argonaute 2 is required for extra-embryonic endoderm ... · supplemental information argonaute 2 is...

Stem Cell Reports, Volume 10

Supplemental Information

Argonaute 2 Is Required for Extra-embryonic Endoderm Differentiation

of Mouse Embryonic Stem Cells

Richard Patryk Ngondo, Daniel Cirera-Salinas, Jian Yu, Harry Wischnewski, MaximeBodak, Sandrine Vandormael-Pournin, Anna Geiselmann, Rahel Wettstein, JaninaLuitz, Michel Cohen-Tannoudji, and Constance Ciaudo

1

SUPPLEMENTAL INFORMATION FILE

ARGONAUTE 2 IS REQUIRED FOR EXTRA-EMBRYONIC ENDODERM DIFFERENTIATION

OF MOUSE EMBRYONIC STEM CELLS.

Richard Patryk Ngondo1, £, Daniel Cirera-Salinas1, £, Jian Yu1, 2, Harry Wischnewski1, Maxime

Bodak1, 2, Sandrine Vandormael-Pournin3, Anna Geiselmann3, Rahel Wettstein1, 2, Janina

Luitz1, Michel Cohen-Tannoudji3 and Constance Ciaudo1*.

1 Swiss Federal Institute of Technology Zurich, IMHS, Chair of RNAi and Genome Integrity, Zurich, Switzerland. 2Life Science Zurich Graduate School, University of Zürich, Switzerland. 3 Institut Pasteur, CNRS, Unité de Génétique Fonctionnelle de la Souris, UMR 3738, Department of

Developmental & Stem Cell Biology, 25 rue du docteur Roux, F-75015 Paris Cedex.

£ These authors contribute equally to this work

* Correspondence: [email protected]

2

SUPPLEMENTAL FIGURES AND LEGENDS

Figure S1. Related to Figure 1. Characterization of Ago1 and Ago2 knockout mESCs and impact on gene

expression. (A) Schematic representation of the CRISPR/CAS9 mediated Ago1 knockout strategy. Two

independent clones (Ago1_KO1 and Ago1_KO2) were generated by deleting the exon 1 of the Ago1 gene using

two pairs of guide RNAs (in green and red). The lower panel shows a representative picture of the wildtype

mESCs (WT) and the two Ago1_KO clones. (B) Western Blot showing the AGO2, AGO1, and OCT4 protein levels

in WT, Ago2_KO, and Ago1_KO mESCs. TUBULIN is used as loading control. (C) Relative expression of Ago1 and

Ago2 mRNAs in WT, Ago2_KO1, Ago2_KO2, Ago1_KO1, and Ago1_KO2 mESCs, measured by RT-qPCR. The

error bars show the standard deviation of three independent experiments. (D) Heatmap depicting the

expression of highly expressed miRNA families in mESCs. Stem cell miRNA clusters regulating cell cycle in

black (miR-290-295; miR-301-367; miR-17-92b; miR-106a-363; miR-106b-25) and other highly expressed

clusters in purple (miR-200b-429; miR-200c-141; miR-183-182) are represented. The expression of miRNAs

is normalized to the library size and is represented in CPTM (Count Per Ten Million) as the mean of two

replicates (expect for Dicer_KO). (E) Northern blot analysis of miRNAs from group 1 and group 2 in WT,

Ago2_KO1, Ago2_KO2, Ago1_KO1, Ago1_KO2, and Dicer_KO mESCs. U6 signal is used as loading control. (F)

Heatmap depicting the significantly differentially expressed genes (DEGs) in Ago2_KO compared to WT

mESCs. The two replicates are represented for each condition. The expression levels are represented as RPKM

values (reads per kilobase of transcript per million reads mapped).

3

Figure S2. Related to Figure 2. Embryoid body (EB) differentiation of Ago1_KO mESCs and definitive

endoderm differentiation of Ago2_KO and WT mESCs. (A) Relative gene expression of definitive endoderm

(Claudin6, Cxcr4, Foxa1) markers in WT, Ago2_KO, and Ago1_KO mESCs during EB differentiation measured by

RT-qPCR. The levels at day 6 (d6) and day 10 (d10) are represented relative to the WT cells at day 0 (d0). The

error bars represent the standard deviation of three biological replicates. (B) Scheme of the DE differentiation

protocol (Gouon-Evans et al., 2006). (C) Representative experiment of flow cytometry analysis of the

expression of c-Kit and CXCR4 DE markers after 4 days of DE differentiation of WT, Ago2_KO1, and Ago2_KO2

cells. (D) Summary analysis of three replicate experiments. The error bars show the standard deviation of

three independent experiments. The fraction of gated CXCR4+ c-KIT+ cells and CXCR4- c-KIT +/- cells are

represented. Multiple comparison statistical analysis (One-way ANOVA) shows no significant difference

between WT, Ago2_KO1, and Ago2_KO2 samples. (E) Immunofluorescence staining of EB sections after 10

days of differentiation of WT, Ago1_KO1, and Ago1_KO2 cells. The fluorescence signal of three different

sections is shown for each of the following proteins: NANOG, GATA6, SOX17, GATA4, and DAB2. The nuclei are

stained with DAPI. The scale bar corresponds to 50μm. (F) Relative gene expression of ExEn and DE markers

(Gata6, Gata4, Dab2, Foxa2) in WT, Ago1_KO1, and Ago1_KO2 mESCs during EB differentiation measured by

RT-qPCR. The levels at day 6 (d6) and day 10 (d10) are represented relative to the WT cells at day 0 (d0). The

error bars represent the standard deviation of three biological replicates.

4

Figure S3. Related to Figure 3. Ago2_KO mESC contribution to embryonic tissues and Ago2_KO-GFP

chimera generation. (A) Flow cytometry analysis of AGO2 expression in WT and Ago2_KO mESCs. The cells

have been fixed, permeabilized and labeled with AGO2 primary (WAKO) antibody followed by Alexa Fluor 488

anti-mouse secondary antibody. Unstained control was used to set up gating. (B) Flow cytometry analysis of

GFP expression in Ago2_KO and WT mESCs stably transfected with a GFP expressing plasmid, including

positive (cells expressing GFP) and negative (cells not expressing GFP) controls. (C) Simple Sequence Length

Polymorphism PCR genotyping on DNA extracted from tissues derived from WT and Ago2_KO chimera. The

contribution of the cells to the three embryonic germ layer derived-tissues in adult mice was assessed

following D2mit206, D2mit102, D9mit269, D19mit19, and D18mit184 microsatellite lengths. WT and Ago2_KO2

mESCs (129/Ola strain) were injected into recipient blastocysts (C57BL/6N strain). DNA from 129/Ola and

C57BL/6N strains are used as control. The pictures of the chimera used for genotyping is presented on the

right side. (D) The contribution of Ago2_KO1 mESCs (129/Ola strain) injected into blastocysts (C57BL/6

strain) to the three embryonic germ layer derived-tissues in adult mice was assessed by following D9mit19

and D9mit184 microsatellites as well as the Ago2 exon 5-10 deletion (Ago2_KO∆Ex5-10). Organs derived from

wild-type C57BL/6 mice were used as negative controls. The pictures of the genotyped mice are presented

below. (E) Pictures of two chimeric mice generated after injection of Ago2_KO-GFP mESCs into C57BL/6

recipient blastocysts. (F) SSLP PCR genotyping of microsatellite D19mit19 length in various tissues from WT-

GFP and Ago2_KO-GFP chimeras. DNA from 129P2/Ola (WT mESCs) and C57BL6 mice (Recipient blastocysts)

are used as controls for the microsatellite length. All the lanes come from the same original gel picture. One

organ representative from every germ layer is shown as an example. (G) Flow cytometry analysis of immune

cells markers (CD45 and CD11b), definitive endoderm marker (FOXA2), and CXCR4 expression in spleen and

pancreatic cells derived from WT C57BL/6 mice. Representative plots show 99,1% of CD45+ CD11b-/ CD45+

CD11b+ cells in the spleen, which do not express FOXA2. 10% of the pancreatic cells express CXCR4+ FOXA2+

but are CD45- CD11b-, indicating that CXCR4 in combination with FOXA2 are exclusive markers for definitive

endoderm.

5

Figure S4. Related to Figure 4. Ago2_KO cells express an impaired gene expression program during

cXEN conversion. (A) Relative gene expression of Ago1 and Ago2 during 9 days of WT and Ago2_KO cell

differentiation toward ExEn, measured by RT-qPCR. The error bars represent the standard deviation of three

biological replicates. The expression is calculated relative to Rrm2 housekeeping gene levels. (B) Western blot

analysis of BMI1 and AGO2 levels in WT and Ago2_KO1 cells before and after cXEN conversion. TUBULIN is

used as loading control. (C) ChIP-qPCR experiments on Gata6, Gata4, Sox17, and Foxa2 promoters before and

after 5 days of cXEN conversion in WT (blue/light blue) and Ago2_KO (Red/light red) cells. As schematically

depicted, three primer pairs were used per promoter region. ChIPs were performed with SUZ12 (PRC2

complex), RING1B (PRC1 complex), H3K27me3 (repressive mark), and H3K27ac (activation mark) antibodies.

Rabbit IgG were used as ChIP specificity control. The enrichment was calculated compare to a repressed Cdx2

promoter (for SUZ12, RING1B, and H3K27me3) and compare to an active Smad3 promoter (for H3K27ac). An

intergenic region is used as a control. The error bars correspond to the standard deviation of three

independent experiments. (D) Table showing miRNAs with validated or predicted binding sites in Gata6

3’UTR (Bhushan et al., 2013; Fantini et al., 2017; Ji et al., 2009; Kim et al., 2015; Liang et al., 2014; Liu et al.,

2008; Tsuji et al., 2014; Zeng et al., 2009).

6

Figure S5. Related to Figure 5. Transcriptome of cXEN converted Ago2_KO cells.

(A) Heatmap depicting the expression of the most expressed miRNAs after cXEN conversion of WT and

Ago2_KO mESCs. The expression levels are represented for two replicates as CPTM (count per Ten million).

(B) Heatmaps depicting the expression of different group of genes: epithelial, mesenchymal, ectodermal,

mesodermal, tropho-ectodermal, pluripotency, and ExEn markers in Ago2_KO mESCs compared to WT cells

after 5 days of cXEN conversion. Two replicates are represented for each condition before (mESC) and after

differentiation (cXEN). Publicly available data of EB conversion after 12 day were used as reference for the

differentiation markers expression (GEO: GSE52899 (Yang et al., 2014)). The expression levels are

represented as RPKM values (reads per kilobase of transcript per million reads mapped). (C) Heatmap

depicting the differences in the expression of genes related to major signaling pathways in WT and Ago2_KO

after cXEN conversion. The gene list was extracted from KEGG database (Hedgehog, WNT, TGF-beta, RAS,

PI3K-AKT, JAK-STAT, MAPK, and pluripotency). The expression levels are represented as RPKM values (reads

per kilobase of transcript per million reads mapped).

7

Figure S6. Related to Figure 6. The MAPK pathway and GATA6 over-expression in mESCs before and

during cXEN conversion. (A) Immunofluorescence staining of WT-GFP/Ago2_KO co-cultured cells after 5

days of cXEN differentiation. Three representative images of the immunofluorescence signals of GFP and

FOXA2 on co-stained sample are shown. Nuclei are stained with DAPI. cXEN differentiated Ago2_KO cells alone

are shown as negative control. The scale bar corresponds to 50μm. (B) Relative expression of ExEn and DE

markers (Gata4, Dab2, and Foxa2) measured by RT-qPCR in WT and Ago2_KO mESCs and after 5 days of cXEN

conversion in the presence 500ng/mL of FGF4 growth factor + 1μg/mL heparin. The levels of the markers are

represented relatively to the levels in WT cells before conversion. The error bars represent the standard

deviation of three independent experiments. (C) Representative pictures of WT and Ago2_KO mESCs after

cXEN conversion in the presence of 500ng/mL of FGF4 + 1μg/mL heparin. cXEN colonies are indicated with

white dashed line. (D) Relative expression of Fgfr2, Fgf4, and Nanog mRNAs measured by RT-qPCR in WT and

Ago2_KO mESCs, and after 5 days of cXEN conversion. The levels of the markers are represented relatively to

the levels in WT cells before conversion. The error bars represent the standard deviation of three independent

experiments. (E) WT and Ago2_KO mESCs were treated with two FGFR inhibitors (PD173074 and AZD4547),

MEK inhibitor (PD0325901), and FGF4 growth factor + heparin in standard mESC culture conditions. A

representative western blot showing the levels of pERK, ERK, and NANOG proteins after 2 days of treatment.

TUBULIN levels or coomassie staining of the membrane is shown as loading control. (F) WT and Ago2_KO

mESCs were converted to cXEN in the presence of FGFR inhibitors (0.1μM PD173074 and 1μM AZD4547),

MEK inhibitor (2μM PD0325901), and 500ng/mL of FGF4 growth factor + 1μg/mL heparin. Levels of GATA6

and NANOG in the different conditions after conversion are shown. TUBULIN levels are shown as loading

control. Undifferentiated cells (ES) and DMSO treated cells are used as controls. (G) Representative pictures of

WT-GATA6 and Ago2_KO1-GATA6 with (+dox) or without (-dox) doxycycline treatment after 3 days in mESC

culture medium containing LIF and serum.

8

Figure S7. Related to Figure 7. Overexpression of AGO1 in Ago2_KO mESCs during XEN conversion. (A)

Western blot showing the over-expression of AGO1 in two Ago2_KO-AGO1-A and B clones before and after

doxycycline induction. A higher exposure of AGO1 western blot is shown. TUBULIN levels are used as loading

control. (B) Scatter-plots representing the miRNA levels (CPTM) in Ago2_KO-AGO1 mESCs before (blue) or

after doxycycline induction (red) compared to levels in Ago2_KO cells (black). The mean value of two

replicates is represented. Two abundant miRNAs from group 1 (miR-295-5p) and group 2 (miR-298-3p) are

highlighted in green and yellow respectively. (C) Relative expression of miRNAs from group 1 and group 2 in

Ago2_KO-AGO1-A cells before and after 5 days of dox, measured by RT-qPCR. The error bars correspond to the

standard deviation of three independent experiments. (D) Heatmap depicting the expression of selected

miRNAs from group 1 and group 2 in WT, Ago2_KO, Ago2_KO-AGO1 mESCs (before and after 5 days of

doxycycline treatment). The expression of miRNAs is normalized to the library size and is represented in

CPTM (Count Per Ten Million) as the mean of two replicates. (E) Relative expression of genes up-regulated in

Ago2_KO mESCs (potential miRNA targets, Figure 1H) measured in WT, Ago2_KO, Ago2_KO-CATmut,

Ago2_KO-RNAmut and Ago2_KO-AGO1 complemented mESCs. The error bars show the standard deviation of

three independent experiments.

9

SUPPLEMENTAL EXPERIMENTAL PROCEDURES

mESC culture, transfections and stable cell line selection.

WT E14 mESC line (129/Ola background) was cultured in Dulbecco’s Modified Eagle Media (DMEM) (Sigma-

Aldrich), containing 15% of fetal bovine serum (FBS; Life Technologies) tested for optimal growth of mESCs,

100 U/mL LIF (Millipore), 0.1 mM 2-ß-mercaptoethanol (Life Technologies) and 1% Penicillin/Streptomycin

(Gibco), on 0.2% gelatin-coated support in absence of feeder cells. The culture medium was changed daily. All

cells were grown at 37°C in 8% CO2. If required, the medium was supplemented with 1 µg/mL of doxycycline,

2µM of PD0325901, 0.1µM of PD173074, 1µM AZD4547 or 500ng/mL FGF4 + 1µg/mL heparin.

All the transfections were performed using the lipofectamine 2000 reagent (Life technologies) according to

manufacturer instructions. Stable clones of mESCs were selected with 2µg/mL of puromycin. The expression

of the transgene was induced by the addition of 1µg/mL of doxycycline. The Ago2_KO2-GFP and WT-GFP cells

were obtained stably transfecting the empty pMSCV PIG plasmid, a polyclonal population of cells was selected

after 2 weeks of puromycin selection. Cells have been sorted by FACs to select only GFP expressing cells. For

the rescue experiments, inducible monoclonal stable cell lines were generated from Ago2_KO1 cells using the

pCW57.1_GATA6, pCW57.1_3xHA-AGO2, pCW57.1_3xHA-AGO2_RNAmut, pCW57.1_3xHA-AGO2_CATmut, and

pCW57.1_AGO1 plasmids. All the plasmids are available in Addgene repository and listed below.

CRISPR/CAS9 mediated gene knockout

The Ago2_KO and Ago1_KO cell lines were generated using a paired CRISPR/CAS9 strategy on WT mESCs as

described previously (Wettstein et al., 2016).

We generated two independent clones per knockout line (Ago2_KO1, Ago2_KO2, Ago1_KO1, and Ago1_KO2)

using two different pairs of gRNAs to delete one or more exons of the gene. Briefly, E14 mESCs were

transfected with pX330-sgRNA_Ago2_1/2, pX458-sgRNA_Ago2_3/4, pX458-sgRNA_Ago1_1/2, or pX458-

sgRNA_Ago1_3/4 plasmids. After 48 hours, the GFP positive cells were single cell sorted in 96 cell plates. The

deletion was genotyped by PCR using primers listed in the supplementary information. All the plasmids are

available in Addgene repository. Positive clones were expanded and verified by Western Blot and RT-qPCR.

The Dicer_KO clones were generated as described in (Bodak et al., 2017).

10

Embryoid body (EB) differentiation

The differentiation was performed in standard mESC medium (as described above) without LIF and with 10%

of fetal bovine serum (Kurosawa, 2007). The EBs were obtained by culturing the cells in suspension for 6 days

in non-tissue culture treated dishes to prevent attachment. After 6 days the EBs were either left in suspension

(Figure 2D) or plated on 0.2 % gelatin-coated culture-treated dishes for 4 additional days (Figures 2A, 2B,

and 2C).

cXEN conversion of mESCs

The cXEN conversion was performed as described in (Niakan et al., 2013). Briefly, mESCs were plated at a

density of 1x104 cells per cm2 on gelatin-coated plates and cultured for 5 days in RPMI 1640 supplemented

with 15% FBS, 1% Penicillin/Streptomycin, 0.1 mM 2-ß-mercaptoethanol, 0.1µM all-trans retinoic acid and

10ng/mL Activin A. All the downstream analysis was performed on the bulk population of cells. If required,

the cXEN differentiation medium was supplemented with 1 µg/mL of doxycycline, 2µM of PD0325901, 0.1µM

of PD173074, 1µM AZD4547, or 500ng/mL FGF4 + 1µg/mL heparin.

mRNA and miRNA expression analysis

The total RNA from 1-10 million of cells was extracted using TRIzol reagent (Life technologies) following the

manufacturer protocol. The reverse transcription was performed using the GoScriptTM (Promega) or the

miScript II RT Kit (Qiagen) according to the manufacturer recommendations. The qPCR was performed on a

LightCycler® 480 instrument (Roche) using the KAPA SYBR® FAST qPCR kit (Kapa Biosystems) or the

miScript SYBR Green PCR kit (Qiagen). The analysis was made using the ∆∆CT method for both mRNA and

miRNA using respectively Rrm2 or U6 as normalizer genes. The primers are listed in the supplementary

information.

Northern Blot analysis

The RNA was extracted from 10 million of cells using TRIzol reagent (Life technologies) according to the

manufacturer’s instructions. The total RNA (20-40μg) was re-suspended in 50% formamide, heated at 95 °C

11

for 5 min and loaded on a 17.5% Acrylamide/Bis 19:1, 7M Urea denaturing gel. The electrophoresis was

performed in TBE 0.5X buffer at 100V for 3-4h. The samples were transferred on a neutral nylon membrane

Hybond-NX (GE Healthcare), using a Trans-Blot® SD semi-dry transfer devise (Biorad) for 1 h at 100 mA. The

RNAs were chemically cross-linked on the membrane using EDC reagent (Pall and Hamilton, 2008) and

hybridized at 42 °C with the radiolabelled probes overnight using PerfectHybTM Plus Hybridization Buffer

(Sigma). The membrane was washed 3 times with SSC 2X, 0.1% SDS solution at 42 °C and exposed for 5 days

with a phosphor Imaging Plate (Fujifilm) and revealed on a Typhoon FLA 7000 scanner (GE Healthcare). The

DNA oligonucleotide probes (30 pmol) were radiolabelled on their 5’ end using a T4 polynucleotide kinase

and 50 μCi of gamma-[32P]ATP (>3000 Ci/ mmol). The membranes were hybridized multiple times with

different probes after stripping (boiling 0.1% SDS) and exposure verification. The oligonucleotide probes used

are listed in the supplementary information.

Cell cycle analysis

About 1 million of cells were harvested, washed twice with ice-cold phosphate-buffered saline (PBS 1X) and

fixed in 70% ethanol (at least 24 hours incubation at -20°C). Cells were washed twice with PBX 1X and stained

with 50 μg/mL propidium iodide (PI) and ribonuclease A at 100 μg/mL (Qiagen - R6148) (to avoid any RNA

contamination) for 1 hour at 37°C protected from light. Cells were analyzed by flow cytometry (LSRFortessa™,

Becton-Dickinson) using selective gating to exclude the doublets of cells and subjected to FLOWJO 7.6.1

software. Percentages of cells in G1, S, and G2/M phases have been calculated using MODFIT analysis (Verity

Software House, Inc.). Cell cycle assays were performed in biological triplicate.

Chimeric mice generation and genotyping

The blastocysts micro-injections were performed at the EPIC transgenic facility (ETH, Zurich). The WT E14,

Ago2_KO1, Ago2_KO2, WT-GFP, and Ago2_KO2-GFP mESCs (129/Ola origin) were injected into the blastocoel

of C57BL/6 derived blastocysts (9 ES cells per blastocyst). WT and Ago2_KO2 cells stably transfected with a

plasmid expressing GFP (pMSCV_PIG) have been selected for their GFP expression by FACS and injected into

C57BL/6 recipient blastocysts to generate chimeric mice (Figures 3A, S3C, S3D, and S3E). For each cell line,

8 injected blastocysts were transferred into each of the two uterine horns of two pseudo-pregnant C57BL/6N

foster

12

mothers. The obtained chimeric pups of both 129/Ola and C57BL6 origin were sacrificed and dissected to

extract ectoderm, mesoderm, and endoderm-derived tissues. The genomic DNA was extracted using the

GenElute kit (Sigma) according to manufacturer protocol and analyzed by PCR using primers specific to the

microsatellites D2mit206, D2mit102, D9mit269, D19mit19, and D18mit184. All experiments were conducted

according to the Swiss law of animal protection and in agreement with the approval of the local institutional

animal care committees (Licences Nr. 106/2013 and ZH123/16). All mice were bred and maintained in

pathogen-free conditions and handled and housed in facilities in accordance with good animal practice as

defined by the Swiss animal welfare.

Cell isolation and histology

Pancreas from chimeric (Ago2_KO-GFP and WT-GFP) and wildtype (C57BL/6) mice were isolated, half of the

tissue was used for FACS analysis and the other half for immunohistochemistry. For the FACS analysis,

pancreatic cells were isolated by collagenase D (2.5mg/ml) plus DNAseI (0.1mg/ml) (all from Sigma)

digestion of the pancreas dissolved in 3 ml Hank’s Balanced Salt Solution (HBSS) (Sigma) during 30 min at

37°C with agitation (700rpm). Digestion was stopped with cold HBSS and cell suspension was strained with a

70μm cell strainer (BD Falcon). Cells were fixed with 4% paraformaldehyde and then harsh permeabilized

with 90% methanol. Cells were resuspended in PBS 1X containing 5% FBS and the primary antibody for 20

minutes at room temperature. The cells were then washed twice with PBS 1X containing 5% FBS and

incubated with the secondary antibodies for 20 min at room temperature. Each sample was then washed and

resuspended in 1ml of PBS 1X and analyzed by flow cytometry (LSRFortessa, BD) using selective gating to

exclude the doublets and cell debris. The antibodies and dilution used for the study are: anti-mouse CXCR4-

biotin (BD Biosciences, 551968, dilution 1:200), anti-mouse FOXA2-PE (BD Biosciences, 561589, dilution

1:200), anti-CD45-BV785 (103149, BioLegend, 1:1000), anti-CD11b-PerCP-Cyc5.5 (101228, BioLegend,

1:1000) and secondary (Streptavidin-APC-Cy7, BD Biosciences, 554063, dilution 1:200). Zombie Aqua BV510

(423101, BioLegend, dilution 1:400) dye has been used to exclude dead cells. Representative plots of three

independent experiments are shown.

13

For immunofluorescent screening, pancreas were embedded in Tissue-tek cryomatrix until small container is

full (Sakura, Japan) and stored at -80°C. Cryo-sections (10μm) of mouse pancreas were prepared using a

Reichert 2800 Frigocut cryostat (Reichert Scientific Instruments) and air dried for 30 min. Slides were washed

twice with PBS 1X containing 0.5% Triton X-100 (0.5% PBT). Next, slides were blocked and permeabilized for

1 hour at room temperature by incubating with blocking buffer (10% goat serum in 0.5% PBT). Primary

antibody 1:1000 was incubated in blocking buffer over night at 4°C (anti-alpha-AMYLASE, D55H10, Cell

Signaling 3796; anti-INSULIN, Sigma i8510; anti-GFP Abcam 13970). Secondary antibody was incubated

1:1000 in blocking buffer for 2 hours at room temperature (anti-rabbit-Alexa 546; anti-chicken-Alexa-488;

anti-guineapig-Alexa-546). Then, incubated with 5ug/ml DAPI in PBS 1X for 10 min at room temperature and

washed again twice with PBS 1X. Finally, sections were mounted with 30ul Thermo Scientific Shandon

Immuno-Mount.

Immunodetection of proteins

Immunostaining was performed on fixed EB sections and adherent cells using the following antibodies: DAB2

(1:100, 610464, BD bioscience), GATA4 (1:300, sc-1237, Santa Cruz), GATA6 (1:200, AF1700, R&D Systems),

NANOG (1:200, 14-5761-80, eBioscience), and SOX17 (1:300, AF1924, R&D Systems). GFP (1:500, 7.1&13.1

Roche), FOXA2 (1:500, ab108422, Abcam). Alexa Fluor-conjugated secondary antibodies (Invitrogen) were

used at 1:400.

The western blots were performed using the following antibodies: AGO2 (#2897S, Cell Signaling Technology),

AGO1 (#5053, Cell Signaling Technology), A-TUBULIN (THETM, GenScript), OCT4/3 (611202, BD

Transduction Lab.), FOXA2 (1:500, ab108422, Abcam), NANOG (8822S, Cell Signaling Technology), GATA6

(58515, Cell Signaling Technology), HA (3F10, ROCHE), pERK Tyr204 (SC-7383, Santa Cruz), ERK1/2 (9102,

Cell Signaling Technology), BMI1 (clone F6, 05-637 Millipore). Alpha-TUBULIN levels or the coomassie

staining of the membrane is used as loading controls.

Western blot analysis

The whole cell extracts were obtained by lysing the cells in RIPA buffer (50mM Tris-HCl pH 8, 150mM NaCl,

1mM EDTA, 0.5% sodium deoxycholate, 0.1% sodium dodecyl sulfate and protease inhibitors). If required, the

14

lysis buffer was supplemented with phosphatase inhibitors (2.5mM NaF, 1mM NaPP, 1mM NA3VO4). The

extracts were separated on 8% or 10% SDS-PAGE and transferred on a nitrocellulose membrane. After

blocking (5% milk in TBST: 50 mM Tris-Cl, pH 7.5. 150 mM NaCl, 0.1% Tween20), membranes were incubated

with primary antibodies diluted in blocking solution overnight at 4°C. The antibodies used are: AGO2

(#2897S, Cell Signaling Technology), AGO1 (#5053, Cell Signaling Technology), A-TUBULIN (THETM,

GenScript), OCT4/3 (611202, BD Transduction Lab.), FOXA2 (1:500, ab108422, Abcam), NANOG (8822S, Cell

Signaling Technology), GATA6 (58515, Cell Signaling Technology), HA (3F10, ROCHE), pERK Tyr204 (SC-

7383, Santa Cruz), ERK1/2 (9102, Cell Signaling Technology), BMI1 (clone F6, 05-637 Millipore). A-TUBULIN

levels or the coomassie staining of the membrane are used as loading controls.

Fluorescence microscopy analysis

Immunostaining on Embryoid Body sections: EBs were formed as described above for 10 days in suspension

and fixed overnight in 4% PFA at 4°C, cryoprotected in PBS 1X containing 30% sucrose, embedded in O.C.T.

compound (Tissue-Tek) and sectioned at 12 µm using a cryostat. Sections were first incubated in

permeabilization solution (0.25% Triton X-100 in PBS 1X) for 10 min at RT and then in blocking solution

(10% fetal calf serum, 3% normal donkey serum, 0.1% Triton X-100 in PBS 1X) for 45 min at RT. The

incubation with primary antibodies and fluorochrome-conjugated secondary antibodies was performed in the

blocking solution at 4°C over-night and RT for 45 min respectively. Sections were mounted in Vectashield

(VestorLabs) and images were acquired with an inverted microscope Zeiss Axiovert 200M with a Zeiss

apotome system. Primary antibodies used are: DAB2 (1:100, 610464, BD bioscience), GATA4 (1:300, sc-1237,

Santa Cruz), GATA6 (1:200, AF1700, R&D Systems), NANOG (1:200, 14-5761-80, eBioscience), and SOX17

(1:300, AF1924, R&D Systems). GFP (1:500, 7.1&13.1 Roche), FOXA2 (1:500, ab108422, Abcam). Alexa Fluor-

conjugated secondary antibodies (Invitrogen) were used at 1:400.

Immunostaining on adherent cells: cells were converted to cXEN for 5 days on 0.2% gelatin-coated coverslips

as described above and fixed with 3% PFA for 10 minutes at RT. Samples were permeabilized at RT (0.25%

Triton X-100 in PBS 1X) and blocked 30 minutes at RT (1% BSA, 5% Goat serum in PBS 1X). The incubation

with primary antibodies and fluorochrome-conjugated secondary antibodies was performed in the blocking

solution at 4°C overnight and RT for 45 min respectively. After each incubation, the samples were washed 3

15

times in PBS 1X for 5 minutes. The last wash contained 0.5µg/mL of DAPI. Slides were mounted (Immu-

Mount, Shadon) and analyzed on a Zeiss Axioplan 2 imaging system. Antibodies used are: GFP (1:500,

7.1&13.1 Roche), FOXA2 (1:500, ab108422, Abcam). Secondary antibody: Alexa Fluor 546 anti-rabbit (Life

technologies).

The fluorescence microscopy analysis of the pancreas was performed in non-fixed cryo-sections in order to

prevent inactivation of GFP during fixation. Following pancreas extraction, half of the organ was dissociated

for FACS analysis and the other half used to generate cryo-sections for microscopy analysis as previously

described. Nuclei have been stained with DAPI and the fluorescence analyzed on a Zeiss axio imager

epifluorescence microscope for GFP expression and pancreatic alpha-amylase or insulin. Representative

images were taken.

Definitive endoderm differentiation of mESCs

The definitive endoderm differentiation was performed according to previously published protocol (Gouon-

Evans et al., 2006). Mouse ESCs were cultured at low density (9,000 cells/ml) in Petri dishes (60x15mm,

VWR) to allow embryoid body formation. The serum-free differentiation media used consists of 75% Iscove’s

modified Dulbecco’s medium (IMDM) (Cellgro), 25% Ham’s F12 medium (Cellgro) supplemented with 0.5x of

both N2 and B27 supplements (Gibco-BRL), 1% penicillin/streptomycin, 0,05% bovine serum albumin, 2mM

glutamine (Gibco-BRL), 0.5 mM ascorbic acid (Sigma) and 4.5x10-4 M MTG (Sigma). At day 2 of differentiation,

Activin A (50ng/ml, Peptrotec) was added to the embryoid body cultures to induce endoderm. Two days after

induction, day 4 embryoid bodies were dissociated with trypsin/EDTA (Gibco) (5 min) and the following

populations were isolated by FACs: APC-Cy7-CXCR4-/APC-c-KITlow/high and APC-Cy7-CXCR4+/APC-c-KIThigh.

Frequency of c-KIThigh/CXCR4+ endoderm progenitor fraction was calculated for WT and Ago2_KO mESCs. The

antibodies used for the study are: APC-conjugated anti-mouse c-KIT (BD Biosciences, 553356) and anti-mouse

CXCR4-biotin (BD Biosciences, 551968) and secondary Streptavidin-APC-Cy7 (BD Biosciences, 554063).

mRNA sequencing and data analysis

Total RNA was extracted from 1-10 million of WT (Passages 33 and 42), Ago2_KO1&2 (two

independent Ago2_KO clones), and Dicer_KO1&2 (two independent Dicer_KO clones) mESCs using TRIzol

Reagent (Life

16

Technologies). Up to 2 µg of polyA purified RNA was used of the library preparation using the TruSeq Paired-

end stranded RNA Library Preparation Kit (Illumina) according to the manufacturer recommendations. The

library preparation and sequencing was performed by the FGCZ (Functional Genomic center, Zurich). The

paired-end sequencing generated about 2X60 million of reads per library.

Reads from RNA-seq were first preprocessed by Trimmomatic (v0.32) (Bolger et al., 2014) to remove low-

quality end and adapters. Then, reads were aligned to mouse genome mm10 by STAR (v2.4.2a) (Dobin et al.,

2013) allowing for at most 2 mismatches. featureCount (v1.4.5-p1) (Liao et al., 2013) was used to count reads

for each gene (Ensembl GRCm38.78), ignoring reads on overlapped region. Differentially expressed genes

were defined by both edgeR (v3.12.0) (Robinson et al., 2010) and DESeq2 (v1.10.0) (Love et al., 2014) with

fold change > 2 and FDR (adjusted p-value) < 0.01. Volcano plot was generated using ggplot2 (1.0.1)

(Ginestet, 2011). The read counts were transformed in RPKM for the heatmap representations of specific

genes and pathways. The differentiation markers (embryonic germ-layers, extra-embryonic endoderm)

epithelial, mesenchymal, markers, fibroblast-related genes and signaling pathways were obtained from

literature mining and KEGG database. The processed data are available as excel files (Table S2 and Table S3)

and raw data have been deposited on NCBI GEO database under the accession: GSE78971 and GSE80454.

Cross-linked IP of AGO1/AGO2 bound small-RNAs.

To avoid unspecific association of miRNAs to the AGO proteins after cell lysis (Riley et al., 2012) we cross-

linked proteins and RNAs with formaldehyde. The RNA IP was performed as described in (Selth et al., 2011)

with small modifications. Briefly, WT, Ago1_KO and Ago2_KO mESCs were grown on 10 cm culture plates to

reach 70-80% confluence (3x107 cells). The cells were cross-linked with 1% formaldehyde for 10 minutes and

lysed in 100µL of Lysis buffer (50 mM Tris–HCl pH 8.0, 10 mM EDTA pH 8.0, 1% SDS, protease inhibitors

(Complete, ROCHE) and 40U/mL of RNAse inhibitors (Ribolock, Thermo Scientific). The samples were diluted

10 times in FA lysis buffer (1mM EDTA pH8.0, 50mM HEPES-KOH ph 7.5, 140 mM NaCl, 0.1% sodium

deoxycholate (w/v), 1% triton X-100 (v/v), protease inhibitors and 40U/mL of RNAse inhibitors and

sonicated for 5 minutes with 30 seconds ON and 30 seconds OFF cycles on a Bioruptor (Diagenode). After 10

min of centrifugation at 16000g to clear the debris, the extracts were pre-cleared and treated with DNAse

(RQ1 DNase, Promega). The extracts were incubated with the beads coupled with the specific antibodies

17

against AGO1 (#5053, Cell Signaling Technology) and AGO2 (Anti-mouse AGO2 2D4, WAKO) with end-over-

end rotation overnight at 4°C. The beads are washed 2 times with FA lysis buffer at 4°C and the complexes

eluted in 150µL of RIP elution buffer (10 mM EDTA, 100 mM Tris–HCl pH 8.0, 1% SDS, RNAse inhibitors) in a

thermomixer at 1200 rpm for 10 min at 37°C. Both 1% input and eluted samples were first incubated 1h at

42°C in the presence of 200µM NaCl and 20µg of proteinase K and then heated 1h at 65°C to reverse crosslink.

The RNAs were re-suspended in RNAse-free water after acid phenol/chloroform extraction followed by

ethanol precipitation. The small RNA content was analyzed by deep sequencing.

Small RNA sequencing and data analysis

The library preparation and sequencing was performed by the FASTERIS company (FASTERIS SA, Plan-les-

Ouates, Switzerland) and The Functional Genomic Center Zurich (Switzerland). The small RNA libraries were

prepared using the Illumina TruSeq Small RNA library preparation kit according to the standardized

manufacturer protocol. 1 µg of total RNA from both WT and Ago2_KO cXENs as well as 20-100 ng of

AGO1/AGO2 IP and input samples from WT, Ago2_KO, Ago1_KO, Dicer_KO mESCs, and Ago2_KO-AGO1A with

or without doxycycline were used for library preparation. The sequencing was performed on an Illumina

Hiseq 2500 sequencer and generated between 20 and 30 millions of single reads of 50bp per library. The

analysis was performed on the Mississippi GALAXY instance (https://mississippi.snv.jussieu.fr) using

available tools (Blankenberg et al., 2010; Giardine et al., 2005; Goecks et al., 2010). Briefly, the reads were

clipped from their adapter sequences and only reads of 18-26 bp were selected for further analysis. The reads

were mapped to the mouse genome (mm10), snoRNAs (Rfam), hairpins miRNAs (miRbase release 21) and

mature miRNAs (miRbase Release 21) using Bowtie software (Langmead et al., 2009). One mismatch and

multiple mapping reads were assigned randomly to the mature miRNAs. The mature miRNA read counts were

normalized to the library size and multiplied by 106 (CPTM: Count per ten million). A cut-off of 50 CPTM per

miRNA in at least one library was set for the mESC samples except for the IP samples. The cut-off for

differentiated XEN cells was set to 300 CPTM. All the small RNA libraries were performed in duplicate except

for the AGO1 and AGO2 IP samples. When required a mean CPTM per miRNA of the two duplicate samples

was calculated. The differential expression of miRNAs was assessed using the DESeq2 software (Greve et al.,

2013) with a fold change > 2 and FDR (adjusted p-value) < 0.01. For the IP analysis, the AGO1/AGO2 IP in

18

Ago1_KO and Ago2_KO cells was used as background control for the miRNA read count. The heatmaps and

graphs were generated using gplots R Package (Ginestet, 2011). The statistical analysis to compare the global

miRNA level was performed using the non parametrical Mann-Whitney ranked test (GraphPad Prism 6.0). The

processed data are available as excel files (Table S1 and Table S4) and raw data have been deposited on

NCBI GEO database under the accession: GSE80454.

ChIP-qPCR analysis

The WT and Ago2_KO mESCs were grown on 10 cm gelatin-coated plates in standard ESC medium until they

reach 70% confluency. The mESCs were differentiated into cXENs as described above for 5 days. For each

ChIP, one plate of mESCs and one plate of cXENs were used. The cells were cross-linked in 1% Formaldehyde

for 10 minutes at RT. The reaction was stopped by the addition of glycine at final concentration 125mM. Cells

were washed in PBS 1X and incubated 15 minutes in swelling buffer (5mM PIPES ph8; 85mM KCL; 0,5% NP-

40; protease inhibitors). After 5 minutes of centrifugation at 2000 rpm, the nuclei were washed once in

swelling buffer. After a second centrifugation, the nuclei pellets were lysed in RIPA_1%SDS buffer (PBS 1X; 1%

NP-40; 0.5% Sodium deoxycholate; 1% SDS; protease inhibitors), 200µL per 10cm plate 10 minutes on ice.

The chromatin was sonicated on a Bioruptor (Diagenode) device for 30 minutes with cycles 30 seconds OFF

and 30 seconds ON. After 15 minutes of centrifugation to clear the debris, the soluble chromatin was diluted

10 times in RIPA_0%SDS buffer (PBS 1X; 1% NP-40; 0.5% Sodium deoxycholate; protease inhibitors) and pre-

cleared for 1 hour at 4°C with Protein-G coupled Dynabeads (Life Technologies) blocked with BSA and yeast

tRNA. 1% of input chromatin is taken away for input DNA isolation. After pre-clearing, about 200µg of

chromatin were incubated with 5 µg of specific antibodies or IgG overnight at 4°C. The chromatin-antibody

complexes were isolated with Protein-G coupled Dynabeads for 2-4 hours at 4°C. Beads were washed 5 times

3 minutes in LiCl wash buffer (100mM Tris-HCL pH 7.5; 500mM LiCl; 1% NP-40; 1% Sodium desoxycholate;

protease inhibitors) and once on TE buffer. The elution was performed for 1 hour at 65°C in 200µL of elution

buffer (1% SDS; 0,1M NaHCO3). Both the input and eluted DNA were reverse cross-linked at 65°C overnight.

The DNA was digested with proteinase K for 1 hour at 45°C and purified by phenol/chloroform extraction

followed by ethanol precipitation. The input and ChIPed DNA was analyzed by qPCR on a LightCycler® 480

instrument (Roche, Penzberg) using the KAPA SYBR® FAST qPCR kit (Kapa Biosystems) and the specific

19

enrichment was calculated using the ∆∆CT method compare to the input and a control locus. The antibodies

used for the ChIP were: SUZ12 (#3737, Cell Signaling Technology), RING1B (#5694, Cell Signaling

Technology), H3K27me3 (#9733, Cell Signaling Technology), and H3K27ac (Ab4729, Abcam). To control the

specific enrichment, IgG ChIPs were performed in parallel for each sample. The primers used in this study are

listed in supplementary file.

20

PLASMID CONSTRUCTS

- pMSCV PIG (Puro IRES GFP empty vector) was a gift from David Bartel (Addgene plasmid # 21654).

- pCW57.1 was a gift from David Root (Addgene plasmid # 41393).

- pSpCas9(BB)-2A-GFP (PX458) was a gift from Feng Zhang (Addgene plasmid # 48138).

- pX330-U6-Chimeric_BB-CBh-hSpCas9 was a gift from Feng Zhang (Addgene plasmid # 42230).

- pX330-sgRNA_Ago2_1 was obtained by inserting the annealed sgRNA_Ago2_2a/b primers into the

pX330 vector linearized with BpsI (Addgene #73529).















- pCW57.1 GATA6 was obtained by cloning the GATA6 ORF obtained by PCR on mouse cDNA using

primers Gata6Fw and Gata6Rev into the pCW57.1 plasmid digested by NheI/BamH1. The cloning was

performed using the In-fusion® Cloning Plus system (Clontech) according to manufacturer

instructions. All the primers used are listed below and plasmid available as (Addgene #73537).

- pCW57.1 3xHA-AGO2 was obtained by cloning (In-fusion® Cloning, Clontech) into the pCW57.1

(digested NheI/Bamh1) the fragment obtained by amplifying the 3xHA-AGO2 ORF from the

21

pMSCV_3xHA-AGO2 construct using primers Ago2Fw and Ago2Rev. The pMSCV_3xHA-AGO2

construct was obtained by cloning the fragment Ago2 ORF obtained by PCR on pMigr-Ago2FL

(O'Carroll et al., 2007) using primers Ago2Fw1.1 and Ago2Rev1.1 and the fragment 3xHA obtained by

PCR on a 3xHA tag using primers 3xHAFw/Rev into the pMSCV_PIG (Digested EcoRI). The cloning was

performed using the In-fusion® Cloning Plus system (Clontech). All the primers used are listed below

and plasmid available as (Addgene #73538).

- pCW57.1 3xHA-AGO2_RNAmut was obtained by cloning (In-fusion® Cloning, Clontech) into the

pCW57.1 (digested NheI/Bamh1) the fragment obtained by amplifying the 3xHA-AGO2_RNAmut ORF

from the pMSCV_3xHA-AGO2_RNAmut construct using primers Ago2Fw and Ago2Rev. The

pMSCV_3xHA-AGO2_RNAmut construct was obtained by mutating the positions Y311A and F312A of

the AGO2 protein (Gao et al., 2014) using the primers RNAmut_Fw and RNAmut_Rev on the

pMSCV_3xHA-AGO2 construct. The cloning and the mutagenesis were performed using the In-

fusion® Cloning Plus system (Clontech). All the primers used are listed below and plasmid available

as (Addgene #73539).

- pCW57.1 3xHA-AGO2_CATmut was obtained by cloning (In-fusion® Cloning, Clontech) into the

pCW57.1 (digested NheI/Bamh1) the fragment obtained by amplifying the 3xHA-AGO2_CATmut ORF

from the pMSCV_3xHA-AGO2_CATmut construct using primers Ago2Fw and Ago2Rev. The

pMSCV_3xHA-AGO2_CATmut construct was obtained by cloning the fragment Ago2 D670A ORF

obtained by PCR on pMigr-Ago2FLAG-D670A (O'Carroll et al., 2007) using primers Ago2Fw1.1 and

Ago2Rev1.1 and the fragment 3xHA obtained by PCR on a 3xHA tag using primers 3xHAFw/Rev into

the pMSCV_PIG (Digested EcoRI). The cloning was performed using the In-fusion® Cloning Plus

system (Clontech). All the primers used are listed below and plasmid available as (Addgene #73540).

- pCW57.1 AGO1 was obtained by cloning the AGO1 ORF obtained by PCR on mouse cDNA using

primers Ago1Fw and Ago1Rev into the pCW57.1 plasmid digested by NheI/BamH1. The cloning was

performed using the In-fusion® Cloning Plus system (Clontech). All the primers used are listed below

and plasmid available as (Addgene #73541).

22

PRIMERS LIST

CRISPR/CAS9 guide RNAs cloning:

sgRNA_Ago2_1a: caccgGCTAAGAACTGTTGAATGGA

sgRNA_Ago2_1b: aaacTCCATTCAACAGTTCTTAGCc

sgRNA_Ago2_2a: caccgTACCCTGCCCCCGTAGAGGA

sgRNA_Ago2_2b: aaacTCCTCTACGGGGGCAGGGTAc

sgRNA_Ago2_3a: caccgCACGTCCCGGTGGCGCTGCT

sgRNA_Ago2_3b: aaacAGCAGCGCCACCGGGACGTGc

sgRNA_Ago2_4a: caccgAGGTTTACCCGACGCGGCCG

sgRNA_Ago2_4b: aaacCGGCCGCGTCGGGTAAACCTc

sgRNA_Ago1_1a: caccgAGTGCGCAGGCGCGACCGAT

sgRNA_Ago1_1b: aaacATCGGTCGCGCCTGCGCACTc

sgRNA_Ago1_2a: caccgGGATGGGGGGCCCATTTTGA

sgRNA_Ago1_2b: aaacTCAAAATGGGCCCCCCATCCc

sgRNA_Ago1_3a: caccgGAGTCAAGCGGGGCGCTCGA

sgRNA_Ago1_3b: aaacTCGAGCGCCCCGCTTGACTCc

sgRNA_Ago1_4a: caccgCATCCCATATACCCGTGCGG

sgRNA_Ago1_4b: aaacCCGCACGGGTATATGGGATGc

CRISPR/CAS9 Genotyping primers:

Ago2KO∆Ex5-10_Fw GCAATTGCTTTGTTCTGCAA

Ago2KO∆Ex5-10_Rev GAAAGCTCGGTGTTCCTTTG

Ago2KO∆Ex1_Fw GAAGGCGAAAAAGCCTCCCC

Ago2KO∆Ex1_Rev GAGCTAGCTTCCCGTCGC

Ago1KO∆Ex1_Fw ACTTCTCACCCTCGGGACA

Ago1KO∆Ex1_Rev CCCTCTTACGCCACTGCG

Primers for mRNAs qPCR

Ago2_Fw TCCATGAGGTACACCCCTGT

Ago2_Rev GATGGAAGCCAAACCACACT

Oct4_Fw CAACTCCCGAGGAGTCCCA

Oct4_Rev CTGGGTGTACCCCAAGGTGA

Nanog_Fw CAGAAAAACCAGTGGTTGAAGA

Nanog_Rev GCAATGGATGCTGGGATACTC

Sox2_Fw CACAGATGCAACCGATGCA

23

Sox2_Rev GGTGCCCTGCTGCGAGTA

Ago1_Fw CCCAGAAACAGTGTCGAGAAG

Ago1_Rev TCCCTGCATCCTTGGAAATC

Nestin_Fw CTCTTCCCCCTTGCCTAATACC

Nestin_Rev TTTAGGATAGGGAGCCTCAGACAT

Fgf5_Fw GCCTGTCCTTGCTCTTCCTCAT

Fgf5_Rev GGAGAAGCTGCGACTGGTGA

Pax6_Fw TAACGGAGAAGACTCGGATGAAGC

Pax6_Rev CGGGCAAACACATCTGGATAATGG

Brachyury_Fw TCTCTGGTCTGTGAGCAATGGT

Brachyury_Rev TGCGTCAGTGGTGTGTAATGTG

Fgf8_Fw CGCTTTAGTTGAGGAACTCGAAGCG

Fgf8_Rev ACATGGCCTTTACCCGCAAG

Actc1_Fw CCAAAGCTGTGCCAGGATGT

Actc1_Rev GCCATTGTCACACACCAAAGC

Gata6_Fw GAAGCGCGTGCCTTCATC

Gata6_Rev GTAGTGGTTGTGGTGTGACAGTTG

Gata4_Fw CTGGAAGACACCCCAATCTC

Gata4_Rev GTAGTGTCCCGTCCCATCTC

Dab2_Fw TTGATGATGTGCCTGATGCT

Dab2_Rev TTTGCTTGTGTTGTCCCTGA

Foxa2_Fw AGCACCATTACGCCTTCAAC

Foxa2_Rev CCTTGAGGTCCATTTTGTGG

Fgf4_Fw TACCCCGGTATGTTCATGGC

Fgf4_Rev TTACCTTCATGGTAGGCGACA

Fgfr2_Fw GCTATAAGGTACGAAACCAGCAC

Fgfr2_Rev GGTTGATGGACCCGTATTCATTC

Rrm2_Fw CCGAGCTGGAAAGTAAAGCG

Rrm2_Rev ATGGGAAAGACAACGAAGCG

Ina_Fw GCGCAGTATGAGTCCCTGG

Ina_Rev CGGTACTCGTGGATCTCCTCT

Lrrn2_Fw CCTGGGCTCAAGTTCCTAGAC

Lrrn2_Rev TCAGGGAGATTTACCAGAGCAAA

Lef1_Fw TGTTTATCCCATCACGGGTGG

Lef1_Rev CATGGAAGTGTCGCCTGACAG

24

Prmt8_Fw ACGTGGTAGCAATCGAAGACA

Prmt8_Rev GCTCCTTCATGGCAACATCC

Claudin6_Fw CGAGACAAGATAGGAACTCCAAGTCTCG

Claudin6_Rev ATAGAGTGGGCAGTCCAGCAGA

Cxcr4_Fw CGGGATGAAAACGTCCATTT

Cxcr4_Rev ATGACCAGGATCACCAATCCA

Foxa1_Fw ATGAGAGCAACGACTGGAACA

Foxa1_Rev TCATGGAGTTCATAGAGCCCA

Primers for miRNA qPCR (QIAGEN)

Mm_miR-

16_2-5p

miScript Primer Assay UAGCAGCACGUAAAUAUUGGCG

Mm_miR-

295_3p

miScript Primer Assay AAAGUGCUACUACUUUUGAGUCU

Mm_miR-

293_3p

miScript Primer Assay AGUGCCGCAGAGUUUGUAGUGU

Mm_miR-

294_3p

miScript Primer Assay AAAGUGCUUCCCUUUUGUGUGU

Mm_miR-

298_1-5p

miScript Primer Assay GGCAGAGGAGGGCUGUUCUUCCC

Mmu-miR-

301a-3p

miScript Primer Assay CAGUGCAAUAGUAUUGUCAAAGC

Mmu-miR-

10a-5p

miScript Primer Assay UACCCUGUAGAUCCGAAUUUGUG

Mmu-miR-

431-5p

miScript Primer Assay UGUCUUGCAGGCCGUCAUGCA

Oligonucleotide miRNA probes for Northern Blot

miR-295-3p AGACTCAAAAGTAGTAGCACTTT

miR-182-5p CGGTGTGAGTTCTACCATTGCCAAA

miR-127-3p AGCCAAGCTCAGACGGATCCGA

miR-16-5p CGCCAATATTTACGTGCTGCTA

miR-143-3p GAGCTACAGTGCTTCATCTCA

miR-431-5p TGCATGACGGCCTGCAAGACA

miR-298-5p GGGAAGAACAGCCCTCCTCTGCC

25

miR-301a-3p GCTTTGACAATACTATTGCACTG

U6 GCAGGGGCCATGCTAATCTTCTCTGTATCG

Primers for microsatellites genotyping

D19mit19_Fw CCTGTGTCCATACAGGCTCA

D19mit19_Rev ACCATATCAGGAAGCACCATG

D18mit184_Fw CACACATGTGTAGGTAGGTAGGTAGG

D18mit184_Rev CGCACAAGGACTACTGAAACA

D2mit206_Fw TGTCAGAACTGGACAATGTCG

D2mit206_Rev ATGATAACAGACACTAATGATTAG

D2mit102_Fw CCATGTGGATATCTTCCCTTG

D2mit102_Rev GTATACCCAGTTGTAAATCTTGT

D9mit269_Fw GGACTAATAGTCAACTGTGTAA

D9mit269_Rev AGGAAGACTGAAAACTTGTG

Cloning primers

Gata6Fw CGCCTGGAGAATTGGccaccATGgccttgactgacggcgg

Gata6Rev GCAACCCCAACCCCGtcaggccagggccagagcac

Ago2Fw CGCCTGGAGAATTGGccaccATGtacccatacgatgttcctga

Ago2Rev GCAACCCCAACCCCGGGATCCtcaagcaaagtacatggtgc

Ago2Fw1.1 tGGATCCtactcgggagccggc

Ago2Rev1.1 ctacccggtagaattGGATCCtcaagcaaagtacatggtgc

3xHAFw cgaggttaacgaattccaccATGtacccatacgatgttcctga

3xHARev cccgagtaGGATCCagcgtaatctggaacgtcat

RNAmut_Fw agtggcccagGCTGCcaaggacaggcacaagctg

RNAmut_Rev cctgtccttgGCAGCctgggccactgtacactccac

Ago1Fw CGCCTGGAGAATTGGccaccATGgaagcgggaccctcgggagc

Ago1Rev GCAACCCCAACCCCGtcaagcgaagtacatggtgcgtag

Primers for ChIP-qPCR

ChIP_Gata6_1_Fw CATCCAGCGCTGTAACACAT

ChIP_Gata6_1_Rev CCAAGTTTCCCTCCCTCTTC

ChIP_Gata6_2_Fw TTTGTTTAGGGCTCGGTGAG

ChIP_Gata6_2_Rev AGAGTCCGGGGTCTGCTAGT

ChIP_Gata6_3_Fw ACCCAGGCAAGATAGCAAGA

ChIP_Gata6_3_Rev TCTGCCCACAGCTTATCTCC

26

ChIP_Gata4_1_Fw TGTTCCCTCCCAAACAATCCAA

ChIP_Gata4_1_Rev AACTGCTCCGCTTTTGACTTTG

ChIP_Gata4_2_Fw CAGTTTCCCAGAAAACCGGC

ChIP_Gata4_2_Rev CCTTGCACGTGACTCCCTTAG

ChIP_Gata4_3_Fw CAACAGGCAAAGTCCATGCG

ChIP_Gata4_3_Rev ACGTGGACCACTGAGAGTAGG

ChIP_Sox17_1_Fw GGTCTGTGGAGAGCAAGTTCA

ChIP_Sox17_1_Rev GTTATCTTAGAGTCCGCCGGG

ChIP_Sox17_2_Fw TCTTCGCTTTGCTAGCCTCTC

ChIP_Sox17_2_Rev TTTCGGGGCACGATTAGACAG

ChIP_Sox17_3_Fw TGTCTAATCGTGCCCCGAAAC

ChIP_Sox17_3_Rev AACATTCCCGACCGGTTACTG

ChIP_Foxa2_1_Fw GTAGTAGCTGCTCCAGTCGGA

ChIP_Foxa2_1_Rev TTTTAAACCGCCATGCACTCG

ChIP_Foxa2_2_Fw TCCCCGTTACAGTTAAGTCCC

ChIP_Foxa2_2_Rev CAGCTAAACGGGTCTCTCCAG

ChIP_Foxa2_3_Fw CTGGAGAGACCCGTTTAGCTG

ChIP_Foxa2_3_Rev TTACGAAATGCTTTGGGCACC

ChIP_Cdx2_Fw GGACTCCGCGAGCCAA

ChIP_Cdx2_Rev CTCAGCCCACGGTGCTC

ChIP_Smad3_Fw GAGACTCCAAGTGGCAGTAGAA

ChIP_Smad3_Rev GTTGGACTTTCCTTCCCGGAG

ChIP_Intergenic_Fw TCCTGGCCTAAACTAGACTGGA

ChIP_Intergenic_Rev GGGCACTCCAAGATCAACACTA

SUPPLEMENTAL REFERENCES

Bhushan, R., Grünhagen, J., Becker, J., Robinson, P.N., Ott, C.-E., and Knaus, P. (2013). miR-181a promotes osteoblastic differentiation through repression of TGF-β signaling molecules. The International Journal of Biochemistry & Cell Biology 45, 696–705.

Blankenberg, D., Kuster, Von, G., Coraor, N., Ananda, G., Lazarus, R., Mangan, M., Nekrutenko, A., and Taylor, J. (2010). Galaxy: a web-based genome analysis tool for experimentalists. Curr Protoc Mol Biol Chapter 19, Unit19.10.1–Unit19.10.21.

Bodak, M., Cirera-Salinas, D., Yu, J., Ngondo, R.P., and Ciaudo, C. (2017). Dicer, a new regulator of pluripotency exit and LINE-1 elements in mouse embryonic stem cells. FEBS Open Bio 7, 204–220.

Bolger, A.M., Lohse, M., and Usadel, B. (2014). Trimmomatic: a flexible trimmer for Illumina sequence data.

27

Bioinformatics 30, btu170–btu2120.

Dobin, A., Davis, C.A., Schlesinger, F., Drenkow, J., Zaleski, C., Jha, S., Batut, P., Chaisson, M., and Gingeras, T.R. (2013). STAR: ultrafast universal RNA-seq aligner. Bioinformatics 29, 15–21.

Fantini, S., Salsi, V., Reggiani, L., Maiorana, A., and Zappavigna, V. (2017). The miR-196b miRNA inhibits the GATA6 intestinal transcription factor and is upregulated in colon cancer patients. Oncotarget.

Gao, M., Wei, W., Li, M.-M., Wu, Y.-S., Ba, Z., Jin, K.-X., Li, M.-M., Liao, Y.-Q., Adhikari, S., Chong, Z., et al. (2014). Ago2 facilitates Rad51 recruitment and DNA double-strand break repair by homologous recombination. Cell Res. 24, 532–541.

Giardine, B., Riemer, C., Hardison, R.C., Burhans, R., Elnitski, L., Shah, P., Zhang, Y., Blankenberg, D., Albert, I., Taylor, J., et al. (2005). Galaxy: a platform for interactive large-scale genome analysis. Genome Res. 15, 1451–1455.

Ginestet, C. (2011). ggplot2: Elegant Graphics for Data Analysis. Journal of the Royal Statistical Society: Series a (Statistics in Society) 174, 245–246.

Goecks, J., Nekrutenko, A., and Taylor, J. (2010). Galaxy: a comprehensive approach for supporting accessible, reproducible, and transparent computational research in the life sciences. Genome Biol.

Gouon-Evans, V., Boussemart, L., Gadue, P., Nierhoff, D., Koehler, C.I., Kubo, A., Shafritz, D.A., and Keller, G. (2006). BMP-4 is required for hepatic specification of mouse embryonic stem cell-derived definitive endoderm. Nat Biotechnol 24, 1402–1411.

Greve, T.S., Judson, R.L., and Blelloch, R. (2013). microRNA Control of Mouse and Human Pluripotent Stem Cell Behavior. Annu. Rev. Cell Dev. Biol. 29, 213–239.

Ji, J., Yamashita, T., Budhu, A., Forgues, M., Jia, H.L., Li, C., Deng, C., Wauthier, E., Reid, L.M., Ye, Q.H., et al. (2009). Identification of microRNA‐181 by genome‐wide screening as a critical player in EpCAM–positive hepatic cancer stem cells. Hepatology 50, 472–480.

Kim, J.S., Kurie, J.M., and Ahn, Y.-H. (2015). BMP4 depletion by miR-200 inhibits tumorigenesis and metastasis of lung adenocarcinoma cells. Molecular Cancer 2015 14:1 14, 173.

Kurosawa, H. (2007). Methods for inducing embryoid body formation: in vitro differentiation system of embryonic stem cells. Journal of Bioscience and Bioengineering 103, 389–398.

Langmead, B., Trapnell, C., Pop, M., and Salzberg, S.L. (2009). Ultrafast and memory-efficient alignment of short DNA sequences to the human genome. Genome Biol 10, R25.

Liang, D., Zhen, L., Yuan, T., Huang, J., Deng, F., and Zhang, H. (2014). miR-10a regulates proliferation of human cardiomyocyte progenitor cells by targeting GATA6. PLoS ONE.

Liao, Y., Smyth, G.K., and Shi, W. (2013). featureCounts: an efficient general purpose program for assigning sequence reads to genomic features. Bioinformatics 30, btt656–btt930.

Liu, N., Bezprozvannaya, S., Williams, A.H., Qi, X., Richardson, J.A., Bassel-Duby, R., and Olson, E.N. (2008). microRNA-133a regulates cardiomyocyte proliferation and suppresses smooth muscle gene expression in the heart. Genes Dev 22, 3242–3254.

Love, M.I., Huber, W., and Anders, S. (2014). Moderated estimation of fold change and dispersion for RNA-seq data with DESeq2. Genome Biol 15, 1–21.

28

Niakan, K.K., Schrode, N., Cho, L.T.Y., and Hadjantonakis, A.-K. (2013). Derivation of extraembryonic endoderm stem (XEN) cells from mouse embryos and embryonic stem cells. Nat Protoc 8, 1028–1041.

O'Carroll, D., Mecklenbrauker, I., Das, P.P., Santana, A., Koenig, U., Enright, A.J., Miska, E.A., and Tarakhovsky, A. (2007). A Slicer-independent role for Argonaute 2 in hematopoiesis and the microRNA pathway. Genes Dev 21, 1999–2004.

Pall, G.S., and Hamilton, A.J. (2008). Improved northern blot method for enhanced detection of small RNA. Nat Protoc 3, 1077–1084.

Riley, K.J., Yario, T.A., and Steitz, J.A. (2012). Association of Argonaute proteins and microRNAs can occur after cell lysis. Rna 18, 1581–1585.

Robinson, M.D., McCarthy, D.J., and Smyth, G.K. (2010). edgeR: a Bioconductor package for differential expression analysis of digital gene expression data. Bioinformatics 26, 139–140.

Selth, L.A., Close, P., and Svejstrup, J.Q. (2011). Studying RNA-protein interactions in vivo by RNA immunoprecipitation. Methods Mol. Biol. 791, 253–264.

Tsuji, S., Kawasaki, Y., and Furukawa, S. (2014). The miR-363-GATA6-Lgr5 pathway is critical for colorectal tumourigenesis. Nature.

Wettstein, R., Bodak, M., and Ciaudo, C. (2016). Generation of a Knockout Mouse Embryonic Stem Cell Line Using a Paired CRISPR/Cas9 Genome Engineering Tool. Methods Mol. Biol. 1341, 321–343.

Yang, W., Lee, Y.-H., Jones, A.E., Woolnough, J.L., Zhou, D., Dai, Q., Wu, Q., Giles, K.E., Townes, T.M., and Wang, H. (2014). The histone H2A deubiquitinase Usp16 regulates embryonic stem cell gene expression and lineage commitment. Nature Communications 5.

Zeng, L., Carter, A.D., and Childs, S.J. (2009). miR-145 directs intestinal maturation in zebrafish. Proc Natl Acad Sci USA 106, 17793–17798.

argonaute 2 is required for extra-embryonic endoderm ... · supplemental information argonaute 2 is...

Documents