. Despite these advances, shortcomings of the alloys have not been completely overcome and, coupled with improper management procedures such as overheating the alloy or using oxidising zone of flame during casting,6) repeated failures can occur.5)

Most of the metal prostheses are made from Co-Cr alloy through casting procedures.7) Casting aims to provide a metallic copy of the wax pattern as much accurate as possible. Nevertheless, a wide range of variables may influence the final result and predictable outcomes are hardly achievable. While casting dental prostheses, problems frequently observed are incomplete casting and internal porosity.8) One of the main factors leading to these defects is the pattern of casting force exerted on the molten metal.9) All casting machines accelerate the molten metal into mould either by centrifugal force or air pressure.7)

Thus evaluation of castability which means the capacity of an alloy to reproduce mould details, is

95


frequently performed.

Surface roughness of dental cast prostheses may also vary with different casting environment. Increase surface roughness had been observed using conventional casting procedures.10) Surface roughness of cast prostheses significantly increased the adhesion of supragingival bacterial plaque, incidence of dental caries, gingivitis, and periodontal disease.11,12) In previous study, an average roughness of Ra 0.09 ± 0.01 µm was adopted as a “limit value” to establish the final acceptable polishing condition.10) It has been reported that greater surface roughness requires additional finishing and polishing procedure.6) An earlier investigation demonstrated that there is considerable loss of metal structure from RPD framework during finishing and polishing resulting in poor fit of retentive clasp arm and improper contact at the tooth-clasp interface,13) thus affecting the stability and retention of the RPD.14) Due to hardness of these alloys, special equipment is required for cleaning and smoothing the restoration after casting, which considerably limits these procedures in dental offices. The hardness of the cast alloy is influenced by their composition and casting method.15) Increase hardness of cast alloy can also be due to formation of a hard surface layer (the α case) because of the reaction of molten metal with the elements of investment material.16) This α case is undesirable in terms of surface roughness and the fit of the appliance, whereas the elongation and fatigue limit of RPD frames and clasps are reduced.17)

As several casting systems are based on different principles, cast specimens need to be evaluated using different casting systems. Thus the purpose of the present research was to compare the casting accuracy of Co-Cr alloys, to determine the loss of metal structure and hardness of cast specimens after polishing using centrifugal and vacuum casting systems.

MATERIAL AND METHODSThis is an experimental laboratory study design as in Figure 1. Mesh wax pattern of 25 x 25 mm (Grids perforated RN III casting, Dentaurum, Ispringen, Germany) which was used in a previous research was prepared for evaluating castability of Co-Cr alloys in this experiment (Figure 2).18) Clear acrylic plates (Erkodur, Erkodent, Pfalzgrafenweiler, Germany) as in Figure 3 were prepared (10 x 20 x 1.5 mm) for evaluating loss of mass of cast specimens after polishing. A wax sprue with diameter of 2.5 mm, length of 6 mm was fixed onto a sprue base (Rapid Ringless System, Bego, Bremen, Germany). Before investing, a surface tension reducing solution (Lubrofilm, Dentaurum, Ispringen, Germany) was applied to the cast specimens. All the specimens were invested using phosphate-bonded investment (ECOVEST PM, dent-e-con, Lonsee, Germany) as in Table 1. The investment was mixed according to the manufacturer’s recommendation. Electric furnace (OVMAT 2007, Manfredi, Torino, Italy) was used for burn out procedure. The specimens were cast with centrifugal (Fornax G/GU (FOR), Bego, Bremen, Germany) and vacuum (Nautilus CC plus (NAU), Bego, Bremen, Germany) casting systems (Table 2). Co-Cr ingot (Remanium GM900, Dentaurum, Ispringen, Germany) was used as cast alloy. All cast specimens were cleaned in sandblast machine (S-U-Prolamat, Schuler Dental, Ulm, Germany) using aluminium oxide particles (250µm) for 1 minute to remove investment residues. Castability was calculated as the percentage of reproduced completed holes of cast specimens compared to the total number of holes of wax pattern as below.

Castability = patternin wax holes totalsegmentscast completely ofnumber

x 100

For the evaluation of loss of mass, each cast plate was weighed on a precision balance (Dragon 204, Mettler Toledo Inc., Greifensee, Switzerland) before and after polishing with 320-1000 grit sandpaper

96


(Hermes, Hermes Abrasives Ltd., Virginia, USA ). The polished surface of cast plate was assessed with atomic force microscopy, AFM (Q-Scope 250/400 Nomad, Ambios Technology Inc., Santa Cruz, United States) at 3 different sites along the diametrical line. The scan size (48 x 48 µm) was maximized and number of scan lines was 50. The cast plates were polished until acceptable surface roughness value of 100 ± 20 µm was attained. This value was then adopted as a “limit value” to establish the final acceptable polishing condition for subsequent tests. Each cast plate was carefully polished alternating with roughness measurements until the limit value was achieved. Then, the specimens were weighed again. Loss of mass related to the initial mass was determined as the structure needed to be grinded for optimal polishing.

Loss of mass = polishing beforeWeight polishingafter Weight -polishing beforeWeight

x 100

The hardness of polished surfaces of cast plates were measured using Vickers hardness tester (Model VM-50, Fuel Instruments & Engineers Pvt. Ltd., Maharashtra, India) with a load of 5 kg and a loading time of 15 s. Indentation made on the polished surfaces was viewed under microscope (Leica DMLM, Leica Microsystems, Bensheim, Germany).

Five specimens of mesh type and plate type were prepared at each casting system. Differences in castability, mass loss (%), and hardness among the casting systems were analyzed using Mann Whitney test (α=0.05), statistical software SPSS 12.

RESULTS

Significantly (p<0.05) improved castability was achieved with centrifugal system (74.12 ± 25.84%) than vacuum system (0.29 ± 0.66%); as shown in Figure 4 and 5. The loss of mass after polishing the cast plates were 5.32 ± 1.15% and 4.49 ± 1.05% for centrifugal and vacuum casting systems respectively which was not significantly different (p>0.05); as shown in Figure 6. Polished surface of cast plate is shown in Figure 7. Figure 8 shows the representative 3D view of the polished cast plate obtained from AFM. Significantly (p<0.05) higher hardness value was observed with polished surfaces of cast plates from vacuum system (Hv 367 ± 59.82) than from centrifugal system (Hv 309 ± 26.60); as shown in Figure 9. Figure 10 shows the indentation made by the Vickers hardness tester on polished surface of cast plate under microscope.

DISCUSSION

The castability of Co-Cr alloy is an important factor to be considered, since it is directly related to casting restoration success. Poor or inconsistent castability often leads to costly laboratory remakes of restorations.19) In this study, the method we used to evaluate castability was first proposed by Watanabe K et al for evaluating castability of cast specimens using titanium.18) In other study, simulated steel crown with dimensions as given in the AS 1620(1985) was used throughout the investigation to evaluate castability of unalloyed titanium using different casting machines.20) An invar-steel mold with an inserter was also used in other study to fabricate a trapezoid wax pattern and for measuring dimensional changes of the wax pattern and casting accuracy at three points when using titanium.21)

Fabricated frame-works on Kennedy Class II, Division 1 maxillary RPD was used for evaluation of castability and surface roughness of pure titanium and cobalt-chromium denture frameworks.22) Among the advantages of the method used in this study are: ease of preparation of the casting pattern, the pattern can be burned out in furnace using the usual procedure for wax elimination, size and shape of specimens can be standardized, the casting pattern can be adjusted accordingly to evaluate specific

97


characteristics depending on the purpose of each study, and castability is evaluated by simply counting the number of completely formed holes.23)

The castability of an alloy may be affected by several factors, including its composition, density, surface tension, type of investment, cast temperature, casting machine, positioning of the wax pattern and vent sprue shape.24,25) Centrifugal system can exert approximately 4-6 times more force on metal than the pressure casting system.26) In a previous study, a centrifugal casting method showed better castability than a pressure casting method using moulds without permeability (fused-silica mould).27)

This observation was explained as followed: as the centrifugal force applies to the molten metal, and the mould gases can exhaust from sprue in moulds without permeability in the centrifugal casting.28)

Incomplete mould filling is an occasional problem with low casting pressure difference.29) Back pressure from gas retention increases the risk of inadequate mould filling especially in thin sections of castings.6) Although studies on titanium castings with different investments and casting systems concluded that the use of a casting machine with higher casting force may allow satisfactory clinical results.30)

Present study showed that the castability of Co-Cr cast specimens increased significantly with centrifugal system probably due to its higher casting force compared to vacuum system. Several factors related to casting systems also influence the castability of the cast specimens. Thus controlling these factors is important to have predictable outcomes. Within the limitation, only the variable casting system was evaluated and therefore the results should be compared to those researches conducted using the same methodology. Different results may be achieved using different study design.31) Further studies should investigate other factors which are not considered in this study, such as investment material, casting temperature, spruing, and mould temperature.

Surface smoothness of cast RPD frameworks is of great importance for improving oral health, decrease plaque retention, and increase alloy resistance corrosion.32) Surface roughness was thought to be caused by the particle size of the investment and reaction between the melting metal and the casting mould.33)

The base metal alloys cast with vacuum casting showed decreased surface roughness compared to base metal alloys submitted to acetylene-oxygen flame casting. This is due to an oxygen-free atmosphere and the absence of flame during induction casting of Ni-Cr and Co-Cr alloys prevented damage by oxidation to the surface of alloys during casting procedures.10) In the same study, there was no difference in surface roughness of Ni-Cr and Co-Cr within the same casting process, thus the composition of the alloys do not influence surface roughness as much as the casting procedures.10)

Finishing and polishing procedures can compensate for greater surface roughness resulting from casting procedures. However, the removal of additional material to provide a clinically acceptable finish can affect the fit5) and the resistance of the metal structure.34)

Thus the present study was focused in evaluation of loss of mass due to polishing of cast specimens and the mean loss of metal due to polishing up to threshold limit was lower for vacuum system although the result was not significantly different comparing with centrifugal system. The similar findings had been observed in a previous study while casting under controlled and uncontrolled atmosphere.10)

A narrow range of surface roughness (100 ± 20 nm) of cast specimens could be precisely measured using AFM. Applications of AFM to metal specimens allow quick and easy generation and quantification of images in the sub-micrometer and nanometer range.35) Within the limitation, the specimens were polished on only one surface, thus preventing direct comparison to the clinical situation where the surface of an RPD is polished on both external and intaglio surfaces.

98


Interestingly the hardness of cast specimens after polishing was found significantly greater with vacuum casting system in the present study. Hardness is influenced by heating time, alloy composition and casting method.18) The use of casting machines supplied with atmosphere control was thought to cover and protect the melt from oxidation and dissolution of other chemical elements, such as nitrogen and oxygen.36,37) From previous study, the hardness values of Ni-Cr alloys were higher when the casting procedures were performed in a non-controlled atmosphere.15) Controversial findings were reported that the casting under argon atmosphere tended to increase the hardness of Ni-Cr alloys when compared to cast under non-controlled atmosphere.38) The study stated that casting with flame/air allows the lowest uptake of oxygen and nitrogen. No apparent reason was found to explain the controversy of these findings among all these studies including the present findings. Further studies on this aspect, such as electron probe microanalysis (EPMA) are required in order to evaluate composition changes of the alloys after different casting conditions in order to support the hypothesis raised in the discussion of the present study.

CONCLUSION

Within the limitations of this study, the following conclusions were drawn:

1. Mould filling with centrifugal system was found to be more accurate.

2. The loss of mass of polished cast specimens was not significantly among the casting systems.

3. The differences in hardness of polished surfaces of cast specimens using different casting systems suggest further elemental analysis.

ACKNOWLEDGEMENTS

The study was generously supported by Mr. Hj. Abdullah Hamat and Mr. Tan Boon Phang of Dental Technology Lab, Health Campus, Universiti Sains Malaysia, Kelantan, Malaysia. We would also like to thank to Craniofacial Lab, Health Campus, Universiti Sains Malaysia for further assistances.

REFERENCES

1. Lanier BR, Rudd KD, Strunk RR. Making chromium-cobalt removable partial dentures: A modified technique. J Prosthet Dent. Feb 1971;25(3):197-205.

2. Taylor DF, Leibfritz WA, Adler AG. Physical properties of chromium-cobalt dental alloys. J Am Dent Assoc. 1958;56:343-351

3. Richard van Noort. Introduction to Dental Materials. 3rd ed. Mosby Elsevier. 2008,2334. Cunningham DM. Comparison of base metal alloys and type IV gold alloys for removable partial denture frameworks.

Dent Clin North Am. 1973;17:719-7225. Dharmar S, Rathnasamy RJ, Swaminathan TN. Radiographic and metallographic evaluation of porosity defects grain

structure of cast chromium cobalt removable partial dentures. J Prosthet Dent. 1993;69:369-3736. Phillips RW. Skinner’s science of dental materials. 9th ed. Philadalphia: Saunders. 1991,431-442 7. John M. Powers, Ronald L. Sakaguchi. Craig’s restorative dental materials. 12th ed. Mosby Elsevier. 2006,4238. Russell R. Wang, Ann M. Boyle. A simple method for inspection of porosity in titanium castings. J of Prosthet Dent.

1993;70:275.9. HerO H, Syverud M, Waarli M. Mold filling and porosity in casting of titanium. Dent Mater. 1993;9:15-1810. Osvaldo Luiz Bezzon, Hamilton Pedrazzi, Osvaldo Zaniquelli, Tânia Bose Cambuy da Silva. Effects of casting

technique on surface roughness and consequent mass loss after polishing of NiCr and CoCr base metal alloys: A comparative study with titanium. J Prosthet Dent. 2004;92(3):274-277

99


11. Tanner J, Carlén A, Söderling E, Vallittu PK. Adsorption of parotid saliva proteins and adhesion of Streptococcus mutans ATCC 21752 to dental fiber-reinforced composites. J Biomed Mater Res. 2003;66B:391-398.

12. Lothar Borchers, Frank Tavassol, Harald Tschernitsche. Surface quality achieved by polishing and by varnishing of temporary crown and fixed partial denture resins. J Prosthet Dent. 1999;82:550-556.

13. James S. Brudvik, David Reimers. The tooth removable partial denture interface. J Prosthet Dent. 1992;68:924-927 14. Yuuji Sato. Clinical methods of adjusting retention force of cast clasp. J Prosthet Dent. 1999;82:557-561.15. Jose Roberto de Oliveira Bauer, Alessandro Dourado Loguercio, Alessandra Reis, Leonardo Eloy Rodrigues Filho.

Microhardness of Ni-Cr alloys under different casting conditions. Braz Oral Res. 2006;20(1):40-4616. Miyakawa O, Watanabe K, Okawa S, Nakano S, Kobayashi M, Shiokawa N. Layered structure of cast titanium surface.

Dent Mater J 1989;8:175-18517. Vallittu P, Kokkonen M. Deflection fatigue of cobalt-chromium, titanium, and gold alloy cast denture clasp. J Prosthet

Dent. 1995;74:412-41918. Watanabe K, Okawa S, Kanatani M, Nakano S, Miyakawa O, Kobayashi M. Study on the one chamber pressure

casting machine for titanium. Part 2 Influence on the mold permeability on casting defects. J J Dent Mater. 1995;14:668-676.

19. Cohen SM, Kakar A, Vaidyanathan TK, Viswanadhan T. Castability optimization of palladium based alloys. Journal of Prosthetic Dentistry. 1996;76(2):125-131

20. Christer Bleesing and Maud Bergman. The castability of unalloyed titanium in three different casting machines. Swed Dent. 1992;16:109-113

21. Yan M, Takahashi H, Nishimura F. Dimensional Accuracy and Surface Property of Titanium Casting Using Gypsum-bonded Alumina Investment. Dental Materials Journal. 2004;23(4):593-544

22. Kung-Soo Jang, Suk-Jin Youn, Yung-Soo Kim. Comparison of castability and surface roughness of commercially pure titanium and cobalt-chromium denture frameworks. J Prosthet Dent. 2001;86:93-98

23. Hinman RW, Tesk JA, Whitlock RP, Parry EE, Durkowski JS. A technique for characterizing casting behaviour of dental alloys. J Dent Res. 1985;64:134-138

24. Bessing C. Evaluation of the castability of four different alternative alloys by measuring the marginal sharpness. Acta Odontol Scand. 1986;44:166-172

25. Johnson A, Winstanley RB. The evaluation of factors affecting the castability of metal ceramic alloy-investment combinations. Int J Prostodont. 1996;9:74-78

26. Watanabe L, Wouldu M, Watanabe K, Okabe T. Effect of casting method on castability of titanium and dental alloys. J Mater Sci Mater Med. 2000;11.547-553

27. Takashi, J., Okazaki, M., Kimura, H. And Joshin, K. Casting into the mould without air-permeability, J J Dent Mat. 1983;2:479-485(in Japanese)

28. Junzo Takahashi, Jian-Zhong Zhang and Masayuki Okazaki. Effect of Casting Methods on Castability of Pure Titanium. Dental Materials Journal. 1993;12(2):245-252

29. Watanabe, JH Watkins, H Nakajima, M Atsuta and T Okabe. Effect of pressure difference on the quality of titanium casting. J Dent Res. March 1997;76(3):773-779

30. Reza F, Takahashi H, Iwasaki N, Tamaki Y. Effects of investment type and casting system on permeability and castability of CP titanium. J Prosthet Dent. 2010:104:114-121

31. Adriana da Fonte Porto Carreiro, Ricardo Faria Ribeiro, Maria da Gloria Chiarello de Mattos, Renata Cristina Silveira Rodrigues. Evaluation of the castability of a Co-Cr-Mo-W alloy varying the investing technique. Braz. Dent. J. Jan./abr.2005;16(1)

32. Aydin AK. Evaluation of finishing and polishing techniques on surface roughness of chromium-cobalt castings. J Prosthet Dent. 1991;54:763-767

33. Min Yan, Hidekazu Takahashi and Fumio Nishimura. Dimensional Accuracy and Surface Property of Titanium Casting Using Gypsum-bonded alumina investment. Dental Materials Journal. 23(4):539-544,2004

34. Gapido CG, Kobayashi H, Miyakawa O, Kohno S. Fatigue resistance of cast occlusal rests using Co-Cr and Ag-Pd-Cu-Au alloys. J Prosthet Dent. 2003;90:261-269

35. Mathias Goken. Studies of Metallic Surfaces and Microstructures with Atomic Force Microscopy. www.veeco.com. July 2010

36. Engstrom G, Fredriksson H, Wictorin L. Absorption of gas in dental gold alloys during the melting. J Oral Rehabil. 1982;9(3):35-44

100

Volume 1 | Number 1 |August 201037. Strandman E. The influence of carbon content on the mechanical properties in a cast dental Co-Cr alloy. Odontol Revy.

1976;27(4):273-28638. Tajima K, Kakigawa H, Kozono Y, Hayashi I. Oxygen and nitrogen uptake in dental Ni-Cr alloy castings by several

melting methods. Dent Mater J. 1984;3(2);262-271

Table 1 Compositions of investment material

Code Brand name Manufacturer Refractory BinderLiquid

for mixing

L(W)/Pratio

EPM ECOVEST PMDent-e-con,

Lonsee, Germany

SiO2 Phosphate

Special liquid

(colloidal silica)

0.14

Table 2 Casting machines

Code Name of machines Type of casting force Manufacturer

FOR Fornax G/GU Centrifugal

NAU Nautilus CC plus Vacuum

BEGO Bremer Goldschlagerei

Wilh. Herbst GmbH & Co.,

Bremen, Germany

Figure 1 Experimental Laboratory Study Design

101

All specimens were invested in ECOVEST PM (EPM)

Cast with Induction/Vacuum casting system

Cast with Induction/Centrifugal casting system

Mesh cast specimens were evaluated for Castability (%)Plate cast specimens were evaluated for Mass loss (%) and

Hardness after polishing

Wax patterns and acrylic plates were prepared


Figure 2 Wax pattern

Figure 3 Clear acrylic plate

Centrifugal (FOR) cast specimens

102


Vacuum (NAU) cast specimens

Figure 4 Cast specimens obtained from different casting systems

0

20

40

60

80

100

Cas

tabi

lity

(%)

Bego-Fornax (FOR) Centrifugal type

Bego-Nautilus (NAU) Vacuum type

Figure 5 Castability of Co-Cr alloy using 2 types of casting systems

0

1

2

3

4

5

6

7

Casting systems

Mas

s los

s (%

)



Figure 6 Mass loss (%) after polishing of cast plates

103


Figure 7 Polished surface of cast plate

Figure 8 AFM 3D view of the polished surface (98.61 nm)

050

100150200250300350400450

Casting systems

Vic

ker'

s Har

dnes

s (H

v)



Figure 9 Hardness of cast plates after polishing

104


Figure 10 Indentation made by Vickers hardness tester on polished cast plate was viewed under microscope, x20

105


13. EFFECT PLATELET RICH PLASMA (PRP) ON BONE REGENERATION AND SOFT TISSUE HEALING FOLLOWING TOOTH EXTRACTION IN RABBITS

Haritzah Lazuardi Izzati, Dica Nilam Putri, Shinta Leo, Evie Lamtiur

Objectives: To understand and gain more information about the effect of Platelet Rich Plasma (PRP) on bone regeneration following tooth exraction in rabbit alveolar bone. Platelet Rich Plasma (PRP) is produced from blood by centrifugation. It contains several kinds of growth factors in high concentration such as platelet derived growth factor (PDGF), transforming growth factor-β (TGF-β), vascular endothelial growth factor (VEGF), insulin-like growth factor (IGF), epidermal growth factor (EGF). PRP contains and releases (through degranulation) at least seven different growth factors (cytokines) that stimulate bone and soft tissue healing. Materials and methods: In this study, we used 16 male Indonesian rabbits, 4 months old average (all weighing 1500-2000 grams) as the subject research. For the study, histophatology examination were used to detect bone regeneration and proliferation of cells on soft tissue at 7, 14, 21, 28 days after the extraction of premolar. For each rabbits, we extracted two teeth, one on the left side and one on the right side of the mandible. After extraction, the right site was treated with PRP injection and the site on the other side of the mouth was not, serving as the control. Results: According to histophatological examination, on the site treated with PRP there was increasing in number of cells that influence the bone regeneration process. Collagen and fibroblast were also expressed in higher number compare to the control site.Conclusions: By injecting PRP on extraction site, the rate of bone and soft tissue formation were increasing, therefore healing time process could be reduced.

INTRODUCTION

Platelet rich plasma (PRP) is a volume of autologous plasma that has a platelet concentration above baseline.1-7 Because it is a concentration of platelets, it is also a concentration of the 7 fundamental protein growth factors proved to be actively secreted by platelets to initiate all wound healing.1 The seven growth factors in PRP are platelet-derived growth factor as PDGFαα, PDGFββ, PDGFαβ, transforming growth factor beta (TGF-β1, TGF-β2), vascular endothelial growth factors (VEGF), insulin-like growth factor (IGF-I and II), epidermal growth factor (EGF), fibroblast growth factor-2 (FGF-2).1-7 Many of these factors have been shown to enhance one or more phases of bone and soft tissue healing. IGF is thought to increase the number and function of the osteoblast (proliferation and differentiation), stimulating collagen synthesis.4,8 Platelet Platelet Rich Plasma (PRP) is produced from blood by centrifugation. To truly concentrates platelets from autologous blood, we must used double centrifugation.2 A natural blood clot contains 95% red blood cells, 5% platelets, less than 1% white blood cells, and numerous ammounts of fibrin strands. A PRP blood clot contains 4% red blood cells, 95% platelets, and 1% white blood cells.3 PRP can only be developed from anticoagulated blood.1,2

Growth factor released by platelet will speed up regeneration bone in resorption and formation phase. This statement also clarified by Fernandez et al.8 in their investigation. In the resorpsion phase, the osteoclasts then begin to dissolve the mineral matrix and decompose the osteoid matrix. This process is completed by the macrophages and permits the release of the growth factors contained within the matrix, fundamentally transforming growth factor beta (TGF-β), platelet derived growth factor (PDGF), insulin-like growth factor I and II (IGF-I and II). In the formation phase, simultaneously in the resorbed areas the preosteoblast grouping phenomena is produced, attracted by the growth factors

106


liberated from the matrix which act as chemotactics and in addition stimulate their proliferation.8

Platelet concentrates are potentially useful in wound-healing applications because they function as both a tissue sealant and a drug delivery system that contains a host of powerful mitogenic and chemotactic growth factors.9

In many previous research, there has been some study about PRP, but each investigation using different PRP preparation methode and variant application10,11-15. In our knowledge, there was no study on the effect of PRP injection on bone regeneration and soft tissue healing post extraction. The aim of the present study was to investigate the histological effects of PRP injection in wound healing process post tooth extraction.


This study was performed at Faculty of Dentistry, University Prof. Dr. Moestopo (B) and Faculty of Veterinary Medicine, Bogor Agricultural University (IPB). The protocol of this study was approved by the Ethic Committee of National Institute of Health Research and Development No. LB.03.02/KE/5580/2010, Jakarta, Indonesia. All animals used in the designed study were from IPB laboratory. We used 16 male Indonesian rabbits, 4 months old average (all weighing 1500-2000 grams). All rabits were fed a pelleted rabbit diet combined with grass daily and water was available ad libitum. Rabbits were divided into 4 groups (T1, T2, T3, T4), with 4 rabbits for each groups.

Group Monitored for (weeks)

T1 1

T2 2

T3 3

T4 4

Table 1. Animal distribution used.

Every rabbits were given the same treatment. All animals received general anesthesia using a combination of Ketamine (30 mg/kg) and Xylazine (3 mg/kg) intramuscular. For each rabbits, we extracted two teeth using mosquito forcep. First premolar on the left side and on the right side of the mandible were extracted.

A

B

107

Asia Pacific Dental Students Journal Fig. 1. Process Extraction First Premolar Mandible. (A).First premolar mandible. (B).Mosquito forcep.

A total of 4,5 mL of autologous blood was drawn from each rabbit by cardiac puncture. The blood was aspirated with a 25G needle on a 5 mL syringe preloaded with 1 mL Natrium citrate Dextrose anti-coagulant. Each blood sample was centrifuged at 2000 rpm for 10 minutes on 40C to separate the plasma containing the platelets from the red blood cells. The first centrifugation allowing the formation of two distinct fraction; the upper part made up of plasma and the lower part composed of red blood cells (red pack). All of the plasma fraction plus the upper (1 mL) part of the blood cells fraction were transferred to another tube and was centrifugated again for another 10 minutes at 4000 rpm. After this last cycle three distinct fraction could be identified. The upper part was Platelet Poor Plasma (PPP), the middle part was a thin layer of buffy coat (greyish colored) contains highly concentrated platelets, and the lower part was red blood cells. The superior layer PPP was removed using micropipet to the point where its remanescnet plus the bottom fraction completed total of 0,5 mL of final product (PRP). The PRP was thus prepared for activation by calcium chloride (CaCl) 10%. After homogenization, the PRP was aspirated using tuberkulyn syringe, ready to be injected. 100µl PRP was set apart for cell counting. The mean platelet count of the PRP was 912,800/µL (table 2).

A B C D

Fig. 2. PRP preparation : (A).2 distinct fraction after first centrifugation.(B).Removed supernatant layer. (C).Plasma+1ml red blood cells transferred to another tube. (D).3 distinct fraction appear after final centrifugation.

Platelet Rich Plasma (PRP) was injected on the right extraction site (buccal and lingual). Rabbits then has been kept alive and fed normally until certain time, depending on which group the rabbits were. Post operatively, rabits were given analgetic ibuprofen to reduce the pain.

108

Volume 1 | Number 1 |August 2010Fig. 3. Injection of PRP in buccal and lingual right extraction site

Group T1 was exsanguinated on days 7, group T2 on days 14, group T3 on days 21, and group T4 on days 28. We took bone and soft tissue sample around the extraction site and then processed it until the specimen were ready to be examinated using an operating microscope. The sections were cut in a buccolingual plane, so that the relationship of the healing wound to the surrounding soft tissue could be observed. Five micrometer section were stained with hematoxylin and eosin (H&E). Osteocyt, osteoblast, osteoclast, fibroblast, and colagen were selected as histophatological parameters used to asses bone regeneration process and progressive increase in soft tissue healing.


SPSS V. 17.0 software was performed for statistical analysis with a t-test and mann-whitney. Statistical significance was accepted for p-v<0.05.

RESULT

Platelet Concentrate

In this study, platelets in rabbits PRP preparation were counted on the hematology analizer PCE-210 ERMA IWC.

Group Mean Platelet Count (x103/mm3)

Week1 897,5

Week 2 685,5

Week 3 891,25

Week 4 1177

Mean 912,8

Table 2. Rabbits Platelet Count

109


Histological Examination

Histological examination has been done using light microscope to observe the proliferation cells. Collagen levels, fibroblast, osteoblast, osteoclast, and osteocytes are illustrated after treatment with PRP injection for the 4 time periods (4 groups).

osteoblasts

osteoblasts

A B

Osteocytes

Fig. 4. Histological appearance of bone tissue in weeks 4 post operative (magnification 100x); (A).Control site. Note that the osteoblast and osteocytes were presented in lower number compare to experimental site. (B). PRP treatment site. Both osteoblasts and osteocytes were expressed in higher number, osteoblasts can be seen lining on the edge of bone.

collagen fibers

collagen fibers

A B

Fig. 5. Histological appearance of soft tissue in weeks 4 post-operative (magnification 40x); (A).Non-PRP treatment site. Collagen fibers expressed in lower number and thinner compare to PRP treatment site.(B).PRP-treatment site. Note the thicker collagen fibers and more frequent fibroblast

110

fibroblasts

** **


were expressed compare to control site.

The histological evaluation of the necropsy sample retrieved from the healing socket revealed the following results. All groups (PRP treatment and control) are represented in this graph with each point representing the mean of five selected areas examination

0

5

10

15

20

25

30

35

T1 T2 T3 T4

PRP

NON PRP

Fig. 6. Osteoblast Cell counting revealed that PRP treatment significantly enhanced the number of osteoblast when compared to non-PRP treated site.

*=P<0.05; **=P<0.01

Fig. 7. Osteocytes Cell Counting showed that PRP treatment significantly increasing the number of osteocytes when compared to non-PRP treated site.

*=P<0.05; **=P<0.01

111

Osteoblast

0

5

10

15

20

25

30

T1 T2 T3 T4

PRP

NON PRP

**

** *

*

Osteocyte

** **

* *


Fig. 8. Fibroblast Cell Counting showed that PRP treatment significantly increasing the number of fibroblast when compared to non-PRP treated site.

*=P<0.05; **=P<0.01

Fig. 9. Collagen Cell Counting showed that PRP treatment significantly increasing the number of collagen when compared to non-PRP treated site.

*=P<0.05; **=P<0.01

112

0

0,5

1

1,5

2

2,5

3

3,5

4

T1 T2 T3 T4

PRP

NON PRP

0

5

10

15

20

25

30

35

T1 T2 T3 T4

PRP

NON PRP

**


Table 3. Significance level of each parameter cells on both hard and soft tissue

*=P<0.05; **=P<0.01

Osteoblast

Compared to control site, in PRP treatment site there was significantly increase number of osteoblast with significant value nearly resembles each weeks, but there decrease in week 4, in week 1 p=0.000, in weeks 2 p=0.043, in weeks 3 p=0.018, in week 4 p=0.064.

Osteocyte

We made comparison of the number osteocytes found in PRP treatment site and control site. Osteocytes in PRP group was expressed in higher number with significant value in week 1 p=0.004, in weeks 2 p=0.004, in weeks 3 p=0.029, in weeks 4 p=0.014.

Osteoclast

No significant differences were observed between the number of osteoclast in PRP treatment group and control group on each week during observation (p >0.05).

Fibroblast

Compared to control site, in PRP treatment site there was significantly increase number of fibroblast with significant value in week 1 p=0.045, in weeks 2 p=0.037, in weeks 3 p=0.014, in week 4 p=0.007.

Collagen

Collagen fibers in PRP treatment site was expressed in higher number than non-PRP treatment site with significant value in week 1 p=0.022, in weeks 2 p=0.017, in weeks 3 p=0.011, in weeks 4 p=0.018.

113

Week 1 Week 2 Week 3 Week 4

Osteoblast 0.000** 0.043* 0.018* 0.064Osteoclast 0.865 0.486 0.740 0.382Osteocyte 0.004** 0.004** 0.029* 0.014*Fibroblast 0.045* 0.037* 0.014* 0.007**Collagen 0.022* 0.017* 0.011* 0.018*


DISCUSSION

Animal Subjects

We used rabbits in our research because we can obtain enough blood sample to produce PRP. The reason why we did not use smaller animals such as rats, as our research subject because we could not get enough blood samples and found difficulties on extraction process because of a large amount of cellular cementum that forms rapidly on the apical portion of the root after 40 to 60 days of age. The roots are easily broken during extraction in animals older than 60 days.16 This also has been confirmed by Marx RE,1 that noted, there have been some research efforts to study PRP in animal models that have a blood volume that is too small to produce PRP, therefore these studies have used donor blood, which is homologous, and definetely not true definition of PRP.1

In our investigation the blood sample had to be obtained intracardially because we were not able to avoid blood coagulation and collected adequate sample to produce PRP by using different puncture sites, such as the ear or femoral vein.

PRP Preparation

Whole blood had to be centrifuged two times. To attempt PRP with a single spin would not produce a true PRP. Instead, it would produce a mixture of PRP and PPP and have dissapointingly low platelet counts.2 Centrifugation process has been done using a centriphuge (Jouan CR 412).

Platelet Count

Federico et al,10 in clinical in vitro study reported that rabbit’s PRP platelet concentration was 807.564 platelets/mm3 (range 622.000 – 1.350.000, SD 211.490) from an original vein concentration of 320.133 platelets/mm3 (range 280.000-408.000, SD 42.323). Therefore, in our investigation, the results obtained by platelet count suitable with range in previous research.

PRP Work

The results obtained from our study revealed the higher proliferation of osteoblast and osteocyte on PRP group on the first week. This compatible with Anila et al,3 which reported that one of major benefits of PRP is “jump-starts” osteogenesis by releasing growth factors at the local site. In week 4, the number of cell was reduced and the difference was not significance beacuse the cell acivities on regeneration process nearly ends.

Upon activation, platelets release their granular contents into the surrounding environment. The platelet α-granules are abundant and of particular interest because they contain many of the growth factors responsible for the initiation and maintenance of the healing response. TGF-β, PDGF, VEGF, and fibroblast growth factor (FGF) are a few of the growth factors released. These growth factors have been shown to play an important role in all phases of healing. The active secretion of these proteins by platelets begins after clotting, with more than 95% of the pre-synthesized growth factors secreted. After this initial burst, the platelets synthesized and secrete additional proteins for the balance of their life. The fibrin matrix formed following platelet activation also has a stimulatory effect on wound healing. The fibrin matrix forms by polymerization of plasma fibrinogen following either external activation with 10% calcium chloride.6

The two most important of these growth factors are PDDG and TGF-β.17 PDGF and EGF, have been shown to stimulate proliferation of osteoblastic progenitors as well as to affect the mitogenesis of

114


mesenchymal stem cells and to stimulate epidermal cell proliferation. TGF-β is believed to stimulate collagen synthesis,4 potent stimulator of bone formation, promoting osteoblastic differentiation. FGF has an anabolic effect on bone, as it is a mitogen of osteoblasts, vascular endothelial cells, and fibroblasts.8 Angiogenesis factors, including VEGF are believed to enhacne early angiogenesis and revascularization.4

There has been some concern about the effect of PRP that stimulate cellular proliferation by secreting growth factors. Some feared that PRP might stimulate cancers. This concerns has been answered by Marx RE,2 which explains that no growth factor can provoke a cancer. All growth factors act on cell membranes, not the cells nucleus. It will activate an internal cytoplasmic signal protein, which promotes a normal gene expression, not an abnormal gene expression. Therefore, growth factors are not mutagenic and they act through the stimulation of normal healing, just much faster.1,2

Most of the previous study were using PRP in gel form and some of them combined the PRP with other substances. But in our research, we only used PRP with with no other substances and the application by injection. Zhang et al,15 studied the effect of PRP gel compounded with porous bioceramic on osteogenesis in rabbit and reported that after 4 weeks, the quantity and maturity of osteoblasts and a large number of osteocytes in the experimental side was better than in the control side. This also confirmed with our study which used PRP injection with no additional substances, that shows greater number of osteoblasts and osteocytes compare to the control site. Other study by de oliveira et al,14

investigate the effect of a highly concentrated PRP on the bone repair using non-critical defects in the calvaria rabbits. Analysis morphological using light microscope showed that after 2 weeks, the PRP group presented a loose and dense connective tissue compatible to granulation tissue with fussion like and osteoblastic cells. Research by Nisbet et al,12 about the efficacy of PRP gel and topical estradiol alone or in combination on healing of full thickness wounds on rabbits, the collagen level on day 7 was significantly lower in PRP gel and estradiol group (p<0.05) than in the control group. This result was obtained because there are some limitation in this study which is the small sample size and the low platelet count. On the contrary, the result obtained by our study revealed that the collagen level on day 7 was increase in PRP group compare to control group.

Clinical Application of PRPIn recent years, science knowledge about PRP-related studies has developed very rapidly, and it continues to discover the true potential of PRP and it’s widely used applications in medical world, especially dentistry. But frequently, PRP was used in interdisciplinary treatment which involve more than one field of medical sciences. A case report by Taner et al,18 has reported the useful combination of autogenous bone, beta-tricalcium phosphate (cerasorb®), and autogenous PRP to treat the narrow alveolar crest of the atrophic bone. Anila et al,3 has reported PRP gel in combination with a resorbable collagen barrier membrane application has proven successful in therapy periodontal infrabony defects in human. In investigation on bone healing following the removal of bilateral mandibular third molars in human, Rutkowski et al,19 reported that PRP gel treatment significantly enhanced the percent bone fill when compared to control site, and it requred 6 weeks for control extraction sites to reach comparable bone prior density that PRP treated sites achieved at week 1. Sampson et al,20 has reported applications PRP injection is increasingly used in various treatment musculoskeletal injuries in elbow, foot and ankle, knee, spine, and wound.

In animal models PRP has also been widely used. PRP application can be combined with other substances or used alone. Yazawa et al,21 used precipitated platelet resuspension (PPR) by resuspended

115


the precipitated platelet (obtained from second centrifugation) in 0,2 ml of fibrin glue to evaluated the bone formation ability in rabbits. They found that bone formation throughout the bone defect and fibrous connective tissue were formed more visible compare to control groups. Jornet et al,16 studied the effects of plasma rich in growth factor of wound healing in rabbits tongue and found that it can accelerates ephitelialization and reduce inflammation. Van den dolder et al,18 reported PRP gel stimulates differentiation initial growth and differentiation of rat bone marrow cells in vitro. In previous research by Gimeno et al,10 reported the use of PRP as an adhesive to attach the corneal button in the setting of non-perforating corneal transplantation.

We can see from our result, even without combination of other substances, we can get the same effect from the PRP. We assumed that our significance result was because the absorbsion of PRP by injection was better compare to PRP gel.

CONCLUSION

Results from this study demonstrates that by injecting Platelet Rich Plasma (PRP) on extraction site, the rate of bone and soft tissue formation were increasing, therefore healing time process could be reduced. We hope that the significant result obtained by this study can give contribution to therapy widely used in many field of medical science especially dentistry. We fully realize that this research still has a lot of limitations and lackness, therefore, we do hope that it can trigger other researchers to explore and investigate deeper about the true potential of PRP and it’s implication on human body mechanism, so it can be beneficial and widely used in the future.

ACKNOWLEDGEMENTS

This work was supported by a grant from University of Prof. Dr. Moestopo (B). We would like to express our deepest gratitude to all the lab technician and veterinarian in Bogor Agricultural University (IPB) for their skillful assistance throughout the entire process.

REFERENCES

1. Marx RE. Platelet Rich Plasma: Evidence to Support Its Use. American Association of Oral and Maxillofacial Surgeons 2004.

2. Marx RE. Platelet-Rich Plasma (PRP): What Is PRP and What Is not PRP? Implant Dentistry 2001;10(4).3. Anila S, Nandakumar K. Aplications of Platelet Rich Plasma for Regenerative Therapy in Periodontics. Trends

Biomater. Artif. Organs 2006;20(1):78-83. 4. Mehta V, MD. Platelet Rich Plasma: A Review of the Science and Possible Clinical Aplications. Orthopedics February

1 2010.5. Tozum TF, Demiralp B. Platelet-Rich Plasma: A Promising Innovation in Dentistry. J Can Dent Assoc

2003;69(10):6646. Sutter W. PRP: Platelet Rich Plasma. October 2007.7. Clark GB. Platelet Rich Plasma (PRP) Therapy Literature Reviews. It’s A Wide Wide World.8. Hernandez-Gil IFT, Gracia MAA, del Canto Pingarron M, et al. Physiological Bases of Bone Regeneration II. The

Remodelling Procces. Med Oral Patol Oral Cir Bucal 2006;11:E151-7. 9. Eppley, Barry L. M.D., D.M.D.; Woodell, Jennifer E. Ph.D.; Higgins, Joel B.S. Platelet Quantification and Growth

Factor Analysis from Platelet-Rich Plasma: Implication for Wound Healing. American Society of Plastic Surgeons. November 2004;114(6):1502-1508.

10. Gimeno FL, et al. Preparation of Platelet-Rich Plasma as A Tissue Adhesive for Experimental Transplantation in Rabbits. Thrombosis Journal 2006;4:18.

11. Jounet PL, Alonso FC, Minano FM, et al. Effect of Plasma Rich in Growth Factors

116


12. on Wound Healing of The Tongue. Experimental Study in Rabits. Med Oral Patol Oral Cir Bucal. Sep 1 2009;14(9):e425-8.

13. 12. Nisbet OH, Nisbet C, Yarim M, Ozak A. The Efficacy of Platelet-rich Plasma Gel and Topikal Estradiol Alone or in Combination on Healing of Fullthickness

14. Wounds. HMP Communication July 01 2009.15. 13. Van Den Dolder J, Mooren R, Vloon APG, et al. Platelet-Rich Plasma: 16. Quantification of Growth Factor Levels and the Effect on Growth and Differentiation 17. of Rat Bone Marrow Cells. Tissue Engineering 2006;12(11)18. 14. de Oliveira Filho MA, Nassif PAN, Malafaia O, et al. Effects of Highly 19. Concentrated Platelet-Rich Plasma on The Bone Repair Using Non-Critical Defects in The Calvaria of Rabbits. Acta

Cir. Bras. Sao Paulo Jan/Feb 2010;25(1)20. 15. Zhang CQ, Yuan T, Zeng BF. Experimental Study of The Effect of 21. Platelet-Rich Plasma on Osteogenesis in Rabbit. Chinese Medical Journal 2004; 117(12):1853-1855.22. 16. Pietrokovski J, Massler M. Ridge Remodelling after Tooth Extraction In Rats. J.Dent. Res. January-February.

1967;46(1):222-230.23. 17. Carlson NE, Roach RB. Platelet Rich Plasma Clinical applications in dentistry. J Am Dent Assoc

2002;133(1):1383-138624. 18. Taner TU , Germec D, Er N, Tulunoglu I. Interdisciplinary Treatment of an Adult Patient with Old Extraction Sites.

Angle Orthodontist 2006;67(6):1066-1073.25. 19. Rutskowski JL, Johnson DA, Radio NM, Fennell JW. Platelet Rich Plasma to Facilitate Wound Healing Following

Tooth Extraction. Journal of Oral Implantology. 2010;36(1):11-22.26. 20. Sampson S, Gerhardt M, Mandelbaum B. Platelet rich plasma injection grafts for musculoskeletal injuries : a

review. Curr Rev Musculoskeletal Med 2008;1:165-174.27. 21. Yazawa M, Ogata H, Kimura A, Nakajima T, et al. Basic Studies on the Bone Formation Ability by Platelet Rich

Plasma in Rabbits. Journal of Craniofacial Surgery 2004;15(3):439-446.

117


14. INFLAMMATORY CYTOKINES PROFILE OF STEM CELLS FROM HUMAN EXTRACTED DECIDUOUS TEETH (SHED)

Tan S. J., Norliana G., Asiah A. B., Shamsuria O. and Nurul A. A.

Introduction: Stem cells from human extracted deciduous teeth (SHED) were identified to be a population of highly proliferative, clonogenic cells capable of differentiating into a variety of cells including osteogenic cells and also induce bone formation by forming an osteoinductive template to recruit host osteogenic cells. This preliminary research aims to study the interactions between stem cells and the immune system by determining the inflammatory cytokines profile expressed by SHED. Methods: Human fetal osteoblasts (hFOB) cell line and isolated SHED from deciduous molars and incisors were cultured and 1x106 cells harvested in triplicate. Extraction of total RNA was done, followed by reverse transcription cDNA synthesis of hFOB and SHED. Semi-quantitative Multiplex PCR was performed using Human Inflammatory Cytokines Genes Set to detect the expression levels of TNF-α, IL-1β, GM-CSF, IL-6, IL-8 and TGF-β in both hFOB and SHED. Results: Analysis of the expression levels of inflammatory cytokines showed that SHED did not express TNF-α, a cytokine which stimulates osteoclastic activity. SHED also expressed relatively lower amounts of IL-1β, IL-6, and IL-8 compared to hFOB. IL-1β is a principal component of osteoclastic activating factor (OAF) and a potent bone-resorbing factor, while IL-6 and IL-8 induce osteoclastogenesis and osteolysis respectively. There was no comparative difference in the expression levels of TGF-β in hFOB and SHED. Since SHED is capable of differentiating into osteoblasts and producing bone in vivo, our findings suggest that osteoblasts derived from SHED may have improved immunomodulatory profile in terms of promoting relatively lower inflammatory reaction during transplant. Conclusion: SHED is an ideal source of osteoblasts to be used in bone regeneration, transplant and stem cell therapies in human. Further studies on the inflammatory cytokines genes profile in SHED-derived osteoblasts are necessary to enable future clinical trials in immunocompetent hosts.

INTRODUCTION

Stem cells from human exfoliated deciduous teeth (SHED) which was discovered in 2003 have been demonstrated to have significant potential in renewal and regeneration of a variety of cells, including neural cells, odontoblasts and osteoblasts [1, 2]. Studies have provided evidence that SHED are postnatal cells which are capable to proliferate and differentiate into several cytotypes, mainly osteoblasts, and also able to form lamellar bone after transplantation into immunosuppressed rats [2]. SHED is a promising source of osteoblasts with potential for bone regeneration and stem cell therapy in humans [2].

A balance between bone formation and resorption during stem cell therapy for bone regeneration is necessary for tissue integration and success of the transplant. Inflammatory cytokines including interleukin-1β (IL-1β), interleukin-6 (IL-6) and tumour necrosis factors (TNF), as well as proteins like osteoprotegerin (OPG) and receptor activator of NF-kB ligand (RANKL), are mediators that regulate cell proliferation and differentiation in bone [3]. The expression levels of these osteogenic and osteoclastogenic genes are important in determining the outcome of the bone remodeling process. In vitro studies have provided evidence that cytokines released by osteoblasts may directly stimulate bone resorption by osteoclasts [4, 5].

RANKL and OPG are expressed by osteoblasts, and together with the protein RANK which is found on osteoclastic progenitors, this triad from the tumour necrosis factor family plays a significant role in bone formation, remodelling and resorption. RANKL provides an osteoclastic signal through RANK, which culminates in attachment, activation and survival of osteoclasts [6, 7]. On the other hand, OPG

118


protects bone from excessive resorption by competitively inhibiting the action of RANKL and promoting apoptosis and reduction in the number of osteoclasts [8, 9].

Inflammatory cytokines TNF-α, IL-1β and IL-6 are synergistic osteoclastogenic factors that are produced by osteoblasts [10]. Secretion of these cytokines will enhance osteoclastic differentiation and bone resorption, which is the main mechanism of immune rejection in cellular transplants. IL-1β directly stimulates osteoclastic resorption, increasing the proliferation and differentiation of the pre-osteoblasts as well as the osteoclastic activity, and inhibiting the apoptosis of osteoclasts [11]. IL-6 stimulates bone resorption and plays an important role in the initial stages of osteoclastogenesis [12]. TNF-α, IL-1β and IL-6 also reduce the OPG/RANKL ratio, which promotes pathological bone loss [10]. Interleukin-8 (IL-8) is a cytokine that similarly alters the OPG/RANKL ratio in favour of osteoclastic formation [13]. On the other hand, transforming growth factor-β (TGF-β) is a potent stimulator of bone formation, promoting osteoblastic differentiation and the synthesis of the osteoid matrix [14]. In essence, all these inflammatory cytokines modulate bone formation and resorption, and hence influence the immunological response towards cellular transplant.

The roles played by inflammatory cytokines in bone metabolism and the effect on osteoblasts have been extensively studied; however the interaction between the human immune system and SHED still remains unclear. Research has demonstrated that SHED has potential capabilities for stem cell therapy, but the transplant tolerance for this premature cell is yet undefined. It is unknown whether SHED possess immunomodulatory functions as seen in osteoblasts, which will influence the success of transplants in an immunocompetent human [15]. The present study will first evaluate the gene expressions of inflammatory cytokines and the proteins factors OPG and RANKL in both osteoblasts and SHED to gauge the potential improvement in immunomodulatory profile in SHED.

MATERIALS AND METHODSCell line and cell culture

Human fetal osteoblasts (hFOB) cell line (Accession no: CRL-11372) was obtained from American Type Culture Collection (ATCC). The hFOB was cultured in commercially prepared Dulbecco’s Modified Eagles medium (DMEM): Nutrient Mixture F-12 (Gibco, UK) supplemented with 10% fetal bovine serum (Sigma, USA) and 1% penicillin/streptomycin (Sigma, USA). The hFOB cell line was incubated in a CO2 incubator at 37°C until confluence.

Stem cells were obtained from a previous study as described by Mohd Hilmi et al. (2008) [16]. The cells were thawed and cultured in Dulbecco’s Modified Eagles medium (DMEM): Low Glucose 1X (Gibco, UK) supplemented with 10% fetal bovine serum (Sigma, USA), 1% penicillin/streptomycin (Sigma, USA) as well as 1μM/ml of L-ascorbic acid (Sigma, Japan). The SHED was similarly incubated in a CO2 incubator at 37°C until confluence.

Total RNA extraction

Total RNA was harvested from 1 X 107 cells of both hFOB and SHED, using RNeasy Mini Kit (Qiagen, USA) according to manufacturer’s instructions. Cells were lysed in RLT buffer and applied onto the Qiashredder column and centrifuged. The lysate was homogenized with 70% ethanol and transferred into RNeasy mini spin column for centrifugation. After that, 700μl of RW1 buffer was added to the column and again centrifuged. Finally, 500μl of RPE buffer was added to dissolve the total RNA. The final eluted RNA was quantified by measuring the absorbance at 260 nm. The purity of the RNA was assessed by the 260/280 nm absorbance ratio. The total RNA was stored at -70°C until the

119


assays.

cDNA synthesis for hFOB and SHED

cDNA synthesis was carried out using revertAid™ H Minus First Strand cDNA Synthesis Kit (Fermentas, USA). The synthesis was performed by adding the cDNA into 0.5μg oligo (dT)18 primer in nuclease-free deionized water, 1X reaction buffer, Ribolock™ Ribonuclease inhibitor (20 u/µl) and 10 mM dNTP mix. The mixture was mixed gently and centrifuged briefly before incubation for 5 minutes at 37°C. One μl of RevertAid™ H Minus M-MuLV Reverse Transcriptase (200 u/µl) was added into the reaction mixture and incubated at 42°C for 60 minutes. These cDNA samples were then used for semi-quantitative reverse transcriptase-polymerase chain reaction (RT-PCR) and multiplex polymerase chain reaction (MPCR).

Multiplex polymerase chain reaction (MPCR) of Human Inflammatory Cytokines Genes

Multiplex PCR was carried out on the cDNA samples using the MPCR Kit for Human Inflammatory Cytokine Genes Set-1 (Maxim Biotech Inc., CA) to detect the expression levels of the cytokines GM-CSF, TNF-α, IL-1β, IL-6, IL-8 and TGF-β genes in hFOB and SHED. The final reaction volume containing 2.5U of Taq DNA polymerase, 1X MPCR buffer mixture and 1X MPCR primers solution was added to 200ng of cDNA from hFOB and SHED, as well as to 1X control cDNA from the MPCR kit. Amplification of cDNA samples were carried out according to the following parameters: denaturation and amplification steps at 96°C (1 min) and 66°C (4 min) for 2 cycles followed by 94°C (1 min), 66°C (2 min) for 35 cycles and elongation step at 70°C for 10 min.

The PCR products were analyzed on a 1.5% agarose gel and subjected to electrophoresis for 120 minutes at 60 V and the bands were observed. The intensity of each band was quantified with Molecular Imager Gel Doc XR System (Bio-Rad, USA).

Semi-quantitative reverse transcriptase-polymerase chain reaction (RT-PCR)

Reverse transcriptase polymerase chain reaction (RT-PCR) amplification was performed in triplicate using a C-1000TM thermal cycler (Bio-Rad, USA). A master mix containing 0.25 μM primer solutions, 1X PCR buffer and 0.5U Taq DNA polymerase was added into 200ng of cDNA samples. The amplification of OPG and RANKL genes was performed according to the parameters as described in Table 1. Expression levels of OPG and RANKL were assessed for both hFOB and SHED following the procedure as described in a previous study [1]. The house keeping gene GAPDH was used as the internal control.

The PCR products were analyzed on 1.5% agarose gel and subjected to electrophoresis for 120 minutes at 60 V. The GAPDH, OPG and RANKL amplicons were visualized and intensity of each band was quantified using the Molecular Imager Gel Doc XR System (Bio-Rad, USA).

120


Table 1. Primer sequence, PCR fragment length and cycling conditions for RT-PCR

Target Gene PCR fragment lengths Sequence Cycling conditions

GAPDH bp 313 F: GAAGTGGAAGGTCGGAGTC

R: GAAGATGGTGATGGGATTTC

94°C 1 min

57°C 1 min

72°C 1 min

29 cycles

OPG bp

Acc. no: NM_002546

469 F: AGACTTTCCAGCTGCTGA

R: GGATCTCGCCAATTGTGA

94°C 1 min

57°C 1 min

72°C 1 min

29 cycles

RANKL bp

Acc. no: AF019047

381 F: CAGGAGACCTAGCTACAGA

R: CAAGGTCAAGAGCATGGA

94°C 40 s

55°C 40 s

72°C 40s

29 cycles

Statistical analyses

Statistical analyses were carried out using the Mann-Whitney test in SPSS software for Windows version 18.0. The p value < 0.05 was considered statistically significant.

RESULTS Detection of expression levels of inflammatory cytokines by Multiplex PCR assay

The expression levels of inflammatory cytokines TNF-α, IL-1β, GM-CSF, IL-6, IL-8 and TGF-β were detected using Multiplex PCR. The TNF-α, IL-1β, GM-CSF, IL-6, IL-8 and TGF-β amplicons were visualized as 680, 555, 424, 360, 300 and 161 bp nucleotides in length, respectively. The cytokine IL-1β was expressed in both hFOB and SHED, with SHED showing significantly lower levels of the IL-1β gene expression compared to hFOB. In addition, SHED also expressed significantly lower levels of IL-6 and IL-8 genes compared to hFOB. There was no significant difference in the expression of TGF-β gene between hFOB and SHED (Fig. 1b). It was also found that no TNF-α and GM-CSF was observed in both hFOB and SHED (Fig. 1a).

121


Fig. 1a. Pictures of gel analysis of MPCR products of inflammatory cytokines genes. All cytokines were less prominent in SHED when compared to hFOB, while the cytokines TNF-α and GM-CSF were not observed in both cell types. Fig. 1b. SHED demonstrated significantly lower expression levels of inflammatory cytokines genes IL-1β, IL-6 and IL-8. The graphs were plotted with relative expression of genes with respect to GAPDH, the internal control. (□ hFOB, ■ SHED, *shows significance at P < 0.05).

Analysis of expression levels of OPG and RANKL by semi-quantitative RT-PCR assay

RT-PCR assay showed that both SHED and hFOB expressed the OPG and RANKL genes, with higher OPG levels compared to RANKL. However, no significant difference between the expression levels of OPG in both hFOB and SHED was noted. SHED appeared to exhibit slightly lower levels of OPG gene compared to hFOB (Fig. 2a). RT-PCR assay also demonstrated that both hFOB and SHED expressed very low amounts of RANKL, but SHED showed significantly higher levels of RANKL gene when compared to hFOB (Fig. 2b). Therefore, the OPG/RANKL ratio for SHED is significantly lower than in hFOB (data not shown).

Fig. 2a. Pictures of gel analysis of RT-PCR products of a) GAPDH, b) OPG and c) RANKL. GAPDH was used as the internal control. Fig. 2b. Expression of OPG and RANKL were detected in both SHED and hFOB. Both cells showed no significant difference in expression levels of OPG, while SHED has significantly higher levels of RANKL compared to hFOB. The graphs were plotted with relative expression of genes with respect to GAPDH, the internal control. (*shows significance at P < 0.05).

122


DISCUSSIONStem cells have the capacity for unlimited self-renewal and retain the potential to differentiate into a variety of specialized cell types. These pluripotent cells are commonly used in regeneration therapy and transplants, which replace effete cells of damaged cartilage, bone, neural cells and others. However, the normal process of immune rejection of mismatched allogeneic tissue, mediated by inflammatory cytokines, would prevent the success of transplant therapy. In the present research, we studied the potential of SHED, in terms of its inflammatory cytokines profile and its relationship with bone regeneration. Inflammatory cytokines have pronounced modulatory effect on the mechanism of bone formation, remodeling, resorption and regeneration. Interactions between these cytokines and bone cells control their proliferation, differentiation and function, therefore dictating normal bone metabolism. The interaction between SHED and the inflammatory cytokines in the immune system can influence the success of the stem cell transplant.

IL-1β is a potent inducer of bone resorption. It is now considered to be the principal component of osteoclast activating factor (OAF), a mixture of factors that stimulates bone resorption in organ cultures [17]. IL-1β inhibits the formation of specific proteins in osteoblasts, i.e. osteocalcin and alkaline phosphatase, and has therefore been suggested to cause the inhibition of osteoblastic activity seen in myeloma [18]. Since IL-1b have been documented to mediate inflammation and osteolysis, the differences in the expression levels of IL-1β in SHED and normal “self” hFOB cells is of considerable importance. The results of RT-PCR showed that SHED expressed significantly lower expression levels of the gene for IL-1β when compared to hFOB, therefore indicating that SHED may only cause minimal stimulation of inflammatory bone resorption and insignificant inhibition of osteoblastic function.

Previous studies have demonstrated that IL-1 enhances the formation of IL-6 in osteoblasts. The expression of IL-6 mRNA and the production of biologically active IL-6 are induced in osteoblasts preferentially in response to local bone-resorbing agents such as IL-lα and IL-1β [19]. We found this to be consistent with the result of our study, where SHED expressed low levels of IL-6 gene in accordance with similarly low levels of IL-1β. On the other hand, hFOB was shown to express high levels of IL-6 gene in line with similarly high levels of IL-1β.

IL-1β induced osteoblast IL-6 production represents one possible mechanism by which IL-1 augments bone resorption. Following that, IL-6 is produced by osteoblastic cells and appears to induce bone resorption by enhancing osteoclast formation. Other reports have shown an inhibitory effect of IL-6-type cytokines on bone formation and marker expression in vitro, as well as potent pro-apoptotic effects through enhancement of the Bax/Bcl2 ratio in the mitochondrial apoptotic pathway [20]. Our research showed that SHED expressed significantly lower levels of IL-6 genes compared to hFOB. This result indicates that SHED may potentially promote relatively lower inflammatory bone resorption due to low levels of osteoclast formation and reduced osteoblastic apoptosis. Therefore, our result suggested that the low expression levels of IL-1β and IL-6 genes in SHED should be further confirmed through in vivo studies to ascertain the significance in bone regeneration.

IL-8 is a member of the α chemokine family of cytokines that are monocyte-derived factors capable of attracting and activating neutrophils, as well as inducing osteolysis [13, 21]. A study in University of Arkansas, USA demonstrated that the addition of recombinant human (rh) IL-8 to osteoblastic cells stimulated both RANKL mRNA expression and protein production, with no effect on the expression of osteoprotegerin (OPG) [13]; therefore stimulates osteoclast formation. Significantly lower level of IL-8

123


gene expression by SHED in the present study proves that stem cells may encourage comparatively reduced osteoclastic formation through increase of OPG/RANKL ratio, thus decreasing inflammatory bone resorption and inproving the stability and integration of cellular transplant and host.

TGF-β is one secreted factor that modulates the differentiation of osteoblasts and proliferation of osteoprogenitor cells. However, osteoblastic overexpression of TGF-β in transgenic mice deregulates bone remodeling and leads to an age-dependent loss of bone mass [14]. MPCR results showed that SHED expressed slightly lower expression levels of TGF-β compared to hFOB. Hence, we speculate that SHED seems to modulate osteoblast differentiation and balancing between bone resorption and matrix formation in response to TGF-β secretion.

TNF-α is one of the most potent osteoclastogenic cytokines produced in inflammation. It stimulates osteoclastic bone resorption [22] and mediates RANKL stimulation of osteoclast differentiation through an autocrine mechanism [23]. GM-CSF promotes the fusion of prefusion osteoclasts into multinucleated osteoclasts into multinucleated cells which function in bone resorption [24]. In this study, we demonstrated that the genes for cytokines TNF-α and GM-CSF was not detected in both SHED and hFOB. This implies that SHED possess some similar properties with hFOB, which is an attractive feature for cell therapy, because this reduces the probability of the human immune system recognizing transplanted SHED as foreign cells. However, future studies must be done on SHED-derived osteoblasts in comparison with hFOB, to determine the similarities or differences in gene expressions and regulation of these cells.

The signals regulating osteoclast differentiation and development is mediated via proteins from the family of tumor necrosis factors, named osteoblasts-like receptor activator of nuclear factor kB (RANK), osteoprotegerin (OPG) and a ligand, receptor activator of NF-kB ligand (RANKL) respectively [25-27]. RANKL is expressed on osteoblasts and its interaction with the receptor RANK, present on osteoclast precursors, induces their differentiation and activation [26, 28]. This signaling pathway can be competitively inhibited by OPG (also produced by osteoblasts), which blocks the interaction between RANKL and the RANK receptor [30-32], thus resulting in increased apoptosis of mature osteoclasts, prevention of osteoclastogenesis and inhibition of activation of existing osteoclasts. In this study, we evaluated the levels of gene expression of OPG and RANKL genes in hFOB and SHED to lay the groundwork for further investigations on the mechanisms of OPG/RANKL regulation by SHED in relation with pro-inflammatory cytokines during stem cell therapy.

The expression of OPG and RANKL is developmentally regulated by osteoblasts. OPG increases during osteoblast differentiation whereas RANKL expression is inversely related to the degree of osteoblast differentiation [31, 32]. A study done on the complete developmental sequence from undifferentiated marrow stromal cells to cells with complete osteoblast phenotype determined that during osteoblast differentiation, RANKL mRNA levels decreased by 5-fold, whereas OPG mRNA levels increased by 7-fold, resulting in a 35-fold change in the OPG/RANKL ratio [32]. Our results showed that while there was no significant difference in OPG gene levels for hFOB and SHED; while SHED showed significantly higher expression levels of RANKL compared to hFOB.

It has been shown that undifferentiated marrow stromal cells express a low OPG/RANKL ratio which initiate and support osteoclastogenesis [32]. In contrast, we demonstrated that SHED expresses a high level of OPG/RANKL ratio. This implies that SHED may potentially initiate osteogenesis and they may not support osteoclastogenesis. Therefore, we suggest that further studies should be carried out on the complete developmental sequence of SHED-derived osteoblasts, passage-by-passage, to clearly

124


elucidate the expression levels of OPG and RANKL and the support of osteoclast formation. It is necessary to understand the contribution of the OPG/RANKL interaction in SHED and its derivative cells throughout the sequence of osteoclast and osteoblast differentiation during the bone remodeling.

In conclusion, this preliminary study shows that SHED has potentially improved immunomodulatory properties in terms of generally low expression levels of IL-1β, IL-6, IL-8 and TGF-β transcription genes, as well as high OPG/RANKL ratio. SHED is capable of differentiating into osteoblasts and forming lamellar bone after implantation into immunosuppressed rats, therefore strongly implying that SHED is an important source of osteoblasts for stem cell and tissue-based clinical therapies [2, 33]. This study provides a description of the inflammatory cytokines profile of SHED which largely favours the positive attributes required for stem cell transplants; however we suggest that further research on the properties of SHED and its derivative cells (especially SHED-derived osteoblasts) in terms of immunomodulatory properties and interaction with human immune cells like PBMCs and T-lymphocytes, which are the main mediators in immune rejection of transplants. This is necessary to determine the efficacy of eventually using SHED in cellular-based therapies in immunocompetent hosts.

ACKNOWLEDGEMENTSThe authors are grateful to the USM Incentive Grant for funding of this research, and also to the School of Dental Sciences, USM for providing the facilities and instruments.

REFERENCES

[1] Miura M, Zhao M, Lu B, Fisher LW, Robey PG and Shi S (2003). SHED: Stem cells from human exfoliated deciduous teeth. Proc Nat Acad Sci USA, 100 : 5807-5812.[2] Laino G, Graziano A, d’Aquino R, Pirozzi G, Lanza V, Valiante S, De Rosa A, Naro F, Vivarelli E, Papaccio G (2006). An approachable human adult stem cell source for hard-tissue engineering. J Cell Physiol, 206 : 693-701.[3] LeGros RZ (2002). Properties of osteoconductive biomaterials: calcium phosphate. Clin Orthopead Related Res, 395 : 81-98.[4] Miller K, Rose–Caprara V, Anderson J (1989) Generation of Il-1 activity in response to biomedical polymer implants: A comparison of in vitro and in vivo models. J Biomed Mater Res, 23 : 1007–1026.[5] Miller K, Anderson J (1988) Human monocyte/macrophage activation and interleukin-1 generation by biomedical polymers. J Biomed Mater Res, 22 : 713–731.[6] Fuller K, Wong B, Fox S, Choi Y. (1998). TRANCE is necessary and sufficient for osteoblast-mediated activation of bone resorption in osteoclasts. J. Exp Med, 188 : 997-1001.[7] Hofbauer LC, Khosla S, Dunstan CR, Lacey DL, Boyle WJ, Riggs BL. (2000) The roles of osteoprotegerin and osteoprotegerin ligand in the paracrine regulation of bone resorption. J Bone Miner Res, 15 : 2-12.[8] Yasuda H, Shima N, Nakagawa N, Yamaguchi K, Kinosaki M, Goto M, (1999) A novel molecular mechanism modulating osteoclast differentiation and function. Bone, 25 : 109-13.[9] Hakeda Y (1998) Osteoclastogenesis inhibitory factor (OCIF) directly inhibits bone-resorbing activity of isolated mature osteoclasts. Biochem Biophys Res Commun, 251 : 796-801.[10] Ragab AA, Nalepka JL, Bi Y, Greenfield EM (2002) Cytokines synergistically induce osteoclast differentiation: support by immortalized or normal calvarial cells. Am J Physiol Cell Physiol, 283 : C679–87.[11] Bresnihan B, Alvaro-Gracia JM, Cobby M, Doherty M, Dolmjan Z, Emery P (1998) Treatment of rheumatoid arthritis with recombinant human interleukin-1 receptor antagonist. Arthritis Rheum, 41 : 2196–204[12] Kotake S, Sato K, Kim KJ, Takahashi N, Udagawa N, Nakamura I (1996) Interleukin-6 and soluble interleukin-6 receptors in the synovial fluids rheumatoid arthritis patients are responsible for osteoclast-like cell formation. J Bone Miner Res, 11 : 88–95.[13] Sozzani S, Locati M, Allavena P, Van Damme J, Mantovani A (1996) Chemokines: a superfamily of chemotactic cytokines. Int J Clin Lab Res, 26 : 69–82.

125

Asia Pacific Dental Students Journal [14] Erlebacher A, Filvaroff EH, Ye JQ and Derynck R (1998) Osteoblastic responses to TGF-beta during bone remodeling. Mol. Biol. Cell, 9 : 1903-1918. [3] Gronthos S, Brahim J, Robey PG and Shi S (2000). Postnatal human dental pulp stem cells (DPSCs) in vitro and in vivo. Proc Nat Acad Sci USA, 97 : 13625-13630.[15] Yamaza T, Kentaro A, Chen C, Liu Y, Shi Y, Gronthos S, Wang S, Shi S (2010) Immunomodulatory properties of stem cells from human exfoliated deciduous teeth. Stem Cell Res Ther, 1 : 5.[16] Mohd Hilmi AB, Fazliah SN, Siti Fadilah A, Asma H, Siti Razila AR, Shaharum S, Jaafar S, Asiah AB, Shamsuria O (2008) Stem cells from childrens’ teeth. Archive of Orofacial Sciences, 3(1) : 29-31[17] Dewhirst FE, Stashenko PP, Mole JE, Tsurumachi T (1985) Purification and partial sequence of human osteoclast activating factor identity with interleukin 1 beta. J. Immunol. 135 : 2562-2568.[18] Stashenko P, Obernesser MS, Dewhirst FE (1989) Effect of immune cytokines on bone. Immunol Invest, 18 : 1–4 [19] Lacey DL, Grosso LE, Moser SA, Erdmann J, Tan HL, Pacifici R, and Villareal DT (1993) IL-1-induced murine osteoblast IL-6 production is mediated by the type 1 IL-1 receptor and is increased by 1,25 dihydroxyvitamin D3. J Clin Invest, 91(4) : 1731–1742[20] Chipoy C, Berreur M, Couillaud S, Pradal G, Vallette F, Colombeix C (2004) Downregulation of osteoblast markers and induction of the glial fibrillary acidic protein by oncostatin M in osteosarcoma cells require PKCdelta and STAT3. J Bone Miner Res, 19 : 1850–61[21] Yoshimura T, Matsushima K, Tanaka S, Robinson E, Appella E, Oppenheim J, Leonard E (1987) Purification of a human monocyte-derived neutrophil chemotactic factor that has peptide sequence similarity to other host defense cytokines. Proc Nat Acad Sci USA, 84 : 9233–7.[22] Thomson BM, Mundy GR, Chambers TJ (1987) Tumor necrosis factors alpha and beta induce osteoblastic cells to stimulate osteoclastic bone resorption. J Immunol, 138 : 775–9.[23] Zou W, Hakim I, Tschoep K, Endres S, Bar-Shavit Z (2001) Tumor necrosis factor-alpha mediates RANK ligand stimulation of osteoclast differentiation by an autocrine mechanism. J Cell Biochem, 83 : 70–83.[24] Lee MS, Kim HS, Yeon JT, Choi SW, Chun CH and Kwak HB (2009) GM-CSF regulates fusion of mononuclear osteoclasts into bone-resorbing osteoclasts by activating the Ras/ERK pathway. J Immunol, 183 : 3390–3399.[25] Lacey DL, Timms E, Tan HL, Kelley MJ, Dunstan CR, Burggess T (1998). Osteoprotegerin ligand is a cytokine that regulates osteoclast differentiation and activation. Cell, 93 : 165-76.[26] Hofbauer LC, Heufelder AE. (2000). The role of receptor activator of nuclear factor- kappaB ligand and osteoprotegerin in the pathogenesis and treatment of metabolic bone diseases. J Clin Endocrinol Metab, 85 : 2355-63. [25] Theoleyre S,Wittrant Y, Tat SK, Fortun Y, Redini F, Heymann D (2004) The molecular triad OPG/RANK/RANKL: involvement in the orchestration of pathophysiological bone remodeling. Cytokine Growth Factor Rev, 15 : 457–75[27] Nakamura M, Udagawa N, Matsuura S, Mogi M, Nakamura H, Horiuchi H (2003) Osteoprotegerin regulates bone formation through a coupling mechanism with bone resorption. Endocrinology, 144 : 5441-9.[28] Simonet WS, Lacey DL, Dunstan CR, Kelley M, Chang MS, Luthy R (1997) Osteoprotegerin: a novel secreted protein involved in the regulation of bone density. Cell, 89 : 309-19.[29] Bucay N, Sarosi I, Dunstan C, Morony S, Tarpley J, Capparelli C (1998) Osteoprotegerin-deficient mice develop early onset osteoporosis and arterial calcification. Genes Development, 12 : 1260-8. [30] Yasuda H, Shima N, Nakagawa N, Yamaguchi K, Kinosaki M, Mochizuki S (1998) Osteoclast differentiation factor is a ligand for osteoprotegerin/osteoclastogenesis-inhibitory factor and is identical to RANKL. Proc Natl Acad Sci USA, 95 : 3597–602[31] Hofbauer LC, Khosla S, Dunstan CR, Lacey DL, Boyle WJ, Riggs BL (2000) The roles of osteoprotegerin and osteoprotegerin ligand in the paracrine regulation of bone resorption. J Bone Miner Res, 15(1) : 2–12.[32] Gori F, Hofbauer LC, Dunstan CR, Spelsberg TC, Khosla S, Riggs BL (2000) The expression of osteoprotegerin and RANK ligand and the support of osteoclast formation by stromal-osteoblast lineage cells are developmentally regulated. Endocrinology, 141(12) : 4768–76. [33] Seo BM, Sonoyama W, Coppe C, Kikuiri T, Akiyama K, Lee JS, Shi S (2008). SHED repair critical-size calvarial defects in immunocompromised mice, Oral Diseases, 14 : 428-434.

126


15. PHYSICAL AND BIOLOGICAL AFFECT OF FIBRONECTIN ON GDP-TREATED TITANIUM SURFACE

W u, S hih- H ui, Lee, Yi-Lun, Lee, Kuan-Han, Tsai, Pei-Yu

Objectives：Titanium (Ti) is widely used as the dental implant due to its great biocompatibility in human body. From the past experiments, we know glow discharge plasma (GDP) can lead to better osseointegration on Ti surface. In this experiment, fibronectin, which is known benefit to cell adhesion, is coated on GDP-treated titanium. We focus on the physical properties and the biocompatibility of fibrobectin-coated Ti surface. Methods：Titanium was treated by GDP with 80W, 10min. Then fibronectin was coated on Ti surface in 4 and℃ 25 , respectively. Physical properties were examined by contact angle method, surface roughness and℃ hemocompability (OD in 540nm). Biocompatibility was determined by MTT test. All samples were observed by SEM. Differences were analyzed by T student’s test (α=0.95). Results ： Ti coated fibronectin in 4 shows℃ lesser contact angle than 25 . Surface roughness presents no significance difference. Test to hemocompability,℃ fibronectin-coated Ti in 4 presents higher OD value than 25 . In MTT test, 25 fibronectin-coated Ti presents℃ ℃ ℃ higher value of cell adhesion than 4 .℃ Conclusions：Ti coated fibronectin in 4 shows better hydrophile than℃ 25 . Surface roughness doesn’t show difference between 4 and 25 . Test to the hemocompability, 4℃ ℃ ℃ ℃ fibronectin-coated Ti presents better OD value than 25 . It means 4 fibronectin-coated Ti has more blood℃ ℃ coagulation effect. MTT test indicates that cell adhesion have significance difference between 4 and 25 after℃ ℃ 48hr. It indicates 25 fibronectin-coated Ti really has better cell adhesion than 4 .℃ ℃

INTRODUCTION

Titanium dental implants have been used for oral rehabilitation since 1965. Branemark et al., have defined osseointegration as “implant direct contact with bone”1-2). According to this definition, however, the level of osseointegration between implant and surrounding bone remains lower than 70%. This is because, from a microscopic viewpoint, a thin intervening layer can always be found between the implant and bone. This thin layer, which is a gligoamino-glucose substrate around 20-100 nm thick, is an imperfect structure. As such, it is a barrier to successful completion of osseointegration, which may cause implantation failure. In modern implant dentistry, osseointegration is defined as a kind of tissue condition wherein the implant and bone are functionally and structurally interconnected, with no other masses in the interval. Osseointegration provides long-term clinical function without rejection1). Since early interaction at the bone and implant interface allows early or immediate implant loading, various surface treatments have been investigated to try to improve the response of bone cells in terms of adhesion to integration with the titanium surface3-4).

The gas plasma process can strip material surfaces of chemical bonds and establish new ones. In general, electrons and ions gain energy by heating; energy is then transferred by collisions between atoms, which increases excitation and causes decomposition and ionization. Therefore, for years, it has been used for surface cleaning and sterilization of titanium and titanium alloys5-6). Recently, low-temperature gas plasma discharge, which operates far below atmospheric pressure and room temperature, has been introduced for surface treatment7-8). Due to this low operative pressure and temperature, it is also termed defined as cold plasma or glow discharge plasma (GDP). The main advantage of GDP is that it can provide a non-destructive reaction, avoiding subsequent reaction failure during chemical modification of surface of biodegradable polymers9).

Glow discharge plasma can be used to treat material surfaces by etching, deposition, co-polymerization and chemical modification7-11). These GDP surface treatment characteristics can be used to establish

127


some bio-functional groups and increase surface wettability10-11), which may enhance the biocompatibility of the target materials12-13).

To test ways to improve bone remodeling on Ti-based surfaces, Yamamoto et al. (2005) incubated GDP-treated titanium discs with typical culture medium containing extracellular matrix proteins (ECM)14). These scholars found that adsorption of ECM proteins to the titanium surface can be achieved. In 2007, Alves et al. also facilitated adsorption of albumin and fibronectin to titanium plates using oxygen-based glow discharge plasma treatment15. Although these studies demonstrated that such plasma modification clearly promotes proliferation of osteoblastic cells, no direct evidence was provided that the proteins chemically bind to the titanium surface. Further, non-specific bio-adhesion is a problem that limits clinical utilization of the biomaterials16).

It is thought that use of amine groups solves the problem of non-specific bioadhesion, as they provide an ideal interface that gives rise to connection between biomaterials and cells17). To graft the amine group onto biomaterials, allylamine (AA) radiofrequency GDP was developed to produce amine-group thin films on biopolymer surfaces16,18). In 2007, Christina and colleagues first used glutaraldehyde (GA) as a bifunctional linker to convalently couple proteins on aminating silicon surfaces19). Although several techniques were used to verify the existence of amine-specific molecules on the material surface, biocompatibility checking using cell culture experiments was not performed.

The aim of this study was to improve the surface activity of titanium. Radiofrequency-GDP was used to establish biofunctional amine groups on a titanium surface, and fibronectin was then grafted onto the amine group interfaced with GA linker. The biocompatibility of the modified titanium discs was subsequently evaluated through observation of morphological changes in the cultured osteoblastic cells.


Titanium disc cleaning

Grade II titanium discs (BioTech One Inc., Taipei, Taiwan) with a diameter of 10 mm were prepared. Before treatment with glow discharge plasma, the discs were cleaned as described elsewhere5). Briefly, the titanium specimens were ultrasonically cleaned in acetone, detergent solution and pure distilled water for 15 min separately and then autoclaved in 121 20min. The disc surfaces were subsequently℃ cleaned using glow discharge (PJ; AST Products Inc., North Bellericca, MA, USA) at 85 W and 13.56 MHz in argon gas at room temperature and at low pressure (100 millitorr) for 15 min. At this study stage, the titanium discs were defined as an original specimens.

Glow discharge protein grafting

Adhesion of NH groups to the titanium surface was achieved by glow discharge feed with AA gas. To deposit the allylamine onto the titanium surface and create NH groups, the GDP reactor was set to expose the specimens to 85W/13.56 MHz gas plasma at room temperature and low pressure (60-100 millitorr) for 30 min. The glow discharge-treated titanium discs were further immersed in 3% GA solution (Merck, NJ, USA) for 30 min. The treated titanium discs were subsequently immersed in 5μg/ml fibronectin solution (Sigma-Aldrich Co., St. Louis, MO, USA) for 30 min. Tris-phosphate buffer (pH 7.4) was then used as a stop solution (30-min immersion).

128


Surface Analysis

Surface wettability was evaluated by an optical measurement of the advancing contact angle of water. For this purpose, a linear goniometer was constructed that consisted of a base platform, 35 mm camera, sample holder, and an external lighting system to illuminate the sample. For each measurement, a 4 µl droplet of water (Millipore-Q, Millipore, Bedford, Mass., filtered, 20 ° C) was applied to the test surface, and a picture was taken meanwhile. Developed slides were then projected on a standardized tracing table, the image was traced, and the contact angle was measured. Advancing contact angles for each water droplet were then calculated.

Surface analyzer (TR200, An-Bomb instrument CO., LTD, Tinan, Taiwan) was used to test surface roughness. The measured length on sample was determined in 0.8*5mm. The amplitude was set in ±40μm. Ra, the arithmetic average of absolute values, was used to express the collected data points. All data was in ISO standard.

Clotting time assay

The blood coagulation properties of the treated Ti specimens were evaluated by using fresh human blood with the kinetic clotting time methods. The specimens were put into a 24 well plate, and 50μl bloods was immediately dropped onto the specimens. After a predetermined time of 10, 20, 30 and 40 min, drop 2ml of distilled water into the wells and incubated for 10 min. The red blood cells not trapped into thrombus were hemolyzed, and the free hemoglobin was dispersed in water. The concentration of free hemoglobin in the water was colorimetrically measured by monitoring the absorbance at 540 nm using a spectrophotometer. The absorbance values were plotted versus the blood contacting time. Each absorbance value represents the average of six measurements. The plates were also investigated for comparison.

MG-63 osteoblast-like cell culture

MG-63 (ATCC CRL-1427) is an osteoblast-like cell line from a rat osteosarcoma. When grown as a monolayer, the cells possess osteoblast-like morphological features. In this study, MG-63 cells were seeded onto the surfaces of type I collagen-grafted titanium discs in 24-well petri dishes (Nunclon; Nunc, Roskilde, Denmark). The cells were maintained in Dulbecco’s modified Eagle’s medium (DMEM; HyClone, Logan, UT) supplemented with L-glutamine (4 mmol/L), 10% fetal bovine serum (FBS), and 1% penicillin streptomycin. Cultures were incubated in a 5% CO2 atmosphere at 37° C and 100% humidity. For all experiments, the cells were first incubated for attachment for 10 hr, with this defined as time point 0 hr for all tests.

Cell morphology and VitalityAt 0, 24, 48, 72, 96 hr, the culture media were removed and the samples were rinsed three times with PBS. The samples were then fixed in 2.5% glutaraldehyde and 2% paraformaldehyde for 30 min. After initial fixation, the samples were rinsed and postfixed in 1% osmium tetroxide for 1 hr. The samples were then washed with PBS and dehydrated in an ethanol series at concentrations of 70%, 80%, 90%, 95%, and 100% in a critical point dryer (HCP-2; Hitachi Ltd, Tokyo, Japan). A thin layer of palladium gold was coated onto the samples using a sputtering apparatus (IB-2; Hitachi, Ltd). The morphological features of the cells were examined using a Hitachi S-2400 electron microscope (Hitachi, Ltd). For each group, two samples were prepared, with nine fields within each sample examined.

Cell vitality was determined by MTT reduction assay, which measures the metabolic reduction of MTT

129


(3-4,5-dimethylethiazol-2-yl)-2,5-diphenyl tetrazolium bromide; Sigma ,USA) to colored formazan by mitochondrial dehydrogenase. MG-63 were seeded into each well of 24-well culture plate at a concentration of 1 x 105 cells/ml with 0.05 ml/well, and incubated at a 37 with 5% CO℃ 2 atmosphere. After 10h of incubation, the culture media was added into each well (0.45 ml/well). After another 0, 24, 48, 72, 96 hr exposure, the medium was replaced with the same volume of fresh medium containing MTT. Following a 4-h incubation the formazan produced was dissolved in solubilizing reagent, and the optical density of the medium was determined using an ELISA reader at a wave length of 570 and 690 nm. Results are expressed as a percentage of the control.

RESULTS

Surface wettability

0

10

20

30

40

50

60

GDP,4℃ fibronectin,4℃

51.1

4.6

＊

＊

Figure 1. Contact angle analysis showed the surface wettability of glow discharge plasma treated titanium and fibronectin-grafted titanium,

The surface wettability showed improvement by fibronectin grafting.(Fig. 1) The contact angle of the GDP-treated titanium surface was 51.1 degree. After the fibronectin grafting , the contact angle decrease to 4.6 degree.It indicated that fibronectin can increase the affinity of cell and protein adhesion to the titanium surfaces.

130


Surface roughness

0

0.1

0.2

0.3

0.4

0.5

0.6

0.7

GDP,4℃ fibronectin,4℃

μm

0.176 0.4

＊

＊

Figure 2. Surface roughness of glow discharge plasma treated titanium and fibronectin-grafted titaniumFibronectin-grafted Ti has greater surface roughness than GDP treated Ti (Fig. 2). The Ra value of GDP treated Ti was 0.176. After fibronectin grafting, the Ra value increased to 0.4. Rougher surface can enhance bone adhesion mechanically.

Figure 3. Hemocompability of glow discharge plasma treated titanium and fibronectin-grafted samples were compared in percentage to the blank plate(100%)

Hemocompatibility decreased after fibronectin grafted on GDP treated Ti(Fig. 3). The result showed significant difference between GDP-treated Ti(72.7%) and fibronectin-grafted Ti(38.0%).

131


Figure 4. MTT assay of glow discharge plasma treated titanium and fibronectin-grafted samples.

MTT assay demonstrated the relative MG63 cell growth rate on the different surfaces after 48 hours culture. The results(Fig. 4) showed improvement of cell differentiation (122.7%) on the GDP treated titanium surfaces and significant difference between non-treated(100%) and GDP treatment with fibronectin grafting titanium surfaces(136.6%). The data suggested osteoblasts differentiation on GDP with fibronectin grafting titanium surfaces were improved.

DISCUSSION

Glow discharge is a lower-ionizing “cold plasma” energy source, which can produce sufficiently energetic species to cause the rupture of molecular bonds at ambient temperatures. The distinguishing characteristic of glow discharge is that the chemical reactions induced by the partially ionized gas and/or gases are limited to the near surface7), with significantly reduced penetration (a few hundred angstroms) compared to high-energy radiation. This characteristic of glow discharge allows applications targeting surface modification.

Fibronectin exists as a dimer, consisting of two nearly identical polypeptide chains linked by a pair of C-terminal disulfide bonds. Pankov R et at suggested fibronectin plays a major role in cell adhesion. Otherwise, fibronectin is important in the process of cell , growth, migration and differentiation. Thus, fibronectin has been a primary focus in investigations of implant materials.

In this study, allylamine gas was used to modify titanium surfaces to allow fibronectin bonding. The amine group is used for this purpose because it exhibits a positive charge which may attract negatively charged biomolecules. Glutaraldehyde was bond to allylamine treated titanium as a crosslinker. And fibronectin was coated on the surface, forming a allylamine-glutaraldehyde-fibronectin linkage.

It has been suggested that osteoblast differentiation is promoted in glow discharge-treated titanium plate13). Shibata et al. (2002) have also demonstrated that stress-fiber formation of osteoblast-like cells on titanium plates can be enhanced by GDP pre-treatment. Further, these workers found that ECM protein released by osteoblastic cells on the titanium surface was increased, even after just 1 hr of incubation12).

In conclusion, although somewhat limited, our results indicate that allylamine glow discharge combined with fibronectin-grafting treatment may enhance ECM protein expression by osteoblast-like cells, especially through glutaraldehyde cross-linking. Based on these results, and despite the lack of

132


animal and clinical evidence for application of this technique in this study, it appears reasonable to suggest that fibronectin-grafting of titanium using glow discharge plasma can potentially reduce the duration of the osseointegration process and improve the osseointegration of dental implants in the early stages.

REFERENCES1) Roberts WE. Bone tissue interface. J Dent Educ 1988; 52: 804-809.2) Branemark PI. Osseointegration and its experimental background. J Prosthet Dent 1983; 50: 155-170.3) Sultana R, Kon M, Hirakata LM, Fujihara E, Asaoka K, Ichikawa T. Surface modification of titanium with

hydrothermal treatment at high pressure. Dent Mater J 2006; 25: 470-479.4) Zinger O, Anselme K, Denzer A, Habersetzer P, Wieland M, Jeanfils J, Hardouin P, Landolt D. Time-dependent

morphology and adhesion of osteoblastic cells on titanium model surface featuring scale-resolved topography. Biomaterials 2004; 25: 2695-2711.

5) Serro AP, Saramago B. Influence of sterilization on the mineralization of titanium implants induced byincubation in various biological model fluids. Biomaterials 2003; 24: 4749–4760.

6) Kibayashi H, Teraoka F, Fujimoto S, Nakagawa M, Takahashi J. Surface modification of pure titanium by plasma exposure and its bonding to resin. Dent Mater J 2005; 24: 53-58.

7) Czarnowska E, Wierzchon T, Maranda-Niedbal A, Karczmarewicz E. Improvement of titanium alloy for biomedical applications by nitriding and carbonitriding processes under glow discharge conditions. J Mater Sci Mater Med 2000; 11: 73-81.

8) Aronsson BO, Lausmaa J, Kasemo B. Glow discharge plasma treatment for surface cleaning and modification of metallic biomaterials. J Biomed Mater Res 1997; 35: 49–73.

9) Teraoka F, Nakagawa M, Hara M. Surface modification of poly(L-lactide) by atmospheric plasma treatment and cell response. Dent Mater J 2006; 25: 560-565.

10) Hesby RM, Haganman CR, Stanford CM. Effects of radiofrequency glow discharge on impression material surface wettability. J Prosthet Dent 1997; 77: 414-422.

11) Ozden N, Akaltan F, Suzer S, Akovali G. Time related wettability characteristic of acrylic resin surfaces treated by glow discharge. J Prosthet Dent 1999; 82: 680-684.

12) Shibata Y, Hosaka M, Kawai H, Miyazaki T. Glow discharge plasma treatment of titanium plates enhances adhesion of osteoblast-like cells to the plates through the integrin-mediated mechanism. Int J Oral Maxillofac Implants 2002; 17: 771–777.

13) Kawai H, Shibata Y, Miyazaki T. Glow discharge plasma pretreatment enhances osteoclast differentiation and survival on titanium plates. Biomaterials 2004; 25: 1805–1811.

14) Yamamoto H, Shibata Y, Miyazaki T. Anode glow discharge plasma treatment of titanium plates facilitates adsorption of extracellular matrix proteins to the plates. J Dent Res 2005; 84: 668-671.

15) Alves CM, Yang Y, Carnes DL, Ong JL, Sylvia VL, Deanc DD, Agrawal CM, Reis RL. Modulating bone cells response onto starch-based biomaterials by surface plasma treatment and protein adsorption Biomaterials 2007; 28: 307–315.

16) Kingshott P, Thissen H, Griesser HJ. Effects of cloud-point grafting, chain length, and densityof PEG layers on competitive adsorption of ocular proteins. Biomaterials 2002; 23: 2043–2056.

17) Nelea V, Luo L, Demers CN, Antoniou J, Petit A, Lerouge S, Wertheimer MR, Mwale F. Selective inhibition of type X collagen expression in human mesenchymal stem cell differentiation on polymer substrates surface-modified by glow discharge plasma. J Biomed Mater Res 2005; 75A: 216–223.

18) Nelson A, Muir BW, Oldham J, Fong C, McLean KM, Hartley PG, Øiseth SK, James M. X-Ray and neutron reflectometry study of glow-discharge plasma polymer films. Langmuir 2006; 22: 453-458.

19) Stine R, Cole CL, Ainslie KM, Mulvaney SP, Whitman LJ. Formation of primary amines on silicon nitride surfaces: a direct, plasma-based pathway to functionalization. Langmuir 2007; 23: 4400-4404.

20) Ulrich KH . A micromethod of deipidation of aqeous proteins. Analytical Biochemistry ,1993; 210:318-327 21) Sul YT. Oxidized titanium screws coated with calcium ions and their performance in rabbit bone . Int J Oral Maxillofac

Implants 2002 ; 17 : 625-63422) Feng B, Weng J, Yang BC, Qu SX, Zhang XD. Characterization of titanium surfaces with calcium and phosphate and

osteoblast adhesion. Biomaterials 2004; 25: 3421-3428.

133


23) Kassem M, Rungby J, Mosekilde L, Eriksen EF. Ultrastructure of human osteoblasts and associated matrix in culture. APMIS 1992; 100: 490-497.

24) Bonewald LF, Kester MB, Schwartz Z, Swain LD, Khare A, Johnson TL, Leach RJ, Boyan BD. Effects of combining transforming growth factor beta and 1,25-dihydroxyvitamin D3 on differentiation of a human osteosarcoma (MG-63). J Biol Chem 1992; 267: 8943-8949.

25) Ringbom-Anderson T, Jantti J, Akerman KE. Production and release of matrix vesicles in the cell processes of TPA-treated human osteoblast-like cells. J Bone Miner Res 1994; 9: 661-670.

134


16. THE EFFICACY OF LIME CALCIUM HYDROXIDE FROM LOCAL PRODUCT TOWARDS ENTEROCOCCUS FAECALIS

Hilmanda, Wazillah Nasserie, Mieke Hemiawati Satari

Objective :To determine The Minimum Inhibitory Concentration (MIC), and the exposure time of local calcium hydroxide and MERCK’s calcium hydroxide used as a control towards pure isolate of Enterococcus faecalis from Microbiology Laboratory of Bogor Agricultural University and Dept. of Soil Science Faculty of Agriculture Padjadjaran University.Methods:This is an experimental study based on a twofold serial dilution method. Both of calcium hydroxide was diluted from 50%, 25%, 12.5%, 6.25%, 3.13%, 1.56%, 0.78%, 0.39%, 0.19%, and 0.10% concentration in 1 minute, 15 minutes, 1 hour, 12 hours, and 24 hours exposure time.Results :Local calcium hydroxide solution could inhibit the growth of Enterococcus faecalis at a concentration of 0.19% and MERCK’s calcium hydroxide solution on 0.39% concentration. The efficacy of both calcium hydroxide to reduce the growth of E. faecalis were in more than 1 hour exposure time.Conclusion:The local calcium hydroxide has lesser MIC than MERCK’s calcium hydroxide used as control, so the local calcium hydroxide is more effective to inhibit the growth of Enterococcus faecalis.

INTRODUCTION

Use of calcium hydroxide dressing is often used for root canal that can be used on vital and non vital teeth, especially teeth with periapical lesions. Calcium hydroxide plays a role in endodontic treatment because it has a good antimicrobial effects, can stimulate the formation of hard tissue, and can dissolve organic tissue.1

E. faecalis found as a dominant bacteria on failed endodotic treatment at one-third root canal with periapical lesion.2 Study conducted by Röças (2004) showed E. faecalis found in root canal on failed endodontic treatment nine times higher before treated.3

Research conducted by Evans et al (2002) showed that the antibacterial power of calcium hydroxide against E. faecalis under high pH activity.4 In research conducted by Estrela (2003), calcium hydroxide is effective in killing E. faecalis after 72 hours and can eliminate dentine infection caused by bacteria.5

Hydroxyl ion as a result from Ca(OH)2 dissociation causing damage to cytoplasmic membran bacteria by lipid peroxidation that destroy phospolipid as a cell membrane structure leads bacteria to lysis.6,7

Calcium hydroxide is commonly used as dental materials in general are still coming from overseas. Endodontics division in RSGM Padjadjaran University still using calcium hydroxide from the German pharmaceutical company Merck. Manufacturer (Brataco) of chemicals in Indonesia actually already produced calcium hydroxide locally originated from Tuban, East Java- Inodnesia at a price relatively cheaper and easy to get but has never been tested.

Based on that, in order to obtain evidence, scientific research must be done on the antibacterial power of calcium hydroxide from local producers (local Ca(OH)2) and calcium hydroxide-German Merck brand (branded Ca(OH)2) as a control against E. faecalis that play a role in secondary infection of endodontic treatment

METHODSThis experimental study on pure isolate of E. faecalis from Microbiology Laboratory of Bogor Agricultural University (IPB) and Dept. of Soil Science Faculty of Agriculture Padjadjaran University

135


(Unpad) was conducted in The Microbiology Laboratory of The Faculty of Dentistry Padjadjaran University.

Based on a twofold serial dilution method, local Ca(OH)2 and branded Ca(OH)2 diluted from standard solution (1,2:1 ratio) to 50%, 25%, 12.5%, 6.25%, 3.13%, 1.56%, 0.78%, 0.39%, 0.19% and 0.10% [Table 1]. The purpose of this test is to obtain the Minimum Inhibitory Concentration (MIC) from local Ca(OH)2 and branded Ca(OH)2.. [Picture 1]

4 ml standard solution calcium hydroxide (100%)

2 ml 2 ml 2 ml 2 ml 2 ml 2 ml 2 ml 2 ml 2 ml 2 ml 2 ml 2 ml

0 1 2 3 4 5 6 7 8 9 10 NC PC

Bulyon 2 ml

E. faecalis suspension 0,1 mlPicture 1. Serial dilution Calcium hydroxide

136

Volume 1 | Number 1 |August 2010Table 1. Serial Dilution of Ca(OH)2

Number

Bulyon

(ml)Ca(OH)2

Concentration (%)

E. faecalis suspension equals to Mc Farhland 0,5 (ml)

0

1

2

3

4

5

6

7

8

9

10

11

12

-

2

2

2

2

2

2

2

2

2

2

-

2

4 ml dari larutan baku

2 ml dari tabung 1

2 ml dari tabung 2

2 ml dari tabung 3

2 ml dari tabung 4

2 ml dari tabung 5

2 ml dari tabung 6

2 ml dari tabung 7

2 ml dari tabung 8

2 ml dari tabung 9

2 ml dari tabung 10

2 ml dari tabung 11

-

100

50

25

12,5

6,25

3,13

1,56

0,78

0,39

0,19

0,10

NCa

PCb

0,1

0,1

0,1

0,1

0,1

0,1

0,1

0,1

0,1

0,1

0,1

-

0,1

*a: Negative control *b: Positive control

After both of Ca(OH)2 MIC has obtained, exposure time test is conducted to found out effective contact time with 1 minute, 15 minutes, 1 hour, 12 hours, and 24 hours testing time.

RESULTSThe result showed local Ca(OH)2 inhibits E. faecalis 0,19% in concentration while branded Ca(OH)2

0,39% in concentration. [Table 2] Table 2. Dilution test of local Ca(OH)2 and branded Ca(OH)2 towards E.,faecalis (IPB and Unpad)

Concentration

Local Ca(OH)2 Branded Ca(OH)2

Sample 1a Sample 2b Sample 1a Sample 2b

1 2 3 1 2 3 1 2 3 1 2 3

50% - - - - - - - - - - - -

25% - - - - - - - - - - - -

12.5% - - - - - - - - - - - -

6.25% - - - - - - - - - - - -

3.13% - - - - - - - - - - - -

137


1.56% - - - - - - - - - - - -

0.78% - - - - - - - - - - - -

0.39% - - - - - - - - - - - -

0.19% - - - - + - + + + + + +

0.10% + + + + + + + + + + + +

NCc - - - - - - - - - - - -

PCd + + + + + + + + + + + +

*a: E. faecalis IPB *b: E. faecalis Unpad

*+: positive growth of bacteria *-: negative growth of bacteria

*c : negative control *d: positive control

On table 2 we can see that local Ca(OH)2 inhibits E.faecalis growth from 0,19%. First repetition on sample 2 at 0,19% shows the positive growth of E.faecalis, but at large this condition is not to be likely the first repetition of the second sample still showed a growth of colonies of E. faecalis, but the concentrations generally showed no growth, which means that the concentration of calcium hydroxide could inhibit the growth of E. faecalis.

At a concentration of calcium hydroxide which resulted in colonies of E. faecalis did not grow up was concentrations of 0.39%, 0.78%, 1.56%, 3.13%, 6.25%, 12.5%, 25%, and 50%. E. faecalis which grew was on the concentration of local Ca(OH)2 0.10% and the concentration of branded Ca(OH)2 0.19% and 0.10%

The lowest effective concentrations (MIC) from both Ca(OH)2 that can inhibits the grow of E.faecalis based on dilution test, was retest to found out effective contact time with 1 minute, 15 minutes, 1 hour, 12 hours, and 24 hours testing time. Test results of the contact time of both Ca(OH)2 with a concentration of 0.19% and 0.39% at time 1 minute, 15 minutes, 1 hour, 12 hours, and 24 hours showed a significant reduction in bacterial growth from time to time. [Table 3]Table 3. Exposure time of both Ca(OH)2 towards E.faecalis(IPB and Unpad)

*a: E. faecalis BAU *b: E. faecalis Unpad

*c: MIC local Ca(OH)2 *d: MIC branded Ca(OH)2

*+: positive growth of bacteria *-: negative growth of bacteria

138

Sample Replication Concentration Exposure time1 min 15 mins 1 hr 12 hrs 24 hrs

1a

123

0.19%c+ + + - -+ + + - -+ + + - -

123

0.39%d+ + + - -+ + + - -+ + + - -

2b

123

0.19%c+ + + - -+ + + - -+ + + - -

123

0.39%d+ + + - -+ + + - -+ + + - -


Tests show that at concentrations of 0.19% local Ca(OH)2 could inhibit E.faecalis with effective contact time over one hour and branded Ca(OH)2 at concentrations of 0.39% could inhibit E.faecalis with effective contact time over one hour.

DISCUSSION

Based on the observation at endodontic clinic RSGM Unpad, the price of calcium hydroxide as an intracanal dressing on endodontic treatment in Indonesia is relatively expensive, because it was imported.

Calcium hydroxide is used as the material for this study was a domestic product. This calcium hydroxide has several differences when compared with calcium hydroxide originating from abroad, which has darker color and powdered consistency with different pH values at the same concentration.

MIC testing performed on both calcium hydroxides, because this research aims to find a MIC of local Ca(OH)2 which has never been used by the field of dentistry, while branded Ca(OH)2 which already has a standard usage as materials used in dental treatment as a control.

MIC test results on the concentration of calcium hydroxide A 50%, 25%, 12.5%, 6.25%, 3.13%, 1.56%, 0.78%, 0.39%, 0.19%, and 0.10%, showed that growth of E. faecalis was at a concentration of 0.10% (Table 2). On the table there was a positive result the second sample concentration of 0.19% of the first replication. These differences in results can occur among replicate testing process: this is due to, among others, by way of investment in the sector Blood Agar, bacterial turbidity standard test, the volume of solution when planting sector, and facultative anaerobic atmosphere during incubation.

Based on Table 2 it can be said that local Ca(OH)2 has better antibacterial effect compared with branded Ca(OH)2 against E. faecalis because branded Ca(OH)2 in concentration of 0.19% was still found the growth of bacteria while in local Ca(OH)2 bacterial growth only has found at a concentration of 0.10%, so the concentration of 0.19% local Ca(OH)2 set as the minimum inhibitory concentration (MIC).

After testing the MIC, Exposure time test was conducted with the aim of obtaining an effective time to determine the contact time on inhibit growth of E. faecalis. Testing time begins from the first minutes of contact; this is done to determine effective contact time as early as possible.

Both Ca(OH)2 at their own MIC gives the same effect on the contact time of 1 minute, 15 minutes and one hour, with the found growth of E. faecalis, while the contact time of 12 hours and 24 hours was not found in the growth of E. faecalis.

CONCLUSION

This study shows that both of calcium hydroxide could inhibit the growth of E.faecalis effectively in more than one hour exposure time. Local Calcium hydroxide has lesser MIC than branded Calcium hydroxide. However, further studies is needed towards E.faecalis isolated from periapical lesion to obtain more effective antibacterial effect from local calcium hydroxide and in vivo study about local Calcium hydroxide use as a dressing in root canal.

139


REFERENCES

1. Yanti, N. 2001. Penggunaaan Kalsium Hidroksida Sebagai Bahan Dressing Saluran Akar. Dent Maj Ilm Kedokt Gigi Universitas Sum Utara. 6,1, 24-30.

2. Hancock HH, Sigurdsson A, Trope M, Moiseiwitsch J. 2001. Bacteria Isolated After Unsuccessful Endodontic Treatment In A North American Population. Oral Surg Oral Med Oral Pathol 91:579–586.

3. Röças, Isabela N; Siquera, Josē F; Santos, Katia RN. 2004. Assosiation of Enterococcus faecalis with different forms of periradicular disease. Int Endod J 2004; 30 (5); 315-320.

4. Evans M, Davies JK, Sundqvist G, Figdor D. 2002. Mechanisms Involved In The Resistance Of Enterococcus Faecalis To Calcium Hydroxide. Int Endod J 35:221–228.

5. Estrela, C., C.R.A., Estrela, J.D. Pecora. 2003. A Study of The Time Necessary for Calcium Hydroxide to Eliminate Microorganisms in Infected Canals. J Appl Oral Sci. 11, 2, 133-137.

6. Byström A, Claesson R, Sundqvist G.1985. The antibacterial effect of camphorated paramonochlorophenol, camphorated phenol and calcium hydroxide in the treatment of infected root canals. Endo Dent Trauma 1:170–175.

7. Siqueira, J.F., I. Rocas, A. Favieri, et all. 2000. Chemomechanical Reduction of The Bacterial Population in the Root Canal after Instrumentation and Irrigation with 1%. 2,5%, and 5% Sodium Hypochlorite. J. Endod. 26, 6, 331-334.

140

asia pacific dental students journal

Documents