analyzing the function of trap1 in models of parkinson’s

Analyzing the function of TRAP1 in models of Parkinson’s

disease

Von der Fakultät für Mathematik, Informatik und Naturwissenschaften der RWTH Aachen

University zur Erlangung des akademischen Grades einer Doktorin der Naturwissenschaften

genehmigte Dissertation

vorgelegt von

Li Zhang

aus

Changchun, Jilin (China)

Berichter: Universitätsprofessor Dr. med. Jörg B. Schulz

Universitätsprofessor Dr. rer. nat. Marc Spehr

Tag der mündlichen Prüfung: 29.01.2016

Diese Dissertation ist auf den Internetseiten der Universitätsbibliothek online verfügbar.

Eidesstattliche Versicherung

___________________________ ___________________________

Name, Vorname Matrikelnummer (freiwillige Angabe)

Ich versichere hiermit an Eides Statt, dass ich die vorliegende Arbeit/Bachelorarbeit/

Masterarbeit* mit dem Titel

__________________________________________________________________________

__________________________________________________________________________

__________________________________________________________________________

selbständig und ohne unzulässige fremde Hilfe erbracht habe. Ich habe keine anderen als

die angegebenen Quellen und Hilfsmittel benutzt. Für den Fall, dass die Arbeit zusätzlich auf

einem Datenträger eingereicht wird, erkläre ich, dass die schriftliche und die elektronische

Form vollständig übereinstimmen. Die Arbeit hat in gleicher oder ähnlicher Form noch keiner

Prüfungsbehörde vorgelegen.

___________________________ ___________________________

Ort, Datum Unterschrift

*Nichtzutreffendes bitte streichen

Belehrung:

§ 156 StGB: Falsche Versicherung an Eides Statt

Wer vor einer zur Abnahme einer Versicherung an Eides Statt zuständigen Behörde eine solche Versicherung

falsch abgibt oder unter Berufung auf eine solche Versicherung falsch aussagt, wird mit Freiheitsstrafe bis zu drei

Jahren oder mit Geldstrafe bestraft.

§ 161 StGB: Fahrlässiger Falscheid; fahrlässige falsche Versicherung an Eides Statt

(1) Wenn eine der in den §§ 154 bis 156 bezeichneten Handlungen aus Fahrlässigkeit begangen worden ist, so

tritt Freiheitsstrafe bis zu einem Jahr oder Geldstrafe ein.

(2) Straflosigkeit tritt ein, wenn der Täter die falsche Angabe rechtzeitig berichtigt. Die Vorschriften des § 158

Abs. 2 und 3 gelten entsprechend.

Die vorstehende Belehrung habe ich zur Kenntnis genommen:

___________________________ ___________________________

Ort, Datum Unterschrift

Zhang, Li

Analyzing the function of TRAP1 in models of Parkinson’s disease

Uebersetzung: Analyse der TRAP1-Funktion in Modellen fuer Morbus Parkinson

Aachen, 17.12.2015

Aachen, 17.12.2015

i

Members of the Thesis Committee

Supervisor

Univ.-Prof. Dr. med. Jörg B. Schulz

Department of Neurology

University Medical Center, RWTH Aachen University

Pauwelsstrasse 30

52074 Aachen

Second member of the Thesis Committee

Univ.-Prof. Dr. rer. nat. Marc Spehr

Institut für Biologie II, Zoologie

Department of Biology, RWTH Aachen University

Worringerweg 3

52074 Aachen

Third member of the Thesis Committee

Univ.-Prof. Dr. rer. nat. Bernhard Lüscher

Institut für Biochemie und Molekularbiologie, Medizinische Fakultät

University Medical Center, RWTH Aachen University

Pauwelsstrasse 30

52074 Aachen

Date of Disputation:

ii

List of Publications

Parts of this work have already been published with authorisation of Prof. Jörg B. Schulz,

Head of the Department of Neurology, University Medical Centre of the RWTH Aachen

University, on behalf of the thesis committee.

Oral presentation. Trap1, a new player in Parkinson’s disease. Regional Drosophila

Meeting 2014 Heidelberg, Germany (05. 2014)

Zhang L, Karsten P, Hamm S, Pogson JH, Müller-Rischart AK, Exner N, Haass C,

Whitworth AJ, Winklhofer KF, Schulz JB, Voigt A. TRAP1 rescues PINK1 loss-of-function

phenotypes. Hum Mol Genet. 2013 Jul 15;22(14):2829-2841. DOI: 10.1093/hmg/ddt132

Poster Presentation. Trap1 rescues Pink1 loss-of-function phenotypes. ISN-ASN Meeting

2013 Cancun, Mexico (04. 2013)

Oral presentation. A chaperone protein TRAP1 rescues Pink1 loss-of-function phenotypes

and mitochondrial dysfunction in vivo. Regional Drosophila Meeting 2012 Osnabrück,

Germany (10. 2012)

Poster Presentation. Trap1 mitigates α-Synuclein-induced toxicity and rescues Pink1 loss-

of-function phenotypes in vivo. 8th

FENS Forum of Neuroscience Barcelona, Spain (07. 2012)

iii

Acknowledgements

Hereby I would like to express my sincere and deepest gratitude,

To Prof. Jörg B. Schulz, for offering me the position at the first place, for giving me

great opportunities in scientific domain and broadening my mind as an international

researcher, for always providing critical suggestions for the direction of the projects, and last

but not least, being an excellent role model himself.

To Prof. Marc Spehr and Prof. Bernhard Lüscher, for being members in my doctoral

thesis committee, for the splendid suggestions from their professional point of views which

expands the horizons of my projects, for their patience and precious time.

To Dr. Aaron Voigt, for being a great advisor as well as a very supportive friend, for

being so generous and unreserved to spread his knowledge and exchange his valuable ideas,

for his kindness to care about not only the scientific projects but also my personal career

blueprint, for inspiring me for the scientific questions and offering me a friendly working and

studying atmosphere.

To Prof. Björn Falkenburg, Dr. Peter Karsten, Dr. Hannes Voßfeldt, Dr. Malte Butzlaff,

Dr. Katja Pr in , Jane Patricia Tögel, Kavita Kaur, Dr. Theodora Saridaki and Dr.

Barbara Stopschinski for showing me the experiments patiently, for sharing their scientific

opinions.

To Sabine Hamm and Anne Lankes, for technique supporting and their kindness. To

Natalie Alexandra Burdiek-Reinhard, for always being so nice, for her considerable thoughts,

and her help.

To Antje Hofmeister, Xia Pan, Sarah Lenz, Stefan Esser, Daniel Komnig, Anna

Hilverling, Athanasios Tarampanis, Maria Ingenerf, Simon Stilling, Larissa Kaltenhäuser,

Elisabeth Dinter, Markus Nippold, Julie Schmidt-Tiedemann, and other students, for being

such wonderful companion, for being so amazing and caring friends, and for the lovely times

spending together.

To Alexander J. Withworth and Konstanze F. Winklhofer for the cooperation, and

Bundesministerium für Bildung und Forschung (Nationales Genomforschungsnetz (NGFN+)

and the Kompetenznetz Degenerative Demenzen (KNDD) for financial support.

Finally, to the ones who love me, only with their unconditional love, I live.

iv

Table of contents

LIST OF PUBLICATIONS ................................................................................................................................................... II

ACKNOWLEDGEMENTS ................................................................................................................................................. III

LIST OF FIGURES ............................................................................................................................................................... VI

LIST OF TABLES .............................................................................................................................................................. VII

LIST OF ABBREVIATIONS ........................................................................................................................................... VIII

ABSTRACT ............................................................................................................................................................................ X

1 INTRODUCTION .............................................................................................................................................................. 1

1.1 OVERVIEW OF PARKINSON’S DISEASE .......................................................................................................................................... 1 1.2 PATHOLOGICAL HALLMARKS ......................................................................................................................................................... 1 1.3 GENETICS OF PD ............................................................................................................................................................................. 3

1.3.1 Autosomal dominant PD-causal gene, SNCA .......................................................................................................... 4 1.3.2 Autosomal recessive PD-causal gene, parkin ......................................................................................................... 5 1.3.3 Autosomal recessive PD-causal gene, Pink1 ........................................................................................................... 5

1.4 MITOCHONDRIAL DYSFUNCTION THEORY ................................................................................................................................... 8 1.5 A MODIFIER OF Α-SYN-INDUCED TOXICITY, TRAP1 ................................................................................................................... 9 1.6 AIM OF STUDY ............................................................................................................................................................................... 10

2 MATERIAL AND METHODS ....................................................................................................................................... 12

2.1 ORGANISM ..................................................................................................................................................................................... 12 2.1.1 Fly stocks............................................................................................................................................................................. 12 2.1.2 UAS-Gal4 System .............................................................................................................................................................. 12 2.1.3 siRNA in fly ......................................................................................................................................................................... 13 2.1.4 Transgenic flies ................................................................................................................................................................ 14

2.2 CHEMICALS, ENZYMES, AND CONSUMABLE MATERIAL ......................................................................................................... 14 2.3 BUFFERS AND SOLUTIONS .......................................................................................................................................................... 16 2.4 KITS ................................................................................................................................................................................................ 17 2.5 EQUIPMENTS ................................................................................................................................................................................. 17 2.6 FLY BEHAVIORS/ PHENOTYPE ASSAYS ...................................................................................................................................... 17

2.6.1 Wing posture & Thorax indentation ........................................................................................................................ 17 2.6.2 Negative geotaxis ............................................................................................................................................................ 18 2.6.3 Longevity ............................................................................................................................................................................ 18

2.7 MITOCHONDRIAL ANALYSIS ........................................................................................................................................................ 18 2.7.1 ATP content ....................................................................................................................................................................... 18 2.7.2 Mitochondrial complex I activity analysis ............................................................................................................. 20 2.7.3 Mitochondrial DNA level analysis ............................................................................................................................. 21 2.7.4 Mitochondrial morphological analysis ................................................................................................................... 22

2.8 OTHER ASSAYS .............................................................................................................................................................................. 22 2.8.1 Analysis of DNA ................................................................................................................................................................ 22

DNA Extraction ............................................................................................................................................................................................... 22 2.8.2 Analysis of RNA ................................................................................................................................................................ 22

RNA Extraction ............................................................................................................................................................................................... 23 Real-time PCR.................................................................................................................................................................................................. 23 Oligo nucleotides (primers)....................................................................................................................................................................... 23

2.8.3 Analysis of protein........................................................................................................................................................... 24 Preparation of protein lysate for western blot ................................................................................................................................. 24 SDS Polyacrylamide Gel Electrophoresis and Western Blot ........................................................................................................ 24 Antibodies ......................................................................................................................................................................................................... 25

2.9 STATISTICAL ANALYSIS ................................................................................................................................................................ 25

3 RESULTS .......................................................................................................................................................................... 26

3.1 TRAP1 FUNCTIONS DOWNSTREAM OF PINK1 .......................................................................................................................... 26 3.1.1 Trap1 recues phenotypes caused by Pink1 loss-of-function in flies ............................................................. 27

3.1.2 Expression of Trap1 mitigates mitochondrial morphology and function in Pink1 loss-of-function

flies ................................................................................................................................................................................................... 33 Mitochondrial dysmorphology................................................................................................................................................................. 33 ATP levels .......................................................................................................................................................................................................... 34 Mitochondrial DNA ....................................................................................................................................................................................... 35 Mitochondrial Complex I ............................................................................................................................................................................ 36 Male fertility .................................................................................................................................................................................................... 37

3.1.3 Knocking down Trap1 in Pink1 loss-of-function flies cause semi-lethality .............................................. 39 3.2 TRAP1 FUNCTIONS INDEPENDENTLY OF PINK1/PARKIN PATHWAY ................................................................................. 40

3.2.1 Trap1 does not influence phenotypes in parkin mutant flies......................................................................... 41 3.2.2 Expression of Trap1 does not mitigate mitochondrial function/morphology in parkin mutant flies

........................................................................................................................................................................................................... 42 3.3 TRAP1 MITIGATES MITOCHONDRIAL MORPHOLOGY/FUNCTION IN PINK1 KNOCK-OUT SH-SY5Y CELLS .................... 43 3.4 TRAP1 AND MITOCHONDRIAL COMPLEX I RESCUE EACH OTHER ............................................................................................ 44

3.4.1 Trap1 rescues mitochondrial complex I subunits loss-of-function .............................................................. 44 3.4.2 Ndi1p (mitochondrial complex I) rescues Trap1 loss-of-function ............................................................... 46

4 DISCUSSION ................................................................................................................................................................... 49

4.1 TRAP1 FUNCTIONS DOWNSTREAM OF PINK1 .......................................................................................................................... 49 4.2 THE RESCUING EFFECT OF TRAP1 ON PINK1 LOSS-OF-FUNCTION REQUIRES MITOCHONDRIAL LOCATION OF TRAP1

AND ITS ATPASE ACTIVITY ................................................................................................................................................................ 51 4.3 TRAP1 DOES NOT FUNCTION IN PINK1/PARKIN PATHWAY ................................................................................................ 52 4.4 Α-SYNUCLEIN, PINK1, TRAP1 AND THE MITOCHONDRIAL COMPLEX I ............................................................................ 54

5 REFERENCES .................................................................................................................................................................. 59

vi

List of Figures

FIGURE 1. PINK1/PARKIN PATHWAYS. .................................................................................................................................................. 8 FIGURE 2. THE STRUCTURE OF TRAP1. ............................................................................................................................................... 10 FIGURE 3. AN OVERVIEW OF THE UAS/GAL4 EXPRESSION SYSTEM. ............................................................................................... 13 FIGURE 4. TRANSGENIC RNAI IN DROSOPHILA. ................................................................................................................................... 14 FIGURE 5. THE PRINCIPLE OF ATP MEASUREMENT. ........................................................................................................................... 19 FIGURE 6. THE ATP STANDARD LINE FOR FLY ATP ASSAY. .............................................................................................................. 19 FIGURE 7. DCIP ACCEPTS ELECTRONS AND BECOMES REDUCED-DCIP. ......................................................................................... 20 FIGURE 8. EXPRESSION LEVELS OF TRAP1 IN HTRAP1 EXPRESSING FLIES. ..................................................................................... 27 FIGURE 9. PINK1B9 FLIES WITH TRAP1 EXPRESSION REGAINED NORMAL WING POSTURE. .......................................................... 28 FIGURE 10. TRAP1 RESCUED THE ABNORMAL WING POSTURE CAUSED BY NEURONAL LOSS OF PINK1. .................................... 29 FIGURE 11. EXPRESSION OF TRAP1 MITIGATES PINK1 LOSS-OF-FUNCTION PHENOTYPES. ......................................................... 31 FIGURE 12. EXPRESSION OF TRAP1 RESCUED THE DEGENERATION OF INDIRECT FLIGHT MUSCLES (LONGITUDINAL MUSCLES)

IN PINK1B9 FLIES............................................................................................................................................................................ 32 FIGURE 13. EXPRESSION OF TRAP1 IMPROVED MITOCHONDRIAL MORPHOLOGY IN INDIRECT FLIGHT MUSCLES OF

PINK1B9

FLIES. .............................................................................................................................................................................. 33 FIGURE 14. EXPRESSION OF TRAP1 RESTORED ATP LEVELS IN THORAXES OF PINK1B9 FLIES. .................................................. 35 FIGURE 15. EXPRESSION OF HTRAP1 RESTORED MTDNA LEVELS IN PINK1B9 FLIES.................................................................... 36 FIGURE 16. HTRAP1 ELEVATED MITOCHONDRIAL COMPLEX I ACTIVITY AND THE LEVELS OF NDUFS3 IN PINK1B9 FLIES. .. 37 FIGURE 17. TRAP1 RESCUES THE STERILITY OF PINK1 MUTANT MALE FLIES....................................................................... 38 FIGURE 18. GENETIC INTERACTION OF PINK1 AND TRAP1 LOSS-OF-FUNCTION ALLELES. .......................................................... 40 FIGURE 19. EXPRESSION OF TRAP1 DID NOT INFLUENCE PHENOTYPES IN PARK

25 FLIES. .................................................. 42

FIGURE 20. EXPRESSION OF TRAP1 DID NOT MITIGATE MITOCHONDRIAL FUNCTION IN PARK25 FLIES. ..................................... 43 FIGURE 21. ATP LEVELS AND MITOCHONDRIAL FRAGMENTATION IN PINK1-SIRNA & PARKIN-SIRNA SH-SY5Y CELLS. ... 44 FIGURE 22. TRAP1 RESTORED ATP LEVELS IN L3 LARVE OF NDUFB1-KNOCK-DOWN FLIES. .................................................. 46 FIGURE 23. PHENOTYPES INDUCED BY TRAP1 LOSS-OF-FUNCTION IN TRAP14 FLIES. .................................................................. 47 FIGURE 24. NDI1P RESCUED TRAP1 LOSS-OF-FUNCTION. ................................................................................................................. 48 FIGURE 25 TRAP1 PROTECTS THE FUNCTION/INTEGRITY OF MITOCHONDRIAL COMPLEX I. ......................................... 56 FIGURE 26. PUTATIVE ROLE(S) OF TRAP1 IN PD. ...................................................................................................................... 58

vii

List of Tables

TABLE 1 LIST OF PD CAUSAL GENES (SELECTION OF GENES) .............................................................................................................. 4 TABLE 2 LIST OF USED FLY STRAINS ................................................................................................................................................ 12 TABLE 3 INDEX OF CHEMICALS, ENZYMES, AND CONSUMABLE MATERIAL....................................................................................... 14 TABLE 4 INDEX OF BUFFER AND SOLUTIONS ........................................................................................................................................ 16 TABLE 5 INDEX OF USED KITS ................................................................................................................................................................. 17 TABLE 6 INDEX OF USED EQUIPMENTS .................................................................................................................................................. 17 TABLE 7 INDEX OF OLIGO NUCLEOTIDES ............................................................................................................................................... 23 TABLE 8 INDEX OF USED ANTIBODIES .................................................................................................................................................... 25 TABLE 9. HTRAP1

WT RESCUES SILENCING OF MITOCHONDRIAL COMPLEX SUBUNITS ....................................................... 45

TABLE 10. A GENETIC SCREEN ON MITOCHONDRIALLY FUNCTIONAL PROTEINS BY LETHALITY .................................. 70

viii

List of Abbreviations

Abbreviation Denotation

Acetyl CoA Acetyl coenzyme A

ATP Adenosine triphosphate

CG Computed Gene

CoQ Coenzyme Q

DA Dopamine

DCIP Sodium 2,6-dichloroindophenolate hydrate

d.p.e. days post eclosion

ddc Dopa decarboxylase-Gal4 driver,

DEPC Diethylpyrocarbonat

dNTPs Deoxynuctleoside triphophates

DRP1 Dynamin-related protein 1

DTNB 5,5’-dithio-bis(2-nitrobenzoic acid; 3-carboxy-4-nitrophenyl disulfide

EDTA Ethylene diamine tetraacetic acid, disodium salt

eIF2α Eukaryotic translation initiation factor 2α

ER Endoplasmic reticulum

EtBr Ethidium bromide

ETC Electron transport chain

EtOH Ethanol

HPLC High performance liquid chromatography

hTrap1 Human Trap1

K2HPO4 di-Potassium hydrogen phosphate

KAc Potassium acetate

kDa Kilodalton

KH2PO4 Potassium dihydrogen phosphate

LBs Lewy bodies

LiCl Lithium chloride

LNs Lewy neurites

LRRK2 Leucine-rich repeat kinase 2

MDVs Mitochondria-derived vesicles

MIM Mitochondrial inner membrane

min Minutes

MOM Mitochondrial outer membrane

MPP Mitochondrial processing peptidase

MPTP 1-Methyl-4-phenyl-1,2,3,6-tetrahydropyridine

mtDNA Mitochondrial DNA

ix

MTS Mitochondrial targeting sequence

NaCl Sodium chloride

NADH Nicotinamide adenine dinucleotide

NDUFS NADH dehydrogenase (ubiquinone) Fe-S protein

PAGE Polyacrylamide gel electrophoresis

PARL Presenilinassociated rhomboid-like protease

PCR Polymerase chain reaction

PD Parkinson’s disease

PFA Paraformaldehyde

PINK1 PTEN-induced kinase 1

qPCR Quantitative polymerase chain reaction

RIPA Radio immunoprecipitation assay

RNAi RNA interference

ROS Reactive oxygen species

SDS Sodium dodecyl sulphate

shRNA Short hairpin RNA

siRNA Small interfering RNA

SNCA Synuclein, alpha (non A4 component of amyloid precursor)

SNpc Substantia nigra pars compacta

SQSTM1 Sequestosome 1

TBS Tris buffered saline

TCA cycle Tricarboxylic acid cycle

TEMED N,N,N’,N’‐Tetramethylethylendiamide

TIM23 Translocase of mitochondrial inner membrane 23

TOM70 Translocase of mitochondrial outer membrane 70

TRAP1 TNF receptor-associated protein 1

Tris-Base Tris (hydroxymethyl) aminomethane

UAS Upstream-activating sequence

UCHL1 Ubiquitin carboxyl-terminal esterase L1

UPS Ubiquitin-proteasomal system

VDAC1 Voltage-dependent anion channel 1

VDRC Vienna Drosophila RNAi Center

w White

WT Wild type

y Yellow

yr Years old

x

Abstract

Loss-of-function mutations in the genes Pink1 and parkin cause recessive, early-onset

Parkinson’s disease (PD). In Pink1/parkin-linked PD patients, mitochondrial function is

impaired. Recent findings imply that PINK1 and Parkin facilitate mitochondrial quality

control and target damaged or depolarized mitochondria for degradation via mitophagy. Thus,

impaired mitophagy is considered to contribute to PD etiology in Pink1/parkin-linked PD.

Pink1 coded PTEN-induced Kinase 1 (PINK1) is a mitochondrial serine/threonine kinase. In

SH-SY5Y cells, overexpression of PINK1 protects from oxidative stress by suppressing

mitochondrial Cytochrome C release, thereby preventing cell death. Interestingly, the

protective effects of PINK1 depend on phosphorylation of the downstream factor TNF

receptor-associated protein 1 (TRAP1). In the absence of TRAP1, the protective effects of

PINK1 overexpression are abolished. Furthermore, TRAP1 has been shown to miti ate α-

Synuclein-induced toxicity. These data suggest that TRAP1 might be an important factor in

PD acting downstream of PINK1.

To gain more insights in TRAP1 function, I asked whether overexpression of TRAP1 rescues

Pink1 and/or parkin deficiency. My data suggest that TRAP1 mediates protective effects on

mitochondrial function in pathways that are affected in PD. TRAP1 rescues dysfunction

induced by Pink1 deficiency in vivo and in vitro. Especially, I show that overexpression of

human Trap1 is able to mitigate Pink1 but not parkin loss-of-function phenotypes in

Drosophila. Moreover, TRAP1 was able to rescue mitochondrial fragmentation and

dysfunction upon siRNA silencing of Pink1 but not parkin in human neuronal SH-SY5Y

cells. In addition, detrimental effects observed after RNAi-mediated silencing of

mitochondrial complex I subunits were rescued by TRAP1 in Drosophila. Expression of

Ndi1p, the only protein in yeast that determines complex I activity, rescued Trap1 loss-of-

function induced phenotypes in flies. Thus the data suggest a functional role of TRAP1 in

maintaining mitochondrial function downstream of Pink1 and mitochondrial complex I

deficits but parallel or upstream of Parkin and independent of mitophagy via the

PINK1/Parkin pathway. It has been reported that α-Synuclein interacts with complex I and

impairs the function of complex I, and that expression of some complex I subunits also

rescues Pink1 loss-of-function situations in flies. Therefore, I hypothesize that TRAP1 acts to

maintain complex I function and in this way is protective against either overexpression of α-

Synuclein or Pink1 loss-of-function induced toxicity. This offers a new pathway to slow or

even stop the progression of neuronal degeneration in PD.

Chapter 1 - Introduction 1

1 Introduction

1.1 Overview of Parkinson’s disease

Parkinson’s disease (PD) is the second most common neurode enerative disease, after

Alzheimer’s disease (AD). The prevalence of PD rises from 1% at 65 years old (yr) to 5% at

85 years (Shulman et al. 2011). Thus, age has been considered as a prominent risk factor of

PD.

PD is characterized by bradykinesia, resting tremor, rigidity and postural instability (Shulman

et al. 2011). Apart from motor abnormalities, PD’s clinical manifestations include depression

(Aarsland et al. 2012), dementia (Aarsland et al. 2005), pain (Wasner & Deuschl 2012),

olfactory dysfunction (Doty 2012), visual hallucination (Barnes & David 2001) and disturbed

sleep (Peeraully et al. 2012).

These symptoms are, at least partially, believed to be caused by a loss of dopaminergic

neurons in the substantia nigra pars compacta (SNpc) in the midbrain (Pakkenberg et al. 1991,

Damier et al. 1999). The lesion in the SNpc in PD patients causes a severe depletion of

striatal dopamine (DA), which is considered to cause the symptoms observed in PD patients

(Obeso et al. 2000). Accordingly, most current therapies for PD are based on exogenous

replacement of DA within the striatum, for example, L-Dopa administration. Although, such

treatments improve most symptoms, they do not impede the progression of

neurodegeneration. This is thought to be the main cause why these therapies lose efficacy

with time (Marsden & Parkes 1977). This dissatisfaction of disease modifying PD treatment

primarily results from a lack of knowledge about the cellular/molecular mechanism in PD

etiology. With better mechanistic understanding of the PD, it might be possible to stop or

even prevent the degeneration of dopaminergic neurons, and thereby the progression of PD.

1.2 Pathological hallmarks

Till now, two key pathological hallmarks are known in brains of PD patients: Lewy bodies

(LBs)/Lewy neurites (LNs) and impairment of mitochondrial function, particularly of

mitochondrial complex I.


LBs and LNs are accumulation of fibrous protein deposits in neuronal cytoplasm (LBs) and

nerve fibres (LNs) in the brain (Gibb & Lees 1988). α-Synuclein (α-Syn) has been identified

as the primary component of LBs/LNs (Spillantini et al. 1997, Baba et al. 1998). Although α-

Syn has been reported to be involved in synaptic traffic of vesicles, the specific function(s) of

α-Syn is(are) still elusive (Maroteaux et al. 1988).

LBs and LNs mainly consist of accumulated α-Syn and are present in both familiar and

idiopathic variants of PD (Polymeropoulos et al. 1997, Spillantini et al. 1997). Accordingly,

LB and LN are considered as cardinal pathological features of PD (Hughes et al. 2001).

αSyn inclusions emerge in a predictable order in different regions of the brain with the

progression of the disease, starting from olfactory bulb and/or the dorsal motor nucleus of the

glossopharyngeal and vagal nerves (loss of smell), later reaching the medulla oblongata and

the pontine tegmentum, followed by reaching the amygdala and the substantia nigra (onset of

motor symptoms) and the temporal cortex, finally spreading the neocortex (showing

cognitive problems) (Braak et al. 2003, Braak & Del Tredici 2009). In addition, recent

investigations have shown a neuron-to-neuron “spread” of α-Syn in rodent brains (Kordower

et al. 2008, Freundt et al. 2012, Rey et al. 2013, Braak et al. 2004, Eisbach et al. 2013).

These findings susbstantiate the pathological finding that synucleopathies might spread

through connected brain regions.

Impairment of mitochondrial complex I is another biochemical hallmark of PD pathology. In

1982, drug addicts were found to develop acute, severe, permanent Parkinsonism after

inadvertent injection of 1-methyl-4-phenyl-1,2,3,6-tetrahydropyridine (MPTP), which was an

unintended side-product of a heroin analog (Langston et al. 1983, Calne & Langston 1983,

Langston et al. 1984). MPTP is a ‘protoxin’ that easily enters the brain where it is

metabolized by glia cells to the active toxin, 1-methyl-4-phenylpyridinium ion (MPP+). As a

substrate for the dopamine transporter, MPP+ is selectively transported into dopaminergic

neurons. Once inside a neuron, MPP+ accumulates in mitochondria and inhibits respiration at

the level of mitochondrial complex I (Langston et al. 1984). Thus, a mitochondrial complex I

toxin selectively acting in dopaminergic neurons is able to produce a Parkinsonian syndrome

in humans. Moreover, the MPP+-induced symptoms were astonishingly similar to symptoms

observed in typical ‘idiopathic’ PD.


This finding prompted researchers to wonder whether there was a defect of mitochondrial

complex I in PD patients. A specific defect of mitochondrial complex I (other complexes

were unaffected) has been firstly reported in necropsy specimens of substantia nigra from

patients with PD already in 1990 (Schapira et al. 1990, Schapira et al. 1989). The

mitochondrial complex I defects in PD appear to be systemic, also affecting tissues outside

the brain. Numerous studies have reported reduced mitochondrial complex I activity in

platelets and skeletal muscle samples from live PD patients (Bindoff et al. 1989, Parker et al.

1989, Haas et al. 1995, Krige et al. 1992, Yoshino et al. 1992). Therefore, a loss of

mitochondrial complex I activity seems to be typically associated with PD.

In line with these findings, rats infused with rotenone, a classical, high affinity inhibitor of

mitochondrial complex I, showed selective degeneration of the substantia nigra dopaminergic

neurons (Betarbet et al. 2000). Many of those dying neurons presented large cytoplasmic

inclusions containing αSyn, which resembled LBs. Behaviorally, rotenone-infused rats

developed symptoms of Parkinsonism, such as bradykinesia and rigidity. Accordingly,

rotenone infusion is capable to recapitulate the anatomical, biochemical, pathological, and

behavioral features of PD. These findings further support the assumption that defects in

mitochondrial complex I can cause Parkinsonism. Although rotenone is administered

systemically, dopaminergic neurons of the substantia nigra are the first cells to react as these

cells are especially sensitive to mitochondrial complex I defects (Greenamyre et al. 2001).

1.3 Genetics of PD

Although LBs/LNs (αSyn inclusions) and impairment of mitochondrial complex I were

observed in dying dopaminergic neurons in the substantia nigra, the cause(s) of neuronal

death in PD remain(s) unknown. Environmental factors, such as exposure to toxins (MPTP,

rotenone) or ageing, were thought to be the main factor contributing to PD. However,

accumulating evidences strongly suggest that genetic factors contribute to PD, as well.

Although the vast majority of PD cases are not directly inherited, susceptibility to PD is

increased in first-degree relatives (parents, siblings, and offspring) of both sporadic and

familial cases (Marder et al. 1996). With the advantage of modern human genome sequence

technologies and studies on families in which many members have developed PD, PD causal

genes were found. Genetic abnormalities in a PD causal gene alone, without the influence of

other genes or environmental factors, will cause PD. A list of PD causal genes is shown Table


1. Mutations in the genes SNCA (Spillantini et al. 1995), Lrrk2 (Zimprich et al. 2004) and

UCHL1 (Maraganore et al. 2004) cause autosomal dominant forms of late-onset

Parkinsonism (affecting patients over the age of 50). In contrast, mutations in parkin (Kitada

et al. 1998), Dj-1 (Bonifati et al. 2003b), Pink1 (Valente et al. 2004), and ATP13A2 (Ramirez

et al. 2006) cause autosomal recessive early-onset Parkinsonism (affecting patients before the

age 50). In the present study, I focused on SNCA, parkin and Pink1. Therefore, these genes

and the function of their gene products are presented in more detail.

Table 1 List of PD causal genes (Selection of genes) Locus Gene Name of

Protein

Protein function Age of onset

(years old)

Clinical phenotpye

Dominant

PARK1/4

(4q21-23) SNCA α-Syn Synaptic protein Duplications:

38-65

Triplications:

24-48

Point mutations

Typical PD, sometimes

associated with cognitive

decline, autonomic

dysfunction and dementia

PARK5

(4p14) UCHL1 UCHL1 Hydrolyze small C-

terminal adducts of

ubiquitin

55-58

(Ile93Met)

Only one family reported so

far

PARK8

(12p12-

q13.1)

LRRK2 LRRK2 Multiple functions 50-70

(range, 32-79)

Typical PD

Recessive

PARK2

(6q25.2-

q27)

parkin Parkin Ubiquitin protein

ligase

30 on average

(range, 16-72)

Mutations account for 50%

familial juvenile and early-

onset parkinsonism, sporadic.

With sleep benefit.

PARK6

(1p35-

p36)

Pink1 PINK1 Mitochondrial

kinase

20-40 Mutations account for 1-2%

familial juvenile and early-

onset parkinsonism, sporadic.

With sleep benefit.

PARK7

(1p36) Dj-1 DJ-1 Oxidative stress

protection

20-40 Mutations account for <1%

early-onset parkinsonism

PARK9

(1p36) ATP13A2 ATPase

type 13A2

Lysosomal protein <20 Juvenile and early-onset

parkinsonism with pyramidal

degeneration and dementia

1.3.1 Autosomal dominant PD-causal gene, SNCA

The SNCA gene was firstly identified as a dominant PD causal gene (Spillantini et al. 1995).

Interestingly, the SNCA gene encodes α-Syn, which has been identified as the primary

component of LBs/LNs (Spillantini et al. 1997, Baba et al. 1998). Mis-sense mutations in α-

Syn like A30P, E46K and A53T have been linked to familial Parkinsonism (Polymeropoulos

et al. 1997, Kruger et al. 1998). SNCA duplication has been found in PD families who

showed late-onset slow-progressing Parkinsonism without cognitive decline. In contrast,

families with SNCA triplication developed early-onset Parkinsonism with dementia (Chartier-


Harlin et al. 2004, Singleton et al. 2003). This indicates a dosage-dependent effect of SNCA-

encoded α-Syn in the disease progression of PD.

1.3.2 Autosomal recessive PD-causal gene, parkin

Mutations in parkin have been identified in 50% of patients with autosomal recessive

juvenile-onset PD (AR-JP) (affecting patients before the age 20) and 77% of apparently

sporadic cases with disease onset before the age of 20 (Kitada et al. 1998, Lucking et al.

2000, Fitzgerald & Plun-Favreau 2008). PD patients with mutations in parkin suffer a slow

progression of PD frequently associated with early-onset dystonia (Schapira 2008), but most

of the patients lack LBs (Hayashi et al. 2000). If at all, LBs appear in some later onset cases

(Farrer et al. 2001, Pramstaller et al. 2005). Parkin encodes an E3 ubiquitin ligase, an

essential component of the ubiquitin-proteasomal system (UPS). Parkin localizes

predominantly to the cytosol and cellular vesicles, but has been found to also associate with

the mitochondrial outer membrane (MOM) (Darios et al. 2003, Shimura et al. 2000, Kubo et

al. 2001).

1.3.3 Autosomal recessive PD-causal gene, Pink1

Mutations in Pink1 are the second most-common cause of autosomal recessive PD after

parkin (Fitzgerald & Plun-Favreau 2008). Initially, three pedigrees were described with

mutations in the Pink1 gene: an amino acid substitution G309D in one family and a

truncation mutation (W437X) in two additional families (Pridgeon et al. 2007, Zhou et al.

2008, Becker et al. 2012, Valente et al. 2004). Subsequently, several studies have described

other pathogenic mutations in Pink1 (Tan & Skipper 2007). Patients with Pink1 mutations

respond well to L-Dopa treatment but do not suffer from dystonia at disease onset (Healy et

al. 2004).

PINK1, encoded by the Pink1 gene, is a serine/threonine kinase (Pridgeon et al. 2007, Zhou

et al. 2008, Becker et al. 2012, Valente et al. 2004). PINK1 is located in the mitochondrial

membranes in human brain tissue, as well as a cytoplasmic pool (Gandhi et al. 2006,

Weihofen et al. 2008, Haque et al. 2008).

PINK1 has been reported to be involved in numerous pathways. Among those pathways, the

so-called PINK1/Parkin pathway is the most well known. In 2006, two independent groups

generated Pink1 mutant fly lines (Clark et al. 2006, Park et al. 2006). Pink1 mutant flies


displayed many phenotypes, closely resembling the phenotypes observed in parkin mutant

flies (Clark et al. 2006, Park et al. 2006, Yang et al. 2006). This suggested that the two

proteins might act in one molecular pathway. Interestingly, overexpression of parkin rescued

abnormal phenotypes in Pink1 loss-of-function flies. In contrast, overexpression of Pink1 did

not mitigate phenotypes caused by parkin loss-of-function. This implies that PINK1 and

Parkin indeed function in a common pathway and that Pink1 acts upstream of parkin. Of note

here is that PD patients with Pink1 or parkin mutations also exhibit overlapping clinical

symptoms (Ibanez et al. 2006).

Very recently, the mechanism of the PINK1/Parkin pathway became unveiled. PINK1 and

Parkin function together to monitor the quality of the mitochondrial population. Under

healthy conditions, full-length PINK1 is synthesized in cytoplasm. According to the N-

terminal mitochondrial localization sequence, PINK1 is imported through MOM via

translocase of MOM 70 (TOM70) complex and then through mitochondrial inner membrane

(MIM) via the translocase of MIM 23 (TIM23) (Lazarou et al. 2012, Kato et al. 2013). In the

mitochondrial matrix PINK1 is cleaved by mitochondrial processing peptidase (MPP) and

presenilinassociated rhomboid-like protease (PARL), and released to the cytosol for

proteasomal degradation (Becker et al. 2012, Greene et al. 2012, Jin et al. 2010, Yamano &

Youle 2013). The import of PINK1 to the inner mitochondrial membrane requires polarized

mitochondria. Thus, in the presence of mitochondria with an intact membrane potential,

PINK1 is rapidly degraded (Figure 1A).

In contrast, damaged mitochondria trigger the accumulation of full-length PINK1 at the

MOM in case of, either by a depletion of mitochondrial membrane potential, accumulation of

mitochondrial misfolded protein in the mitochondrial matrix or oxidative damage (Vives-

Bauza et al. 2010b, Jin & Youle 2013). Full-length PINK1 on the MOM recruits Parkin to

these damaged mitochondria (Geisler et al. 2010, Kawajiri et al. 2010, Michiorri et al. 2010,

Narendra et al. 2010b, Narendra et al. 2010a, Vives-Bauza et al. 2010a) and also

phosphorylates ubiquitin for activation (Kane et al. 2014, Koyano et al. 2014, Kazlauskaite et

al. 2014). As a consequence, Parkin initiates the ubiquitination on numerous mitochondrial

targets. In this way, abundant downstream pathways are switched on or off, such as

mitochondrial transport (off, to halt the damaged mitochondria), mitochondrial fusion (off, to

prevent damaged mitochondria to fuse and thereby alter other healthy mitochondria) and

mitophagy or mitochondria-derived vesicles (MDVs) (Gegg et al. 2010, Tanaka et al. 2010,


Poole et al. 2010, Glauser et al. 2011, Chen & Dorn 2013, Klionsky 2010, Wang et al. 2011,

Geisler et al. 2010, McLelland et al. 2014) (Figure 1B).

Strong stimulation of the PINK1/Parkin pathway in response to low mitochondrial membrane

potential or accumulation of misfolded proteins causes the targeting of damaged

mitochondria to mitophagy (Klionsky 2010, Wang et al. 2011, Geisler et al. 2010). In

contrast, only mild stimulation, such as mild oxidative damage, the PINK1/Parkin pathway

mediates MDVs to sort out just the damaged parts for degradation by lysosomes (McLelland

et al. 2014).

Intriguingly, in addition to Parkin, PINK1 is also known to interact with several other

proteins encoded by PD-linked genes. DJ-1 forms a complex with PINK1 and Parkin to

degrade Parkin substrates (Xiong et al. 2009). In addition, α-Syn-induced mitochondrial

fragmentation is rescued by PINK1, but not the PD-associated mutation PINK1G309D

(Kamp

et al. 2010). Therefore, PINK1 seems to play a central role in the etiology of PD. Thus,

understanding the endogenous functions of the cellular mechanisms regulated by PINK1 will

help in the future design of PD therapies.

PINK1 has also been shown to affect mitochondrial complex I activity. Pink1 deficiency or

clinical mutations in the gene cause reduced mitochondrial complex I activity in rat and

Drosophila (Morais et al. 2009, Park et al. 2006). Phenotypes in Pink1 deficient flies can be

rescued by the expression of Saccharomyces cerevisiae Ndi1p (an enzyme that bypasses

mammalian ETC complex I), but not by sea squirt Ciona intestinalis AOX (an enzyme

bypassing mammalian ETC Complex III and IV). In contrast, expression of Ndi1p failed to

rescue any of the parkin mutant phenotypes in flies, and flies deficient for parkin did not

show reduced activity of complex I. In summary, these data suggest that mitochondrial

complex I acts downstream of Pink1, but upstream or independent of Parkin (Vilain et al.

2012). This assumption is further supported by the finding that flies deficient for certain

mitochondrial complex I subunits display phenotypes similar to Pink1 deficient flies, which

suggest strong genetic link between Pink1 and mitochondrial complex I (Vilain et al. 2012).


Figure 1. PINK1/Parkin pathways.

(A) In healthy mitochondria, after being synthesized in cytoplasm, PINK1 translocates to

mitochondria and stops at MOM. As a result of mitochondrial membrane potential (ΔΨm), PINK1 is

imported through the MOM via TOM70, and docks at TIM23 complex on the MIM. In case of

depolarized mitochondria, PINK1 is cleaved by the matrix proteases MPP and PARL. Cleaved

PINK1 is released to the cytosol for proteasomal degradation. In damaged mitochondria, newly

synthesized PINK1 accumulates on the MOM. (B) Accumulation of PINK1 is required to recruit

Parkin to damaged mitochondria. This recruitment probably involves increasing amounts of

phosphorylated ubiquitin, another direct target of PINK1. Recruited to the mitochondria, Parkin

ubiquitinates several targets to prevent the damaged mitochondria from fusing with other healthy

mitochondria. Finally, Parkin initiates either mitophagy to clear the damaged mitochondria, or MDVs

to remove only damaged parts of mitochondria.

1.4 Mitochondrial dysfunction theory

As mentioned, deficiency of ETC in mitochondria has been reported in PD (Schapira et al.

1990, Schapira et al. 1989, Parker et al. 2008, Parker et al. 1989, Haas et al. 1995, Krige et al.

1992, Yoshino et al. 1992, Bindoff et al. 1989), and inhibitors of the ETC, such as Rotenone

or MPTP cause Parkinsonian symptoms (Langston et al. 1983, Calne & Langston 1983,

Langston et al. 1984, Betarbet et al. 2000, Greenamyre et al. 2001). Therefore, it is generally

accepted that mitochondrial dysfunction at least contributes to PD pathology.


In addition, accumulating evidence strengthened the idea that mitochondrial dysfunction is a

critical event in PD pathology. Mitochondria are key regulators of cell survival and have a

central role in ageing, which is the highest risk factor for PD. Mitochondria are thought to

contribute to ageing through the accumulation of mitochondrial DNA (mtDNA) mutations

and production of reactive oxygen species (ROS). Oxidative stress and mtDNA damage have

been commonly detected, especially in substantia nigra neurons, and are thought to induce

the degeneration of dopaminergic neurons of PD patients (Gu et al. 1998, Ikebe et al. 1990,

Jenner et al. 1992, Bender et al. 2006).

Moreover, proteins encoded by several PD-genes have indispensable roles for mitochondrial

function. As mentioned, PINK1 and Parkin monitor the quality of mitochondrial population.

DJ-1 is protective against oxidative stress. Consequently, this anti-oxidative stress function

keeps mitochondria healthy and prevents cell death (Taira et al. 2004, Menzies et al. 2005).

α-Syn induces mitochondrial fragmentation (Kamp et al. 2010). Moreover, α-Syn has been

reported to associate with, and thereby inhibit mitochondrial complex I activity. This in turn

causes increased production of ROS, causing additional damage to the ETC (Devi et al.

2008).

1.5 A modifier of α-Syn-induced toxicity, Trap1

Despite the knowledge of the hallmarks of PD pathology and the theory of mitochondrial

dysfunction, the cause(s) of PD is(are) still indistinct. To gain insights in the role of α-Syn in

PD etiology, an unbiased, genome-wide screen for genetic modifiers of α-Syn-induced

toxicity was conducted (Butler et al. 2012). This screen utilized a Drosophila (fruit fly)

model.

The fruit fly is a reliable model to study α-Syn-induced toxicity. Albeit flies do not possess a

SNCA ortholog, human SNCA transgenic flies carrying a disease causing mutation were

reported to present an impairment of locomotion as seen in humans (Feany & Bender 2000).

LBs-like inclusions in some neurons were also observed (Feany & Bender 2000). Moreover,

these SNCA transgenic flies showed age-dependent loss of dopaminergic neurons, while other

neurons appeared to be fairly unaffected (Feany & Bender 2000, Auluck et al. 2001). Thus,

the SNCA transgenic fly model closely recapitulated many of the characteristic features of PD.


Expression of the α-SynA53T

(a PD causing mutant variant of α-Syn) in flies also recapitulated

the key features of PD. Flies with α-SynA53T

expression in aminergic neurons (including

dopaminergic neurons as a subgroup) displayed shortened life span, reduced age-dependent

locomotion defects and reduced level of dopamine (Butler et al. 2012). Using the dopamine

level of brain as an indicator for the dysfunction of dopaminergic neurons, modifier(s) of α-

SynA53T

-induced toxicity were screened for. Among several other candidates, TNF receptor-

associated protein 1 (TRAP1) was found to modulating α-SynA53T

-induced toxicity. A

reduction of endogenous Trap1 (by 50%) strongly enhanced α-SynA53T

-induced toxicity,

whereas overexpression of human Trap1 in flies suppressed the toxicity (Butler et al. 2012).

TRAP1 is a mitochondrial molecular chaperone with similarity to heat shock protein 90

(Hsp90) (also called Hsp75). The domain structure of TRAP1 is very similar to Hsp90

(Figure 2). Although the proteins share a similar domain structure, they seem to function

slightly different. So far, there has no co-chaperone partner for TRAP1 identified (as it is for

the Hsp90s) and TRAP1 fails to execute the classical Hsp90 activity assays (Matassa et al.

2012).

Figure 2. The structure of TRAP1.

TRAP1, as a mitochondrial chaperone, contains a 59 amino acids N-terminal Mitochondria-Targeting

Sequence (MTS), an ATPase domain with four ATP-binding sites (ATP binding sites are located at

amino acid positions 119, 158, 171 and 205) and a C-terminal Hsp90-like domain (Matassa et al.

2012).

Interestingly, TRAP1 was also discovered as a substrate of PINK1 (Pridgeon et al. 2007,

Zhou et al. 2008, Becker et al. 2012, Valente et al. 2004). PINK1 binds and co-localizes with

TRAP1 in the mitochondria and PINK1 was shown to phosphorylate TRAP1 both in vitro

and in vivo (Pridgeon et al. 2007). Moreover, in the same study, they also found that PINK1

protects against oxidative-stress-induced cell death by suppressing cytochrome c release from

mitochondria. This protection depended on the phosphorylation of TRAP1 by PINK1.

Furthermore, the ability of PINK1 to promote TRAP1 phosphorylation and cell survival was

impaired by PD-linked PINK1 G309D, L347P, and W437X mutations.

1.6 Aim of study


On the one hand, TRAP1 rescues the toxicity caused by α-SynA53T

, a PD-linked mutant

variant of α-Syn. On the other hand, TRAP1 is a substrate of a serine/threonine kinase PINK1,

encoded by an autosomal recessive PD gene Pink1. Therefore, TRAP1 seems a crucial

molecular factor of PD as it connects autosomal dominant PD-causal gene SCNA to

autosomal recessive PD-causal gene Pink1.

In this study, I examined whether and how TRAP1 involved in the pathways/components

relating to PINK1 or α-Syn. In addition, I analyzed Trap1 to address its molecular

mechanism. Better understanding of TRAP1 is required to gain a more complete view of the

mechanism of PD. Finally, I hope that my research will unravel new pathways to slow or

even stop the progression of neuronal degeneration in PD.

Chapter 2 - Material and Methods 12

2 Material and Methods

2.1 Organism

2.1.1 Fly stocks

The fly stocks in this study are from Bloomington Drosophila Stock Center (BL), Vienna

Drosophila RNAi Center (VDRC) and National Institute of Genetics (Japan) (NIG-fly).

Unless otherwise noted, flies were raised on standard cornmeal medium at 25ºC. The fly

stocks used in this study are listed in Table 2.

Table 2 List of used fly strains

Symbol Genotype Detail Origin/Donor

Pink1B9

w*,Pink1B9

/FM7i, P{w+mC.ActGFP} Pink1 loss-of-function BL34749

Park25

(y)w;;park25

/TM3,Ser,Sb parkin loss-of-function Alex Whitworth

Trap14 w;Trap1

4 / (CyO) Trap1 loss-of-function Miguel Martins

Trap1KG

y

1w[67c23];P{y

+mDint2w

BR.E.BR= SUPor-

P}Trap1KG06242

Trap1 loss-of-function BL14032

Ndi1p w; P{w+mC

=UAS-Ndi1p} The Yeast mitochondrial

complex I Equivalent Patrik Verstreken

elav P{ w+mC.hs.GawB}elavC155 Pan-neuronal driver BL458

Da w*;;P{w+mW.hs

.Gal4-da.G32} Ubiquitous driver BL5460

white-RNAi w[*];;P{GD14981}v30033 Invert repeats of white VDRC30033

Trap1-RNAi w*;P{w

+mC=UAS-Trap1.B}4M/TM3,

Sb1

Invert repeats of Trap1 BL58766

Pink1-RNAi w1118

; P{GD11336}v21860/CyO Invert repeats of Pink1 VDRC21860

hTrap1WT

y[*],w[*];P(acman){w[+]=UAS-

hTRAP1/(CyO),

y[*],w[*];;P(acman){w[+]=UAS-

hTRAP1[WT]/(TM3, Sb)

UAS-hTrap1WT

Bestgene, strains:

9723 (28E7)

9732 (76A2)

hTrap1D158N

y[*],w[*];P(acman){w[+]=UAS-

hTRAP1/(CyO),

y[*],w[*];;P(acman){w[+]=UAS-

hTRAP1[D158N]/(TM3, Sb)

UAS-hTrap1D158N

Bestgene, strains:

9723 (28E7)

9732 (76A2)

2.1.2 UAS-Gal4 System

The UAS-Gal4 system is a widely used tool to express target gene(s) in specific tissues. Gal4

is a yeast transcriptional activator. A plethora of different Gal4-expressing lines (so called

drivers) are available in public stock centers. Using this well characterized set of drivers,

Gal4 expression can be restricted to virtually every cell type in a spaiotemporal manner.

Upstream-activating sequence (UAS) are the the target of Gal4. A given sequence under


control of UAS will only be expressed in presence of Gal4. Thus, by crosssing a specific

Gal4 driver to transgenes carrying a UAS-transgene, expression of the UAS-controlled

sequence mimicks Gal4 expression in the F1-generation. By choosing a suitable dirver,

spatiotemporal expression of UAS-controlled sequences is facilitated (Figure 3). The Gal4

drivers used in this study are listed in Table 2.

Figure 3. An overview of the UAS/Gal4 expression system. Target gene follows UAS sequence and only express when Gal4 binds on UAS. Gal4 with a tissue

specific expression enhancer expresses only in certain tissue. Thus, only in Gal4-driven tissue, Gal4 is

expressed and binds to UAS, thus target gene is translated.

2.1.3 siRNA in fly

The UAS/Gal4 system can also be used to knock down a specific gene in certain tissue by

inducing transgenic RNAi. Instead of a target gene under UAS control, a short gene

fragments (300-400bp) as inverted repeats (IR) in the antisense-sense orientation is inserted

in a modified pUAST vector pMF3 and then transfected into fly. In Gal4 driven tissue, the IR

is transcripted into hairpin RNAs (hpRNAs), which later is cleaved into siRNA by a dicer

(Figure 4). Next, the siRNAs target at the endogenous mRNA of the target gene, and in this

way the target mRNA is degraded and the expression of target gene is halted.


Figure 4. Transgenic RNAi in Drosophila.

The UAS/Gal4 system is used to drive the expression of a hairpin RNA (hpRNAs), which is coded by

inverted repeat sequence. Dicer processes these double-stranded RNAs into siRNAs, which direct

sequence-specific degradation of the target mRNA.

2.1.4 Transgenic flies

Transgenic flies carrying UAS-hTRAP1 (wild-type and D158N) on second and third

chromosomes were generated by BestGene, Inc. using sitedirected integration (on second

location 28E7, strain 9723;on third location 76A2, strain 9732) (Butler et al. 2012).

2.2 Chemicals, Enzymes, and Consumable Material

Table 3 Index of chemicals, enzymes, and consumable material

Name Source & Number

Acetyl CoA(acetyl coenzyme A) lithium salt, C23H38N7O17P3S Li SIGMA, A2056-5MG

Acetic acid, CH3COOH MERCK, 1.00063.1000

LE Agarose PeQlab, 35-1020

Antimycin-A Fluka, 10792-5MG

APS (ammonium peroxodisulfate) ROTH, 9592.2

ATP (Adenosine- 5'-triphosphate), C10H14N5O13P3Na2 SIGMA, A-7699-1G

BSA (Bovine serum albumin) SIGMA, A9418-10G

Chloroform, CHCl3 ROTH, 3313.1

Complete™ Protease Inhibitors Roche, 11873580

DCIP (2,6-dichloroindophenolate hydrate), C12H7Cl2NO2•xH2O SIGMA, 119814-5G

Decyl-Ubiquinone, C19H30O4 SIGMA, D7911-10MG

DEPC (Diethylpyrocarbonat) ROTH, K028.1


DMSO, C2H6OS ROTH, A994.2

DNA ladder (100bp, 1kb), Fermentas, GeneRulerTM

DNA loading Buffer 6 × Thermo, R0611

dNTPs (Deoxynuctleoside triphophates Mix 10 mM) Fermentas, R0193

DTNB (5,5’-dithio-bis(2-nitrobenzoic acid; 3-carboxy-4-

nitrophenyl disulfide, Ellman’s rea ent), C14H8N2O8S2 SIGMA, D-8130-5g

EDTA (ethylene diamine tetraacetic acid), disodium salt, dehydrate,

C10H14N2O8Na2•2H2O MERCK, 1.00944.1000

EtOH (Ethanol), C2H5OH, ≥ 99.8% p.a. ROTH, 9065.4

EtBr (Ethidium bromide) ROTH, Art.2218.1

Fluoromount Southern Biotech, 0100-01

Glycine, H2NCH2COOH, ≥ 99% p.a. ROTH, 3908.2

Lithium chloride (LiCl) MERCK, Art. 5675

KAc (Potassium acetate), CH3COOK MERCK 1.04820.1000

KH2PO4 (Potassium dihydrogen phosphate) MERCK, 1.04873.1000

K2HPO4 (di-Potassium hydrogen phosphate) MERCK, 1.05099.1000

Isopropanol, (CH3)2CHOH ROTH, T910.1

ß-mercaptoethanol, C2H6OS ROTH, 4227.3

Methanol, CH3OH ROTH, 717.1

Methyl benzoate, C8H8O2 MERCK, 822330.1000

NaCl (Sodium chloride), ≥ 95.5% p.a. ROTH, P029.2

NADH (Nicotinamide adenine dinucleotide), C21H27N7O14P2Na2 Roche, 10128015001

Oxalacetic acid (oxobutanedioic acid), C4H4O5 SIGMA, O4126-1G

PFA (Paraformaldehyde) ROTH, 0335.2

Proteinase K ROTH, 7588.1

RNase Inhibitor Fermentas, EO0381

Rotenone, C23H22O6 SIGMA, R8875-5G

SDS (Sodium dodecyl sulphate, AccuGene), 10% Cambrex, 51213

Silk milk ROTH, T145.2

Succinate, C4H4O4Na2• 6H2O SIGMA, S-5047 1008

Sucrose ROTH, 4621.1

Sodium citrate MERCK, 1.06448.0500

Taq polymerase Genecraft, GC-002-1000

TEMED, C6H16N2, N,N,N’,N’‐Tetramethylethylendiamide Applichem, A1148,0100

Triethanolamine (2,2’,2’’-nitrilotriethanol), C6H15NO3 ROTH, 6300.1

Tris-Base, NH2C(CH2OH)3, (Tris(hydroxymethyl)aminomethane), ≥ 99.3%

ROTH, AE15.2

Triton X-100, C34H62O11 ROTH, 3051.3


Tween 20, C58H114O26 ROTH, 9127.1

TRIZOL-Reagent pepGOLD TriFast TM Ambion, 15596026

2.3 Buffers and Solutions

Table 4 Index of buffer and solutions

Description Constitution Application

10mM Tris-HCl pH7.6 12.1 g/l Tris-HCl pH 7.6 H2O Mitochondria isolation

mitochondrial complex I

Incubation Buffer

0.25M pH 7.4 Potassium phosphate Buffer

Bovine serum albumin (BSA) 3,5 g/l,

DCIP 60 µM,

Decyl- Ubichinon in DMSO, 70 µM,

Antimycin-A in DMSO 1 µM,

mitochondrial complex

I activity measurement

0.1M, pH 7.4,

Potassium phosphate

Buffer (200 ml),

3.8 ml, 1M KH2PO4, 16.2 ml, 1M

K2HPO4, 180 ml H2O

DNA Extraction buffer 10 mM Tris-HCl pH 8.2, 1 mM EDTA, 25

mM NaCl, 0.2 µg/µl Proteinase K

Genomic DNA

isolation

Drosophila Ringer 182 mM KCl, 46 mM NaCl, 3 mM CaCl2

x 2 H2O, 10 mM Tris pH 7.2

LiCl/KAc Solution 5M KAc: 6M LiCl, Volume 1 : 2.5

TE Buffer (1L) 10 ml 1 M Tris pH 8.0, 200 µl 0.5 M

Na2EDTA pH 8.0, add H2O to 1 L

TAE Buffer (1L) 242 g Tris Base, 100 ml 0.5 M Na2EDTA,

pH 8.0, 57.1 ml glacial acetic acid, add

H2O to 1 L

DNA, cDNA analysis

Western Blot Running

Buffer

0.1 M Tris, 1 M Glycine and 0.5% SDS Western blot

Western Blot Semi-Dry

Buffer

25 mM Tris, 192 mM Glycine, 20%

Methanol

SDS PAGE running Buffer 0.4% SDS, 1.5 M Tris, pH 8.8

SDS PAGE stacking Buffer 4% SDS, 0.25 M Tris, pH 6.8

Tris Buffered Saline (TBS)

Buffer

25 mM Tris, 140 mM NaCl, pH 7.5

TBST Buffer 25 mM Tris, 140 mM NaCl, pH 7.5, 0.05%

Tween

Blocking Buffer 5% silk milk in TBST

Laemmli buffer (SDS

PAGE sample buffer)

1.25% Bromphenol Blue, 50% Glycerol,

EDTA 10 mM, 10% SDS, 250 mM Tris,

pH 6.8, ß- Mercaptoethanol 5%,


Protein Extraction Buffer

RIPA

70 mM HEPES, pH 7.5, 100 mM KCl, 10

mM EDTA, 70 mM ß –glycerophophate,

0.1 mM Na3NO4 pH 11, 5% glycerin,

Triton X-100

Protein extraction

2.4 Kits

Table 5 Index of used kits

Description Application Origin

iQTM SYBR R Green Supermix Real-time PCR BIO-RAD, 170-8882

iScriptTM

Select cDNA synthesis Kit Reverse Transcription BIO-RAD, 170-8897

Mitochondria Isolation Kit Mitochondria extraction Sigma, MITOISO1

ATP Bioluminescence Assay Kit HS II ATP content Roche, 11699709001

Qiagen RNeasy Mini Kit RNA purification Qiagen, 74106

2.5 Equipments

Table 6 Index of used equipments

Description Application

Dissecting microscope SZX10 with ring light S80-55 RL and camera SC30,

Olympus, Germany

Documentation microscope BX51, Olympus, Germany

Camera for microscopy documentation DP72, Olympus, Germany

UV-light source X-Cite® 120 Q, Olympus, Germany

Homogenisator Speedmill P12 Analytik Jena AG, Germany

PCR Cycler T Professional Basic, Biometra Germany

Western blot documentation Alliance LD4.777.WL.Auto, Biometra, Germany

UV documentation UV Solo TS, Biometra, Germany

UV Transilluminator UVStar 20, Biometra, Germany

Scanning electron microscope ESEM XL 30 FEG, FEI, Netherlands

Photometer Plate reader infinite M200, Tecan, Switzerland

Real-time PCR Cycler BIO-RAD, MyiQTM

2 Two color Detection System

2.6 Fly behaviors/ phenotype assays

2.6.1 Wing posture & Thorax indentation

Wing posture and thorax indentation were assessed by visual inspection, and the presence of

abnormal wing posture and indentations was scored regardless of severity or number. Both


assays were scored 5 days post eclosion (d.p.e.) with flies raised at 25ºC and shifted to 29ºC

after eclosion. In case of pan-neural (elav-Gal4 driver) induction of RNAi, wing posture

defects were scored 20 d.p.e. At least 100 flies of each genotype were tested.

2.6.2 Negative geotaxis

Negative geotaxis (climbing) analysis was performed 5 d.p.e. with flies raised at 25ºC and

shifted to 29ºC after eclosion. Groups of 10 flies per vial (2.5 cm diameter) were gently

tapped to the bottom and the number of flies crossing a line at 8 cm height within a time

period of 10 s was scored. Each analysis was repeated 10 times with 60 seconds resting

interval. The experiments were always conducted at the same time period of a day (between

10-11 am) to avoid the influence of circadian rhythm.

2.6.3 Longevity

Freshly hatched male flies of designed genotype were selected according to the relative

phenotype of corresponding genotype. Flies were maintained in vials and transferred to new

vials every 2 days and counted every day. 10 flies were maintained in each vial.

For stress study, 1 ml of 1% H2O2 in 5% sucrose or 5 mM Rotenone in 5% sucrose was

added to 3 pieces of round filter paper which were located at the bottom of the vial as food

source. Several drops of fresh 1% H2O2 in 5% sucrose or 5 mM Rotenone in 5% sucrose

were added each day. Dead flies were counted every day.

2.7 Mitochondrial analysis

2.7.1 ATP content

ATP Bioluminescence Assay Kit HS II from Roche company was applied. The luciferase

from Photinus pyralis (American firefly) in the kit catalyzes the following reaction:

ATP + D-luciferin + O2→ oxyluciferin + PPi + AMP + CO2 + light

The quantum yield for this reaction is about 90%. The resulting green light has an emission

maximum at 562 nm. The Michaelis equation has the following form:

light intensity = (Vmax × CATP)/(Km + CATP)


At low ATP concentrations (CATPm), the formula is simplified to light intensity = Vmax ×

CATP/Km. From this equation, it becomes obvious that the light output is directly proportional

to the ATP concentration (CATP), and is dependent on the amount of luciferase (Vmax) present

in the assay. Therefore, for maximum sensitivity, the sample ATP must be in a minimum

volume, and the luciferase reagent must not be diluted.

Figure 5. The principle of ATP measurement. ATP is catalyted by D-luciferin with the help of oxygen, to produce AMP, PPi, CO2, oyxluciferin and

light with an emission maximum at 562 nm. Then the emission can be read out by a photometer

reader.

Standard line was generated by four standard samples with ATP content of 10-8

, 10-9

, 10-10

,

10-11

mole. The readout of the sample was accorded to the standard line to find out the

according ATP content.

Figure 6. The ATP standard line for fly ATP assay. Standard line was created by samples with ATP content of 10

-8, 10

-9, 10

-10, 10

-11 moles. Then, the

readout of the sample was accorded to the standard line to caculate the according ATP content.

For flies, as described in Song Liu et al. 2010, 2 thoraxes of flies were dissected in lysis

buffer on ice and immediately homogenized in 100 μl lysis buffer for 1 min 30 sed. The

6,776036343

5,816229033

4,842184721

3,862787098 y = 0,9714x + 14,552

3,5

4

4,5

5

5,5

6

6,5

7

-11 -10,5 -10 -9,5 -9 -8,5 -8

log

10 B

iolu

min

escen

e

log10 ATP mole


sample was boiled at 95°C for 5 min before centrifuged at 4°C for 1 min with max speed. 2.5

μl clear lysis was added to 187.5 μl dilution buffer from the kit. 10 μl luciferase was added

shortly before the measurement.

2.7.2 Mitochondrial complex I activity analysis

Mitochondria Isolation Kit (Sigma) was applied for mitochondrial isolation from the whole-

amount fly. Intact mitochondria were isolated from 30 fresh flies according to the

manufacturer’s instructions. The final mitochondrial pellet was re-suspended in 60μl 10mM

Tris-HCl buffer, pH 7.6 and diluted to 1:10 in 10 mM Tris-HCl pH 7.6.

Mitochondrial complex I (NADH dehydrogenase) is an enzyme complex, locating in the

MIM. Mitochondrial complex I catalyzes the transfer of electrons from NADH to coenzyme

Q (CoQ).

NADH + H+ + CoQ + 4H

+in → NAD+

+ CoQH2 + 4H+

out

Mitochondrial complex I oxidizes NADH and the electrons produced reduce the artificial

substrate decyl-ubiquinone that subsequently delivers the electrons to 2,6-

dichloroindophenolate (DCIP), the terminal acceptor (Figure 7). The reduction of DCIP is

followed spectrophotometrically at 600 nm. Since the electrons produced by other NADH-

dehydrogenases are not accepted by decyl-ubiquinone, only mitochondrial complex I activity

contributes the reduction of DCIP.

Figure 7. DCIP accepts electrons and becomes reduced-DCIP.

The reduction of DCIP can be followed spectrophotometrically at 600 nm. The electrons accepted by

DCIP come from mitochondrial complex I, but not other NADH-dehydrogenases.

Mitochondrial complex I activity in fly was analyzed using 2 μl from mitochondrial

extraction, 4 μl of 10mM NADH and 194 μl of freshly made incubation buffer. This solution

was incubated for 1 min and measured at 37°C every 30 s for 10 min at 600 nm wavelength.

Activity of the mitochondrial complex I is expressed per milligram protein (mU/mg protein):


mU: activity of the enzyme is expressed per mg protein (mU/mg protein)

Net A: rate of absorbance change (min-1

)

εNADH: extinction coefficient of NADH at 600 nm and pH 8.1 (= 0.0191 mM-1•cm-1

)

d: dilution factor of the solution (= 100)

Mitochondrial complex I activity was normalized to protein concentration of lysates

(measured using DC Protein Assay, Bio-Rad). Each lysate was measured in triplicate. Results

from triplicate measurements were depicted as fold change compared to control genotype.

The number of independent repetitions was n ≥ 5 per enotype.

2.7.3 Mitochondrial DNA level analysis

Total (nuclear and mitochondrial) DNA was extracted from 30 anesthetized flies.

Quantitative polymerase chain reaction (qPCR) was performed to determine mtDNA content

via iQTM

SYBR Green Supermix Kit (BIO-RAD).

For each sample (15 μl):

1 μl cDNA

1 μl for primer

1 μl rev primer

12 μl SYBR Green Mix

Program:

Initialization (activation of HotStar Taq): 15 min 95°C

Denaturation: 95°C, 15 s

Annealing: 50-60°C, 30s 40 cycles

Extension: 72°C, 30s

Final extension: 72°C, 10min

Description Sequence 5’→3’ Application

nCOX5A-206Fw TATGAACGATCTGGTGGGCATGGA 5’ primer for enomic DNA

nCOX5A-322Rv CAAATAGGGATAGAGGGTGGCCTT 3’ primer for enomic DNA

mtCOI-375Fw AACTGTTTACCCACCTTTATCTGCTG 5’ primer for mtDNA

mtCOI-458Rv CCCGCTAAGTGTAAAGAAAAAATAGC 3’ primer for mtDNA


The relative quantification of the mtDNA was performed using Ct values. Ct is the number of

cycles that it takes each reaction to reach an arbitrary amount of fluorescence. The mean

value of Ct is calculated from the three parallel samples as for both control gene (express

constant, equation [1]) and interested gene (equation [2]). Then the difference in Ct values for

the gene of interested and the endogenous control is calculated as △ Ct. These values should

remain constant for sample genotype and I have expressed my results comparing △ Ct values.

2.7.4 Mitochondrial morphological analysis

Thoraces were prepared from 5-day-old adult flies (raised at 25°C and adults shifted to 29°C

and treated as previously described. Semi-thin sections were stained with Toluidine blue,

whereas ultra-thin sections were examined using a transmission electron microscope (FEI

tecnai G2 Spirit, 120 kV). Transmission electron microscopy, FEI tecnai G2 Spirit, 120 kV.

2.8 Other assays

2.8.1 Analysis of DNA

DNA Extraction

20-30 adult flies were homogenized in 500 μl DNA extraction buffer plus 10 µl 10mg/ml

Proteinase K, and then incubated for 2 h at 56°C. Afterwards, supernatant was kept and

centrifuged for 10 min at 12000 rpm at 4°C. Supernatant was collected. 2.5 μl RNAase A

(10mg/ml) was added. The solution was incubated for 20 min at 50°C. Next, 500 μl

Phenol/Chloroform/Isoamylalcohol (25/24/1) was added and centrifuged for 5 min at 2000-

3000 rpm. The upper phase was kept and Phenol/Chloroform separation was repeated once

more. Then, 1 ml NaAcetat/Isopropanol (1/19) was added to the upper phase. Afterwards,

the solution was centrifuged for 10 min at 12000 rpm at 4°C. The supernatant was discarded

and the pellet was kept and washed with cold 75% Ethanol. The solution was centrifuged for

10 min at 12000 rpm at 4°C. Ethanol was removed and DNA pellet was dissolved in TE

buffer.

2.8.2 Analysis of RNA


RNA Extraction

20 whole flies were homogenized in 100 µl Trizol buffer via speedmill and then 50 µl

chloroform was added to the lysate. After vortexing for 15 s and incubation on ice for 5 min,

the samples were centrifuged at 4°C at 17.5 g speed for 15 s and the supernatant was

transfered into 100 µl 70% ethanol. Next, RNA was purified by Qiagen RNAeasy Kit. RNA

sample was disovled in RNAase free water and stored at -80°C.

Real-time PCR

1 µg of extracted RNA reversely transcribes into cDNA via Iscript cDNA synthesis Kit

followin the manufacturer’s instructions. RNA expression was normalized with respect to

endogenous reference genes: human b-actin; Drosophila ribosomal protein 49 (rp49).

Relative expression was calculated for each gene using the delta delta cycle threshold method.

For each sample (15 μl):

1 μl cDNA

1 μl for primer

1 μl rev primer

12 μl SYBR Green Mix

Program:

Initialization( activation of HotStar Taq): 5 min 95°C

Denaturation: 94°C, 15 s

Annealing: 50-60°C, 30s 40 cycles

Extension: 72°C, 30s

Final extension: 72°C, 10min

Oligo nucleotides (primers)

The following forward (for) and reverse (rev) primers were used to analyze mRNA

abundance of respective human genes:

Table 7 Index of oligo nucleotides

Description Sequence 5’→3’

b-actin for TGGACTTCGAGCAAGAGA

b-actin rev AGGAAGGAAGGCTGGAAGAG

parkin for CGA CCC TCA ACT TGG CTA CT


parkin rev GAC ACA CTC CTC TGC ACC ATA C

Pink1 for CCA ACA GGC TCA CAG AGA AG

Pink1 rev AGC GTT TCA CAC TCC AGG TT

rp49 for TCG GAT CGA TAT GCT AAG CTG TCG CAC

rp49 rev AGG CGA CCG TTG GGG TTG GTG AG

dTrap1 for AGG CAG AGT CAC CGA TCC

dTrap1 rev TGA TGC CTG CTT GGT CTC

hTrap1 for TCG CTG GAA AAC TCC TTG

hTrap1 rev GAG GAC ATT CCC CTG AAC CT

hTrap1 for and rev were from metabion. The rest were from InvitrogenTM

.

The relative quantification of the cDNA was performed using 2-△ △ Ct

values.

2.8.3 Analysis of protein

Preparation of protein lysate for western blot

5 flies of interest were homogenized in 100 μl radio immunoprecipitation assay (RIPA)

buffer by Speedmill P12 Analytik Jena AG. Lysates of homogenized heads were centrifuged

at 13 krpm for 20 min at 4°C. Supernatant was collected and stored at -20°C. 12 μl of lysate

was incubated at 95°C for 5 min after added with 3 μl 5x Laemmli lysis buffer.

SDS Polyacrylamide Gel Electrophoresis and Western Blot

SDS Polyacrylamid Gel Eletrophoresis:

10% Polyacrylamide gel electrophoresis (PAGE) running gel for complex I unit NDUFS3

was prepared. Samples were run on the PAGE gel it at 110v for approximately 1-2 h.

Blotting:

Prepare transfer membrane by soaking in Semi-Dry Buffer for 5 min. Wet four pieces of filter

paper in Semi-Dry Buffer, as well. Place 2 filter papers on cathode plate of blotter one by one.

Then place membrane on top of filter paper stack and gel on top of it. Apply a constant

current of 225 mA for one membrane for 1 h.

Blocking:

After transfer is complete, transfer membrane was incubated in Blocking Solution at RT for 2

hours.


1st/2

nd Antibodies:

Then the membrane was incubated overnight at 4°C in primary antibody reagent. After three

washes at RT for 15 min with TBST, the membrane was incubated at RT for 3 hours in an

appropriate secondary antibody reagent. The membrane was washed afterwards at RT for 15

min three times with TBST and was incubated with Immune-Startm chemiluminescent

reagent (WesternCTM kit, BioRad, USA). Documentation of chemiluminescent signals was

achieved using Alliance LD4 documentation system.

Data Analysis:

A reference protein should always be applied. In my case, syntaxin functions as the reference

protein, which is expressed constantly and remains similar expression amount among

different genotypes and different groups of age.

Antibodies

Table 8 Index of used antibodies

Antibody Dilution Animal Weight Source Application

Anti-TRAP1/Hsp75 1:1000 mouse 75kD BD Transduction

laboratoriesTM

Primary

antibody for

western blot Anti-syntaxin 1:2000 mouse 35kD DSHB

anti-NDUFS3 1:1000 mouse 25kD Abcam, ab14711

Anti-mouse 1:10000 sheep - GE Healthcare

Secondary

antibody for

western blot

2.9 Statistical analysis

Experimental data were plotted and statistically analyzed by GraphPad Prism software.

Statistical test for each experiment is described in the respective results section.

Chapter 3 - Results 26

3 Results

3.1 Trap1 functions downstream of Pink1

Transgenic fly lines UAS-hTrap1WT

(wild-type hTrap1 variant) and UAS-hTrap1D158N

(a point

mutation in one ATP-binding site) were generated (Butler et al. 2012). Flies expressing

hTrap1D158N

did not show any protective effect against α-SynA53T

-induced-toxicity as flies

expressing hTrap1WT

did (Butler et al. 2012). Therefore, hTrap1D158N

is believed to be an

inactive TRAP1 variant and was used as a control in this study.

To exclude the possibility that quantitative inequality might account for potential differences

in my assays, the expression levels of the hTRAP1 were measured in both hTrap1WT

and

hTrap1D158N

expressing flies. The RNA expression levels of Trap1 were detected by real-time

PCR. Flies with ubiquitous expression of hTrap1WT

and hTrap1D158N

driven by DaG-Gal4

showed similar levels of hTrap1 mRNA, while the control flies display no hTrap1 mRNA

(Figure 8A). To rule out the effect of exogenous hTrap1 on endogenous Drosophila Trap1

(dTrap1), the mRNA levels of endogenous dTrap1 were also tested. The mRNA levels of

dTrap1 did not vary among flies expressing hTrap1WT

and hTrap1D158N

and the control fly

lines (Figure 8A). In addition, protein levels of hTRAP1 were detected via Western blot. Flies

with ubiquitous expression (DaG-Gal4) of hTrap1WT

and hTrap1D158N

displayed very

similar/almost identical levels of hTRAP1 protein (Figure 8B). In summary, hTrap1WT

and

hTrap1D158N

transgenic flies, driven by Gal4 driver, express almost identical amounts of

hTRAP1.

Flies with the amorphic Pink1B9

allele were chosen for rescue experiments. The Pink1 gene is

localized on the X chromosome in flies. Accordingly, in this study, hemizygous Pink1B9

flies

(Pink1B9

/Y;;DaG-Gal4/+) were analyzed as Pink1 deficient (Pink1B9

in the text), while

heterozygous Pink1B9

females (Pink1B9

/+;;DaG-Gal4/+) served as control. Pink1B9

flies

were originally generated and described by Jeehye Park and co-workers. These flies display a

variety of well characterized phenotypes, including abnormal wing posture, collapsed

thoraxes, disturbed climbing ability, lack of flight ability, dysmorphic and dysfunctional

mitochondria (reduced ATP levels, low protein levels of the mitochondrial complex I subunit

NDUFS3 and loss of mtDNA content), loss of dopamine content and loss of dopaminergic

neurons (Park et al. 2006). To analyze whether there is a genetic interaction between Trap1

and Pink1, the two human Trap1 variants, hTrap1WT

and hTrap1D158N

, were expressed in a


Pink1B9

mutant background. In the F1 generation, I asked the question whether TRAP1 was

able to mitigated Pink1B9

phenotypes.

Figure 8. Expression levels of Trap1 in hTrap1 expressing flies. (A) Relative mRNA levels of hTrap1 and dTrap1 in hTrap1 expressing flies. RNA was isolated

from the entire flies and was reverse transcripted into cDNA. By applying real-time PCR, the mRNA

levels of Trap1 were determined. The mRNA levels of dTrap1 in control flies (DaG-Gal4) were set

for normalization. The mRNA levels of hTrap1 (white bars) were similar between flies expressing

hTrap1WT

and hTrap1D158N

. Control flies (DaG-Gal4) exhibited no hTrap1 mRNA. Endogenous

dTrap1 mRNA levels (black bars) did not change according to expression of hTrap1. (B) Protein

levels of hTRAP1 in hTrap1 expressing flies. Protein was extracted from the whole flies and the

protein levels of TRAP1 were detected by Western blot. Flies expressing hTrap1WT

and hTrap1D158N

presented similar levels of hTRAP1. Syntaxin was used as loading control.

3.1.1 Trap1 recues phenotypes caused by Pink1 loss-of-function in

flies

The most obvious phenotype of Pink1B9

flies, visible even without microscopy, is the

abnormal wing posture. Compared to wild type flies, most Pink1B9

flies showed either

dropped or up-held wing posture (Figure 9A), as these flies were not able to post the wings

flat on their back. Quantification revealed that only 60% of 5-day-old Pink1B9

flies presented

normal wing posture. In contrast about 80% of Pink1B9

flies expressing hTrap1WT

displayed

normal wing posture (Figure 9B). However, when hTrap1D158N

was expressed, the rescuing

effect was vanished. This indicates that TRAP1 rescued Pink1 loss-of-function induced

abnormal wing posture. The fact that the ATP-binding deficient variant TRAP1D158N

did not

provide any rescue activity suggests that ATP-binding and/or that the ATPase activity of

TRAP1 was required for the observed rescuing effect.


Figure 9. Pink1B9

flies with Trap1 expression regained normal wing posture.

(A) Wing posture phenotype. Healthy/normal flies position their wings flat on the back. In contrast,

Pink1B9

flies display either a dropped or an up-held wing posture. (B) Quantification of wing

posture phenotype. All control flies showed normal wing posture (green bar), but only 60% of

Pink1B9

flies presented normal wing posture (red bar). This abnormal wing posture phenotype was

rescued by ubiquitous expression of hTrap1WT

(yellow bar). However, ubiquitous expression of

hTrap1D158N

did not affect the abnormal wing posture induced by Pink1 loss-of-function (orange bar).

n > 200 flies per genotype. Fly age: 5 days. Flies were raised at 29°C. One-way ANOVA followed by

the Neuman–Keuls multiple comparison test was used to determine significance. *** P < 0.001; ** P

< 0.01; ns, not significant.


Next I asked whether neuronal knock-down of Pink1 by RNAi might also cause abnormal

wing posture. In a first step, I analyzed the efficiency of the Pink1-RNAi transgene. 90% of

the mRNA level of Pink1 was abolished in flies with ubiquitous (DaG-Gal4) expression of

Pink1-RNAi (Figure 10A). Thus, Pink1-RNAi is very efficient to achieve knocking down

Pink1. Next, I silenced Pink1 in all fly neurons using the pan neural elav-Gal4. Abnormal

wing posture phenotype was detected in elav>Pink1-RNAi flies at 20 days after eclosion.

This suggests that low expression of Pink1 in neurons is detrimental as well. Also in this case,

neuronal expression of hTrap1WT

mitigated the abnormal wing posture caused by neuronal

loss of Pink1. Pan neural expression of an unrelated white-RNAi did not result in any

abnormal wing posture (Figure 10B).

Figure 10. Trap1 rescued the abnormal wing posture caused by neuronal loss of Pink1. (A) Efficiency of Pink1-RNAi. The mRNA level of Pink1 in DaG-Gal4>Pink1-RNAi flies was 5-10%

of driver only control flies (DaG-Gal4). (B) Neuronal Pink1-knock-down flies expressing Trap1

regained the normal wing posture. The flies with neuronal knock-down of Pink1 (elav-

Gal4>Pink1-RNAi) displayed abnormal wing posture (red bar), while the control flies (elav-

Gal4>white-RNAi) presented normal wing posture (green bar). Flies with neuronal knock-down of

Pink1 and expression of Trap1 (elav>Pink1-RNAi,hTrap1) regained normal wing posture (yellow

bar). n > 200 per genotype. Fly age, 20 days. One-way ANOVA followed by the Neuman–Keuls

multiple comparison test was used to determine significance. ** P < 0.01; ns, not significant.

My data strongly suggest that the abnormal wing posture phenotype induced by Pink1 loss-

of-function can be rescued by TRAP1. This implies that TRAP1 acts downstream of PINK1.

To test this hypothesis, I asked whether TRAP1 also rescues other Pink1B9

phenotypes.


Thorax-indentation is another phenotype of Pink1B9

flies (Figure 11A), which was detected

in 90% of Pink1B9

flies, but not in control flies. Less Pink1B9

flies with ubiquitous expression

of hTrap1WT

displayed abnormal thoraxes, compared to Pink1B9

flies (Figure 11B). As in

previous analysis, expression of hTrap1D158N

did not show any rescuing effects on this

phenotype.

Negative geotaxis is an indicator of locomotor activity in Drosophila (Rhodenizer et al.

2008). It has been shown that Pink1B9

flies display disturbed locomotor ability in negative

geotaxis (Park et al. 2006, Imai et al. 2010). Compared to controls, Pink1B9

flies display a

strong reduction in locomotor activity. In contrast, Pink1

B9 flies with expression of hTrap1

WT,

but not hTrap1D158N

, performed significantly better in climbing analysis as compared to

Pink1B9

flies (Figure 11C).

Moreover, Pink1B9

flies have also been reported to be unable to fly. Assaying the flight

ability, I could confirm that more than 80% of Pink1B9

flies lost their flight ability, similar as

described in Park et al. 2006. In contrast to previous findings, neither expression of hTrap1WT

nor Trap1D158N

caused a regain of flight ability (Figure 11D).

Abnormal wing posture, disturbed locomotor ability and loss of flight ability of Pink1B9

flies

were ascribed to muscle degeneration (Park et al. 2006, Imai et al. 2010). Flies control wings

by the indirect flight muscles (Figure 12A). Upward movement of the wings results indirectly

from the contraction of vertical muscles within the thorax, depressing the notum (upper

surface of fly thorax). Downward movement of the wings is produced indirectly by the

contraction of longitudinal muscles raising the notum. Degeneration of indirect flight

muscles is believed to be the reason for disability of flight and abnormal wing posture in

Pink1B9

flies.

To visualize fly muscles, semi-thin transverse sections of the thorax and subsequent Toluidine

blue staining were conducted. In the indirect flight muscles of Pink1B9

flies, clear

vacuolization and disorganized appearing muscle fibers were observed. In contrast, Pink1B9

flies with ubiquitous expression of hTrap1WT

presented well-organized muscle fibers without

vacuolization, as in control flies. As for wing posture and locomotor activity, expression of

hTrap1D158N

was not able to rescue the muscle degeneration in Pink1B9

flies (Figure 12B).


Figure 11. Expression of Trap1 mitigates Pink1 loss-of-function phenotypes.

(A) Thorax-indentation phenotype. Wild-type flies (left) have a roundish and smooth edge on the

anterior side of the dorsal surface of thorax, the so-called notum (the red arrow pointed). Pink1B9

flies

(right) frequently display dints at this position of thorax (red arrow), referred as indentation. (B)

Quantification of indentation phenotype. The plotted indentation index reflects the percentage of

the flies showing normal thoraxes (without indentation). Pink1B9

flies showed strongest indentation

phenotype (red bar). On the other hand, control flies had no indentation phenotype at all (green bar).

Pink1B9

flies expressing hTrap1WT

suppressed indentation (yellow bar), while expression of

hTrap1D158N

did not (orange bar). n=100 per genotype. Absolute values were depicted. (C) Negative

geotaxis. To study the locomotor activity of flies, negative geotaxis (climbing ability) was measured.

50% of Pink1B9

flies (red bar) failed to achieve the task (8cm within 10s), while 80% of the control

flies (green bar) were capable. Expression of hTrap1WT

(yellow bar), but not hTrap1D158N

(orange bar),

in Pink1B9

flies rescued the disturbed climbing ability. (D) Flight ability. Flight index equaled the

average percentage of flies that were able to escape from the vial within certain time. Less than 20%

of Pink1B9

flies (red bar) escaped. A similar flight index was observed in Pink1B9

flies expressing

either hTrap1WT

(yellow bar) or hTrap1D158N

(orange bar). In contrast, 60% of control flies (green bar)

successfully escaped. (C) and (D), n > 200 flies per genotype. Fly age: 5 days. Flies were raised at

29°C. Original data of (B) and (D) were provided by Alexander J. Whitworth. One-way ANOVA

followed by the Neuman–Keuls multiple comparison test was used to determine significance. *** P <

0.001; * P < 0.05; ns, not significant.


In summary, hTrap1WT

rescued phenotypes induced by Pink1 loss-of-function, including

wing posture, thoracic indentation, climbing ability and muscle degeneration. Interestingly,

hTrap1D158N

, hTrap1 with one point mutation in one of four ATP binding sites, did not show

any rescuing effect. This is in line with my hypothesis that Trap1 functions downstream of

Pink1. Moreover, the ATP-binding and most likely subsequent ATP lysis by the ATPase

activity of TRAP1 is required for the rescuing function.

Figure 12. Expression of Trap1 rescued the degeneration of indirect flight muscles (longitudinal

muscles) in Pink1B9

flies. (A) The schematic presentation of wing/flight control by indirect flight muscles. Flies control the

upward movement of wings by contracting the longitudinal indirect flight muscles. By contracting the

vertical indirect flight muscles, flies control the downward movement of wings. These muscle

contraction cause a deformation of the thorax and are not directly attached to the wings. Accordingly,

the two groups of muscles are considered indirect flight muscles. Picture is adept from the Amateur

Entomologists' Society. (B) First row, lateral sections of indirect flight muscles. Second row,

dorsal/ventral sections of indirect flight muscles. Muscle fibers were well organized without

vacuolization in control flies (Pink1B9

/+;;DaG). In contrast, muscle fibers appeared disorganized with

vacuoles in Pink1B9

flies (Pink1B9

/Y;;DaG). Pink1B9


, but

not hTrap1D158N

, regained the healthy pattern of indirect flight muscles. Semi-thin transverse sections

of muscle with Toluidine blue staining. Fly age: 5 days. Flies were raised at 29°C.


3.1.2 Expression of Trap1 mitigates mitochondrial morphology

and function in Pink1 loss-of-function flies

Mitochondrial dysmorphology

To further explore the mechanism of muscle degeneration in Pink1B9

flies, electron

microscopy was applied to visualize the muscles in detail. Pink1 B9

flies presented swollen

mitochondria with fragmented cristae in indirect flight muscles. In contrast, mitochondria in

control flies showed normal size and intact, densely packed cristae. Pink1B9

flies with

ubiquitous expression of hTrap1WT

displayed healthy mitochondria as in control flies.

Expression of hTrap1D158N

did not provide a rescue of altered mitochondrial morphology

observed in Pink1B9

flies (Figure 13). This suggests that expression of Trap1 restores the

morphology of mitochondria in indirect flight muscles in Pink1 loss-of-function flies.

Figure 13. Expression of Trap1 improved mitochondrial morphology in indirect flight muscles

of Pink1B9

flies.

In control flies (Pink1B9

/+;;DaG), mitochondria (white arrow) appeared healthy, were of

normal size, displayed densely packed cristae and showed no signs of vacuolization. In

contrast, in Pink1B9

flies (Pink1B9

/Y;;DaG), mitochondria were enlarged and had fragmented

cristae. Ubiquitous expression of hTrap1WT

, but not hTrap1D158N

, in Pink1B9

flies caused a

regained of the healthy morphology of mitochondria in indirect flight muscles. Second row

shows a magnification of boxed areas in the first row. White asterisk mark muscle fibers.


Original pictures were provided by Alexander J. Whitworth. Fly age: 5 days. Flies were

raised at 29°C.

Mitochondrial dysmorphology usually reflects mitochondrial dysfunction. It has been

reported that Pink1 loss-of-function flies represent signs of mitochondrial dysfunction, such

as low levels of ATP, reduced mtDNA content and impaired mitochondrial electron transport

chain (ETC) (Park et al. 2006, Clark et al. 2006, Vilain et al. 2012). Trap1 rescues

mitochondrial dysfunction in Pink1 loss-of-function flies. Thus, I examined whether Trap1

also rescued mitochondrial dysfunction in Pink1B9

flies, by determining ATP levels, mtDNA

content and mitochondrial ETC activity.

ATP levels

The main function of mitochondria is to produce energy (ATP) to support cells. Therefore,

the ATP level is an indicator of mitochondrial function. Low levels of ATP in thoraxes of

Pink1 loss-of-function flies were already described (Park et al. 2006, Clark et al. 2006). I

confirmed decreased ATP levels in thoraxes of Pink1B9

flies. As expected from my previous

analysis (see Fig. 13), ATP levels were partly restored when hTrap1WT


,

was ubiquitously expressed in Pink1B9

flies (

Figure 14A). The increased ATP levels and recovered mitochondrial morphology after

TRAP1WT

expression strongly imply a recovered mitochondrial function.

Elevated TRAP1 levels might increase ATP levels per se. In this case, increased ATP upon

TRAP1WT

-expression in Pink1B9

flies would be caused by an indirect effect. To test for this

possibility, ATP levels were measured in flies expressing either hTrap1WT

or hTrap1D158N

ubiquitously (DaG-Gal4). Compared to controls, there was no significant difference in

hTrap1WT

or hTrap1D158N

expressing flies (

Figure 14B). This means that expression of hTrap1 does not simply increase the ATP levels,

but compensates the decreased ATP production caused by Pink1 loss-of-function.


Figure 14. Expression of Trap1 restored ATP levels in thoraxes of Pink1

B9 flies.

(A) Compared to the control flies, Pink1B9

flies displayed low levels of the ATP. Ubiquitous

expression of hTrap1WT


, in Pink1B9

flies restored the ATP levels. (B) Ubiquitous

expressing either hTrap1WT

or hTrap1D158N

did not change ATP levels in thoraxes of flies. Fly age: 5

days. Flies were raised at 29°C. One-way ANOVA followed by the Neuman–Keuls multiple

comparison test was used to determine significance. *** P < 0.001; * P < 0.05; ns, not significant.

Mitochondrial DNA

The amount of mtDNA is regarded as an indicator of mitochondrial function. It is linked to

abundance and fitness of the mitochondrial population. Declined mtDNA levels in Pink1B9

flies were reported (Park et al. 2006). The index of mtDNA level equals the amount of

mitochondrial encoded cytochrome c oxidase I (COI) divided by the amount of nuclearly

encoded cytochrome c oxidase X (COX). Pink1B9

flies presented very low levels of mtDNA.

However, the mtDNA levels were restored by expression of hTrap1WT

. On the contrary,

expression of hTrap1D158N

did not elevate the reduced content of mtDNA in Pink1B9

flies

(Figure 15).


Figure 15. Expression of hTrap1 restored mtDNA levels in Pink1

B9 flies.

mtDNA levels were reduced in Pink1B9

flies. Ubiquitous expression of hTrap1WT


,

increased mtDNA levels in Pink1 loss-of-function flies. Fly age: 5 days. Flies were raised at 29°C.

One-way ANOVA followed by the Neuman–Keuls multiple comparison test was used to determine

significance. * P < 0.05; ns, not significant.

Mitochondrial Complex I

The ETC is a series of protein complexes that create an electrochemical proton gradient that

drives ATP synthesis. Declined mitochondrial complex I activity has been shown in Pink1

loss-of-function flies (Park et al. 2006,Vilain et al. 2012). Accordingly, I asked whether

Trap1 is able to restore mitochondrial complex I activity. Thus I measured mitochondrial

complex I activity in Pink1B9

flies with and without concomitant expression of Trap1.

In Pink1B9

flies, mitochondrial complex I activity was reduced compared to the control flies.

However, Pink1B9


regained the mitochondrial

complex I activity almost to the control levels. In contrast, Pink1B9

flies with expression of

hTrap1D158N

presented similar mitochondrial complex I activity to Pink1B9

flies (Figure 16A).


Figure 16. hTrap1 elevated mitochondrial complex I activity and the levels of NDUFS3 in

Pink1B9

flies. (A) Plotted is mitochondrial complex I activity relative to control flies (Pink1

B9/+;;DaG/+). Pink1

B9

flies (Pink1B9

/Y;;DaG/+) showed decreased mitochondrial complex I activity. Ubiquitous expression

of hTrap1WT


, rescued mitochondrial complex I activity in Pink1B9

flies (8

measurements per genotype). (B) Compared to controls, Pink1B9

flies displayed a reduced abundance

of NDUFS3. Pink1B9



, increased

NDUFS3 almost to the control level. Fly age: 5 days. Flies were raised at 29°C. One-way ANOVA

followed by the Neuman–Keuls multiple comparison test was used to determine significance. *** P <

0.001; ** P < 0.01; * P < 0.05; ns, not significant.

To investigate mitochondrial complex I protein abundance, the levels of one nuclear encoded

mitochondrial complex I subunit, NADH dehydrogenase [ubiquinone] iron-sulfur protein 3

(NDUFS3) was assayed in Western blot. Compared to control, NDUFS3 levels were reduced

in Pink1B9

flies, In contrast, Pink1B9


displayed

similar levels of NDUFS3 as control (Figure 16B). In agreement with the previous analyses,

hTrap1D158N

had no beneficial effect.

Male fertility

Proper mitochondrial function is required for spermatogenesis. Male sterility due to impaired

spermatogenesis and swollen nebenkern (a special mitochondrial formation in Drosophila

spermatids) has been reported in Pink1B9

flies (Park et al. 2006). In my study, single Pink1B9

male flies (20 days old) were crossed with female virgins (Pink1B9

/FM7, GFP) to check

whether the male was fertile or sterile. Only 50% of Pink1B9

male flies were fertile. However,

80% of Pink1B9

male flies with expression of hTrap1WT

were fertile (Figure 17). In contrast,

Pink1B9

male flies expressing hTrap1D158N

performed similar to Pink1B9

male flies. Therefore


expression of hTrap1 also rescues the partial sterility of Pink1B9

male flies. Altogether, all my

data strengthen the idea that Trap1 rescues mitochondrial dysfunction induced by Pink1 loss-

of-function.

Figure 17. Trap1 rescues the sterility of Pink1 mutant male flies.

Single Pink1B9

male fly at the same age (20 days old) was crossed with female virgins

(Pink1B9

/FM7, GFP). About 50% of Pink1B9

male flies were fertile (red bar) while roughly

80% of Pink1B9

male flies with expression of hTrap1WT

were fertile (yellow bar). Expression

of hTrap1D158N

did not influence the sterility of Pink1B9

males. One-way ANOVA followed

by the Neuman–Keuls multiple comparison test was used to determine significance. *** P <

0.001; ** P < 0.01; ns, not significant.

To summarize, Pink1 loss-of-function flies presented mitochondrial dysmorphology and

dysfunction (reduced ATP production, decreased mitochondrial complex I activity, depletion

of mtDNA and decreased expression of nuclear encoded NDUFS3). The mitochondrial

dysmorphology and dysfunction in Pink1 loss-of-function flies attributed to the phenotypes

such as impaired locomotor activity, thorax-indentation, abnormal wing posture and male

sterility. Expression of hTrap1 rescued these phenotypes via enhancing the mitochondrial

function. On the other hand, expression of hTrap1D158N

did not present any rescuing effects in


Pink1B9

flies. This illustrates the ATP binding and most likely subsequent ATPase activity of

TRAP1 is critical for the rescuing effects.

3.1.3 Knocking down Trap1 in Pink1 loss-of-function flies cause

semi-lethality

Enhancing Trap1 abundance (endogenous and exogenous) in flies rescued abnormal

phenotypes caused by Pink1 loss-of-function. Next I asked whether reduced expression

levels of Trap1 would enhance the phenotypes induced by Pink1 loss-of-function in flies. To

tackle this question, I used a P-element insertion (Trap1KG

) in the Trap1 locus. This P-

element insertion is known to cause a hypomorphic Trap1 allele (Butler et al., 2012).

Following the crossing scheme depicted in Figure 18A, I asked whether the Trap1KG

allele

would reduce the viability of hemizygous Pink1B9

males. In the F1 generation I compared the

hatching rates of hemizygous Pink1B9

males with or without presence of one Trap1KG

allele

(Figure 18B). I found that the combination of Pink1B9

and one copy of the Trap1KG

allele

caused semi-lethality. This indicates that Trap1 loss-of-function enhances the effect of Pink1

loss-of-function.

I have shown that the phenotypes induced by Pink1 loss-of-function flies were mitigated by


, such as abnormal wing posture, collapsed thorax, impaired climbing

and flight ability, as well as mitochondrial dysmorphology and dysfunction. Furthermore,

Trap1 loss-of-function worsened the effects caused by Pink1 loss-of-function, leading to

semi-lethality in flies. Therefore, I assume that Trap1 functions downstream of Pink1.


Figure 18. Genetic interaction of Pink1 and Trap1 loss-of-function alleles.

(A) yw/Y ( y, yellow, determines cuticle pigmentation of fly; w, white, determines eye color of fly. y

and w are used as visible biological makers) and yw/Y;Trap1KG

male flies were crossed to

Pink1B9

/FM7,GFP virgin females. The resulting male offspring in the F1 generation can be either

Pink1B9

/Y or FM7,GFP/Y for control (upper) crosses or in combination with one copy of the Trap1KG

allele, Pink1B9

/Y;Trap1KG

/+ or FM7,GFP/Y;Trap1KG

/+, respectively (lower scheme). (B) In controls,

the observed ratio of Pink1B9

/Y versus FM7,GFP/Y male offspring was 35%:65%. The presence of the

Trap1KG

allele reduced the percentage of Pink1B9

(Pink1B9

/Y;Trap1KG

/+ versus

FM7,GFP/Y;Trap1KG

/+, 15%:85% respectively). Unpaired t test was used to determine significance.

** P < 0.01.

3.2 Trap1 functions independently of PINK1/Parkin

pathway

Parkin loss-of-function flies display almost identical phenotypes to Pink1 loss-of-function

flies, such as abnormal wing posture, thoracic indentation, declined locomotor ability,

impaired mitochondrial morphology and function (Park et al. 2006, Clark et al. 2006, Yang et

al. 2006). This suggested that the both proteins act in the same pathway. Indeed, epistatic

analysis showed that overexpression of parkin rescues Pink1 loss-of-function phenotypes in

flies, suggesting a function of parkin downstream of Pink1 (Park et al. 2006, Clark et al.

2006).

Though Pink1 has been reported to be involved in multiple pathways, the main function of

PINK1 in vertebrate cells seems to be the quality control of the mitochondrial population via

the so-called PINK1/Parkin pathway. In agreement with the analysis in flies, Pink1 is

reported to function upstream of parkin in mitochondrial quality control in vertebrate cells


(Geisler et al. 2010, Narendra et al. 2008, Narendra et al. 2010a, Chen & Dorn 2013, Jin &

Youle 2013, McLelland et al. 2014).

My data suggest that expression of hTrap1 rescued almost all of the phenotypes in Pink1

loss-of-function flies, this acting downstream of Pink1. Similar rescue activities have been

reported for parkin (Park et al. 2006, Clark et al. 2006). Thus, I asked whether Trap1

functions downstream of parkin in this pathway. To address this question, I examined

whether Trap1 rescued the phenotypes induced by parkin loss-of-function. The park25

allele

is a null mutation, accordingly homozygous park25

flies do not have any residual Parkin

function (Whitworth et al. 2005, Deng et al. 2008). In this study, homozygous Park25

flies

(w/Y;;Park25

,DaG-Gal4/Park25

) were used as parkin loss-of-function flies and termed as

“Park25

flies”, while heterozygous Park25

flies (w/Y;;Park25

,DaG-Gal4/TM3,Sb,e) served as

the controls.

3.2.1 Trap1 does not influence phenotypes in parkin mutant flies

As reported for Pink1 mutants, also parkin deficient flies display almost invariable

phenotypes in adults. In close similarity to previous approaches, I applied these analyses in

parkin deficient flies to examine whether Trap1 rescued parkin loss-of-function. First, I

addressed abnormal wing posture. Only 40% of Park25

flies showed normal wing posture,

whereas 100% of the control flies did (Figure 19A). Unlike for Pink1B9

flies, expression of

hTrap1WT

did not improve the wing posture in parkin deficient flies.

As reported for Pink1 deficient flies, Park25

flies displayed disturbed climbing ability as well

(Figure 19B). However, expression of hTrap1 did not mitigate the impaired locomotor

activity in Park25

flies (Figure 19B). The abnormal wing posture and reduced climbing ability

is believed to be caused by mitochondrial dysfunction. Both Pink1 and parkin deficent flies

display disorganized muscles with enlarged mitochondria harboring fragmented cristae. Thus,

I analyzed muscle sections of Park25

flies. Also in this case, expression of hTrap1 did not

rescue disorganized muscle fibers in thoraxes of park deficient flies (Figure 19C).


Figure 19. Expression of Trap1 did not influence phenotypes in park25

flies. (A) Wing posture phenotype. Only 40% of Park

25 flies displayed normal wing posture (red bar),

while none of the control flies showed abnormal wing posture (green bar). Expression of hTrap1 did

not show significant rescue of abnormal wing posture in Park25

flies (yellow bar). (B) Index of

climbing ability. Park25

flies presented impaired climbing ability. Expression of hTrap1 did not

improve the climbing ability in Park25

flies. (C) Fly muscle sections. Park25

flies displayed

disorganized indirect flight muscle fibers in thoraxes. Expression of hTrap1 did not cause a regaining

the well-organized muscle fibers in thoraxes in Park25

flies. Fly age: 5 days. Flies were raised at 29°C.

One-way ANOVA followed by the Neuman–Keuls multiple comparison test was used to determine

significance. *** P < 0.001; ** P < 0.01; ns, not significant.

3.2.2 Expression of Trap1 does not mitigate mitochondrial

function/morphology in parkin mutant flies

My analysis of indirect flight muscles (Figure 19C) suggests that mitochondrial function is

impaired in Park25

flies. Thus, I analyzed mitochondrial function by ATP measurement and

protein abundance of mitochondrial complex I. The Park25

flies had reduced ATP levels in

thoraxes (Figure 20A) and low abundance of a mitochondrial complex I subunit NDUFS3

(Figure 20B). In contrast to my findings in Pink1 deficient flies, expression of hTrap1 was

neither able to restore the ATP levels in thoraxes nor NDUFS3 protein levels in Park25

flies

(Figure 20).


In summary, Trap1 rescued no phenotypes induced by parkin loss-of-function, although all

these phenotypes were rescued in Pink1 loss-of-function flies. Therefore, I assume that Trap1

functions downstream of Pink1, but not downstream of parkin. Trap1 acts either

upstream/parallel to parkin in the Pink1/parkin pathway, or in an alternative, so far unknown

pathway, parallel to the Pink1/parkin pathway.

Figure 20. Expression of Trap1 did not mitigate mitochondrial function in park25

flies.

(A) ATP content. Park25

flies showed declined ATP levels as compared to control flies. Expression

of hTrap1 did not rescue the lost ATP levels in Park25

flies. (B) Expression levels of NDUFS3.

Park25

flies possessed low expression levels of NDUFS3 compared to control flies. Expression of

hTrap1 did not change the expression levels of NDUFS3 in Park25

flies. Fly age: 5 days. Flies were

raised at 29°C. One-way ANOVA followed by the Neuman–Keuls multiple comparison test was used

to determine significance. ** P < 0.01; ns, not significant.

3.3 Trap1 mitigates mitochondrial morphology/function in

Pink1 knock-out SH-SY5Y cells

In an attempt to test whether my findings obtained in flies can be reproduced in vertebrate

cells, I tried to recapitulate my findings in cooperation with Kathrin Müller-Rischart and

Konstanze F. Winklhofer (LMU, Munich). In human SH-SY5Y cells, transient silencing of

either Pink1 or parkin by transfection of specific shRNAs results in mitochondrial

fragmentation and reduced ATP content. Thus I asked whether these phenotypes could be

rescued by co-transfection of either hTrap1WT

or hTrap1D158N

or hTrap1ΔMTS

(TRAP1 lacking

the mitochondrial target sequence). In line with my finding in flies, expression of hTrap1WT

,

http://dict.leo.org/#/search=%C3%BCber&searchLoc=0&resultOrder=basic&multiwordShowSingle=on


but neither hTrap1D158N

nor hTrap1ΔMTS

, in Pink1-siRNA treated SH-SY5Y cells caused a

regained normal ATP levels and restored mitochondrial morphology (Figure 21). In parkin-

siRNA treated SH-SY5Y cells, there was only a mild rescuing effect after expression of

hTrap1WT

. hTrap1D158N

or hTrap1∆MTS

did not display any rescuing activity. All these

findings were coherent with the data obtained in flies.

Figure 21. ATP levels and mitochondrial fragmentation in Pink1-siRNA & parkin-siRNA SH-

SY5Y cells. SH-SY5Y cells treated with either Pink1-siRNA or parkin-siRNA displayed declined ATP levels (A)

and fragmented mitochondria (B). Expression of hTrap1WT

, but neither hTrap1D158N

nor hTrap1ΔMTS

,

in Pink1-siRNA SH-SY5Y cells restored the ATP content and regained normal morphology of

mitochondria. In contrast, in parkin-siRNA treated SH-SY5Y cells, the rescue effect by expression of

hTrap1WT

was not as pronounced as in Pink1-siRNA treated cells. Two-way ANOVA followed by

the Bonferroni post-test was used to determine significance. *** P < 0.001; ** P < 0.01; * P < 0.05.

3.4 Trap1 and mitochondrial complex I rescue each other

3.4.1 Trap1 rescues mitochondrial complex I subunits loss-of-

function

My data imply that Trap1 does not function within the Pink1/parkin pathway. Thus I

wondered how Trap1 acts to rescue the phenotypes caused by Pink1 loss-of-function.

According to the location of TRAP1 in mitochondria and the observed rescuing effect on

ETC (mitochondrial complex I acitivty and NDUSF3 abundance), as well as the rescue on

overall ATP levels in Pink1 deficient flies and cells, I reasoned that TRAP1 might act in

mitochondria, most likely in stabilizing the ETC. To gain more insights in possible function(s)

of TRAP1, I silenced genes, known to code for proteins acting in mitochondria in flies. In a

first attempt, I asked whether ubiquitous (DaG-Gal4) silencing of these genes by RNAi

caused lethality. A detailed summary of genes silenced and obtained results are depicted in

the appendix (Table 10). Overall, I silenced 93 genes. In brief

19 genes were silenced coding for enzymes of the Krebs cycle, 7 caused lethality;


25 genes were silenced coding for complex I subunits, 12 caused lethality;

6 genes were silenced coding for complex II subunits, 4 caused lethality;

6 genes were silenced coding for complex III subunits, 4 caused lethality;

13 genes were silenced coding for complex IV subunits, 7 caused lethality;

24 genes were silenced coding for ATP synthase (complex V; F-type and V-type), 16 caused

lethality.

In a second step, I asked whether the lethal phenotype observed after ubiquitous gene

silencing could be reverted by co-expression of Trap1WT

. To control for potential titration

effects of Gal4, I co-expressed the inactive Trap1D158N

. As a result, I found that expression of

hTrap1 WT

rescued the lethality caused by the silencing of three mitochondrial complex I

subunits (NDUFa5, NDUFb1, NDUFS8) and one mitochondrial complex IV subunit (COX6c)

(Table 9). Interestingly, expression of hTrap1D158N

did not rescue the lethality after ubiquitous

RNAi-mediated silencing of these genes. This suggests that the rescue effect is specific for

TRAP1 and requires fully functional TRAP1 activity.

Table 9. hTrap1WT

rescues silencing of mitochondrial complex subunits Ubiquitous knock down of these genes caused lethality. The lethal phenotype was rescued by co-



. CG Gene Name Symbol

6439 NADH dehydrogenase (ubiquinone) 1 alpha subcomplex 5 NDUFa5

18624 NADH dehydrogenase (ubiquinone) 1 beta subcomplex 1 NDUFb1

4094 NADH dehydrogenase (ubiquinone) Fe-S protein 8 NDUFS8

14028 cytochrome c oxidase subunit 6c, cyclope COX6c

Moreover, my findings suggest that TRAP1 acts to stabilize protein complexes of the ETC,

especially mitochondrial complex I. Mitochondrial complex I is the first complex of the ETC,

and the main role of the ETC is to produce energy (ATP). Therefore, I measured the ATP

levels in NDUFb1 silenced larvae. As expected, ubiquitous knock down of NDUFb1 caused

decreased ATP levels compared to control. Larvae with ubiquitous knock down of NDUFb1

and co-expression of hTrap1WT

displayed normal ATP levels (Figure 22). This reveals that

Trap1 overexpression remains the ETC functional in NDUFb1 deficient situations.


Figure 22. Trap1 restored ATP levels in L3 Larve of NDUFb1-knock-down flies. Ubiquitous knock-down of NDUFb1 resulted in reduced ATP levels (red bar) compared to controls

(green bar). However, the ATP levels reached control levels when hTrap1WT

was co-expressed. One-

way ANOVA followed by the Neuman–Keuls multiple comparison test was used to determine

significance. ** P < 0.01; ns, not significant.

3.4.2 Ndi1p (mitochondrial complex I) rescues Trap1 loss-of-

function

Since Trap1 rescued the lethality caused by knocking down of certain mitochondrial complex

I subunits in flies, I assumed that Trap1 might protect mitochondrial complex I. To support

this assumption, I analyzed whether overexpression of mitochondrial complex I could

compensate Trap1 loss-of-function. I used the amorphic Trap14 allele. Homozygous Trap1

4

flies are viable but do not display any detectable Trap1 mRNA in qRT-PCR analysis (Figure

23A). Moreover, homozygous Trap14

have been reported to show characteristic phenotypes

(Costa et al. 2013). Among these are reduced climbing activity (Figure 23B), increased

sensitivity to mitochondrial complex I inhibitor Rotenone (Figure 23C) and decreased ATP

levels (Figure 23D). All of these phenotypes can be explained by a reduced activity of the

ETC.


Figure 23. Phenotypes induced by Trap1 loss-of-function in Trap14 flies.

(A) Expression levels of Trap1 assayed by qRT-PCR revealed the absence of detectable Trap1-

transcripts in homozgous Trap14 flies. (B) Compared to heterozygous Trap1

4 flies (Trap1

4/CyO),

homozygous Trap14 flies presented an impaired climbing ability. (C) Trap1

4 flies displayed shortened

life span under 2 mM Rotenone compared to heterozygous controls (Trap14/Cyo). (D) Low ATP

levels were observed in Trap14 flies. One-way ANOVA followed by the Neuman–Keuls multiple

comparison test (A) and T-test (B, D) was used to determine significance. *** P < 0.001; * P < 0.05;

ns, not significant.

To investigate whether normalized mitochondrial complex I could rescue Trap1 loss-of-

function, Ndi1p was expressed in the neurons of homozygous Trap14

flies. In yeast, Ndi1p is

the only protein that determines mitochondrial complex I function. Overexpression of Ndi1p

in flies was reported to functionally bypass mitochondrial complex I. Moreover,

overexpression of Ndi1p rescued phenotypes in Pink1 deficient flies (Vilain et al. 2012).

Homozygous Trap14 flies were vulnerable against heat stress, and only 40% survived 24 h

after heat shock treatment (Figure 24A). Compared to homozygous Trap14

flies, ectopic

neuronal expression of Ndip1 resulted in survival of more Trap14 homozygous flies after heat

shock (Figure 24A). This indicates that reconstitution of mitochondrial complex I function in

Trap1 deficient flies at least partially rescues sensitivity to heat stress. My own and

previously published data suggest that there is a decline in mitochondrial function and

abundance in Trap1 deficient flies (Costa et al. 2013). Accordingly, I tested indirectly


mitochondrial abundance by assessing the protein levels of a mitochondrial complex I

subunit NDUFS3. Homozygous Trap14 flies showed low levels of NDUFS3, while Trap1

4

flies with neuronal expression of Ndi1p regained the levels of NDUFS3 (Figure 24B).

Figure 24. Ndi1p rescued Trap1 loss-of-function.

(A) Survival of flies after induction of heat stress. Homozygous Trap14 flies were

vulnerable to heat stress, indicated by low survival after heat stress (red bar). Neuronal (elav-

Gal4) expression of Ndip1 (grey bar) ameliorated sensitivity to heat stress, whereas

heterozygous Trap14 controls (black bar) did not show reduced survival 24 h after heat stress.

(B) Determination of mitochondrial complex I subunit NDUFS3 abundance in Western

blot. Homozygous Trap14 flies (Trap1[4]) display reduced abundance of NDUFS3, which

was restored to control levels (elav>Ndi1p) after pan neural expression of Ndi1p (elav>Ndi1p,

Trap1[4]). Fly age: 10 days. One-way ANOVA followed by the Neuman–Keuls multiple

comparison test was used to determine significance. *** P < 0.001; * P < 0.05.

In summary, Trap1 rescues the phenotypes caused by Pink1 loss-of-function, which reflects

that Trap1 functions downstream of Pink1. In contrast, Trap1 did not show any rescuing

effects on the phenotypes induced by parkin loss-of-function. This suggested that Trap1 is

not involved in mitophagy/mitochondria-derived vesicles (MDVs) controlled by the

Pink1/parkin pathway. In addition, I found that Trap1 rescued the lethality and decreased

ATP levels caused by knocking down certain mitochondrial complex I subunits (Table 9,

Figure 22). All these data imply that TRAP1 acts on mitochondrial complex I to maintain a

functional ETC. The fact that Ndi1p, bypassing mitochondrial complex I rescues Trap1 loss-

of-function is in line with the assumed function of TRAP1.

Chapter 4 –Discussion 49

4 Discussion

PD is the most common movement disorder, characterized by a loss of dopaminergic neurons

in the SNpc. Current therapies of PD are mainly based on exogenous replacement of

dopamine. Such methods of therapies temporarily remit the symptoms, but do not impede the

progression of neuronal decline. This is one reason why the efficiency of the therapies is

decreasing over time. Accordingly, it is crucial to understand why dopaminergic neurons

degenerate. Slowing down or preventing DA neuron degeneration would be a key step in the

rational development of new therapies to ameliorate PD (progression). This requires further

investigation at the genetic/molecular levels of those dying neurons. So far, there are two

pathological hallmarks in dying DA neurons, LBs/LNs and impairment of mitochondrial

complex I. α-Syn has been found to be the main component in LBs/LNs. Specific mutations

in SNCA, the gene encoding α-Syn, as well as duplication or triplication of SNCA locus cause

autosomal dominant PD (Polymeropoulos et al. 1997, Kruger et al. 1998, Singleton et al.

2003, Chartier-Harlin et al. 2004). Thus, the mechanism of α-Syn-induced toxicity is critical

for understanding PD pathology. The mitochondrial chaperone TRAP1 has been found to

mitigate α-Syn-induced toxicity in vitro and in vivo (Butler et al. 2012). The toxicity caused

by α-Syn was decreased by overexpression of Trap1 and increased absence of Trap1.

Interestingly, TRAP1 has been reported as a substrate of a serione/theronine kinase, PINK1.

Mutations in Pink1 cause autosomal recessive PD (Valente et al. 2004). Overexpression of

PINK1 protects cells from oxidative stress and this protection is known to dependent on

TRAP1 (Pridgeon et al. 2007). These findings suggest that TRAP1 might act downstream of

PINK1. Thus, I asked whether TRAP1 might act downstream of PINK1 and has a role in the

etiology of PD.

4.1 Trap1 functions downstream of Pink1

To investigate whether Trap1 affects Pink1 loss-of-function, I expressed human Trap1

(hTrap1) in Pink1B9

flies (Pink1 loss-of-function flies). Pink1B9

flies display well

characterized phenotypes, including male sterility, abnormal wing posture, collapsed thoraxes,

impaired climbing ability, lack of flight ability as well as a dysmorphology and dysfunction

of mitochondria, loss of dopamine content and dopaminergic neurons (Park et al. 2006, Clark

et al. 2006). Ubiquitous hTrap1WT

expression in a Pink1B9

background attenuated abnormal

wing posture (Figure 9), collapsed thoraxes (Figure 11) and impaired locomotor ability

(Figure 11). Except for the lack of the ability to fly, all other Pink1B9

-induced phenotypes


were at least partially rescued by expression of hTrap1. These above described phenotypes

might be explained by a dysmorphology and dysfunction of mitochondria in muscles of

Pink1B9

flies. In Pink1B9

flies, mitochondria in indirect flight muscles appeared swollen and

displayed highly fragmented cristae. Expression of hTrap1 caused a re-gain of normal

mitochondria size and densely packed cristae (Figure 13). Also the amount of mitochondrial

DNA and abundance of mitochondrial complex I, as measured by NDUSF3 levels, was

restored (Figure 14, Figure 15, Figure 16). In agreement with these observations, also the

impaired mitochondrial function in Pink1B9

flies was rescued by expression of hTrap1. A

mitochondrial dysmorphology is usually accompanied by mitochondrial dysfunction. The

main function of mitochondria is to produce energy (ATP). Therefore, the ATP levels were

examined. Whereas Pink1B9

flies showed low ATP levels and reduced mitochondrial complex

I activity, expression of hTrap1 ameliorated these parameters of mitochondrial function.

Of note, the sterility observed in Pink1B9

males is also caused by mitochondrial dysfunction.

In sperm development, mitochondria fuse to form a structure called ‘Nebenkern’. The

Nebenkern is wrapped with multiple layers of mitochondrial membranes, and in later stages

of sperm development, the Nebenkern elongates and splits into two mitochondrial derivatives.

The proper function of these mitochondria is crucial for sperm motility. Ubiquitous hTrap1

expression restored male fertility almost to control levels (Figure 17). This indicates that not

only mitochondrial defects in muscles are rescued by hTrap1.

Moreover, I found that flies with neuronal Pink1 knock-down (elav>Pink1-RNAi) developed

an abnormal wing posture phenotype. Neuronal expression of hTrap1WT

mitigated the

abnormal wing posture caused by neuronal Pink1-RNAi (Figure 10). This further supports the

idea that hTrap1 rescues phenotypes in Pink1 loss-of-function situations in many (if not all)

tissues. Moreover, a parallel study basically confirmed my findings in flies. There, it has been

shown that overexpression of Drosophila Trap1 (dTrap1), instead of hTrap1, rescued the

phenotypes in Pink1B9

flies (Costa et al. 2013).

Altogether, these data suggest that Trap1 rescues the phenotypes caused by Pink1 loss-of-

function, most likely through rescuing the mitochondrial dysmorphology and dysfunction.

Mitochondrial dysfunction leads to an impaired function of muscles. Dysfunctional muscles

in turn might explain abnormal motor functions, such as abnormal wing posture and impaired

locomotor activity. Flight requires an extremely high amount of energy. Given the partial


rescue observed after overexpression of hTrap1 on other phenotypes induced by Pink1 loss-

of-function (e.g. wing posture, ATP levels etc.), this might explain why a partial rescue is not

sufficient to restore flight ability. Even the reduced male fertility in PINK1B9

flies can be

explained by mitochondrial dysfunction. In PINK1B9

males, sperm with a swollen Nebenkern

are observed.

In summary, expression of hTrap1 rescues the phenotypes induced by Pink1 loss-of-function

most likely by normalizing mitochondria function and integrity. With regard to the rescue

effect, I suppose that TRAP1 supports mitochondria maintaining their normal morphology

and function.

4.2 The rescuing effect of Trap1 on Pink1 loss-of-function

requires mitochondrial location of TRAP1 and its ATPase

activity

TRAP1 is a mitochondrial molecular chaperone with similarity to HSP 90, containing three

main domains: a 59 amino acids N-terminal MTS, an ATPase domain with four ATP-binding

sites and a C-terminal chaperone domain (Matassa et al. 2012). To explore which component

of TRAP1 is involved in the rescuing effect, I introduced hTrap1D158N

(with a point mutation

in one ATP-binding site) and hTrap1ΔMTS

(without mitochondrial target sequence). By RT-

PCR, I showed that flies with ubiquitous expression of hTrap1WT

and hTrap1D158N

presented

the same levels of hTrap1 mRNA. In addition, hTrap1 overexpression had no effect on

endogenous dTrap1 mRNA abundance. Western blot analysis revealed also very

similar/identical protein levels (Figure 8). These results indicate that the differences of the

effects between hTrap1WT

and hTrap1D158N

presented in this study were due to the functional

variation between two exogenous TRAP1 proteins and did not arise by difference in

expression levels of endogenous dTrap1.

Sequence alignment of TRAP1 with Hsp90 family members showed striking sequence

similarities in the ATP binding sites. According to this conservation in protein sequence, we

suggested that Aspartic acid at position 158 is a crucial amino acid in one of the ATP-binding

sites of TRAP1. A mutation in one of the four ATP binding sites of Hsp90 is known to abolish

Hsp90 function (Panaretou, et al. 1998). Using this information, hTrap1 was mutagenized,

replacing Aspartic acid at amino acid position 158 by Asparagine (hTrap1D158N

). In contrast


to hTrap1WT

, expression of hTrap1D158N

did not show any rescuing effect in Pink1 loss-of-

function in flies (Figure 9-17).

In cooperation with Konstanze Winklhofer, Pink1 deficient SH-SY5Y cells were analyzed.

Pink1 and parkin deficient cells displayed fragmented mitochondria and reduced ATP levels ,

both findings are indicative of a general dysfunction of mitochondria. Expression of

hTrap1WT

ameliorated phenotypes in Pink1, but not parkin deficient SH-SY5Y cells. Similar

to the observation in Pink1 deficient flies, Trap1D158N

or Trap1∆mito

(Trap1 lacking the

mitochondrial localization signal) did not provide any rescue effect neither on mitochondrial

fragmentation nor on ATP levels (Figure 21). Therefore, the protective effects by Trap1 not

only require proper ATP binding, but also require proper localization to mitochondria.

Interestingly, flies expressing hTrap1D158N

did not show any protective effect against. As

hTrap1WT

expressing flies provided protective effects towards α-SynA53T

-induced toxicity,

these previous findings are in agreement with the assumption that ATP binding and most

likely subsequent ATP to ADP conversion is required for TRAP1 (chaperone) function in

mitochondria (Butler et al. 2012).

4.3 Trap1 does not function in PINK1/Parkin pathway

Pink1 has been found to be involved in numerous pathways like oxidative-stress and

calcium-induced cell death (Pridgeon et al. 2007, Plun-Favreau et al. 2007, Gandhi et al.

2009). Among these pathways, the PINK1/Parkin pathway is the best understood. It has been

reported that Parkin functions downstream of PINK1 in regulating the quality of

mitochondrial population by either mitophagy or mitochondria-derived vesicles (MDVs)

(Park et al. 2006, Clark et al. 2006, Yang et al. 2006, Klionsky 2010, Wang et al. 2011,

Geisler et al. 2010, McLelland et al. 2014). Thus, it was analyzed whether TRAP1 is able to

also rescue phenotypes in Parkin-deficient flies.

Parkin loss-of-function flies display very similar/identical phenotypes compared to Pink1

loss-of-function flies (Greene et al. 2003, Park et al. 2006, Clark et al. 2006). This already

suggested that the two gene products may act in a common pathway. Epistatic analysis

revealed that overexpression of parkin is able to rescue phenotypes in Pink1-deficient flies.

Overexpression of Pink1, however, did not rescue phenotypes observed in parkin deficient

flies. This showed that Pink1 acts upstream of parkin (Clark et al. 2006, Park et al. 2006). I

have shown that expression of Trap1 rescued almost all phenotypes in Pink1 deficient flies.


As Pink1 acts upstream of parkin, I asked whether Trap1 also mitigates phenotypes in parkin

deficient flies.

Parkin loss-of-function flies (park25

) showed abnormal wing posture, disturbed climbing

ability and degenerated mitochondria in flight muscles (Figure 19). However, unlike in

Pink1B9

flies, expression of hTrap1 did not mitigate those phenotypes in park25

flies (Figure

19). Similar to Pink1 loss-of-function flies, parkin loss-of-function flies also display

mitochondrial dysfunction. The park25

flies presented reduced ATP levels in thoraxes and low

protein abundance of the mitochondrial complex I subunit NDUFS3. Expression of hTrap1

was neither able to restore the ATP level in thoraxes nor the decreased NDUFS3 protein level

in park25

homozygous flies (Figure 20). In summary, none of the abnormal phenotypes in

parkin loss-of-function flies were rescued by ectopic expression of hTrap1. Since the (almost)

identical phenotypes were rescued in a Pink1 deficiency, I assume that Trap1 acts

downstream of Pink1 but upstream or parallel to parkin.

This assumption has been further supported by my collaborator Konstanze Winklhofer. SH-

SY5Y cells, treated with parkin-siRNA exhibited refrained ATP levels and fragmented

mitochondria, similar to Pink1-deficient cells (Figure 21). However, in parkin-deficient SH-

SY5Y cells, hTrap1-expression provided no (ATP levels) or an only mild rescue

(mitochondrial fragmentation). These findings are coherent with the data obtained in flies.

Another study has shown that overexpression of dTrap1 (fly Trap1), instead of hTrap1,

rescues Pink1 loss-of-function (Costa et al. 2013). However, overexpression of dTrap1

mildly suppressed some parkin loss-of-function phenotypes like thorax indentation and

reduced ATP levels. Other phenotypes like locomotor ability were not suppressed. In addition

to my analysis, these authors investigated the phenotypes of Trap1-deficient (Trap14) flies.

Trap14 flies showed shortened life span, sensitivity to heat stress and chemicals (Paraquat,

Rotenone, Antimycin), impaired climbing ability and impaired mitochondrial function.

Interestingly, overexpression of parkin was able to partially restore some phenotypes of

Trap14 flies. Climbing ability and protein levels of the complex I subunit NDUFS3 in Trap1

4

flies were partially rescued by overexpression of parkin. The authors suppose that Trap1

functions downstream of Pink1 and independent of parkin in flies (Costa et al. 2013). In

summary, the reported findings and conclusions by Costa and co-workers is consistent with

my data and the interpretation thereof.


4.4 α-Synuclein, PINK1, TRAP1 and the mitochondrial

complex I

To further investigate how Trap1 might function downstream of Pink1, an unbiased genetic

screen was performed. The findings on TRAP1 function so far imply that the protein

preserves mitochondrial function and/or integrity. I reasoned that expression of TRAP1

should at least partially rescue RNAi-mediated knockdown of genes known to encode

proteins with mitochondrial function. To test this hypothesis, I ubiquitously knocked down

such genes using RNAi and asked whether this knock down caused lethality. In total, 93

genes coding proteins either of the mitochondrial electron transport chain complexes I, II, III,

IV, V or the Krebs cycle were screened. 50 of those genes caused lethality when ubiquitously

silenced by RNAi (Table 10). In a second approach, I asked whether co-expression of

hTrap1WT

is able to rescue the lethal phenotype by RNAi-mediated silencing of these 50

genes. In parallel, co-expression of hTrap1D158N

was as control, since this variant was

inefficient to abolish effects of Pink1 deficiency and therefore should not rescue lethality. In

this screening approach, I identified three mitochondrial complex I subunits that when

silenced caused lethality and were rescued by hTrap1WT

but not by hTrap1D158N

expression.

These mitochondrial complex I subunits were NDUFa5, NDUFb1 and NDUFS8 (Table 9).

Except of the three complex I subunits, only the deficiency of one complex IV protein

seemed to be compensated by TRAP1 overexpression. The lethality observed upon RNAi-

mediated silencing of cytochrome c oxidase subunit 6c (cyclope) was rescued by hTrap1WT

but not by hTrap1D158N

. These findings suggested that TRAP1 is involved in maintaining

functionality of mitochondrial complex I. To further support this hypothesis, I measured ATP

levels of L3 larvae with strong ubiquitous knock down of NDUFb1. These larvae presented

low ATP levels compared to the controls. However, L3 larvae with ubiquitously knock down

of NDUFb1 and co-expression of hTrap1WT

showed normal levels of ATP (Figure 22).

Larvae with strong ubiquitous knock down of NDUFb1 usually die as pupae. The regained

ATP level upon co-expression of hTrap1WT

in a NDUFb1-silenced background might explain

why pupal lethality was at least partially rescued by hTrap1WT

and adult flies hatched from

the pupal cage. Although adult flies were obtained, these flies were short lived and survived

only a few days (data not shown). These support the suggestion that Trap1 functions

downstream of mitochondrial complex I. In addition, TRAP1 seems to maintain

mitochondria in a functional state, allowing the normal production of ATP. Since hTrap1D158N


did not display any rescuing effects, I assumed that the ATP and most likely subsequent ATP-

lysis by TRAP1s inherited ATPase activity is crucial for the protective function.

Next I confirmed selected phenotypes reported in Trap14 (Trap1 mutant) flies by Costa et al.

like the impaired climbing ability (Figure 23B). In addition, I showed that Trap14 flies were

more sensitive to the heat stress. Only 40% of Trap14 flies survived 24 hours after a heat

shock, while all the control flies survived (Figure 24A). Also, Trap14 flies were vulnerable

when exposed to mitochondrial complex I inhibitor, Rotenone. Under Rotenone treatment,

the medial survival of Trap14 flies was about 11 days, while it was 18 days for controls

(Figure 23C). In addition, Trap14 flies also displayed mitochondrial dysfunction, by showing

reduced levels of NDUFS3 (Figure 24B) and thoracic ATP levels (Figure 23D), which were

also described by Costa et al. (Costa et al. 2013). These data suggest that in a Trap1 loss-of-

function situation, the electron transport chain (ETC) is dysfunctional and most likely

mitochondrial complex I is impaired. In this scenario, reconstitution of mitochondrial

complex I activity should rescue the phenotypes observed in a Trap1 loss-of-function

situation. A yeast protein Ndi1p bypasses mammalian function of mitochondrial complex I

(Vilain et al. 2012). Pan neuronal expression of Ndi1p in Trap14 flies restored NDUFS3

abundance in fly heads (Figure 24B). Moreover, I found that neuronal Ndi1p mitigated the

vulnerability of Trap14 flies to heat stress (Figure 24A). These findings indicate that, the

phenotype induced by Trap1 loss-of-function might be attributed to mitochondrial complex I

deficiency. Moreover, I have shown that TRAP1 rescues detrimental effects induced by

silencing of certain single mitochondrial complex I subunits. Also in rat cortical

overexpression of Trap1 has been also reported that provided a protection against Rotenone

(Butler et al. 2012). Altogether, I assume that TRAP1 is beneficial in maintaining the

integrity of mitochondrial complex I and/or is involved in correct protein folding of

mitochondrial complex I subunits (Figure 25). In this way, without TRAP1, mitochondrial

complex I is more vulnerable to environmental stressors, such as ROS. This would explain

why Trap1 loss-of-function flies displayed mitochondrial complex I deficiency and reduced

ATP levels. With certain mitochondrial complex I subunits being knocked down in flies,

overexpression of TRAP1 may slow down the progress of mitochondrial complex I

dysfunction.


Figure 25 TRAP1 protects the function/integrity of mitochondrial complex I. Under stress, such as ROS, mitochondrial complex I undergoes damage. TRAP1 may repair/prevent

the damage of mitochondrial complex I by refolding the subunits or remaining the integrity of the

entire complex I. Without TRAP1 mitochondrial complex I is vulnerable to stress. With TRAP1

overexpression, the mitochondrial complex I seems less sensitive towards certain stress conditions.

Interestingly, Pink1 loss-of-function have been reported to cause mitochondrial complex I

dysfunction. In Pink1 deficient mice or mice with Pink1 clinical mutations, decreased

mitochondrial complex I activity has been reported (Morais et al. 2009). Furthermore, in flies,

abnormal phenotypes induced by Pink1 loss-of-function can be rescued by Ndi1p

(mitochondrial complex I), but not by AOX (CIII and IV) (Vilain et al. 2012). Moreover, flies

with loss-of-function of some mitochondrial complex I subunits phenocopied Pink1 loss-of-

function flies (Vilain et al. 2012). Those finding strongly suggest that Pink1 functions

upstream of mitochondrial complex I. Interestingly, expression of Ndi1p failed to rescue any

of the parkin mutant phenotypes, and parkin mutant flies did not show reduced activity of

mitochondrial complex I (Vilain et al. 2012). These results using the yeast mitochondrial

complex I equivalent Ndi1p resemble what has been observed after Trap1 expression.

Expression of both, Ndi1p and Trap1 rescued Pink1 loss-of-function, but not parkin loss-of-

function. These data suggest that TRAP1 and mitochondrial complex I function downstream

of PINK1 and both of them act independent of Parkin. This is in agreement with the idea of

an additional PINK1-involving pathway that acts independent of the classical PINK1/Parkin

pathway. The PINK1/Parkin is facilitating mitochondrial quality control and is required to

target dysfunctional mitochondria for degradation. In the alternative pathway involving

PINK1 and TRAP1, TRAP1 seems to be involved in maintaining mitochondrial function

(most likely by stabilizing complex I). In this scenario, according to TRAP1 function, the

mitochondria are kept polarized. Polarized mitochondria in turn are not a target for

mitophagy via the PINK1/Parkin pathway.

In sporadic PD, an impaired complex I function has been described already in 1989 (Schapira,

J Neurochem.). Moreover, altered TRAP1 levels have been shown to modulate toxicity

induced by -Syn in flies and in rat cortical neurons (Butler et al. 2012). How -Syn impairs

complex I function remains elusive. It can only be speculated whether -Syn directly or


indirectly impairs complex I function. Data showing that PINK1, Parkin and DJ-1 rescue -

Syn-induced mitochondrial fragmentation support the idea that -Syn could directly impair

complex I function. Most notably, the PD-causing mutations in Pink1, parkin and DJ-1 failed

to rescue -Syn-induced mitochondrial fragmentation (Kamp et al. 2010). In support of a

direct impairement of complex I function by -Syn would be the report by Cole et al. 2008.

Here Cole and co-workers detected -Syn at mitochondrial outer membrane under acid cell

condition in primary rat hippocampal neurons. Kamp et al. 2010 observed that -Syn directly

binds to mitochondrial outer membrane in SH-SY5Y cells. At the mitochondrial outer

membrane, -Syn seems to bind the outer mitochondrial membrane and promotes

mitochondrial fission. Tight control of mitochondrial integrity by fission/fusion and

mitochondrial transport seems to be important in PD etiology (Liu, et al. 2012, Chen, et al.

2009). Genetic studies in flies showed that the PINK1/Parkin pathway seems to promote

mitochondrial fission to initiate mitophagy. Furthermore, Pink1 mutant phenotypes are

enhanced by heterozygous mutation in the gene coding the pro fission Dynamin related

protein1 (Deng et al. 2008).

On the other hand, there is evidence that -Syn is associated with the mitochondrial inner

membrane. Devi et al. 2008 and Robotta, et al. 2014 showed that -Syn binds to the

mitochondrial inner membrane, in human fetal dopaminergic primary neuronal cultures and

human HEK293 cells, respectively.

Also an indirect effect of -Syn on mitochondira and/or complex I function is possible. For

example, accumulation of -Syn is known to trigger several cellular mechanisms including

oxidative stress and proteasomal stress (Branco et al. 2010). Chronic stress might impair the

mitochondrial function. Especially dopaminergic neurons, which are known to have

increased risk to produce reactive oxygen species (ROS) according to the synthesis of

dopamine, are vulnerable towards such stressors.

Nevertheless, the findings in this and previous fly studies imply a genetic cascade in which α-

Syn-induced toxicity is upstream of PINK1. TRAP1 in turn is located downstream

mitochondrial complex I (Figure 26) and seems to be involved in maintaining a functional

mitochondrial complex I. In this way, TRAP1 attenuates the phenotypes caused by

overexpression of α-Syn, or induced by a Pink1 deficiency. In the context of PD etiology, the

presented data are of importance. TRAP1 not only attenuates the effects of mutations in


SNCA that cause dominantly inherited PD but also effects of mutations in Pink1 that cause

recessively inherited PD. Moreover TRAP1 rescues a key element of PD pathology, namely

mitochondrial complex I dysfunction. Thus, enhancing TRAP1 activity or abundance might

be a reasonable approach in the future therapies of PD.

Figure 26. Putative role(s) of TRAP1 in PD. In case of an accumulation of misfolded proteins in mitochondria or upon depolarization of the

organelle (∆), PINK1 is stabilized and locates to the mitochondrial outer membrane (MOM). At

the MOM, PINK1 recruits Parkin to mitochondria. Parkin in turn ubiquitinates its mitochondrial

target protein and initiates mitophagy. This process seems to be independent of TRAP1. In contrast,

there seems to be a tight connection between PINK1 and TRAP1. TRAP1 is phosphorylated by

PINK1 and both proteins co-localize in mitochondrial inner membrane (MIM) as well as in the

mitochondrial intermembrane space (MIS). Here, the protective effects of PINK1 against oxidative

stress-induced cell death require TRAP1. In addition, TRAP1 rescues Pink1 loss-of-function and

mitochondrial complex I loss-of-function phenotypes. Moreover, TRAP1 mitigates α-Syn-induced

mitochondrial fragmentation and α-Syn-dependent inhibition of mitochondrial complex I. Whether α-

Syn localizes at MOM or MIM is still unclear. In summary, TRAP1 is a key element in PD.

Chapter 5 – References 59

5 References

Aarsland, D., Pahlhagen, S., Ballard, C. G., Ehrt, U. and Svenningsson, P. (2012) Depression

in Parkinson disease--epidemiology, mechanisms and management. Nat Rev Neurol,

8, 35-47.

Aarsland, D., Zaccai, J. and Brayne, C. (2005) A systematic review of prevalence studies of

dementia in Parkinson's disease. Mov Disord, 20, 1255-1263.

Alam, M. and Schmidt, W. J. (2002) Rotenone destroys dopaminergic neurons and induces

parkinsonian symptoms in rats. Behavioural Brain Research, 136, 317-324.

Auluck P. K., Edwin Chan H. Y. Trojanowski J. Q. et al. (2001) Chaperone Suppression of

α-Synuclein Toxicity in a Drosophila Model for Parkinson's Disease. Science, 295,

865-868.

Baba, M., Nakajo, S., Tu, P. H., Tomita, T., Nakaya, K., Lee, V. M., Trojanowski, J. Q. and

Iwatsubo, T. (1998) Aggregation of alpha-synuclein in Lewy bodies of sporadic

Parkinson's disease and dementia with Lewy bodies. Am J Pathol, 152, 879-884.

Barnes, J. and David, A. S. (2001) Visual hallucinations in Parkinson's disease: a review and

phenomenological survey. J Neurol Neurosurg Psychiatry, 70, 727-733.

Becker, D., Richter, J., Tocilescu, M. A., Przedborski, S. and Voos, W. (2012) Pink1 kinase

and its membrane potential (Deltapsi)-dependent cleavage product both localize to

outer mitochondrial membrane by unique targeting mode. J Biol Chem, 287, 22969-

22987.

Bender, A., Krishnan, K. J., Morris, C. M. et al. (2006) High levels of mitochondrial DNA

deletions in substantia nigra neurons in aging and Parkinson disease. Nat Genet, 38,

515-517.

Betarbet, R., Sherer, T. B., MacKenzie, G., Garcia-Osuna, M., Panov, A. V. and Greenamyre,

J. T. (2000) Chronic systemic pesticide exposure reproduces features of Parkinson's

disease. Nat Neurosci, 3, 1301-1306.

Bindoff, L. A., Birch-Machin, M., Cartlidge, N. E., Parker, W. D., Jr. and Turnbull, D. M.

(1989) Mitochondrial function in Parkinson's disease. Lancet, 2, 49.

Blesa, J., Phani, S., Jackson-Lewis, V. and Przedborski, S. (2012) Classic and new animal

models of Parkinson's disease. J Biomed Biotechnol, 2012, 845618.

Bonifati, V., Rizzu, P., van Baren, M. J. et al. (2003a) Mutations in the DJ-1 gene associated

with autosomal recessive early-onset parkinsonism. Science, 299, 256-259.


Bonifati, V., Rizzu, P., van Baren, M. J. et al. (2003b) Mutations in the DJ-1 gene associated

with autosomal recessive early-onset parkinsonism. Science, 299, 256-259.

Braak, H. and Del Tredici, K. (2009) Neuroanatomy and pathology of sporadic Parkinson's

disease. Adv Anat Embryol Cell Biol, 201, 1-119.

Braak, H., Del Tredici, K., Rub, U., de Vos, R. A., Jansen Steur, E. N. and Braak, E. (2003)

Staging of brain pathology related to sporadic Parkinson's disease. Neurobiol Aging,

24, 197-211.

Braak H, Ghebremedhin E, Rüb U, Bratzke H, Del Tredici K. Stages in the development of

Parkinson's disease-related pathology. (2004) Cell Tissue Res, 318(1):121-34.

Branco, D. M., Arduino, D. M., Esteves, A. R., Silva, D. F. F., Cardoso, S. M., & Oliveira, C.

R. (2010). Cross-Talk Between Mitochondria and Proteasome in Parkinson’s Disease

Pathogenesis. Frontiers in Aging Neuroscience, 2, 17.

Butler, E. K., Voigt, A., Lutz, A. K. et al. (2012) The mitochondrial chaperone protein

TRAP1 mitigates alpha-Synuclein toxicity. PLoS Genet, 8, e1002488.

Calne, D. B. and Langston, J. W. (1983) Aetiology of Parkinson's disease. Lancet, 2, 1457-

1459.

Chartier-Harlin, M. C., Kachergus, J., Roumier, C. et al. (2004) Alpha-synuclein locus

duplication as a cause of familial Parkinson's disease. Lancet, 364, 1167-1169.

Chen, Y. and Dorn, G. W. (2013) PINK1-Phosphorylated Mitofusin 2 Is a Parkin Receptor

for Culling Damaged Mitochondria. Science, 340, 471-475.

Clark, I. E., Dodson, M. W., Jiang, C., Cao, J. H., Huh, J. R., Seol, J. H., Yoo, S. J., Hay, B.

A. and Guo, M. (2006) Drosophila pink1 is required for mitochondrial function and

interacts genetically with parkin. Nature, 441, 1162-1166.

Cola, N. B., DiEuliis D., Leo D., Mitchell D. C., Nussbaum R. L. (2008) Mitochondrial

translocation of -Synuclein is promoted by intracellular acidification. Exp Cell Res,

314, 2076-2089.

Costa, A. C., Loh, S. H. and Martins, L. M. (2013) Drosophila Trap1 protects against

mitochondrial dysfunction in a PINK1/parkin model of Parkinson's disease. Cell

Death Dis, 4, e467.

Damier, P., Hirsch, E. C., Agid, Y. and Graybiel, A. M. (1999) The substantia nigra of the

human brain. II. Patterns of loss of dopamine-containing neurons in Parkinson's

disease. Brain, 122 ( Pt 8), 1437-1448.

http://www.ncbi.nlm.nih.gov/pubmed/15338272



Darios, F., Corti, O., Lucking, C. B. et al. (2003) Parkin prevents mitochondrial swelling and

cytochrome c release in mitochondria-dependent cell death. Hum Mol Genet, 12, 517-

526.

Deng, H., Dodson, M. W., Huang, H. and Guo, M. (2008) The Parkinson's disease genes

pink1 and parkin promote mitochondrial fission and/or inhibit fusion in Drosophila.

Proc Natl Acad Sci U S A, 105, 14503-14508.

Devi, L., Raghavendran, V., Prabhu, B. M., Avadhani, N. G. and Anandatheerthavarada, H.

K. (2008) Mitochondrial import and accumulation of alpha-synuclein impair complex

I in human dopaminergic neuronal cultures and Parkinson disease brain. J Biol Chem,

283, 9089-9100.

Doty, R. L. (2012) Olfactory dysfunction in Parkinson disease. Nat Rev Neurol, 8, 329-339.

Eisbach SE, Outeiro TF. Alpha-synuclein and intracellular trafficking: impact on the

spreading of Parkinson's disease pathology. J Mol Med (Berl). 2013 Jun;91(6):693-

703.

Farrer, M., Chan, P., Chen, R. et al. (2001) Lewy bodies and parkinsonism in families with

parkin mutations. Ann Neurol, 50, 293-300.

Feany, M. B. and Bender, W. W. (2000) A Drosophila model of Parkinson's disease. Nature,

404, 394-398.

Fitzgerald, J. C. and Plun-Favreau, H. (2008) Emerging pathways in genetic Parkinson's

disease: autosomal-recessive genes in Parkinson's disease--a common pathway?

FEBS J, 275, 5758-5766.

Freundt EC, Maynard N, Clancy EK, Roy S, Bousset L, Sourigues Y, Covert M, Melki R,

Kirkegaard K, Brahic M. Neuron-to-neuron transmission of α-synuclein fibrils

through axonal transport. Ann Neurol. 2012 Oct;72(4):517-24.

Gandhi, S., Muqit, M. M., Stanyer, L. et al. (2006) PINK1 protein in normal human brain and

Parkinson's disease. Brain, 129, 1720-1731.

Gandhi, S., Wood-Kaczmar, A., Yao, Z., et al. (2009) PINK1-Associated Parkinson's Disease

Is Caused by Neuronal Vulnerability to Calcium-Induced Cell Death. Molecular Cell,

33, 627-638.

Gegg, M. E., Cooper, J. M., Chau, K. Y., Rojo, M., Schapira, A. H. and Taanman, J. W.

(2010) Mitofusin 1 and mitofusin 2 are ubiquitinated in a PINK1/parkin-dependent

manner upon induction of mitophagy. Hum Mol Genet, 19, 4861-4870.






Geisler, S., Holmstrom, K. M., Skujat, D., Fiesel, F. C., Rothfuss, O. C., Kahle, P. J. and

Springer, W. (2010) PINK1/Parkin-mediated mitophagy is dependent on VDAC1 and

p62/SQSTM1. Nat Cell Biol, 12, 119-131.

Chen, H. and Chan, D. C. (2009) Mitochondrial dynamics–fusion, fission, movement, and

mitophagy–in neurodegenerative diseases. Hum. Mol. Genet.,18 (R2), R169-R176.

Gibb, W. R. and Lees, A. J. (1988) The relevance of the Lewy body to the pathogenesis of

idiopathic Parkinson's disease. J Neurol Neurosurg Psychiatry, 51, 745-752.

Glauser, L., Sonnay, S., Stafa, K. and Moore, D. J. (2011) Parkin promotes the ubiquitination

and degradation of the mitochondrial fusion factor mitofusin 1. J Neurochem, 118,

636-645.

Greenamyre, J. T., Betarbet, R. and Sherer, T. B. (2003) The rotenone model of Parkinson's

disease: genes, environment and mitochondria. Parkinsonism Relat Disord, 9 Suppl 2,

S59-64.

Greenamyre, J. T., Sherer, T. B., Betarbet, R. and Panov, A. V. (2001) Complex I and

Parkinson's disease. IUBMB Life, 52, 135-141.

Greene, A. W., Grenier, K., Aguileta, M. A., Muise, S., Farazifard, R., Haque, M. E.,

McBride, H. M., Park, D. S. and Fon, E. A. (2012) Mitochondrial processing

peptidase regulates PINK1 processing, import and Parkin recruitment. EMBO Rep, 13,

378-385.

Greene, J. C., Whitworth, A. J., Kuo, I., Andrews, L. A., Feany, M. B. and Pallanck, L. J.

(2003) Mitochondrial pathology and apoptotic muscle degeneration in Drosophila

parkin mutants. P Natl Acad Sci USA, 100, 4078-4083.

Gu, M., Cooper, J. M., Taanman, J. W. and Schapira, A. H. (1998) Mitochondrial DNA

transmission of the mitochondrial defect in Parkinson's disease. Ann Neurol, 44, 177-

186.

Haas, R. H., Nasirian, F., Nakano, K., Ward, D., Pay, M., Hill, R. and Shults, C. W. (1995)

Low platelet mitochondrial complex I and complex II/III activity in early untreated

Parkinson's disease. Ann Neurol, 37, 714-722.

Haque, M. E., Thomas, K. J., D'Souza, C. et al. (2008) Cytoplasmic Pink1 activity protects

neurons from dopaminergic neurotoxin MPTP. Proc Natl Acad Sci U S A, 105, 1716-

1721.

Hayashi, S., Wakabayashi, K., Ishikawa, A. et al. (2000) An autopsy case of autosomal-

recessive juvenile parkinsonism with a homozygous exon 4 deletion in the parkin

gene. Mov Disord, 15, 884-888.


Healy, D. G., Abou-Sleiman, P. M. and Wood, N. W. (2004) PINK, PANK, or PARK? A

clinicians' guide to familial parkinsonism. Lancet Neurol, 3, 652-662.

Hughes, A. J., Daniel, S. E. and Lees, A. J. (2001) Improved accuracy of clinical diagnosis of

Lewy body Parkinson's disease. Neurology, 57, 1497-1499.

Ibanez, P., Lesage, S., Lohmann, E., Thobois, S., De Michele, G., Borg, M., Agid, Y., Durr,

A. and Brice, A. (2006) Mutational analysis of the PINK1 gene in early-onset

parkinsonism in Europe and North Africa. Brain, 129, 686-694.

Ikebe, S., Tanaka, M., Ohno, K., Sato, W., Hattori, K., Kondo, T., Mizuno, Y. and Ozawa, T.

(1990) Increase of deleted mitochondrial DNA in the striatum in Parkinson's disease

and senescence. Biochem Biophys Res Commun, 170, 1044-1048.

Imai, Y., Kanao, T., Sawada, T. et al. (2010) The loss of PGAM5 suppresses the

mitochondrial degeneration caused by inactivation of PINK1 in Drosophila. PLoS

Genet, 6, e1001229.

Jenner, P., Dexter, D. T., Sian, J., Schapira, A. H. and Marsden, C. D. (1992) Oxidative stress

as a cause of nigral cell death in Parkinson's disease and incidental Lewy body

disease. The Royal Kings and Queens Parkinson's Disease Research Group. Ann

Neurol, 32 Suppl, S82-87.

Jensen, P. H., Nielsen, M. S., Jakes, R., Dotti, C. G. and Goedert, M. (1998) Binding of

alpha-synuclein to brain vesicles is abolished by familial Parkinson's disease mutation.

J Biol Chem, 273, 26292-26294.

Jin, S. M., Lazarou, M., Wang, C., Kane, L. A., Narendra, D. P. and Youle, R. J. (2010)

Mitochondrial membrane potential regulates PINK1 import and proteolytic

destabilization by PARL. J Cell Biol, 191, 933-942.

Jin, S. M. and Youle, R. J. (2013) The accumulation of misfolded proteins in the

mitochondrial matrix is sensed by PINK1 to induce PARK2/Parkin-mediated

mitophagy of polarized mitochondria. Autophagy, 9.

Kamp, F., Exner, N., Lutz, A. K. et al. (2010) Inhibition of mitochondrial fusion by alpha-

synuclein is rescued by PINK1, Parkin and DJ-1. EMBO J, 29, 3571-3589.

Kane, L. A., Lazarou, M., Fogel, A. I., Li, Y., Yamano, K., Sarraf, S. A., Banerjee, S. and

Youle, R. J. (2014) PINK1 phosphorylates ubiquitin to activate Parkin E3 ubiquitin

ligase activity. J Cell Biol, 205, 143-153.

Kato, H., Lu, Q., Rapaport, D. and Kozjak-Pavlovic, V. (2013) Tom70 is essential for PINK1

import into mitochondria. PLoS One, 8, e58435.


Kawajiri, S., Saiki, S., Sato, S., Sato, F., Hatano, T., Eguchi, H. and Hattori, N. (2010)

PINK1 is recruited to mitochondria with parkin and associates with LC3 in

mitophagy. FEBS Lett, 584, 1073-1079.

Kazlauskaite, A., Kondapalli, C., Gourlay, R. et al. (2014) Parkin is activated by PINK1-

dependent phosphorylation of ubiquitin at Ser65. Biochem J, 460, 127-139.

Kitada, T., Asakawa, S., Hattori, N., Matsumine, H., Yamamura, Y., Minoshima, S., Yokochi,

M., Mizuno, Y. and Shimizu, N. (1998) Mutations in the parkin gene cause autosomal

recessive juvenile parkinsonism. Nature, 392, 605-608.

Klionsky, D. J. (2010) The molecular machinery of autophagy and its role in physiology and

disease. Semin Cell Dev Biol, 21, 663.

Kordower JH, Chu Y, Hauser RA, Freeman TB, Olanow CW. Lewy body-like pathology in

long-term embryonic nigral transplants in Parkinson's disease.Nat Med. 2008

May;14(5):504-6.

Koyano, F., Okatsu, K., Kosako, H. et al. (2014) Ubiquitin is phosphorylated by PINK1 to

activate parkin. Nature, 510, 162.

Krige, D., Carroll, M. T., Cooper, J. M., Marsden, C. D. and Schapira, A. H. (1992) Platelet

mitochondrial function in Parkinson's disease. The Royal Kings and Queens

Parkinson Disease Research Group. Ann Neurol, 32, 782-788.

Kruger, R., Kuhn, W., Muller, T. et al. (1998) Ala30Pro mutation in the gene encoding

alpha-synuclein in Parkinson's disease. Nat Genet, 18, 106-108.

Kubo, S. I., Kitami, T., Noda, S. et al. (2001) Parkin is associated with cellular vesicles. J

Neurochem, 78, 42-54.

Langston, J. W., Ballard, P., Tetrud, J. W. and Irwin, I. (1983) Chronic Parkinsonism in

humans due to a product of meperidine-analog synthesis. Science, 219, 979-980.

Langston, J. W., Irwin, I., Langston, E. B. and Forno, L. S. (1984) 1-Methyl-4-

phenylpyridinium ion (MPP+): identification of a metabolite of MPTP, a toxin

selective to the substantia nigra. Neurosci Lett, 48, 87-92.

Lazarou, M., Jin, S. M., Kane, L. A. and Youle, R. J. (2012) Role of PINK1 binding to the

TOM complex and alternate intracellular membranes in recruitment and activation of

the E3 ligase Parkin. Dev Cell, 22, 320-333.

Liu S, Lu B (2010) Reduction of Protein Translation and Activation of Autophagy Protect

against PINK1 Pathogenesis in Drosophila melanogaster. PLoS Genet 6(12).

http://www.ncbi.nlm.nih.gov/pubmed?term=Kordower%20JH%5BAuthor%5D&cauthor=true&cauthor_uid=18391962

http://www.ncbi.nlm.nih.gov/pubmed?term=Chu%20Y%5BAuthor%5D&cauthor=true&cauthor_uid=18391962

http://www.ncbi.nlm.nih.gov/pubmed?term=Hauser%20RA%5BAuthor%5D&cauthor=true&cauthor_uid=18391962

http://www.ncbi.nlm.nih.gov/pubmed?term=Freeman%20TB%5BAuthor%5D&cauthor=true&cauthor_uid=18391962

http://www.ncbi.nlm.nih.gov/pubmed?term=Olanow%20CW%5BAuthor%5D&cauthor=true&cauthor_uid=18391962


Liu S, Sawada T, Lee S, Yu W, Silverio G, et al. (2012) Parkinson's Disease–Associated

Kinase PINK1 Regulates Miro Protein Level and Axonal Transport of Mitochondria.

PLoS Genet 8(3).

Lucking, C. B., Durr, A., Bonifati, V. et al. (2000) Association between early-onset

Parkinson's disease and mutations in the parkin gene. N Engl J Med, 342, 1560-1567.

Maraganore, Demetrius M., Lesnick, Timothy G., Elbaz, Alexis et al. (2004) UCHL1 is a

Parkinson's disease susceptibility gene. Annals of neurology, 55, 512-521

Maroteaux, L., Campanelli, J. T. and Scheller, R. H. (1988) Synuclein: a neuron-specific

protein localized to the nucleus and presynaptic nerve terminal. J Neurosci, 8, 2804-

2815.

Marsden, C. D. and Parkes, J. D. (1977) Success and problems of long-term levodopa

therapy in Parkinson's disease. Lancet, 1, 345-349.

Matassa, D. S., Amoroso, M. R., Maddalena, F., Landriscina, M. and Esposito, F. (2012)

New insights into TRAP1 pathway. Am J Cancer Res, 2, 235-248.

McLelland, G. L., Soubannier, V., Chen, C. X., McBride, H. M. and Fon, E. A. (2014) Parkin

and PINK1 function in a vesicular trafficking pathway regulating mitochondrial

quality control. Embo Journal, 33, 282-295.

Menzies, F. M., Yenisetti, S. C. and Min, K. T. (2005) Roles of Drosophila DJ-1 in survival

of dopaminergic neurons and oxidative stress. Curr Biol, 15, 1578-1582.

Michiorri, S., Gelmetti, V., Giarda, E. et al. (2010) The Parkinson-associated protein PINK1

interacts with Beclin1 and promotes autophagy. Cell Death Differ, 17, 962-974.

Morais, V. A., Verstreken, P., Roethig, A. et al. (2009) Parkinson's disease mutations in

PINK1 result in decreased Complex I activity and deficient synaptic function. Embo

Molecular Medicine, 1, 99-111.

Narendra, D., Kane, L. A., Hauser, D. N., Fearnley, I. M. and Youle, R. J. (2010a)

p62/SQSTM1 is required for Parkin-induced mitochondrial clustering but not

mitophagy; VDAC1 is dispensable for both. Autophagy, 6, 1090-1106.

Narendra, D., Tanaka, A., Suen, D. F. and Youle, R. J. (2008) Parkin is recruited selectively

to impaired mitochondria and promotes their autophagy. J Cell Biol, 183, 795-803.

Narendra, D. P., Jin, S. M., Tanaka, A., Suen, D. F., Gautier, C. A., Shen, J., Cookson, M. R.

and Youle, R. J. (2010b) PINK1 is selectively stabilized on impaired mitochondria to

activate Parkin. PLoS Biol, 8, e1000298.


Obeso, J. A., Rodriguez-Oroz, M. C., Rodriguez, M., Lanciego, J. L., Artieda, J., Gonzalo, N.

and Olanow, C. W. (2000) Pathophysiology of the basal ganglia in Parkinson's

disease. Trends Neurosci, 23, S8-19.

Pakkenberg, B., Moller, A., Gundersen, H. J., Mouritzen Dam, A. and Pakkenberg, H. (1991)

The absolute number of nerve cells in substantia nigra in normal subjects and in

patients with Parkinson's disease estimated with an unbiased stereological method. J

Neurol Neurosurg Psychiatry, 54, 30-33.

Panaretou B, Prodromou C, Roe SM, O'Brien R, Ladbury JE, Piper PW, Pearl LH. ATP

binding and hydrolysis are essential to the function of the Hsp90 molecular chaperone in vivo.

EMBO J. 1998;17(16):4829-4836.

Panov, A., Dikalov, S., Shalbuyeva, N., Taylor, G., Sherer, T. and Greenamyre, J. T. (2005)

Rotenone model of Parkinson disease: multiple brain mitochondria dysfunctions after

short term systemic rotenone intoxication. J Biol Chem, 280, 42026-42035.

Park, J., Lee, S. B., Lee, S. et al. (2006) Mitochondrial dysfunction in Drosophila PINK1

mutants is complemented by parkin. Nature, 441, 1157-1161.

Parker, W. D., Jr., Boyson, S. J. and Parks, J. K. (1989) Abnormalities of the electron

transport chain in idiopathic Parkinson's disease. Ann Neurol, 26, 719-723.

Parker, W. D., Jr., Parks, J. K. and Swerdlow, R. H. (2008) Complex I deficiency in

Parkinson's disease frontal cortex. Brain Res, 1189, 215-218.

Peeraully, T., Yong, M. H., Chokroverty, S. and Tan, E. K. (2012) Sleep and Parkinson's

disease: a review of case-control polysomnography studies. Mov Disord, 27, 1729-

1737.

Polymeropoulos, M. H., Lavedan, C., Leroy, E. et al. (1997) Mutation in the alpha-synuclein

gene identified in families with Parkinson's disease. Science, 276, 2045-2047.

Poole, A. C., Thomas, R. E., Yu, S., Vincow, E. S. and Pallanck, L. (2010) The

mitochondrial fusion-promoting factor mitofusin is a substrate of the PINK1/parkin

pathway. PLoS One, 5, e10054.

Plun-Favreau, H., Klupsch, K., Moisoi, N., et al. (2007) The mitochondrial protease HtrA2

is regulated by Parkinson's disease-associated kinase PINK1. Nature cell biology, 9,

1243-52.

Pramstaller, P. P., Schlossmacher, M. G., Jacques, T. S. et al. (2005) Lewy body Parkinson's

disease in a large pedigree with 77 Parkin mutation carriers. Ann Neurol, 58, 411-422.


Pridgeon, J. W., Olzmann, J. A., Chin, L. S. and Li, L. (2007) PINK1 protects against

oxidative stress by phosphorylating mitochondrial chaperone TRAP1. PLoS Biol, 5,

e172.

Ramirez, A., Heimbach, A., Gruendemann, J. et al. (2006) Hereditary parkinsonism with

dementia is caused by mutations in ATP13A2, encoding a lysosomal type 5 P-type

ATPase. Nature Genetics, 38, 1184-1191.

Rey NL, Petit GH, Bousset L, Melki R, Brundin P. Transfer of human α-synuclein from the

olfactory bulb to interconnected brain regions in mice. Acta Neuropathol. 2013 Aug 8.

Rhodenizer, D., Martin, I., Bhandari, P., Pletcher, S. D. and Grotewiel, M. (2008) Genetic

and environmental factors impact age-related impairment of negative geotaxis in

Drosophila by altering age-dependent climbing speed. Exp Gerontol, 43, 739-748.

Robotta M., Gerding H. R., Vogel A., Hauser K., Schildknecht S., Karreman C., Leist M.,

Subramaniam V., Drescher M. (2014) ChemBioChem, 15, 2499-2502.

Schapira, A. H. (2008) Mitochondria in the aetiology and pathogenesis of Parkinson's disease.

Lancet Neurol, 7, 97-109.

Schapira, A. H., Cooper, J. M., Dexter, D., Clark, J. B., Jenner, P. and Marsden, C. D. (1990)

Mitochondrial complex I deficiency in Parkinson's disease. J Neurochem, 54, 823-827.

Schapira, A. H., Cooper, J. M., Dexter, D., Jenner, P., Clark, J. B. and Marsden, C. D. (1989)

Mitochondrial complex I deficiency in Parkinson's disease. Lancet, 1, 1269.

Sherer, T. B., Betarbet, R. and Greenamyre, J. T. (2002) Environment, mitochondria, and

Parkinson's disease. Neuroscientist, 8, 192-197.

Sherer, T. B., Betarbet, R., Testa, C. M. et al. (2003a) Mechanism of toxicity in rotenone

models of Parkinson's disease. J Neurosci, 23, 10756-10764.

Sherer, T. B., Kim, J. H., Betarbet, R. and Greenamyre, J. T. (2003b) Subcutaneous rotenone

exposure causes highly selective dopaminergic degeneration and alpha-synuclein

aggregation. Exp Neurol, 179, 9-16.

Shimura, H., Hattori, N., Kubo, S. et al. (2000) Familial Parkinson disease gene product,

parkin, is a ubiquitin-protein ligase. Nat Genet, 25, 302-305.

Shoffner, J. M., Watts, R. L., Juncos, J. L., Torroni, A. and Wallace, D. C. (1991)

Mitochondrial oxidative phosphorylation defects in Parkinson's disease. Ann Neurol,

30, 332-339.

Shulman, J. M., De Jager, P. L. and Feany, M. B. (2011) Parkinson's disease: genetics and

pathogenesis. Annu Rev Pathol, 6, 193-222.




Singleton, A. B., Farrer, M., Johnson, J. et al. (2003) alpha-Synuclein locus triplication

causes Parkinson's disease. Science, 302, 841.

Spillantini, M. G., Divane, A. and Goedert, M. (1995) Assignment of human alpha-synuclein

(SNCA) and beta-synuclein (SNCB) genes to chromosomes 4q21 and 5q35.

Genomics, 27, 379-381.

Spillantini, M. G., Schmidt, M. L., Lee, V. M., Trojanowski, J. Q., Jakes, R. and Goedert, M.

(1997) Alpha-synuclein in Lewy bodies. Nature, 388, 839-840.

Sterky, F. H., Hoffman, A. F., Milenkovic, D. et al. (2012) Altered dopamine metabolism and

increased vulnerability to MPTP in mice with partial deficiency of mitochondrial

complex I in dopamine neurons. Hum Mol Genet, 21, 1078-1089.

Strauss, K. M., Martins, L. M., Plun-Favreau, H. et al. (2005) Loss of function mutations in

the gene encoding Omi/HtrA2 in Parkinson's disease. Hum Mol Genet, 14, 2099-2111.

Taipa R, Pinho J, Melo-Pires M. Clinico-Pathological. (2012) Correlations of the Most

Common Neurodegenerative Dementias. Frontiers in Neurology, 3, 68.

Taira, T., Saito, Y., Niki, T., Iguchi-Ariga, S. M., Takahashi, K. and Ariga, H. (2004) DJ-1

has a role in antioxidative stress to prevent cell death. EMBO Rep, 5, 213-218.

Tan, E. K. and Skipper, L. M. (2007) Pathogenic mutations in Parkinson disease. Hum Mutat,

28, 641-653.

Tanaka, A., Cleland, M. M., Xu, S., Narendra, D. P., Suen, D. F., Karbowski, M. and Youle,

R. J. (2010) Proteasome and p97 mediate mitophagy and degradation of mitofusins

induced by Parkin. J Cell Biol, 191, 1367-1380.

Valente, E. M., Abou-Sleiman, P. M., Caputo, V. et al. (2004) Hereditary early-onset

Parkinson's disease caused by mutations in PINK1. Science, 304, 1158-1160.

Vilain, S., Esposito, G., Haddad, D. et al. (2012) The Yeast Complex I Equivalent NADH

Dehydrogenase Rescues pink1 Mutants. Plos Genetics, 8.

Vives-Bauza, C., Zhou, C., Huang, Y. et al. (2010) PINK1-dependent recruitment of Parkin

to mitochondria in mitophagy. Proc Natl Acad Sci U S A, 107, 378-383.

Wang, X., Winter, D., Ashrafi, G. et al. (2011) PINK1 and Parkin target Miro for

phosphorylation and degradation to arrest mitochondrial motility. Cell, 147, 893-906.

Wasner, G. and Deuschl, G. (2012) Pains in Parkinson disease--many syndromes under one

umbrella. Nat Rev Neurol, 8, 284-294.

Weihofen, A., Ostaszewski, B., Minami, Y. and Selkoe, D. J. (2008) Pink1 Parkinson

mutations, the Cdc37/Hsp90 chaperones and Parkin all influence the maturation or

subcellular distribution of Pink1. Hum Mol Genet, 17, 602-616.


Whitworth, A. J., Theodore, D. A., Greene, J. C., Benes, H., Wes, P. D. and Pallanck, L. J.

(2005) Increased glutathione S-transferase activity rescues dopaminergic neuron loss

in a Drosophila model of Parkinson's disease. Proc Natl Acad Sci U S A, 102, 8024-

8029.

Wood-Kaczmar, A., Gandhi, S. and Wood, N. W. (2006) Understanding the molecular

causes of Parkinson's disease. Trends Mol Med, 12, 521-528.

Xiong, H., Wang, D., Chen, L. et al. (2009) Parkin, PINK1, and DJ-1 form a ubiquitin E3

ligase complex promoting unfolded protein degradation. J Clin Invest, 119, 650-660.

Yamano, K. and Youle, R. J. (2013) PINK1 is degraded through the N-end rule pathway.

Autophagy, 9.

Yang, Y., Gehrke, S., Imai, Y. et al. (2006) Mitochondrial pathology and muscle and

dopaminergic neuron degeneration caused by inactivation of Drosophila Pink1 is

rescued by Parkin. Proc Natl Acad Sci U S A, 103, 10793-10798.

Yoshino, H., Nakagawa-Hattori, Y., Kondo, T. and Mizuno, Y. (1992) Mitochondrial

complex I and II activities of lymphocytes and platelets in Parkinson's disease. J

Neural Transm Park Dis Dement Sect, 4, 27-34.

Zhang, L., Karsten, P., Hamm, S. et al. (2013) TRAP1 rescues PINK1 loss-of-function

phenotypes. Hum Mol Genet, 22, 2829-2841.

Zhou, C., Huang, Y., Shao, Y., May, J., Prou, D., Perier, C., Dauer, W., Schon, E. A. and

Przedborski, S. (2008) The kinase domain of mitochondrial PINK1 faces the

cytoplasm. Proc Natl Acad Sci U S A, 105, 12022-12027.

Zimprich, A., Biskup, S., Leitner, P. et al. (2004) Mutations in LRRK2 cause autosomal-

dominant Parkinsonism with pleomorphic pathology. Neuron, 44, 601-607.

Appendix 70

Appendix

Table 10. A genetic screen on mitochondrially functional proteins by lethality

CG, CG (Computed Gene) number. Column ‘A’, ubiquitous expression of accordin RNAi would cause lethality (l) or viable (v) of the progenies. Column ‘B’, ubiquitous expression of accordin RNAi of the ‘l’ candidates and hTrap1

WT co-expressed would cause viable, ‘yes’ would be marked,

and if cause lethal, ‘no’ would be noted. CG A B Name/Orthology Symbol Category

11661 l no 2-oxoglutarate dehydrogenase E1 component, Neural

conserved at 73EF Nc73EF

TCA Cycle

5075 v - 2-oxoglutarate dehydrogenase E2 component

(dihydrolipoamide succinyltransferase)

4706 v - aconitate hydratase 1 / homoaconitase

9244 l no aconitate hydratase 1 / homoaconitase, Aconitase Acon

8322 l no ATP citrate lyase ATPCL

3944 l no citrate synthase kdn

14740 v - citrate synthase

4095 v - fumarate hydratase, class II

6140 v - fumarate hydratase, class II

12233 l no isocitrate dehydrogenase (NAD+) l(1)G0156

5261 v - Malate dehydrogenase 1 Mdh1

7998 v - Malate dehydrogenase 2 Mdh2

17725 v - Phosphoenolpyruvate carboxykinase Pepck

1516 v - pyruvate carboxylase

7010 l no pyruvate dehydrogenase E1 component subunit alpha l(1)G0334

8808 v - Pyruvate dehydrogenase kinase Pdk

6255 l no succinyl-CoA synthetase alpha subunit

10622 v - succinyl-CoA synthetase beta subunit Sucb

11963 v - succinyl-CoA synthetase beta subunit, skpA associated protein skap

6463 l no NADH dehydrogenase

Complex I

NADH

dehydrogena

se

34439 v - NADH dehydrogenase (ubiquinone) 1 alpha subcomplex 1 NDUFa1





6439 l yes NADH dehydrogenase (ubiquinone) 1 alpha subcomplex 5 NDUFa5

7712 l no NADH dehydrogenase (ubiquinone) 1 alpha subcomplex 6 NDUFa6

6020 l no NADH dehydrogenase (ubiquinone) 1 alpha subcomplex 9 NDUFa9

18624 l yes NADH dehydrogenase (ubiquinone) 1 beta subcomplex 1 NDUFb1

8844 l no NADH dehydrogenase (ubiquinone) 1 beta subcomplex 10 NDUFb10,

Pdsw

6008 l no NADH dehydrogenase (ubiquinone) 1 beta subcomplex 11 NDUFb11

10320 l no NADH dehydrogenase (ubiquinone) 1 beta subcomplex 3 NDUFb3

5389 v - NADH dehydrogenase (ubiquinone) 1 beta subcomplex 7 NDUFb7

Appendix 71

12400 v - NADH dehydrogenase (ubiquinone) 1 subcomplex unknown 2 NDUFc2

11913 v - NADH dehydrogenase (ubiquinone) Fe-S protein 2 NDUFS2


8680 l no NADH dehydrogenase (ubiquinone) Fe-S protein 6 NDUFS6



4094 l yes NADH dehydrogenase (ubiquinone) Fe-S protein 8 NDUFS8

8102 v - NADH dehydrogenase (ubiquinone) flavoprotein 1 NDUFV1

9140 l no NADH dehydrogenase (ubiquinone) flavoprotein 1 NDUFV1

11423 v - NADH dehydrogenase (ubiquinone) flavoprotein 1 NDUFV1

5548 l no NADH dehydrogenase (ubiquinone) flavoprotein 2 NDUFV2

6485 l no succinate dehydrogenase (ubiquinone) cytochrome b560

subunit SdhC

Succinate

dehydrogena

se

6666 l no succinate dehydrogenase (ubiquinone) cytochrome b560

subunit, Succinate dehydrogenase C SdhC

5703 l no succinate dehydrogenase (ubiquinone) flavoprotein subunit SdhA

5718 v - succinate dehydrogenase (ubiquinone) flavoprotein subunit

7211 v - succinate dehydrogenase (ubiquinone) iron-sulfur subunit SdhB

7349 v - succinate dehydrogenase (ubiquinone) iron-sulfur subunit

3321 l no Succinate dehydrogenase B SdhB

4169 l no ubiquinol-cytochrome c reductase core subunit 2 QCR2

Complex III

Cytochrome

bc1 complex

4769 l no ubiquinol-cytochrome c reductase cytochrome c1 subunit Cyt 1

14482 v - ubiquinol-cytochrome c reductase subunit 10 QCR10

3612 l no ubiquinol-cytochrome c reductase subunit 7 QCR7

7580 v - ubiquinol-cytochrome c reductase subunit 8 QCR8

8764 l no ubiquinol-cytochrome c reductase subunit 9, oxen QCR9, ox

31648 v - cytochrome c oxidase subunit 11 COX11

Complex IV

cytochrome

c oxidase

3861 l no cytochrome c oxidase subunit 15 COX15

9065 v - cytochrome c oxidase subunit 17 COX17

10664 l no cytochrome c oxidase subunit 4 CoIV

11015 l no cytochrome c oxidase subunit 5b CoVb

11043 v - cytochrome c oxidase subunit 5b CoVb

14077 v - cytochrome c oxidase subunit 6a COX6a

17280 v - cytochrome c oxidase subunit 6a levy,

COX6a

14235 l no cytochrome c oxidase subunit 6b CoVIb

14028 l yes cytochrome c oxidase subunit 6c, cyclope cype,

COX6c

9603 l no cytochrome c oxidase subunit 7a COX7a

2249 v - cytochrome c oxidase subunit 7c CoVIIc

14724 l Cytochrome c oxidase subunit Va CoVa

32089 l no V-type H+-transporting ATPase 16kDa proteolipid subunit,

Vacuolar H[+] ATPase subunit 16-2 Vha16-2

Complex V,

ATP

synthase, V-

type 32090 v -

V-type H+-transporting ATPase 16kDa proteolipid subunit,


Appendix 72

9013 v - V-type H+-transporting ATPase 16kDa proteolipid subunit,



Vacuolar H[+] ATPase subunit PPA1-1

VhaPPA1-

1


Vacuolar H[+] ATPase subunit PPA1-2

VhaPPA1-

2

3803 l no V-type H+-transporting ATPase subunit A, V-ATPase 69 kDa

subunit 2 Vha68-2

12403 l no V-type H+-transporting ATPase subunit A, Vacuolar H[+]

ATPase subunit 68-1 Vha68-1

5037 l no V-type H+-transporting ATPase subunit A, Vacuolar H[+]


2934 l no V-type H+-transporting ATPase subunit AC39, Vacuolar H[+]

ATPase subunit AC39-1

VhaAC39-

1

17369 l no V-type H+-transporting ATPase subunit B, Vacuolar H[+]-

ATPase 55kD B subunit Vha55

8186 l no V-type H+-transporting ATPase subunit D, Vacuolar H[+]


14909 v - V-type H+-transporting ATPase subunit H, Vacuolar H[+]

ATPase subunit M9.7-d

VhaM9.7-

d

12602 v - V-type H+-transporting ATPase subunit I, Vacuolar H[+]


1088 l no Vacuolar H[+]-ATPase 26kD E subunit Vha26

4307 l no F-type H+-transporting ATPase oligomycin sensitivity

conferral protein, Oligomycin sensitivity-conferring protein Oscp

Complex V

ATP

synthase, F-

type

4412 l no F-type H+-transporting ATPase subunit 6,ATPase coupling

factor 6

ATPsyn-

Cf6

8189 l no F-type H+-transporting ATPase subunit b, ATP synthase,

subunit b ATPsyn-b

5362 l no F-type H+-transporting ATPase subunit beta

11154 v - F-type H+-transporting ATPase subunit beta, ATP synthase-

beta

ATPsyn-

beta

3446 v - F-type H+-transporting ATPase subunit e

31477 v - F-type H+-transporting ATPase subunit epsilon

9032 l no F-type H+-transporting ATPase subunit epsilon, stunted sun

4692 l no F-type H+-transporting ATPase subunit f

7610 v - F-type H+-transporting ATPase subunit gamma, ATP

synthase-gamma chain

ATPsyn-

gamma

Chapter 6 – Appendix 73

Curriculum Vitae

Family name, First name: Zhang, Li (张力)

Place of birth: Chang Chun, Jilin Province, P.R.China

Date of birh: 21.05.1984

Nationality: Chinese

Gender: Female

Education

RWTH Aachen, Aachen, Germany (11. 2010 - 2015)

PhD. Department of Neurology, University Medical Centre, RWTH Aachen. Research on the

mechanisms of Parkinson’s Disease via Drosophila melanogaster model, especially focus on

mitochondrial dysfunction.

University of Regensburg, Regensburg, Germany (09. 2008 – 10. 2010)

Master Degree of Science. Experimental & Clinical Neuroscience (Elite network of Bavaria).

Master Thesis: Analysis of mitochondrial function in an alpha-synuclein Parkinson-model in

Drosophila.

National Huaqiao University Quanzhou, China (09. 2003 – 07. 2007)

Bachelor Degree of Science, Biotechnology. Completed 72 courses on biology, chemistry,

physics, mathematics, programming, English, et al. GPA 4.207 out of 5, ranked No.1 in the

major. Bachelor Thesis: The mechanism of proline dependent heat-shock resistance in self-

flocculating yeast.

University of Jilin Changchun, China (02 - 03, 2007)

Visiting student. School of Basic Medical Science

Biological Products of China National Biotechnology Group Changchun, China (06 - 07,

2006)

Internship.

Publication

Zhang L, Karsten P, Hamm S, Pogson JH, Müller-Rischart AK, Exner N, Haass C, Whitworth

AJ, Winklhofer KF, Schulz JB, Voigt A.. TRAP1 rescues PINK1 loss-of-function phenotypes

Hum Mol Genet. 2013 Jul 15;22(14):2829-2841. Epub 2013 Mar 21

Navarro, J, Heßner, S, Yenisetti, S, Bayersdorfer, F, Zhang, L, Voigt, A, Schneuwly, S,

Botella, J. Analysis of dopaminergic neuronal dysfunction in genetic and toxin-induced

models of Parkinson’s disease in Drosophila. Journal of Neurochemistry. 2014 Jul 10. doi:

10.1111/jnc.12818

Professional Conferences

Regional Drosophila Meeting 2014, Heidelberg, Germany (05. 2014)

Oral presentation. Trap1, a new player in Parkinson’s disease

ISN-ASN Meeting 2013 Cancun, Mexico (04. 2013)

Poster Presentation. TRAP1 rescues PINK1 loss-of-function phenotypes

Regional Drosophila Meeting 2012 Osnabrück, Germany (10. 2012)

Oral presentation. a chaperone protein Trap1 rescues PINK1 loss-of-function phenotypes and

mitochondrial dysfunction in vivo,

8th FENS Forum of Neuroscience Barcelona, Spain (07. 2012)

Chapter 6 – Appendix 74

Poster Presentation. Trap1 miti ates α-Synuclein-induced toxicity and rescues PINK1 loss-of-

function phenotypes in vivo

The European Conference on Visual Perception (ECVP) Regensburg, Germany (08.

2009)

8th Goettingen Meeting of the German Neuroscience Society Goettingen, Germany (03.

2009)

Professional Membership

International Society for Neurochemistry

Federation of European Neuroscience Societies

Elite network of Bavaria, Germany

Awards

Travel grant (1200 USD, ISN-ASN Meeting 2013)

Annually First-class scholarship (award top 5% student of the department), Huaqiao

University, China

“Extraordinarily Excellent Student” (award top 0.5% student of university), Huaqiao

University, China

Winner of Experimental Skill Competition, Huaqiao University, China

Once City Physics Competition and twice City Olympic Mathematics Competition,

Changchun, China

Activities

Writing, published book ”Tan Fan Chen Gon Zhe De Zu Ji”, ISNB 978-7-206-05709,

(title translation: Trace the Footprints of the Greats). Painting. Was a student leader for years.

analyzing the function of trap1 in models of parkinson’s

Documents