trapidil inhibits monocyte cd40 expression by preventing ifn-γ-induced stat1 s727 phosphorylation
Post on 17-Oct-2016
218 Views
Preview:
TRANSCRIPT
www.elsevier.com/locate/intimp
International Immunopharmacology 4 (2004) 863–871
Trapidil inhibits monocyte CD40 expression by preventing
IFN-g-induced STAT1 S727 phosphorylation
Ling Zhoua, Liliane Schandenea, Viatcheslav A. Mordvinova, Pierre Chatelainb,Olivier Pradiera, Michel Goldmana, Patrick Stordeura,*
aDepartment of Immunology-Hematology-Transfusion, Erasme Hospital, Universite Libre de Bruxelles, route de Lennik, 808,
Brussels, B-1070, BelgiumbDepartment of In Vitro Pharmacology, UCB Pharma, Braine l’Alleud, Belgium
Received 2 December 2003; received in revised form 4 December 2003; accepted 12 March 2004
Abstract
Trapidil is a triazolopyrimidine that has been found to prevent restenosis after vascular injury. Although its precise mode of
action is still unclear, several biological effects have been described including inhibition of IFN-g-induced CD40 expression on
monocytes. Herein, we investigated the molecular mechanisms by which Trapidil exerts this inhibitory action. First, we
observed that the inhibition of CD40 expression is associated with the suppression of CD40 gene transcription, as demonstrated
by a clear decrease of CD40 nuclear RNA (nRNA) levels and unchanged CD40 mRNA half-life. IFN-g-induced CD40
transcription has been shown to be mediated by STAT1a dimers (p91/p84) which, after nuclear translocation, bind to GAS
elements present in the promoter of IFN-g responsive genes. Electrophoresis mobility shift assay (EMSA) with both STAT1
consensus and CD40 mGAS probes showed that Trapidil did not affect the DNA binding ability of STAT1 dimers. STAT1
dimerization and activation are conferred by upstream phosphorylation of two amino acid residues of the STAT1 protein. The
subsequent studies on these two potential STAT1 phosphorylation sites (Tyr701, Ser727) revealed that Trapidil attenuated IFN-
g-induced Ser727 but not Tyr701 phosphorylation. The inhibition of CD40 transcription by Trapidil could at least partially
owing to the impaired Ser727 phosphorylation of STAT1, since IFN-g failed to trigger CD40 expression in U3A S727A cells, a
cell line displaying a point mutation at the Ser727 site. Collectively, our results indicate that phosphorylation of STAT1 at the
Ser727 site enhances CD40 transcription and that Trapidil might be used as a selective inhibitor that could differentially
modulate STAT1 target genes.
D 2004 Elsevier B.V. All rights reserved.
Keywords: CD40; Trapidil; STAT1; Serine phosphorylation; IFN-g
1. Introduction presenting cell (APC) and of T cell during immune
CD40 is a member of TNF receptor family which
plays an important role in the activation of antigen
1567-5769/$ - see front matter D 2004 Elsevier B.V. All rights reserved.
doi:10.1016/j.intimp.2004.03.007
* Corresponding author. Tel.: +32-2-555-38-62; fax: +32-2-
555-44-99.
E-mail address: pstordeu@ulb.ac.be (P. Stordeur).
response. Engagement of CD40 on APC leads to the
synthesis of inflammatory cytokines such as TNF-a
and IL-12 as well as the up-regulation of MHC class II
and the co-stimulatory molecules CD80 and CD86
[1,2]. Consistent with this, the CD40/CD40L pathway
was shown to be involved in the pathology of several
disorders of immune origin, including multiple scle-
L. Zhou et al. / International Immunopharmacology 4 (2004) 863–871864
rosis, rheumatoid arthritis and atherosclerosis [3,4].
Moreover, CD40-activated expression of tissue factor,
the coagulation cascade initiator, and of the chemo-
kine MCP-1 reinforces the possible role of the CD40/
CD40L pathway in pathogenesis of atherosclerosis
[5]. CD40 expression can be induced in many cell
types in vitro. Monocytes express CD40 in response
to IFN-g, IL-3 and GM-CSF, among which IFN-g is
the most potent inducer [6]. As other IFN-g-induced
genes, the regulation of CD40 expression is presumed
to be controlled mainly by the JAK1/2-STAT1(p91/
p84) pathway. Indeed, the study of the CD40 promot-
er sequence identified three potential GAS elements
among which at least two are essential to IFN-g-
induced CD40 expression [7].
Many cytokines including IFN-g use Janus kinase
(JAK) followed by signal transducer and activator of
transcription (STAT) as signaling pathway [8,9]. IFN-
g receptor engagement activates receptor-associated
tyrosine kinases JAK1 and JAK2 (JAK1/2) through
autophosphorylation. Once JAK1/2 are activated, they
subsequently phosphorylate a single tyrosine residue
(Tyr701) on STAT1 which pre-exists in the cytoplasm
in a latent form. Tyrosine phosphorylation of STAT1
leads to STAT1 dimerization (p91/p84) and nuclear
translocation of STAT1 dimers where these dimers
bind to the gamma-activated sequence (GAS) present
in the promoter of IFN-g responsive genes [10].
However, in most cases, Tyr701 phosphorylation is
not sufficient to initiate transcription. STAT1 must
also be phosphorylated on its serine site (Ser727) by a
serine kinase independent of tyrosine to acquire full
transcriptional activity, and thus to induce effective
STAT1-targeted gene transcription [11,12].
Trapidil is a triazolopyrimidine used in patients to
control angina pectoris or prevent platelet aggregation
[13,14]. Its large spectrum of biological activities
prompted us to explore new potential uses for this
drug. In a previous study, we showed that Trapidil
decreases IFN-g-induced CD40 expression on mono-
cytes [15]. The present study was undertaken to
approach the molecular mechanism of this inhibition.
We demonstrate here that the drug inhibits IFN-g-
induced CD40 expression on monocytes at the tran-
scriptional level. We also provide evidence showing
that this inhibitory effect could be due, at least
partially, to STAT1 Ser727 phosphorylation suppres-
sion, the rest of the JAK-STAT pathway being appar-
ently not affected. This novel mechanism of Trapidil
action might lead to new applications for this drug.
2. Materials and methods
2.1. Recombinant proteins and reagents
Recombinant human IFN-g and TNF-a were pur-
chased from R&D Systems Europe (Abingdon, UK).
Trapidil powder was received from UCB Pharma
(Braine l’Alleud, Belgium) and the solution was
prepared as described [15]. Actinomycin D (Roche
Applied Science, Brussels, Belgium) was dissolved in
ethanol and used at 5 Ag/ml. Anti-STAT1-Tyr701,
anti-STAT1-Ser727, anti-STAT1 and polyclonal per-
oxidase-conjugated goat anti-rabbit antibodies were
all purchased from Upstate Biotechnology (Mundol-
sheim, France).
2.2. Cell cultures
Monocytes were purified from peripheral blood
mononuclear cells (PBMC) isolated from healthy
donors and stimulated in the culture medium as
previously described [15]. 2fTGH and U3A-S727A
fibrosarcoma cells kindly provided by Prof. G.R.
Stark (Lerner Research Institute, Cleveland, OH) were
maintained in DMEM medium, 10% fetal bovine
serum (FBS) with 400 Ag/ml hygromycin B or 250
Ag/ml G418 (A.G. Scientific, San Diego, CA). U3A-
S727A is a 2fTGH-derived STAT1-null mutant U3A
cell line reconstituted with STAT1 possessing a
Ser727-Ala727 mutation [16].
2.3. Quantification of CD40 mRNAs and CD40
nRNAs by real time PCR
The methodology used for h-actin and CD40
mRNAs quantification, i.e. reverse transcription, real
time PCR on a Lightcycler instrument (Roche Applied
Science) and the choice of the primers and probes,
was identical to what we described for cytokines and
h-actin in a previous study [17]. The PCR parameters
specific for CD40 mRNA are listed in Table 1. For
GAPDH and CD40 nRNAs measurements, reverse
transcription was performed using the standard proto-
col ‘‘ThermoScript RT-PCR System For First-Strand
Table 1
Oligonucleotidesa
Primers and probes for real time PCR
RNA target Oligonucleotides (5V–3V)b Product size (bp) Final concentration (nM)c
CD40 mRNA F701: GGCCAAGAAGCCAACCAATAA
R777: CAGGAAGATCGTCGGGAAAAT
P727: 6Fam-CCCACCCCAAGCAGGAACCCC-Tamra-p
78 F 300 R 600
CD40 nRNA F1888: GATACCCAGGTTGAATGAGAGC
R1987: CATTTGTTTCTGCTTGCATGAT
P1932: 6Fam-ACAGCCAGCCAGGTAGCCGG-Tamra-p
100 F 600 R 900
GAPDH nRNA F2962: GGGAAGCTCAAGGGAGATAAA
R3039: CATTAAGAGGGCGAATGCAG
P2988: 6Fam-ACCTCTTGGGCCCTCCTGGG-Tamra-p
78 F 600 R 900
Primers for standard preparation by ‘‘classical’’ PCRd,e
RNA target Oligonucleotides (5V! 3V)b Product size (bp) Annealing temperatured
CD40 nRNA F1678: GGGAGTGAGAACTGGAGATTGA
R2088: GCAGGTTGGATTACGAAGATAAG
411 60
GAPDH nRNA F2716: TTGAGTTTGATGATGCTGAGT
R3185: GATGGCAACAATATCCACTTT
470 56
a For a full description, see 12.b F, R and P indicate forward and reverse primers and probes, respectively; numbers indicate the sequence position.c Final concentration of forward (F) and reverse (R) primers.d Standard curves were generated from serial dilutions of PCR products prepared by ‘‘classical’’ PCR for which specific conditions were as
follows: denaturation at 95 jC for 20 s, annealing (temperature as stated) for 20 s and elongation at 72 jC for 45 s, for a total of 35 cycles.
MgCl2 final concentration was 1.5 mM.e For CD40 mRNA, the standard curves were generated from serial dilutions of a plasmid purchased at the American Type Culture
Collection (Manassas, VA).
L. Zhou et al. / International Immunopharmacology 4 (2004) 863–871 865
cDNA Synthesis’’ from Invitrogen life technologies
(Merelbeke, Belgium), starting from 500 ng of total
cellular RNA pretreated with deoxyribonuclease. We
used the same reverse primer as cDNA synthesis
template as for real time PCR (GAPDH R3039 or
CD40 R1987, Table 1, 6 AM). The real time PCR was
performed as described [17] using primers and probes
targeting intronic sequences (Table 1).
2.4. Electrophoresis mobility shift assay (EMSA)
After 1-h pre-incubation with Trapidil or solvent,
monocytes were activated with IFN-g for 30 min,
and the nuclear extracts were then prepared as
described by Osborn et al. [18]. The STAT1 p84/
p91 consensus and mutant oligonucleotides were
purchased from Santa Cruz biotechnology (Santa
Cruz, CA). The mGAS element probe was synthe-
sized according to the described sequence [7]. All
the double-strand oligonucleotides were end-labeled
with [g-32P] ATP (Amersham Pharmacia Biotech,
Rossendaal, The Netherlands) by T4 polynucleotide
kinase according to the manufacturer’s instructions
(Roche Applied Science). For the binding reaction,
10 Ag of nuclear extracts was incubated at room
temperature for 15 min with the reaction mixture
containing binding buffer (75 mM KCl; 2.5 mM
MgCl2; 0.1 mM EDTA; 10% glycerol; 0.25 mM
DTT; 10 mM Tris–HCl, pH 7.5), poly-dI–dC and
2000 cpm probe in a final volume of 20 Al. Boundor free DNA were resolved by electrophoresis
through a 6% polyacrylamide gel in Tris–borate
EDTA buffer. For competition and supershift analy-
sis, nuclear extracts were preincubated with
100� unlabelled probe or polyclonal anti-STAT1a
(p91) antibodies for 30 min. The gel was dried and
exposed to autoradiography film (Eastman Kodak,
Bornem, Belgium) at � 80 jC.
2.5. Western blot analysis
After stimulation by IFN-g in the presence of
Trapidil or solvent, 107 cells were lysed in 1 ml of
Radioimmunoprecipitation (RIPA) Buffer (50 mM
L. Zhou et al. / International Immunopharmacology 4 (2004) 863–871866
Tris–HCl, pH 7.4; 1% NP-40; 0.25% sodium deox-
ycholate; 150 mM NaCl; 1 mM EGTA; 1 mM PMSF;
1 Ag/ml aprotinin; 1 Ag/ml leupeptin; 1 Ag/ml pep-
statin; 1 mM Na3VO4; 1 mM NaF). The proteins were
separated by denaturing polyacrylamide gel (6%)
electrophoresis in the presence of SDS and then
transferred onto a nitrocellulose membrane. Immuno-
blot analysis used a primary anti-STAT1, anti-STAT1-
Tyr701 or anti-STAT1-Ser727 antibody, followed by a
polyclonal peroxidase-conjugated goat anti-rabbit an-
tibody. The membrane was subjected to the enhanced
chemiluminescence detection system (Amersham
Pharmacia Biotech) and exposed to X-ray film (East-
man Kodak).
2.6. The multiplex bead immunoassay
Akt phosphorylation at serine 473 was measured
by the ‘‘Phospho Akt, Jnk1/2, p38 MAPK 3-Plex
Kit’’ (Biosource Europe, Nivelles, Belgium). After
stimulation by IFN-g in the presence or in absence
of Trapidil for 15 and 60 min, 107 cells were lysed
by cell lysis buffer (50 mM Tris–HCl; pH 7.4; 1%
NP-40; 250 mM NaCl; 5 mM EDTA; 1 mM PMSF;
50 mM NaF; 1 mM Na3VO4; 10% protease inhibitor
cocktail). Cell lysis and phospho-protein measure-
ment were performed following manufacturer’s
instructions. The plate was read using a Luminex
XYk platform by counting 100 events/bead region,
and concentration of the unknown samples was
extrapolated from a standard curve. The ultimate
results were normalized against total protein quantity
contained in each sample.
2.7. Statistical analysis
Data were compared using Wilcoxon’s non-para-
metric test.
3. Results
3.1. Trapidil inhibits IFN-c-induced CD40 mRNA
accumulation
We previously showed, using a ‘‘classical’’ PCR
assay, that Trapidil attenuated CD40 mRNA increase
induced by IFN-g [15]. Taking advantage of the new
real time PCR methodology, we confirmed and quan-
tified the Trapidil-induced decrease of CD40 mRNA
levels. After IFN-g stimulation, about 65% of inhibi-
tion was observed at the different incubation times.
Moreover, in Trapidil-treated versus non-treated
monocytes, a decrease of basal CD40 mRNA amounts
was observed at 16 h, which was also statistically
significant (Fig. 1).
3.2. Trapidil inhibits IFN-c-induced CD40 gene
transcription
The CD40 mRNA decrease by Trapidil could be
due to CD40 mRNA destabilization. We thus ana-
lyzed Trapidil’s influence on CD40 mRNA stability in
monocytes stimulated by IFN-g. Precisely, transcrip-
tion was stopped by actinomycin D addition 4 h after
IFN-g stimulation and CD40 mRNA levels were
measured using real time PCR at different time points
following actinomycin D addition. CD40 mRNA half-
life was determined from the slope of decay. A half-
life of 3.9 h was calculated for IFN-g-induced CD40
mRNA in the absence of Trapidil versus 3.5 h in the
presence of Trapidil (Fig. 2A), indicating that CD40
mRNA stability is not affected by the drug.
In order to determine if Trapidil acts at the tran-
scriptional level, we quantified CD40 nRNA by real
time PCR. An increase of CD40 nRNA expression by
IFN-g was detected which reflects the transcriptional
induction of CD40 gene, as reported previously [7].
Trapidil inhibits CD40 nRNA expression in a dose-
dependent manner (Fig. 2B). Thus, we conclude that
Trapidil inhibits CD40 nRNA expression but does not
change mRNA half-life, suggesting that this drug
mainly inhibits CD40 gene transcription.
3.3. Trapidil does not change CD40 promoter DNA
binding activity of STAT1 dimers
Two GAS elements (mGAS and dGAS) in the
CD40 promoter have been shown to be important
for CD40 transcription induced by IFN-g. We thus
checked by EMSA whether Trapidil interferes with
the appropriate activation of STAT1 which could
impair its binding to GAS elements. Upon IFN-g
activation, nuclear extracts formed a complex with
the STAT1 (p91/p84) consensus probe or the mGAS
probe (Fig. 3A). This complex formation was pre-
Fig. 1. Trapidil inhibits IFN-g-induced CD40 mRNA accumulation. Real time PCR assay for CD40 mRNA quantification. Monocytes (5� 106)
were stimulated with or without IFN-g (1 ng/ml) up to 16 h in the presence of 100 AM Trapidil (open columns) or solvent (hatched columns).
RNAwas extracted after 0, 4, 8 and 16 h of culture. Quantitative PCR were performed for CD40 and h-actin mRNAs. CD40 mRNA levels are
normalized against endogenous h-actin mRNA and the values presented as relative number of copies by referring to negative control
(unstimulated cells) (100). The mean + S.E.M. of four independent experiments are represented. *p< 0.05, **p< 0.015, as compared to IFN-g
plus solvent treated samples.
L. Zhou et al. / International Immunopharmacology 4 (2004) 863–871 867
vented by the addition of 100� unlabelled probe or
anti-STAT1 antibody but not by addition of the mutant
STAT1 probe (not shown). Trapidil was used at
Fig. 2. Trapidil inhibits IFN-g-induced CD40 gene transcription. (A) Real ti
stimulated with IFN-g (1 ng/ml) for 4 h in the presence of 100 AM of Tra
added at the end of 4 h; cells were then harvested at the indicated times th
represent the percentage of CD40 mRNA remaining in the sample by using
representative of three independent experiments are shown. (B) Real time P
stimulated with IFN-g (1 ng/ml) for 20 h in the presence of graded doses of
and GAPDH nRNAs quantification. The Y-axis values represent relative num
against GAPDH nRNA. The mean + S.E.M of seven independent experim
plus solvent treated samples.
concentrations up to 400 AM and did not prevent
the formation of DNA–protein complexes (Fig. 3A),
nor did it alter the binding to the dGAS element (data
me PCR assay for CD40 mRNA half-life. Monocytes (5� 106) were
pidil (continuous line) or solvent (dotted line). Actinomycin D was
at follow actinomycin D addition (1–8 h). The values of the Y-axis
mRNA level at time 0 as reference (100%). Data of one experiment
CR assay for CD40 nRNA quantification. Monocytes (5� 106) were
Trapidil (TPD) or solvent. Real time PCR was performed for CD40
bers of copies by referring to negative control (100) after correction
ents are represented. *p< 0.05, **p< 0.015, as compared to IFN-g
Fig. 3. Trapidil prevents IFN-g-induced Ser727 phosphorylation of STAT1. (A) EMSA experiment using STAT1 and mGAS probes. Monocytes
(5� 106) were stimulated with IFN-g (1 ng/ml) for 30 min in the presence of graded doses of Trapidil (TPD) or solvent. Nuclear extracts were
prepared and EMSAwas performed with labeled STAT1 consensus probe (upper panel) or CD40 mGAS probe (bottom panel). The data shown
are representative of three independent experiments. (B) Western blot detection of phospho-STAT1 Tyr701 and Ser727. Monocytes (5� 106)
were stimulated with IFN-g (1 ng/ml) for 30 min in the presence of graded doses of Trapidil (TPD) or solvent. Total protein extracts were
prepared and cell lysates were resolved by 6% SDS-PAGE. Western analyses were carried out with anti-phospho-Ser727-STAT1 (upper panel),
anti-phospho-Tyr701-STAT1 (medium panel) or anti-STAT1 (bottom panel) antibodies. The data of one experiment representative of three
independent experiments are shown.
Fig. 4. CD40 mRNA expression is impaired in U3A-S727A cells.
2fTGH and U3A-S727A cells of 2� 106 per 10-cm dish were treated
with 100 ng/ml IFN-g (black columns) or 10 ng/ml IFN-g+ 10 ng/ml
TNF-a (hatched columns) for 20 h. Quantitative real time PCR was
performed for CD40 and h-actin mRNAs quantification. The values
are presented as relative numbers of copies by referring to negative
controls (100%) after correction against h-actin. Negative controls
were unstimulated cells (open bars). The S.E.M. and the mean of six
independent experiments are represented.
L. Zhou et al. / International Immunopharmacology 4 (2004) 863–871868
not shown). This implies that the drug does not impair
dimerization, nucleus translocation or DNA binding
of STAT1.
3.4. Trapidil attenuates IFN-c-induced Ser727 phos-
phorylation of STAT1
STAT1 activation requires both phosphorylation on
tyrosine (Tyr701) and serine (Ser727) sites. IFN-g
treatment clearly induced STAT1 Tyr701 as well as
Ser727 phosphorylation, as observed by immunoblot
assays (Fig. 3B). Tyr701 phosphorylation was not
different in Trapidil-treated and untreated samples
which was consistent with the normal DNA binding
ability demonstrated by gel shift assay. On the con-
trary, a decrease in Ser727 phosphorylation was
observed in Trapidil-conditioned samples (Fig. 3B).
Taken together, these data demonstrate that this drug
alters IFN-g-induced JAK-STAT1 pathway by reduc-
ing Ser727 phosphorylation.
3.5. CD40 mRNA expression is impaired in U3A-
S727A cells
In order to determine whether STAT1 Ser727
phosphorylation is required for CD40 expression,
we measured CD40 mRNA expression in wild-type
2fTGH cells as well as in U3A-S727A cells, a mutant
cell line lacking the Ser727 phosphorylation site.
Upon stimulation by IFN-g alone or IFN-g plus
TNF-a, 2fTGH cells increased CD40 mRNA expres-
sion approximately two- to threefold, whereas CD40
expression was not inducible in U3A-S727A cells
(Fig. 4). These results confirm the importance of the
STAT1-Ser727 phosphorylation site for IFN-g-in-
duced CD40 expression.
Fig. 5. Trapidil does not prevent IFN-g-induced Akt serine 473 phosphorylation. Cells (107) were incubated with and without 10 ng/ml IFN-g
and Trapidil (concentration as stated), for 15 and 60 min. The cells were then lysed by cell lysis buffer. The amount of phosphorylated Akt
serine 473 was measured by multiplex bead immunoassay using a Luminex instrument. The concentration of unknown samples was normalized
against their total protein concentration, and is expressed in arbitrary units. The data of one representative experiment out of two are shown.
L. Zhou et al. / International Immunopharmacology 4 (2004) 863–871 869
3.6. Trapidil does not prevent IFN-c-induced Akt
phosphorylation
In a previous study, Nguyen et al. [19] demonstrat-
ed that phosphatidylinositol 3-kinase (PI3K) and its
effector kinase Akt play an important role in the serine
phosphorylation of STAT1. We therefore studied the
effect of Trapidil on IFN-g-induced Akt phosphory-
lation by multiplex bead immunoassay. As shown in
Fig. 5, we found that IFN-g treatment induced a rapid
Akt phosphorylation already observed after 15 min
and still persisting after 60 min. The presence of
Trapidil did not prevent Akt phosphorylation either
after 15 or 60 min. We concluded that the inhibitory
effect of Trapidil on STAT1 serine phosphorylation
was not due to a direct inhibition of Akt activation.
4. Discussion
Based on our previous observations that Trapidil
suppresses IFN-g-induced CD40 expression [15], the
present work extended our study to the molecular
level, looking at the mechanisms of this inhibition.
CD40 up-regulation after IFN-g stimulation is mainly
controlled at transcriptional level. Accordingly, we
observed that the suppression of CD40 transcription
is the dominant effect of Trapidil whereas post-tran-
scriptional events do not seem to be altered. Hence,
the transcriptional inhibition of CD40 by Trapidil
could represent one of the most efficient ways to
prevent CD40 up-regulation.
The transcriptional regulation of CD40 gene was
first studied by Nguyen and Benveniste [7] on a
macrophage cell line. These authors demonstrated that
the binding of STAT1a to two GAS sites at � 521
[distal GAS (dGAS)] and � 483 [medial GAS
(mGAS)] in the CD40 promoter was critical for
IFN-g-induced CD40 transcription. Therefore, distur-
bance at any step of JAK1/2-STAT1 signal transduc-
tion pathway would theoretically prevent functional
activation of the STAT1 molecule and result in CD40
expression deficiency. We thus studied Trapidil’s
effects on DNA binding ability as well as on Ser727
and Tyr701 phosphorylation. In the presence of the
drug, the whole activation cascade occurred normally
except a weaker Ser727 phosphorylation. Actually,
Tyr701 phosphorylation leads to subsequent STAT1
dimerization, nuclear entrance and DNA binding, but
poorly activates transcription. On the other hand, the
Ser727 phosphorylation dramatically enhances the
transcriptional activity of STAT1 (p91/p84) without
affecting its DNA binding. Thus, in order to know if
CD40 expression could occur in the absence of
L. Zhou et al. / International Immunopharmacology 4 (2004) 863–871870
STAT1 Ser727 phosphorylation, we measured CD40
mRNA expression in wild-type and Ser727 mutant
cell lines. We found an obvious correlation between
STAT1 Ser727 phosphorylation and CD40 expression,
CD40 induction being impaired in mutant cells com-
pared to wild-type cells. Considering the multiple
effects of Trapidil, other mechanisms could also be
involved. Nevertheless, the decreased Ser727 phos-
phorylation could explain, at least partially, the inhib-
itory effect of the drug.
The exact mechanisms by which serine phosphor-
ylation enhances transcription activity are not clear.
An interesting hypothesis is that this site may be
directly involved in the STAT1 interaction with other
proteins such as transcription co-activators. Among
these co-activators, MCM5 and BRCA1 were
reported to bind preferentially S727-phosphorylated
STAT1 and to synergize with STAT1 for maximal
gene transcription in a promoter specific manner
[20,21]. In fact, a serine phosphorylation defect dif-
ferently affects STAT1 targeted genes, as demonstrat-
ed by Kovarik et al. [22] who observed a variable
sensitivity of several IFN-g inducible genes to the
absence of Ser727 phosphorylation. Moreover, IFN-
a/h-induced transcription factor ISGF3, a complex
formed by STAT1, STAT2 and p48, displays normal
biological activity when STAT1 Ser727 phosphoryla-
tion is deficient [23]. Along this line, among the
proteins coded by IFN-g inducible genes we tested,
CD40, MHC class II and CD54 but not CD80 or
CD86 are susceptible to Trapidil’s inhibitory effect.
This phenomenon could be explained by the different
requirements in co-activators of transcription.
The serine kinase that relays IFN-g signal to STAT1
is not clearly identified. Mitogen-activated kinases
ERK1/2 and p38 have been proposed as the mediators
of STAT1 Ser727 phosphorylation following various
stimuli, however, with contradictory results [24,25].
Interestingly, using U0126 or SB203580, specific
inhibitors to ERK kinase (MEK1/2) or p38 pathways,
respectively, we observed the prevention of STAT1
Ser727 phosphorylation by U0126 but not by
SB203580 (data not shown). U0126 also inhibited
CD40 expression at the cell surface as well as at the
messenger level. These results are in line with the
previous studies in which Trapidil has been found to
inhibit ERK kinase [26,27], leading to the speculation
that Trapidil-mediated suppression of CD40 expres-
sion as well as STAT1 Ser727 phosphorylation might
be related to its effect on ERK activation. Further
studies should be conducted to learn about the exact
role of ERK1/2 in IFN-g-induced STAT1 Ser727
phosphorylation. Apart from these pathways, the phos-
phatidylinositol 3V-kinase (PI3K) pathway was also
identified to induce STAT1 Ser727 phosphorylation
[19]. This finding was further supported by Deb et al.
[28] who showed that protein kinase C (PKC) family
of proteins was activated downstream the PI3 kinase.
We thus investigated the effect of Trapidil on IFNg-
induced Akt phosphorylation and found, contrary to
what was expected, that Trapidil did not directly
inhibit Akt activation.
In conclusion, we demonstrate here the important
role of STAT1 Ser727 phosphorylation in the induc-
tion of CD40 gene transcription and identify a novel
molecular target for Trapidil. We show that Trapidil
acts as an inhibitor of the JAK-STAT pathway affect-
ing the serine phosphorylation arm. In the future, this
drug might be useful to selectively inhibit a group of
genes whose transcription strictly requires serine
phosphorylation of STAT1 molecules. This paves
the way to new potential clinical applications espe-
cially in inflammatory diseases and immune system
disorders.
Acknowledgements
We thank Prof. G.R. Stark from the Lerner
Research Institute of Cleveland for providing us with
the 2fTGH and U3A-S727A cell lines. We are greatly
indebted to Claire Debusscher for kindly revising the
English version of the manuscript.
This work was supported by UCB Pharma
Belgium.
References
[1] Diehl L, Den Boer AT, Van VD, Melief CJ, Offringa R, et al.
The role of CD40 in peripheral T cell tolerance and immunity.
J Mol Med 2000;78:363–71.
[2] van Kooten C, Banchereau J. CD40-CD40 ligand. J Leukoc
Biol 2000;67:2–17.
[3] Laman JD, de Smet BJ, Schoneveld A, van Meurs M. CD40-
CD40L interactions in atherosclerosis. Immunol Today 1997;
18:272–7.
,
L. Zhou et al. / International Immunopharmacology 4 (2004) 863–871 871
[4] Noelle RJ, Mackey M, Foy T, Buhlmann J, Burns C. CD40
and its ligand in autoimmunity. Ann N Y Acad Sci
1997;815:384–91.
[5] Pradier O, Willems F, Abramowicz D, Schandene L, de Boer M
M, et al. CD40 engagement induces monocyte procoagulant
activity through an interleukin-10 resistant pathway. Eur J
Immunol 1996;26:3048–54.
[6] Alderson MR, Armitage RJ, Tough TW, Strockbine L, Fans-
low WC, et al. CD40 expression by human monocytes: regu-
lation by cytokines and activation of monocytes by the ligand
for CD40. J Exp Med 1993;178:669–74.
[7] Nguyen VT, Benveniste EN. Involvement of STAT-1 and ets
family members in interferon-gamma induction of CD40 tran-
scription in microglia/macrophages. J Biol Chem 2000;275:
23674–84.
[8] Leonard WJ. Role of Jak kinases and STATs in cytokine signal
transduction. Int J Hematol 2001;73:271–7.
[9] Ortmann RA, Cheng T, Visconti R, Frucht DM, O’Shea JJ.
Janus kinases and signal transducers and activators of tran-
scription: their roles in cytokine signaling, development and
immunoregulation. Arthritis Res 2000;2:16–32.
[10] Bromberg JF, Horvath CM,Wen Z, Schreiber RD, Darnell JEJ.
Transcriptionally active Stat1 is required for the antiprolifera-
tive effects of both interferon alpha and interferon gamma.
Proc Natl Acad Sci U S A 1996;93:7673–8.
[11] Wen Z, Zhong Z, Darnell JEJ. Maximal activation of tran-
scription by Stat1 and Stat3 requires both tyrosine and serine
phosphorylation. Cell 1995;82:241–50.
[12] Decker T, Kovarik P. Serine phosphorylation of STATs. On-
cogene 2000;19:2628–37.
[13] Maresta A, Balducelli M, Cantini L, Casari A, Chioin R, et al.
Trapidil (triazolopyrimidine), a platelet-derived growth factor
antagonist, reduces restenosis after percutaneous transluminal
coronary angioplasty. Results of the randomized, double-blind
STARC study. Studio Trapidil versus Aspirin nella Restenosi
Coronarica. Circulation 1994;90:2710–5.
[14] Okamoto S, Inden M, Setsuda M, Konishi T, Nakano T.
Effects of trapidil (triazolopyrimidine), a platelet-derived
growth factor antagonist, in preventing restenosis after percu-
taneous transluminal coronary angioplasty. Am Heart J
1992;123:1439–44.
[15] Zhou L, Ismaili J, Stordeur P, Thielemans K, GoldmanM, et al.
Inhibition of the CD40 pathway of monocyte activation by
triazolopyrimidine. Clin Immunol 1999;93:232–8.
[16] Kumar A, Commane M, Flickinger TW, Horvath CM, Stark
GR. Defective TNF-alpha-induced apoptosis in STAT1-null
cells due to low constitutive levels of caspases. Science
1997;278:1630–2.
[17] Stordeur P, Poulin LF, Craciun L, Zhou L, Schandene L, et al.
Cytokine mRNA quantification by real-time PCR. J Immunol
Methods 2002;259:55–64.
[18] Osborn L, Kunkel S, Nabel GJ. Tumor necrosis factor alpha
and interleukin 1 stimulate the human immunodeficiency virus
enhancer by activation of the nuclear factor kappa B. Proc
Natl Acad Sci U S A 1989;86:2336–40.
[19] Nguyen H, Ramana CV, Bayes J, Stark GR. Roles of phos-
phatidylinositol 3-kinase in interferon-gamma-dependent
phosphorylation of STAT1 on serine 727 and activation of
gene expression. J Biol Chem 2001;276:33361–8.
[20] Ouchi T, Lee SW, Ouchi M, Aaronson SA, Horvath CM.
Collaboration of signal transducer and activator of transcrip-
tion 1 (STAT1) and BRCA1 in differential regulation of IFN-
gamma target genes. Proc Natl Acad Sci U S A 2000;97:
5208–13.
[21] Zhang JJ, Zhao Y, Chait BT, Lathem WW, Ritzi M, et al.
Ser727-dependent recruitment of MCM5 by Stat1alpha in
IFN-gamma-induced transcriptional activation. EMBO J
1998;17:6963–71.
[22] Kovarik P, Mangold M, Ramsauer K, Heidari H, Steinborn R,
et al. Specificity of signaling by STAT1 depends on SH2 and
C-terminal domains that regulate Ser727 phosphorylation, dif-
ferentially affecting specific target gene expression. EMBO
2001;20:91–100.
[23] Muller M, Laxton C, Briscoe J, Schindler C, Improta T, et al.
Complementation of a mutant cell line: central role of the 91
kDa polypeptide of ISGF3 in the interferon-alpha and -gamma
signal transduction pathways. EMBO J 1993;12:4221–8.
[24] Kovarik P, Stoiber D, Eyers PA, Menghini R, Neininger A,
et al. Stress-induced phosphorylation of STAT1 at Ser727
requires p38 mitogen-activated protein kinase whereas IFN-
gamma uses a different signaling pathway. Proc Natl Acad
Sci U S A 1999;96:13956–61.
[25] Takaoka A, Tanaka N, Mitani Y, Miyazaki T, Fujii H, et al.
Protein tyrosine kinase Pyk2 mediates the Jak-dependent ac-
tivation of MAPK and Stat1 in IFN-g, but not IFN-a, signal-
ing. EMBO J 1999;18:2480–8.
[26] Bonisch D, Weber AA, Wittpoth M, Osinski M, Schror K.
Antimitogenic effects of trapidil in coronary artery smooth
muscle cells by direct activation of protein kinase A. Mol
Pharmacol 1998;54:241–8.
[27] Jaster R, Sparmann G, Emmrich J, Liebe S. Extracellular sig-
nal regulated kinases are key mediators of mitogenic signals in
rat pancreatic stellate cells. Gut 2002;51:579–84.
[28] Deb DK, Sassano A, Lekmine F, Majchrzak B, Verma A, et al.
Activation of protein kinase C delta by IFN-gamma. J Immu-
nol 2003;171:267–73.
top related