toll-like receptor signaling alters the expression of regulator of g protein signaling proteins in...

of November 9, 2014.This information is current as Signaling

Implications for G Protein-Coupled Receptor Signaling Proteins in Dendritic Cells:Expression of Regulator of G Protein Toll-Like Receptor Signaling Alters the

Moratz and John H. KehrlGeng-Xian Shi, Kathleen Harrison, Sang-Bae Han, Chantal

http://www.jimmunol.org/content/172/9/5175doi: 10.4049/jimmunol.172.9.5175

2004; 172:5175-5184; ;J Immunol 

Referenceshttp://www.jimmunol.org/content/172/9/5175.full#ref-list-1

, 27 of which you can access for free at: cites 49 articlesThis article

Subscriptionshttp://jimmunol.org/subscriptions

is online at: The Journal of ImmunologyInformation about subscribing to

Permissionshttp://www.aai.org/ji/copyright.htmlSubmit copyright permission requests at:

Email Alertshttp://jimmunol.org/cgi/alerts/etocReceive free email-alerts when new articles cite this article. Sign up at:

Print ISSN: 0022-1767 Online ISSN: 1550-6606. Immunologists All rights reserved.Copyright © 2004 by The American Association of9650 Rockville Pike, Bethesda, MD 20814-3994.The American Association of Immunologists, Inc.,

is published twice each month byThe Journal of Immunology

at Oregon H

ealth & Science U

niversity on Novem

ber 9, 2014http://w

ww

.jimm

unol.org/D

ownloaded from

at O

regon Health &

Science University on N

ovember 9, 2014

http://ww

w.jim

munol.org/

Dow

nloaded from

Toll-Like Receptor Signaling Alters the Expression ofRegulator of G Protein Signaling Proteins in Dendritic Cells:Implications for G Protein-Coupled Receptor Signaling

Geng-Xian Shi,1 Kathleen Harrison,1 Sang-Bae Han,1 Chantal Moratz, and John H. Kehrl2

Conserved structural motifs on pathogens trigger pattern recognition receptors present on APCs such as dendritic cells (DCs). Animportant class of such receptors is the Toll-like receptors (TLRs). TLR signaling triggers a cascade of events in DCs that includesmodified chemokine and cytokine production, altered chemokine receptor expression, and changes in signaling through G protein-coupled receptors (GPCRs). One mechanism by which TLR signaling could modify GPCR signaling is by altering the expressionof regulator of G protein signaling (RGS) proteins. In this study, we show that human monocyte-derived DCs constitutively expresssignificant amounts of RGS2, RGS10, RGS14, RGS18, and RGS19, and much lower levels of RGS3 and RGS13. Engagement ofTLR3 or TLR4 on monocyte-derived DCs induces RGS16 and RGS20, markedly increases RGS1 expression, and potently down-regulates RGS18 and RGS14 without modifying other RGS proteins. A similar pattern of Rgs protein expression occurred inimmature bone marrow-derived mouse DCs stimulated to mature via TLR4 signaling. The changes in RGS18 and RGS1 expres-sion are likely important for DC function, because both proteins inhibit G�i- and G�q-mediated signaling and can reduce CXCchemokine ligand (CXCL)12-, CC chemokine ligand (CCL)19-, or CCL21-induced cell migration. Providing additional evidence,bone marrow-derived DCs from Rgs1�/� mice have a heightened migratory response to both CXCL12 and CCL19 when com-pared with similar DCs prepared from wild-type mice. These results indicate that the level and functional status of RGS proteinsin DCs significantly impact their response to GPCR ligands such as chemokines. The Journal of Immunology, 2004, 172: 5175–5184.

D endritic cells (DC)3 function as the sentinels of the im-mune system (reviewed in Refs. 1 and 2). Immature DCs(iDC) traffic from the blood to inflamed tissues where

they capture Ag, and differentiate into mature DC (mDC). Subse-quently, they move to the draining lymphoid nodes to prime naiveT cells. iDC are highly endocytic and well adapted for the captureof Ag, but they function poorly as APCs. In contrast, mDC areefficient APCs and important modulators of T cell function. Manypathogen-derived substances are efficient inducers of iDC matura-tion, and do so predominantly by the engagement of Toll-like re-ceptors (TLRs) (reviewed in Refs. 3 and 4). In humans, 10 TLRhomologs have been identified, the majority displayed by DCs.TLR contain two major domains, an extracellular domain charac-terized by leucine-rich repeats and an intracellular Toll-like do-

main. TLR signaling leads to NF-�B activation, a requirement forthe differentiation of iDC to mDC (5).

iDCs express the chemokine receptors CCR1, CCR2, CCR5,and CXCR1, and respond to their respective ligands, chemokinesoften expressed in inflamed tissues (6, 7). In addition, iDCs mi-grate in response to other inflammatory mediators that couple to Gprotein-coupled receptors (GPCRs) including histamine (8), sphin-gosine-1-phosphate (S-1P) (9), lysophosphatidic acid (LPA) (10),and ATP (11). Maturing DCs lose their migratory response tomany of these inflammatory chemoattractants by either receptordown-regulation or receptor desensitization, and acquire respon-siveness to CC chemokine ligand (CCL)19 and CCL21 via theacquisition of high levels of CCR7 (6, 7). CCL19 and CCL21 havesignificant roles in the accumulation of Ag-loaded DCs in T cell-rich areas of draining lymph nodes. Exposure of maturing DCs tohistamine, S-1P, LPA, or ATP no longer induces a chemotacticresponse, but rather down-regulates IL-12 and enhances IL-10 pro-duction (8–11). A number of prior studies have demonstrated thatsignaling via chemokine and other GPCRs can modulate DC IL-12production (reviewed in Ref. 12). For example, the production ofIL-12 by CD8�� murine DCs can be triggered by CCR5signaling (13).

Ligand-activated GPCRs such as chemokine receptors act as aguanine nucleotide exchange factor for G� subunit of the hetero-trimeric G protein (reviewed in Refs. 14 and 15). Once the G�

subunit exchanges GDP for GTP, it dissociates from the G�� het-erodimer, thereby allowing both G� and G�� to activate down-stream effectors. However, G� subunits have an intrinsic GTPaseactivity that limit the duration that they remain GTP bound andthus able to signal. In addition, GTPase-activating proteins (GAPs)for G� subunits termed regulator of G protein signaling (RGS)proteins can further accelerate the intrinsic GTPase activity of G�

B Cell Molecular Immunology Section, Laboratory of Immunoregulation, NationalInstitute of Allergy and Infectious Diseases, National Institutes of Health, Bethesda,MD 20892

Received for publication September 29, 2003. Accepted for publication February13, 2004.

The costs of publication of this article were defrayed in part by the payment of pagecharges. This article must therefore be hereby marked advertisement in accordancewith 18 U.S.C. Section 1734 solely to indicate this fact.1 G.-X.S., K.H., and S.-B.H. contributed equally to the completion of this study.2 Address correspondence and reprint requests to Dr. John H. Kehrl, B Cell MolecularImmunology Section, Laboratory of Immunoregulation, National Institute of Allergyand Infectious Diseases, National Institutes of Health, Bethesda, MD 20892. E-mailaddress: jkehrl@niaid.nih.gov3 Abbreviations used in this paper: DC, dendritic cell; iDC, immature DC; mDC,mature DC; TLR, Toll-like receptor; GPCR, G protein-coupled receptor; S-1P, sphin-gosine-1-phosphate; LPA, lysophosphatidic acid; CCL, CC chemokine ligand;CXCL, CXC chemokine ligand; GAP, GTPase-activating protein; RGS, regulator ofG protein signaling; BM, bone marrow; ERK, extracellular signal-regulated kinase;med, medium; M1, muscarinic type 1; SRE, serum response element; TTBS, Tween20 plus TBS; MAPK, mitogen-activated protein kinase; PTX, pertussis toxin; IP3,inositol 1,4,5-trisphosphate; GFP, green fluorescent protein.

The Journal of Immunology

Copyright © 2004 by The American Association of Immunologists, Inc. 0022-1767/04/$02.00

at Oregon H

ealth & Science U

niversity on Novem

ber 9, 2014http://w

ww

.jimm

unol.org/D

ownloaded from

subunits (reviewed in Ref. 16). Genetic studies in yeast, Aspergil-lus nidulans, and Caenorhabditis elegans initially identified suchproteins (17–19). Providing evidence that they function by inter-acting with G� subunits, a yeast two-hybrid screen with G�i3 iden-tified a mammalian RGS protein originally termed GAIP and nowRGS19 (20). Cementing the functional relationship between theyeast and mammalian proteins, several human RGS proteins sub-stituted for Sst2p, a protein involved in the desensitizing of pher-omone signaling, a G protein-coupled signaling pathway in yeast(21). Rapidly thereafter, RGS proteins were shown to possess GAPactivity for Gi and Gq subfamily members (22–24). Coding regionsfor �25 human RGS proteins have now been identified. Two Rhoguanine exchange factors, which possess divergent RGS domains,selectively act as GAPs for G�12 and G�13 (25, 26). Experimen-tally, the introduction of expression vectors for RGS1, RGS3, andRGS4 into B lymphocyte cell lines dramatically impairs chemo-kine-induced cell migration (27–29). Furthermore, the lack ofRgs1 results in aberrant responses to the chemokines CXCL12 andCXCL13 in murine B cells.4

Differential expression of RGS proteins in iDC and mDC mayalso contribute to the regulation of DC trafficking and regulateresponses to other GPCR ligands. We have examined the expres-sion of RGS proteins by analyzing mRNA expression in iDC andmDCs derived from human monocytes and mouse bone marrow(BM). Maturation is accompanied by a marked reduction in RGS14(Rgs14) and RGS18 (Rgs18) levels and the induction of RGS1(Rgs1) and RGS16 (Rgs16). Because the effects of RGS18 on cellmigration had not been previously studied, we examined whetherRGS18 modulates CXCL12-, CCL19-, and CCL21-induced cellmigration. In addition, we provide evidence for the functional im-portance of Rgs1 by examining the chemoattractant responses ofRgs1-deficient mouse DCs.

Materials and MethodsPlasmids and reagents

The coding regions of human RGS18 and mouse RGS18 were isolated byPCR from human BM and mouse spleen Marathon-ready cDNA library(BD Clontech, Palo Alto, CA) and then subcloned into the EcoRI/BamH1sites of p3XFLAG-CMV-14 (Sigma-Aldrich, St. Louis, MO) orpEGFP-N1 (BD Clontech, Palo Alto, CA). The coding region of CXCR5was isolated by RT-PCR using RNA prepared from HS-Sultan cells andsubcloned into EcoRI site of pAAV-MCS. The coding region of human andmouse CCR7 were isolated by PCR from human and mouse spleen Mar-athon-ready cDNA libraries (BD Clontech) and then subcloned into TA-cloning vector pCR3.1 (Invitrogen, Carlsbad, CA). The Abs against thefollowing were purchased: FLAG (Sigma-Aldrich), phospho-p42/44 extra-cellular signal-regulated kinase (ERK) (Cell Signaling, Beverly, MA),p42/44 ERK, anti-G�s (Santa Cruz Biotechnology, Santa Cruz, CA),CD14, CD11c, CD40, CD95 (BD PharMingen, San Diego, CA), and anti-RGS1 (Novus Biologicals, Littleton, CO). Rabbit anti-RGS14 was raisedagainst recombinant mouse RGS14 and cross-reacts with human RGS14.

Human GM-CSF, IL-4, IL-15, CXC chemokine ligand (CXCL)12,CXCL13, CCL19, and CCL21 were purchased from R&D Systems (Minne-apolis, MN), and LPS, poly(I:C), and L-�-LPA were from Sigma-Aldrich.

Cell lines and cell cultures

293T, CHO-K1, COS, and HeLa were obtained from the American TypeCulture Collection (Manassas, VA). All of the cell lines were maintainedin DMEM (Life Technologies, Carlsbad, CA) supplemented with 10% FCS(HyClone, Logan, UT) except CHO-K1 cells, which were maintained inRPMI 1640 (Life Technologies) supplemented with 10% FCS.

Generation of human monocyte-derived DCs

PBMC were obtained from heparinized blood of healthy donors by Ficolldensity gradient centrifugation (Amersham Pharmacia Biotech, Uppsala,Sweden). The isolated PBMC were cultured in RPMI 1640 at 37°C in100-mm plate (Falcon, Franklin Lakes, NJ) for 3 h, and the nonadherentcells were discarded, and the adherent cells were washed with PBS forthree times. After this procedure, the resulting cell population was repre-sented by �98% CD14� monocytes, as assessed by flow cytometry usingFITC-CD14 Ab. Alternatively, elutriated monocytes prepared from leuco-paks were used as the starting population. The monocytes were maintainedin RPMI 1640 medium supplemented with 10% FCS in the presence ofGM-CSF (100 ng/ml) and IL-4 (50 ng/ml). After 4–6 days of culture,nonadherent and loosely adherent cells were collected and used for sub-sequent experiments. The purity of the recovered DCs exceeded 95% asassessed by flow cytometry using PE-CD11c Ab.

Isolation of mouse BM-derived DCs

DCs were generated from BM cells from 8- to 10-wk-old C57BL/6 femalemice (30). Briefly, BM cells were flushed out from the femurs and tibias.After lysis of RBC, whole BM cells (2 � 105 cells/ml) were cultured in100-mm2 culture dishes in 10 ml/dish complete medium containing 2ng/ml GM-CSF. At day 3, another 10 ml of fresh complete medium con-taining 2 ng/ml GM-CSF was added. On day 6 of the culture, half of themedium was changed. On day 8 of the culture, nonadherent DCs andloosely adherent DCs were harvested by gently pipetting and used as iDC.iDCs recovered from these cultures were generally �85–90% CD11c� andMHC class IImed-high, CD80med, and CD86low-med. Maturation of iDC wasaccomplished by treating with LPS at 1 �g/ml for the last 24 h of culture.mDCs were MHC class IIhigh, CD80high, and CD86high.

Luciferase reporter gene assay

For the muscarinic type 1 (M1) receptor-mediated serum response element(SRE) and NF-�B activation, HeLa cells were cotransfected with M1 re-ceptor gene constructs (0.25 �g), SRE (50 ng), or NF-�B (50 ng) luciferasereporter gene, and �-galactosidase gene (100 ng) in the absence or presenceof RGS18-3XFlag (0.5, 1.0, or 2.0 �g), RGS3-Flag (2.0 �g), or C3 (0.5�g). After 24 h, the cells were stimulated with 100 �mol/L carbachol(Sigma-Aldrich) for 5–6 h while starving cells with fresh DMEM withoutFCS and then were lysed in reporter lysis buffer (Promega, Ann Arbor,MI). After removing the cell debris, the luciferase and �-galactosidaseactivity were measured using a luminometer (Analytical LuminescenceLaboratory, San Diego, CA).

Measurement of inositol phosphates

The COS cells maintained in the inositol-free DMEM in 12-well plate weretransfected with 0.1 �g of M1 receptor gene construct in the absence orpresence of RGS18-3XFlag (0.25, 0.5, or 1.0 �g) or RGS3-Flag (1.0 �g).Twenty-four hours after transfection, the culture medium was replacedwith inositol-free DMEM containing 5% FCS and 1 mM sodium pyruvatefor 2 h, after which 2 �Ci/ml myo-[2-3H]inositol (Amersham PharmaciaBiotech) was added and, 15 min later, 10 mM LiCl. The cells were incu-bated for an additional 14 h and then stimulated with 100 �mol/L carba-chol for 15 min before washing with PBS, followed by the addition of 0.5ml of 20 mM formic acid. Thirty minutes later, the supernatant was col-lected, and a second extraction was performed. Each 1-ml extract wasneutralized to pH 7.5 with 7.5 mM HEPES and 150 mM KOH. The su-pernatants were centrifuged for 2 min at 15,000 � g and collected, andeach was loaded onto a 0.5-ml Dowex AG-X8 column (Bio-Rad, Rich-mond, CA) that had been previously washed with 2 ml of 1 M NaOH, 2 mlof 1 M formic acid, and then five washes of 5 ml of water. After loadingthe sample, the column was washed with 5 ml of water and 5 ml of 5 mMborax and 60 mM sodium formate. The columns were eluted with 3 ml of0.9 M ammonium formate and 0.1 M formic acid. A volume of 0.2 ml ofeach elution was added to 10 ml of CytoScint and analyzed via scintillationcounting.

Immunoblotting and immunoprecipitations

Cell lysates were prepared using an appropriate lysis buffer plus proteaseinhibitors for 30 min on ice. The detergent-insoluble materials were re-moved by microcentrifugation for 10 min at 4°C. Equal amounts of pro-teins from each sample were fractionated by 10% SDS-PAGE and trans-ferred to pure nitrocellulose. Membranes were blocked with 5% BSA inTween 20 plus TBS (TTBS) for 1 h and then incubated with an appropriatedilution of the primary Ab in 5% BSA in TTBS for 2 h or overnight. Theblots were washed three times with TTBS before the addition of a biotin-ylated Ab (DAKO, Carpinteria, CA) diluted 1/5,000 in TTBS containing

4 C. Moratz, J. R. Hayman, H. Gu, and J. H. Kehrl. Abnormal B cell responses tochemokines, disturbed plasma cell localization and distorted tissue architecture inRgs1�/� mice. Submitted for publication.

5176 TLR SIGNALING AND RGS PROTEINS

at Oregon H

ealth & Science U

niversity on Novem

ber 9, 2014http://w

ww

.jimm

unol.org/D

ownloaded from

5% BSA for 1 h and then incubated with streptavidin conjugated to HRP(DAKO) diluted 1/10,000 in TTBS containing 5% BSA for 1 h. The signalwas detected by ECL according to the manufacturer’s instruction (Amer-sham Pharmacia Biotech).

Mitogen-activated protein kinase (MAPK) assay or ERKactivation

COS cells were transfected with appropriate receptor expression construct(0.5 �g, respectively) in presence or absence of RGS18-3XFlag, RGS3-Flag, or RGS1-Flag (2.0 �g, respectively) using Superfect (Qiagen, Va-lencia, CA). Pertussis toxin (PTX; Calbiochem, Darmstadt, Germany)treatment for 6 h at concentration of 100 ng/ml was used as positive con-trol. Twenty-four hours after transfection, the cells were starved with freshDMEM without FCS for 6 h and then stimulated with LPA (30 �mol/L),CXCL12 (100 ng/ml), CXCL13 (250 ng/ml), or CCL19 (250 ng/ml) forvarying durations, and then lysed with 300 �l of kinase lysis buffer. MAPK

(ERK) activation was detected by immunoblotting with anti-phospho-p42/44 ERK mAb using detergent-soluble fraction of lysates afterfractionation by SDS-PAGE.

RT-PCR and Northern blot analysis

Total RNA was isolated using TRIzol reagents. For RT-PCR, 500 ng oftotal RNA was used for reverse transcription (Qiagen). The PCR primersused for the PCR are listed in Table I.

For the quantitative RT-PCR, a Roche LightCycler was used with aLightCycler Fast Start-DNA Master Syber Green 1 kit (no. 2239264;Roche, Indianapolis, IN). Melting curve analysis was performed to controlthe specificity of PCR product fluorescence. Value of the crossing pointwas determined for each gene and sample during real-time PCR. The valueof crossing point represents the number of cycles where fluorescence levelsof each sample are the same. Plasmids with the appropriate PCR insertsubcloned served as the control templates. For the Northern blot analysis,

Table I. Primers used for the PCR

Gene 5� and 3� Primers PCR Product (bp)

RGS1 ACCTGAGATCTATGATCCCACATCTGG & GGCTATTAGCCTGCAGGTCAT 460RGS2 CAGACCCATGGACAAGAGCGC & TAGCATGAGGCTCTGTGGTGA 590RGS3L TTGGCTGTCAGGGCAGCTGTACAATAGTGG & CACTGAACTCAGTGCGAAGGAAGGCTTGGA 1300RGS3P AACCGCTTCAATGGGCTCTGCAAGGTGTGC & CCTCTTCTCATCTGCCTCCGTCTCAAACAT 1200RGS3S CTCCGAGGCATGTACCTCACTCGCAACGGG & CACTGAACTCAGTGCGAAGGAAGGCTTGGA 200RGS4 GCCGGCTTCTTGCTTGAGGAG & CACTGAGGGACCAGGGAAGCA 590RGS5 ATGTGCAAAGGACTTGCAGCTTTGCCCCAC & TTGATTAACTCCTGATAAAACTCAGAGCGC 541RGS6 GTCCACAGGCCTGTGCCAGGC & CGTGAGGCGCTTGCCCGCCAG 850RGS7 TCTGGGACGTGCACAGGCCCG & CCCTCTGCTGGCTCGGTTCTT 390RGS8 AGACCCTCAGGCCATGAGGAC & GAGCCTCCTCTGGCTTTGGGA 540RGS9 GTGCACCGATGCCCTCCTGGA & GCTGGGAGCCATGTGCTGGCC 860RGS10 AGCCTCAAGAGCACAGCCAAATGG & TGCTTCTTAAAGCTGCCAGTCC 494RGS11 AGGAAGATGGAGCGGGTGGTC & ACGGAGCTTCGTGGGGGCAGC 840RGS12 ACCAGGAGCACCGGGAGGTCC & CTCTCCCGTAGCCGAGTGGTT 710RGS13 ATGAGCAGGCGGAATTGTTGGA & GAAACTGTTGTTGGACTGCATA 480RGS14 GGGCACAGCAGCTTCAGATCTTCA & GCCCTGAGACTCTCGGCGCAAGGC 296RGS16 CACCTGCCTGGAGAGAGCCAA & TGGCAGAGGCGGCTGAGGCTT 540RGS17 AGGAACACCTGCCGTGTCTCA & GATTCAGAAGAAGAGCCAGCAGTACTT 600RGS18 ATGGAAACAACATTGCTTTTCT & TTATAACCAAATGGCAACATCTGA 708RGS19 AGCCGCAACCCCTGCTGCCTG & AGGAGGACTGTGATGGCCCCT 540RGS20 GAGCGGGGAGTCGCGGGTCCA & TAGATTTCTCCGATAAGGACTGAAGCA 560Actin GTTTGAGACCTTCAACACCC & ATACTCCTGCTTGCTGATCC 699Rgs1 GATCCCACATCTGGAATCTGG & GCTGTCGATTCTCGAGTATGG 310Rgs2 AGTGCAGGCAACGGCCCCAAG & TGGGGCTCCGTGGTGATCTGT 570Rgs3S TCCTGAGTCTCAAGGTGGGGGGAC & CAGAGCGGAGGAAGCGAGGGTAAGAGT 562Rgs3L GTGCTTATTCACTTTGGAGGCACA & TGGGTGGGAGGTCTTGTCCTACAG 410Rgs4 GCCGGCTTCCTGCCTGAGGAG & TGCAGACTGCACTTCCCTGGT 580Rgs5 ATGTGTAAGGGACTGGCAGCTCTGCC & CGCTCTGAATTTTATAAGGAGCTAATCAAG 540Rgs6 TGCCGCCCAGGGCTACATCTT & GCAGTATGTGGAGTACGACCC 630Rgs7 CAGTGGAGGATCTCCATTTGG & ACAGGCCTGTGCCTGGATGTG 390Rgs8 GGCAGAGGAAGCCTTCAAGTC & CAGAGTCCTGCTGACGGGGAC 630Rgs9 GGCTGGTGCACCGAAGTCCGC & GCTCCAGCCCAAGCCCTGTCA 770Rgs10 AGATGGGAGCTCAAGCAGCGG & GGAGGCTCGCTTAGCTGCGGT 470Rgs11 CCCAACGTGGCTGCCCCCACA & AGGGAGCCTGCAGCAACCAGT 520Rgs12 AGCACGGGGCGGTGGGAGAAG & GCTCAGAGCAACAGAGCCGAT 900Rgs13 TCTACACCATTGTACCAGCATGAG & CCTTCTAAGGTCAATCATGGACATGCTGCT 1080Rgs14 AACGGGCGCATGGTTCTGGCTGTCTCAGATGG & CCGACTCTCGCTCTCACTCTC 870Rgs16 GTTCAAGACGCGGCTGGGAAT & AAGGCTCAGCTGGGCTGCCGC 540Rgs17 TGGAGAGCATCCAGGTCCTAG & GGAAAGTACCACCAGCTGTAC 440Rgs18 CAGAATATGGATATGTCACTGGTTTTCTTCT & CATAACCAAATGGCAACATCTGACTTTACATC 720Rgs19 ACCTCCCAGTCGCAATCCCTG & GACTGTGGGGCCCCCTGGAGT 550Rgs20 GGCTAGCCCAGCGGACCCTGG & GGACTCCCAAGTAGCAGAGGT 520GNAS ATGGGCTGCCTCGGGAACAGTAAG & CCGGATGACCATGTTGTAGCTGCT 780GNAI1 TGAGGACGGCGAGAAGGCGGCGCG & CCAGCAAGTTCTGCAGTCATAAAGCCT 289GNAI2 GGCCGAGCGCTCTAAGATGATCGA & GGACAGGTCATCAGGGAGCACGCC 340GNAI3 AGTGGAGCGAAGCAAGATGATCGA & TGCCGGGCATCATCTGCCCTGGCA 282GNAO ATGGGATGTACTCTGAGCGCAGAG & TCGCTGGCCTCCGACGTCAAACAG 620GNAZ AAAAAGAAGCAGCCCGGCGGTCCC & ATGACGTCTGTCACCGCGTCGAAG 1006GNAQ ATGACTCTGGAGTCCATCATGGCG & TGCGTAGGCAGGTAGGCAGGGTCA 528GNA11 TGATGGCGTGTTGCCTGAGCGATG & CCACCAGGTGCGAGTACAGGATCT 861GNA14 ATGGCCGGCTGCTGCTGCCTGTCC & CTGTAGAATTGTGTCTTTGACAGCAGC 1030GNA16 ATGGCCCGCTCGCTGACCTGGCGC & CCGTCCACGCACCCGGTGTACATC 980GNA12 TCTGGCATCAGGGAGGCTTTCAGC & CACGGTCTTCACCTTCTCCACCAG 444GNA13 GACTTCCTGCCGTCGCGGTCCGTG & GTTTCCACCATTCCTTGGGCTGCC 410

5177The Journal of Immunology

at Oregon H

ealth & Science U

niversity on Novem

ber 9, 2014http://w

ww

.jimm

unol.org/D

ownloaded from

RNA was size fractionated and transferred to nitrocellulose. The mem-branes were hybridized with a 708-bp RGS18 cDNA fragment or a1137-bp CCR7 cDNA fragment labeled with [�-32P]dCTP using Prime-ItRmT Random Primer Labeling kit (Stratagene, La Jolla, CA) as a probe.�-Actin expression was used as a control. Hybridization was performed at68°C for 2 h using QuickHyb (Stratagene), washed three times in 2�SSC/0.1% SDS for 15 min each at room temperature, and then in 0.1�SSC/0.1% SDS at 60°C for 30 min.

Migration assay

For CHO cell migration, CHO cells were transfected with or without 0.5�g of expression vector for CCR7 in the presence of 2 �g of RGS18-GFP,RGS1-GFP, or pEGFP-N1 as control. After 36 h, the transfected cells wereharvested and loaded into upper 8-�m-pore polycarbonate six-well cham-ber (Corning, Cambridge, MA). CXCL12 (100 ng/ml), CCL19 (250 ng/ml), and CCL21 (250 ng/ml) were diluted in serum-free medium and addedto the lower compartment. After 6-h incubation at 37°C, the migrated cellswere collected and counted with FACS at high speed for 1 min. The 100ng/ml PTX-treated pEGFP-N1-transfected cells were used as positive con-trol. For monocyte-derived DC migration, the recovered DCs were trans-fected with empty pEGFP-N1, hRGS-18-GFP, hRGS13-GFP, and hRGS1-CT-GFP using Human Dendritic Cell Nucleofector kit I (AmaxaBiosystems, Gaithersburg, MD). The cells were incubated in presence of100 ng/ml GM-CSF and 50 ng/ml IL4 at 37°C for 48–60 h and thenharvested for migration assay using 5-�m pore polycarbonate filter in 24-well Transwell chambers (Corning) with or without chemokines in lowerwell at concentration of SDF1�/CXCL12 (100 ng/ml), MIP-3�/CCL19(250 ng/ml), or 6Ckine/CCL21 (250 ng/ml) for 3 h. The PTX-treated (100ng/ml) pEGFP-N1-transfected cells (3 h) was used as positive control. Themigrated cells were harvested, and the green fluorescent protein (GFP)-positive cells were counted with FACS for 1 min at high flow speed. Theinitial cell pools were counted as control of loaded cell number. The per-centage of migration is calculated by dividing migrated GFP-positive cellnumber with loaded GFP-positive cell number. The migration assays withthe murine BM-derived DCs were performed similar to those performedwith the human DCs.

Generation of Rgs1�/� mice

The targeting construct was designed by replacing the small Xbal fragmentlocated at the end of exon 1 with the neomycin gene. For negative selectionof nonhomologous recombination, the thymidine kinase gene was placed inopposite transcriptional orientation upstream of exon 1. Following electro-poration with the linearized targeting, ES cells were selected with G418and resistant clones screened for homologous recombination. Resultant ESclones were injected into C57BL/6J blastocysts. Chimeric mice were bred,and germline transmission was documented by Southern blotting. Screen-ing for homozygous Rgs1�/� mice was performed by PCR analysis ofgenomic DNA using Rgs1-specific primers. The Rgs1 mutation was back-crossed onto a C57BL/6 background six times. Mice were housed in spe-cific pathogen-free conditions and used in accordance to the guidelines ofthe Institutional Animal Care Committee at the National Institutes ofHealth.

ResultsRGS protein expression in human monocytes and monocytes-derived DCs

We reverse-transcribed RNAs extracted from purified humanmonocytes, iDC (monocytes cultured with GM-CSF and IL-4 for4–6 days), and iDC stimulated with LPS, poly(I:C), or CD95 foreither 4 or 24 h, and amplified the resulting DNA with specificprimers for RGS1–14, RGS16–20, or �-actin (Fig. 1A). We de-tected very low levels or no mRNA expression of RGS3–9,RGS11, RGS13, or RGS17 in monocytes, iDC, or stimulated iDC(data not shown). The purified monocytes contained modestamounts of RGS2, RGS10, RGS14, and RGS19, and lower amounts

FIGURE 1. Expression of RGS proteins in DCs. A, Monocyte-derivedDCs were cultured in medium for 4 or 24 h or stimulated with LPS, CD95,or poly(I:C) for similar durations (lanes 1–8). RNA was extracted andsubjected to RT-PCR with primers specific for various RGS proteins or�-actin. In addition, RNAs from monocytes (lane 9) were similarly ana-lyzed. Lane 10 is from RNA not subjected to reverse transcription beforeamplification (no RT control). PCR products were fractionated on an aga-rose gel followed by ethidium bromide staining. At the bottom of the fig-ure, a Northern blot is shown, which documents RGS18, CCR7, and �-actinexpression in similar RNAs. B, Quantitative RT-PCR analysis was per-formed with the same RNAs to determine changes in RGS18, RGS16, orRGS1 relative to �-actin levels. The amounts are expressed as mRNAexpression relative to �-actin. The RGS18 results (�10) are shown. Be-cause the RGS16 peak expression level did not exceed 10�4, the RGS16results are not shown on the graph. C, Western blot analysis of RGS1,

RGS14, and G�s expression. Human iDCs were cultured with medium for24 h or stimulated with LPS for 24 or 48 h. Cell lysates were immuno-blotted using a 1/300 dilution of anti-RGS1, 1/1000 dilution of anti-RGS14, or 1/500 dilution of anti-G1�s. The approximate molecular massesof the identified bands are indicated.

5178 TLR SIGNALING AND RGS PROTEINS

at Oregon H

ealth & Science U

niversity on Novem

ber 9, 2014http://w

ww

.jimm

unol.org/D

ownloaded from

of RGS1, RGS16, and RGS18. In comparison, the iDCs had muchless RGS1 and RGS16 expression and a higher level of RGS18.Signaling through the TLRs, TLR3 and TLR4, markedly enhancedRGS1, RGS16, and RGS20 expression, but down-regulated that ofRGS14 and RGS18. The analysis of the same RNAs by Northernblotting revealed the same pattern of RGS18 expression as detectedby RT-PCR as well as verified the efficacy of the LPS andpoly(I:C) signaling, because both stimuli rapidly induced mRNAexpression for the chemokine receptor CCR7 (Fig. 1A, and datanot shown).

Next, we established quantitative PCR assays for the analysis ofRGS1, RGS16, RGS18, and �-actin expression. We normalized theresult from the RGS proteins to that of �-actin and expressed thedata as nanograms per microliter based on standard curves gener-ated from plasmid DNA containing the appropriate inserts. Thisapproach allowed for a quantitative comparison between the dif-ferent samples (Fig. 1B). We found that the iDC expressed modestlevels of RGS18 (�50% higher than monocytes) and low levels ofRGS1 (5-fold less than monocytes) and RGS16 (7-fold less thanmonocytes). Stimulation of iDC with LPS led to a �24-fold in-crease in RGS1 levels, a 6-fold increase in RGS16, and a 100-folddecrease in RGS18 expression, whereas poly(I:C) stimulationcaused a 32-fold increase in RGS1, 3-fold increase in RGS16, anda similar drop in RGS18, as did LPS.

Although high-quality Abs for many of the RGS proteins arelacking, an RGS1 Ab raised against a peptide from the C terminusof RGS1 readily identified an LPS-inducible band at the appropri-ate molecular mass in human monocyte-derived DCs (Fig. 1C).Similar lysates immunoblotted with affinity-purified Abs raisedagainst the C terminus of RGS18 failed to identify a band at theappropriate molecular mass, which decreased with stimulation(data not shown). Although this antiserum recognized overex-pressed RGS18, it did so poorly, suggesting that the failure todetect endogenous RGS18 may be secondary to a relatively low

affinity. An RGS14-specific Ab (31) documented the fall in RGS14expression following LPS signaling, whereas a G�s-specific Abdemonstrated no significant change in G�s levels, and an actin-specific Ab revealed similar actin levels (Fig. 1C, and data notshown).

G� expression in human BM-derived DCs

Signaling through the yeast pheromone receptor causes a signifi-cant increase in the expression of the yeast RGS homolog SST2 aswell as the yeast G� homolog GPA1 (32, 33). To determinewhether the changes in RGS protein expression in DCs stimulatedwith TLRs was accompanied by the altered expression of G� sub-units, we examined RNAs prepared from iDCs and iDCs stimu-lated with LPS or poly(I:C) (Fig. 2) We found that monocytes andiDC expressed significant amounts of G�s, G�i2, and G�16, whichdid not change significantly following TLR3 or TLR4 stimulation.iDC expressed low levels of G�i3, which were reduced by TLR3and TLR4 signaling. iDC also expressed low levels of G�q andG�13; however, in contrast to G�i3, TLR4 and, even more so,

FIGURE 2. Levels of G� subunits in monocytes, monocyte-derivedDCs, and following TLR stimulation. RNAs extracted from monocytes(lane 9) or monocyte-derived DCs cultured in medium for 4 or 24 h orstimulated with LPS, poly(I:C), or CD95 for similar durations were sub-jected to RT-PCR (33 cycles) to analyze the expression of G� subunits.The RT-PCR products were size fractionated on agarose gels and visual-ized by ethidium bromide staining. The G� subunits are referred to by theirGenBank names. There was no detectable expression of GNAI1, GNAO,or GNA14, and low levels of GNAZ relative to the other G� subunits.

FIGURE 3. RGS18 inhibits M1 receptor signaling. A, IP3 production.COS cells were transfected with 0.2 �g of M1 receptor gene constructs inthe presence or absence of constructs that express RGS18 or RGS3. IP3

production was measured as described in Materials and Methods. The cellswere stimulated with 100 �mol/L carbachol for 6 h after serum starving thecells. B, SRE activation. HeLa cells were cotransfected with 50 ng of aSRE reporter gene construct and 0.25 �g of M1 receptor gene constructin the presence or absence of RGS18 or RGS3. A construct that ex-presses the Clostridium botulinum C3 exozyme served as a control. Thecells were stimulated as above. Luciferase activity was measured andnormalized to a control plasmid that expressed �-galactosidase. C,NF-�B activation. HeLa cells were cotransfected with 0.2 �g of a M1receptor construct and 100 ng of a NF-�B reporter gene construct in thepresence or absence of constructs that express RGS18 or RGS3. Lucif-erase activity normalized to �-galactosidase activity is shown.

5179The Journal of Immunology

at Oregon H

ealth & Science U

niversity on Novem

ber 9, 2014http://w

ww

.jimm

unol.org/D

ownloaded from

TLR3 signaling caused a significant increase in their expressionlevels. We did not detect PCR products arising from either G�i1 orG�o. Despite the pronounced induction of RGS20, we detectedonly a very low level of G�z, which did not change following TLRsignaling (data not shown). Immunoblotting with G�-specific Absrevealed no changes in G�s (above), G�16, G�12, or G�i2 follow-ing LPS stimulation of iDCs (data not shown).

Comparison of RGS18 with RGS3 on M1 receptor andchemokine receptor signaling

The pronounced alteration in RGS18 during DC maturationprompted a comparison between RGS18 and several other RGSproteins on known GPCR signaling pathways (Figs. 3 and 4). Theactivities of numerous RGS proteins have been assessed using theM1 receptor, which signals through Gq and G12/13. To monitor Gq

signaling, we measured the production of inositol 1,4,5-trisphos-phates (IP3), and used the activation of a SRE reporter gene toassess both Gq and G12/13 signaling (34, 35). We first comparedRGS18 to RGS3, because RGS3 is among the most potent of theRGS proteins in inhibiting GPCR signaling (34). We transfected293 cells with the M1 receptor and the following day stimulatedthe cells with M1 receptor ligand carbachol and measured the gen-eration of IP3 and the activation of the SRE reporter (Fig. 5). BothRGS3 and RGS18 blunted to a similar extent the induction of IP3

by M1 receptor signaling. In contrast, RGS3 much more signifi-cantly interfered with the M1 receptor-mediated activation of theSRE reporter than did RGS18. M1 receptor signaling also activatesan NF-�B-dependent reporter gene, probably also via Gq andG12/13 signaling (36). When we compared the effects of RGS3 andRGS18 on M1 receptor, both inhibited, although the effect ofRGS3 again exceeded that of RGS18.

LPA is a bioactive lipid mediator, which signals through theLPA1, LPA2, and LPA3 receptors, all of which are expressed byiDC and mDC (10). LPA stimulates iDC actin polymerization andchemotaxis, through a PTX-sensitive pathway. To assess the effectof RGS18 on LPA signaling, we transfected COS-7 cells withRGS18 or RGS3 and measured MAPK/ERK activation usingphospho-specific Abs following exposure of COS-7 cells to LPA(Fig. 6). In this experiment, LPA signaled through the endogenousLPA receptors on COS-7 cells. We found that both RGS18 andRGS3 inhibited LPA-mediated ERK activation, although RGS3reduced ERK activation slightly more than did RGS18. Next, wecompared RGS18 and RGS3 on signaling through two chemokinereceptors, CXCR4 and CXCR5 (Fig. 6). Both iDC and mDC ex-press CXCR4, whereas a subset of DC that home to primary lym-phoid follicles express CXCR5. Using a similar approach as withthe other receptors, we transfected 293 cells with either CXCR4 orCXCR5 in the presence or absence of expression vectors forRGS18 or RGS3. We again monitored ERK activation using phos-pho-specific Abs at various time points following exposure to the

FIGURE 4. Comparision of RGS18, RGS1, and RGS3 on signalingthrough the LPA receptor, CXCL12, CXCL13, and CCR7. A, Inhibition ofLPA induced ERK activation. COS cells were transfected with or without2 �g of vectors that express RGS18 (lanes 2, 5, 8, and 11) or RGS3 (lane3, 6, 9, and 12). The cells (lanes 4–12) were stimulated with LPA (30�mol/L) for 2, 5, or 10 min. The amount of phosphorylated ERK1(pERK1) induced was detected with a specific Ab by immunoblotting. Thelevels of RGS3 and RGS18, and of ERK1 and ERK2 in the cell lysates areshown. B, Inhibition of CXCL12 induced ERK activation. COS cells weretransfected with 0.5 �g of expression vector for CXCR4 (lanes 1–12) in thepresence or absence of 2 �g of expression vectors for RGS3 or RGS18.

The cells (lanes 4–12) were stimulated with CXCL12 for 2, 5, or 10 min.Similar immunoblotting was performed as in the first panel. C, Inhibitionof CXCL13 induced ERK activation. Similar experiment as shown in sec-ond panel except the cells were transfected with CXCR5 rather thanCXCR4. The cells were stimulated with CXCL13 at final concentration of250 ng/ml for 5, 10, or 15 min. D, Inhibition of CCL19 induced ERK1activation. COS cells were transfected with 0.5 �g of expression vector ofCCR7 (lanes 1–15) in the presence or absence of 2 �g of expression vec-tors for RGS18 (lanes 2, 7, and 12), RGS1 (lanes 3, 8, and 13) or RGS3(lanes 4, 9, and 14). The cells treated with PTX (lanes 5, 10, and 15; 100ng/ml) for 6 h was used as control. The cells were stimulated with CCL19(lanes 6-15) at final concentration of 250 ng/ml for 2 or 5 min. Similarimmunoblotting was performed as in the above panels.

5180 TLR SIGNALING AND RGS PROTEINS

at Oregon H

ealth & Science U

niversity on Novem

ber 9, 2014http://w

ww

.jimm

unol.org/D

ownloaded from

appropriate chemokine. Both RGS3 and RGS18 significantly in-hibited CXCL12- and CXCL13-induced ERK activation. Finally,we examined signaling through the CCR7, a chemokine receptorinduced on mDC (Fig. 6). We compared RGS1, RGS3, andRGS18. We did not detect a significant difference among the threeRGS proteins. PTX blocked the CCR7-induced ERK activation, aresult consistent with the known role of Gi in chemokine signaling.Overall, the signaling data did not reveal any significant differencebetween RGS18 and either RGS1 or RGS3 in modulating Gi or Gq

signaling.

Comparison of RGS18 and RGS on chemokine-induced cellmigration

We also tested whether RGS18 like RGS1 and RGS3 can inhibitchemokine-induced cell migration. First, we transfected CHO cellswith CXCR4 or CCR7 in the presence of expression vectors forGFP, RGS18-GFP, or RGS1-GFP, and measured the ability of thecells to respond to either CXCL12 (data not shown), CCL19, orCCL21 (Fig. 7) using a standard filter-based assay. We found thatstimulation of the cells with the appropriate chemokine led to anincrease in CHO cell migration, and that both the RGS proteins

significantly inhibited the chemokine-induced enhancement. Fi-nally, we performed a similar experiment using DCs transfectedwith RGS18-GFP, RGS1-GFP, or RGS13-GFP, inducing cell mi-gration by stimulation through endogenous chemokine receptors.Although the transfection procedure had a deleterious effectupon the migratory capacity of the DCs, each of the RGS-GFPfusion proteins significantly reduced DC migration in responseto CXCL12, CCL19 (not shown), and CCL21 when comparedwith GFP alone. The decreased migratory capacity followingtransfection was not due to expression of GFP, but rather sec-ondary to the transfection procedure itself (K. Harrison, unpub-lished observation).

Rgs expression in mouse BM-derived DCs

Next, we examined the Rgs protein expression in mouse BM-de-rived DCs induced to mature with LPS for 2 or 48 h or not (Fig.2A). A similar pattern of Rgs protein expression occurred, althoughwe noted some differences. Like the human DCs, the levels ofRgs2, Rgs10, and Rgs19 remained unchanged following stimula-tion, Rgs1 and Rgs16 levels rose, and Rgs18 and Rgs14 levelsdeclined, although by 48 h the levels of Rgs14 had begun to returntoward the level observed in the immature cells. In contrast to thehuman cells, the mouse DCs expressed Rgs11, Rgs12, and Rgs17,but not Rgs20.

Because CXCL12 signaling enhanced RGS1 expression in hu-man monocyte-derived DCs (K. Harrison, unpublished observa-tion), we also examined the expression of Rgs1 and Rgs18 follow-ing stimulation of mouse BM-derived DCs with CXCL12 andcompared it to LPS. Again, the stimulation of BM-derived DCsresulted in an up-regulation of Rgs1 and down-regulation ofRgs18; however, in contrast to the human DCs, signaling throughCXCR4 had no effect on Rgs1 and Rgs18 expression (Fig. 2B).Also, several other Rgs proteins including Rgs11, Rgs14, and

FIGURE 5. Inhibition of CHO cell and monocyte-derived DC migra-tion in response to CXCL12, CCL19, and CCL21. A, RGS18 inhibits CHOcell migration to CCL19 and CCL21. CHO cells were transfected with 0.5�g of expression construct for CCR7 in the presence or absence of RGS18-GFP, RGS1-GFP, or GFP for 36 h, and then collected for migration assayas described in Materials and Methods. CCL19 and CCL21 were used at250 ng/ml in the lower chamber. PTX treatment (100 ng/ml) for 6 h wasused as control. B, RGS18 inhibits human monocyte-derived DC cell mi-gration. Recovered DCs were transfected with RGS18-GFP, RGS13-GFP,RGS1-GFP, or GFP vector for 48 h, and then collected for migration assayas described in Materials and Methods. The data are represented as X �SD from one experiment performed in triplicate. Medium or medium pluseither CXCL12 (100 ng/ml) or CCL21 (250 ng/ml) were placed in thebottom chamber. Where indicated, the cells were treated with PTX (100ng/ml) for 6 h before the assay. The experiments were performed threetimes with similar results.

FIGURE 6. Rgs expression in murine BM-derived DCs. A, Rgs expres-sion following LPS stimulation. BM-derived DCs were stimulated or notfor 2 or 48 h; RNA was extracted and subjected to RT-PCR with Rgs-specific primers listed in Table I (30–33 cycles). PCR products were frac-tionated on an agarose gel followed by ethidium bromide staining. B, Effectof CXCL12 on Rgs1 and Rgs18 expression. BM-derived DCs were stim-ulated with LPS or CXCL12 for 2, 4, or 24 h. The levels of Rgs1, Rgs18,and actin expression at the various time points are shown.

5181The Journal of Immunology

at Oregon H

ealth & Science U

niversity on Novem

ber 9, 2014http://w

ww

.jimm

unol.org/D

ownloaded from

Rgs16 did not change following exposure to CXCL12 (data notshown).

Migration of Rgs1-deficient mouse BM-derived DCs

The availability of mice in which Rgs1 has been disrupted allowedus to directly test the effect of Rgs1 on the migratory response ofDCs to chemokines. Mice homozygous for the Rgs1 mutation haveno readily apparent abnormalities, although many of the B cellfollicles in their spleens have germinal centers even in the absenceof immune stimulation. Furthermore, antigenic stimulation of aRgs1�/� mouse leads to an exaggerated splenic germinal centerreaction, partial disruption of the normal architecture of the spleenand Peyer’s patches, and abnormal trafficking of Ab-secretingcells.4 Although many of these abnormalities likely result fromimproper trafficking of Rgs1�/� B cells, DC defects may also con-tribute. We first verified that the Rgs1�/� iDCs and mDCs lackedRgs1 mRNA. We prepared BM-derived DCs from wild-type andRgs1�/� mice, stimulated them with LPS or not, and checked Rgs1expression. As expected, Rgs1�/� DCs lacked Rgs1 expression,but possessed levels of Rgs18 similar to that of wild-type mice,indicating that the disruption of Rgs1 did not effect Rgs18 expres-sion (Fig. 7A). Rgs18 resides near to Rgs1 on chromosome 1. Next,

we analyzed the response of wild-type and Rgs1�/� BM-derivediDCs in a migration assay, using varying concentrations of eitherCXC12 or CC19 in the bottom well of the chemotaxis chamber. Atevery concentration that we tested, nearly twice as many Rgs1�/�

iDCs migrated in response to CXCL12 and to CCL19 as comparedwith the wild-type iDCs (Fig. 7B). Somewhat surprisingly, theabsence of Rgs1 had less effect on the ability of the mDCs tomigrate in response to CXCL12 in the chemotaxis assay than it didin the iDCs. Nevertheless, the chemotactic response of theRgs1�/� mDCs exceeded that of wild-type mice at every concen-tration tested.

DiscussionBoth TLR and GPCR receptor signaling have substantive roles inthe regulation of DC function. Signaling through either TLR3 orTLR4 induces the maturation of iDC and alters the expression ofchemokine receptors, i.e., induces CCR7 and CXCR4, and dimin-ishes CCR5 and CCR6. TLR signaling significantly alters the ex-pression of RGS proteins in human monocyte-derived DCs, de-creasing RGS18 and RGS14, but augmenting RGS1, RGS16, andRGS20. In addition, TLR signaling induces changes in the expres-sion of several G� subunits including increasing the expression ofGq� and G�13 in these cells. This provides a mechanism wherebyTLR signaling can regulate signaling through chemokine receptorsand other GPCRs. Consistent with human monocyte-derived DCdata, mouse BM-derived iDCs expressed a similar pattern of Rgsproteins, whose expression levels responded similarly to LPS sig-naling. Of the RGS proteins modulated by TLR signaling, we fo-cused on RGS1 and RGS18 because of their substantial regulationand the availability of Rgs1�/� mice.

We showed that iDC cells express RGS18 and that TLR receptorsignaling potently down-regulates it. Three previous reports doc-umented strong RGS18 expression in megakaryocytes (37–39),and another report found that hemopoietic stem cells express highamounts of Rgs18 (40). These reports also demonstrated that Ju-rkat, K562, platelets, and CD14� peripheral blood cells expressedRGS18. RGS18 acted as a GAP for Gi� and Gq� and localized inthe cytosol of megakaryocytes. It also inhibited angiotensin-in-duced IP3 production in 293 cells and CCR2 signaling (37, 38, 40).We performed a wider range of functional studies of RGS18 thanpreviously reported, revealing that it inhibits Gi and/or Gq signal-ing through the CXCR4, CXCR5, CCR7, LPA receptors, and theM1 receptor. In most instances, RGS18 behaved similar to RGS3in its effect on GPCR signaling, and our data suggests that RGS18is a particularly potent inhibitor of Gq signaling. In addition, wedemonstrated that RGS18 inhibited chemokine-induced DC mi-gration; however, its role in DC function will require further study.

Besides decreasing RGS18, TLR signaling also decreasedRGS14 levels in human monocyte-derived iDC and Rgs14 andRgs11 in mouse BM-derived DCs. RGS14 possesses G�i and G�o

GAP activity, G�i guanine nucleotide dissociation inhibitor activ-ity, and a small GTPase binding domain (31, 41, 42). A recentmicroarray study of DCs exposed to various pathogens (43) alsoindicates that RGS14 levels decreases in DCs following exposureto Leishmania major or Toxoplasma gondii. Rgs11, which containsa conserved DEP (Dishevelled/EGL-10/Pleckstrin) and a GGL (Gprotein �-like) domain, is prominently expressed in the brain andnot previously reported to be expressed in any BM-derivedcell type.

Although TLR signaling reduced RGS18 and RGS14 expres-sion, RGS1 and RGS20 and to a lesser extent RGS16 were induced.The two original reports of RGS20 documented a largely brain-specific expression pattern (44, 45). However, RGS20 expressed

FIGURE 7. Migratory response of BM-derived DCs from wild-type andRgs1�/� mice. A, Rgs1 and Rgs18 expression in wild-type and Rgs1�/�

mice. RNA extracted from BM-derived DCs stimulated with LPS for 24 h(mDC) or not (iDC) from wild-type and Rgs1�/� was subjected to RT-PCRto detect Rgs1, Rgs18, and actin expression levels. B, Migration of iDCs toCXCL12 or CCL19. Wild-type and Rgs1�/� BM-derived iDCs were sub-jected to a standard chamber chemotaxis assay using increasing concen-trations of either CXCL12 or CCL19. Data are shown as percentage ofmigration and are representative of one of three experiments performed. C,Migration of mDCs to CXCL12. Wild-type and Rgs1�/� BM-derived DCswere stimulated to mature by treating with LPS for 24 h. Percentage ofmigration of wild-type and Rgs1�/�-deficient mDCs in response to increas-ing concentrations of CXCL12 is shown. Representative of one of threeexperiments performed.

5182 TLR SIGNALING AND RGS PROTEINS

at Oregon H

ealth & Science U

niversity on Novem

ber 9, 2014http://w

ww

.jimm

unol.org/D

ownloaded from

sequence tags suggest a broader range of tissue expression, be-cause expressed sequence tags have been found in cDNA librariesfrom placenta, liver, melanocytes, and several tumors. The level ofRGS20 expression we detected in poly(I:C)-treated DCs was sim-ilar to those observed with RNA from brain (K. Harrison, unpub-lished observation). Because RGS20 has potent Gz GAP activity,the question arose whether TLR signaling altered DC G�z expres-sion. However, we detected only low levels of G�z, which did notchange with TLR3 or TLR4 signaling. A recent study documenteda role for G�z in maintenance of the Golgi apparatus. The over-expression of RGS20 caused the dissolution of the Golgi complexin HeLa cells (46). Because DCs are known to tightly control thecompartmentalization and transport of MHC class I and class IImolecules (47), perhaps Gz and RGS20 have some role in the reg-ulation of MHC transport through the Golgi complex. RGS16 ex-pression was also up-regulated in response to TLR signaling, al-though much more in human than in mouse cells. RGS16reportedly regulates signaling through CXCR4, CCR3, and CCR5in T cells, while having little effect on CCR2 and CCR7signaling (48).

Human monocyte-derived iDCs express low levels of RGS1,and TLR signaling markedly increases RGS1 expression andRGS1 protein levels. Similarly, mouse BM-derived iDCs expresslower amounts of Rgs1 than do mDCs stimulated with LPS tomature. Analysis of the chemotactic response of iDCs fromRgs1�/� mice revealed a heightened sensitivity to both CXCL12and CCL19, arguing that Rgs1 functions in iDCs to set a thresholdfor chemokine-triggered cell migration. Those cells with a lowerlevel respond while those cells with a higher level do not.

A higher percentage of BM-derived mouse mDCs migrated toCXCL12 than did iDCs at each concentration tested, despite thenormal up-regulation of Rgs1 expression that occurs in wild-typemDCs. Although the lack of Rgs1 further enhanced the chemotac-tic response of mDCs to CXCL12, the difference was not as strik-ing as between wild-type and Rgs1�/� iDCs. Because G�i expres-sion did not significantly change during DC maturation, anincreased availability of G�i is an unlikely explanation for theirrobust CXCL12-triggered migratory response. What else might ex-plain the enhanced migratory response of wild-type mDCs? Onepossibility is that some of the intracellular pool of RGS1 protein isunavailable to interfere with chemokine signaling. For example, aposttranslational modification triggered by TLR signaling mightinterfere with the intracellular localization or function of RGS1.Another possibility is that the overall balance of RGS proteins inmDCs favors enhanced signaling: although Rgs1 expression in-creases, Rgs18 and Rgs14 expression falls. Finally, the enhancedchemotaxis of mDCs may be secondary to alterations in the levelsof CXCR4 or other components in the signaling apparatus. Futurestudies should be able to delineate among these possibilities.

Several studies have observed differences in the responsivenessof human monocyte-derived iDC and mDC to GPCR signaling.Although both iDC and mDC have a similar array of S-1P recep-tors, S-1P stimulated a PTX-sensitive (Gi-sensitive) increase inactin polymerization and chemotaxis of iDC, but those responseswere lost by DCs matured with LPS. In mDCs, S-1P inhibited thesecretion of TNF-� and IL-12, and it enhanced secretion of IL-10(9). The differential effect of S-1P on iDCs and mDCs suggests aprominent Gi response or Gs response, respectively. Althoughnone of the five S1P receptors, S1P1–5, functionally couple to Gs,recently S-1P has been shown to be a ligand for GPR3, GPR6, andGPR12, receptors that do couple to Gs (49). Studies of LPA, ATP,and histamine signaling suggest a similar pattern, Gi-coupled re-sponses in iDC and Gs-coupled responses in mDCs (10–12). Al-though a change in receptor expression did not account for the

changing pattern of responses (9–12), an altered RGS protein ex-pression could explain the apparent switch from a prominent Gi

response to a Gs response. Two important factors distinguish thechemokine receptors from the GPCR receptors for the above li-gands. First, the LPA, ATP, histamine, and likely the S-1P recep-tors have subtypes that couple to Gs, whereas chemokine receptorsdo not. Therefore, a modest reduction in Gi signaling mediated byan RGS protein may facilitate a Gs-mediated response in thoseligands that have Gs- and Gi-coupled receptors. In contrast, noGs-coupled response is unmasked with chemokine receptors. Sec-ond, mDCs markedly increase their CXCR4 and CCR7 expressionlevels (6, 7), whereas the expression of the nonchemokine recep-tors remain stable. The high receptor levels and large amounts ofchemokines may overcome some of the inhibitory effects of theRGS proteins, whereas those GPCRs expressed at lower levelsremain sensitive.

In conclusion, TLR signaling dramatically altered RGS expres-sion in human and murine iDCs, increasing RGS1 (Rgs1) andRGS16 (Rgs16), and decreasing RGS14 (Rgs14) and RGS18(Rgs18). One consequence of the enhanced RGS1, RGS16, andRGS20 expression may be to shunt a prominent Gi response to a Gs

response to those ligands that have both Gi- and Gs-coupled re-ceptors. Consistent with that hypothesis is the known shift inGPCR signaling that occurs during DC maturation. Studies of theRgs1�/� iDCs indicate that RGS1 sets a threshold for chemoat-tractant responses in these cells. The ability of mDCs to respond tochemoattractants despite their significant up-regulation of RGS1argues for another level regulation, which likely has an importantphysiological role in DC function.

AcknowledgmentsWe thank Mary Rust for her editorial assistance and Dr. Anthony Fauci forhis continued support.

References1. Banchereau, J., F. Briere, C. Caux, J. Davoust, S. Lebecque, Y. T. Liu,

B. Pulendran, and K. Palucka. 2000. Immunobiology of dendritic cells. Annu.Rev. Immunol. 18:767.

2. Sallusto, F., and A. Lanzavecchia. 2000. Understanding dendritic cell and T-lymphocyte traffic through the analysis of chemokine receptor expression. Im-munol. Rev. 177:134.

3. Janeway, C. A., and R. Medzhitov. 2002. Innate immune recognition. Annu. Rev.Immunol. 20:197.

4. Kaisho, T., and S. Akira. 2003. Regulation of dendritic cell function throughToll-like receptors. Curr. Mol. Med. 3:373.

5. Rescigno, M., M. Martino, C. L. Sutherland, M. R. Gold, andP. Ricciardi-Castagnoli. 1998. Dendritic cell survival and maturation are regu-lated by different signaling pathways. J. Exp. Med. 188:2175.

6. Sozzani, S., W. Luini, A. Borsatti, N. Polentarutti, D. Zhou, L. Piemonti, G.D’Amico, C. A. Power, T. N. Wells, M. Gobbi, et al. 1997. Receptor expressionand responsiveness of human dendritic cell to a defined set of CC and CXCchemokines. J. Immunol. 159:1993.

7. Sallusto, F., P. Schaerli, P. Loetscher, C. Schaniel, D. Lenig, C. R. Mackay,S. Quin, and A. Lanzavecchia. 1998. Rapid and coordinated switch in chemokinereceptor expression during dendritic cell maturation. Eur. J. Immunol. 28:2760.

8. Idzko, M., A. la Sala, D. Ferrari, E. Panther, Y. Herouy, S. Dichmann,M. Mockenhaupt, F. Di Virgilio, G. Girolomoni, and J. Norgauer. 2002. Expres-sion and function of histamine receptors in human monocyte-derived dendriticcells. J. Allergy Clin. Immunol. 109:839.

9. Idzko, M., E. Panther, S. Corinti, A. Morelli, D. Ferrari, Y. Herouy, S. Dichmann,M. Mockenhaupt, P. Gebicke-Haerter, F. Di Virgilio, et al. 2002. Sphingosine1-phosphate induces chemotaxis of immature and modulates cytokine-release inmature human dendritic cells for emergence of Th2 immune responses. FASEB J.16:625.

10. Panther, E., M. Idzko, S. Corinti, D. Ferrari, Y. Herouy, M. Mockenhaupt,S. Dichmann, P. Gebicke-Haerter, F. Di Virgilio, G. Girolomoni, andJ. Norgauer. 2002. The influence of lysophosphatidic acid on the functions ofhuman dendritic cells. J. Immunol. 169:4129.

11. Idzko, M., S. Dichmann, D. Ferrari, F. Di Virgilio, A. la Sala, G. Girolomoni,E. Panther, and J. Norgauer. 2002. Nucleotides induce chemotaxis and actinpolymerizaton in immature but not mature human dendritic cells via activation ofpertussis toxin-sensitive P2y receptors. Blood 100:925.

12. Braun, M. C., and B. L. Kelsall. 2001. Regulation of interleukin-12 production byG-protein-coupled receptors. Microbes Infect. 3:99.

5183The Journal of Immunology

at Oregon H

ealth & Science U

niversity on Novem

ber 9, 2014http://w

ww

.jimm

unol.org/D

ownloaded from

13. Aliberti, J., C. ReiseSousa, M. Schito, S. Hieny, T. Wells, G. B. Huffnagle, andA. Sher. 2000. CCR5 provides a signal for microbial induced production of IL-12by CD8�� dendritic cells. Nat. Immunol. 1:83.

14. Hepler, J. R., and A. G. Gilman. 1992. G proteins. Trends Biochem. Sci. 17:383.15. Neer, E. J. 1995. Heterotrimeric G proteins: organizers of transmembrane signals.

Cell 80:249.16. Kehrl, J. H. 1998. Heterotrimeric G protein signaling: roles in immune function

and fine-tuning by RGS proteins. Immunity 8:1.17. Dietzel, C., and J. Kurjan. 1987. Pheromonal regulation and sequence of the

Saccharomyces cerevisiae SST2 gene: a model for desensitization to pheromone.Mol. Cell. Biol. 7:4169.

18. Koelle, M. R., and H. R. Horvitz. 1996. EGL-10 regulates G protein signaling inthe C. elegans nervous system and shares a conserved domain with many mam-malian proteins. Cell 84:115.

19. Lee, B. N., and T. H. Adams. 1994. Overexpression of flbA, an early regulator ofAspergillus asexual sporulation, leads to activation of brlA and premature initi-ation of development. Mol. Microbiol. 14:323.

20. De Vries, L., M. Mousli, A. Wurmser, and M. G. Farquhar. 1995. GAIP, a proteinthat specifically interacts with the trimeric G protein G�i3, is a member of aprotein family with a highly conserved core domain. Proc. Natl. Acad. Sci. USA92:11916.

21. Druey, K. M., K. J. Blumer, V. H. Kang, and J. H. Kehrl. 1996. Inhibition ofG-protein-mediated MAP kinase activation by a new mammalian gene family.Nature 379:742.

22. Berman, D. M., T. M. Wilkie, and A. G. Gilman. 1996. GAIP and RGS4 areGTPase-activating proteins for the Gi subfamily of G proteins � subunits. Cell86:445.

23. Watson, N., M. E. Linder, K. M. Druey, J. H. Kehrl, and K. J. Blumer. 1996. RGSfamily members: GTPase-activating proteins for heterotrimeric G-protein �-sub-units. Nature 383:172.

24. Hunt, T. W., T. A. Fields, P. J. Casey, and E. G. Peralta. 1996. RGS10 is aselective activator of G�i GTPase activity. Nature 383:175.

25. Mao, J., H. Yuan, W. Xie, and D. Wu. 1998. Guanine nucleotide exchange factorGEF115 specifically mediates activation of Rho and serum response factor by theG protein � subunit G�13. Proc. Natl. Acad. Sci. USA 27:12973.

26. Kozasa, T., X. Jiang, M. J. Hart, P. M. Sternweis, W. D. Singer, A. G. Gilman,G. Bollag, and P. C. Sternweis. 1998. p115 RhoGEF, a GTPase activating proteinfor G�12 and G�13. Science 280:2109.

27. Bowman, E. P., J. J. Campbell, K. M. Druey, A. Scheschonka, J. H. Kehrl, andE. C. Butcher. 1998. Regulation of chemotactic and proadhesive responses tochemoattractant receptors by RGS (regulator of G-protein signaling) familymembers. J. Biol. Chem. 273:28040.

28. Moratz, C., V. H. Kang, K. M. Druey, C. S. Shi, A. Scheschonka, P. M. Murphy,T. Kozasa, and J. H. Kehrl. 2000. Regulator of G protein signaling 1 (RGS1)markedly impairs Gi� signaling responses of B lymphocytes. J. Immunol.164:1829.

29. Reif, K., and J. G. Cyster. 2000. RGS molecule expression in murine B lympho-cytes and ability to down-regulate chemotaxis to lymphoid chemokines. J. Im-munol. 164:4720.

30. Inaba, K., M. Inaba, N. Romani, H. Aya, M. Deguchi, S. Ikehara, S. Muramatsu,and R. M. Steinman. 1992. Generation of large numbers of DC from mouse bonemarrow cultures supplemented with GM-CSF. J. Exp. Med. 176:1693.

31. Cho, H., T. Kozasa, K. Takekoshi, J. De Gunzburg, and J. H. Kehrl. 2000.RGS14, a GTPase-activating protein for Gi�, attenuates Gi�- and G13�-mediatedsignaling pathways. Mol. Pharmacol. 58:569.

32. Jahng, K. Y., J. Ferguson, and S. I. Reed. 1988. Mutations in a gene encoding the� subunit of a Saccharomyces cerevisiae G protein indicate a role in matingpheromone signaling. Mol. Cell. Biol. 8:2484.

33. Dohlman, H. G., J. Song, D. Ma, W. E. Courchesne, and J. Thorner. 1996. Sst2,a negative regulator of pheromone signaling in the yeast Saccharomyces cerevi-siae: expression, localization, and genetic interaction and physical associationwith Gpa1 (the G-protein � subunit). Mol. Cell. Biol. 16:5194.

34. Scheschonka, A., C. W. Dessauer, S. Sinnarajah, P. Chidiac, C. S. Shi, andJ. H. Kehrl. 2000. RGS3 is a GTPase-activating protein for Gi� and Gq� and apotent inhibitor of signaling by GTPase-deficient forms of Gq� and G11�. Mol.Pharmacol. 58:719.

35. Shi, C. S., S. Sinnarajah, H. Cho, T. Kozasa, and J. H. Kehrl. 2000. G13�-me-diated PYK2 activation: PYK2 is a mediator of G13�-induced serum responseelement-dependent transcription. J. Biol. Chem. 275:24470.

36. Shi, C. S., and J. H. Kehrl. 2001. PYK2 links Gq� and G13� signaling to NF-�Bactivation. J. Biol. Chem. 276:31845.

37. Nagata, Y., M. Oda, H. Nakata, Y. Shozaki, T. Kozasa, and K. Todokoro. 2001.A novel regulator of G-protein signaling bearing GAP activity for G�i and G�q

in megakaryocytes. Blood 97:3051.38. Yowe, D., N. Weich, M. Prabhudas, L. Poisson, P. Errada, R. Kapeller, K. Yu,

L. Faron, M. Shen, J. Cleary, et al. 2001. RGS18 is a myeloerythroid lineage-specific regulator of G-protein-signalling molecule highly expressed inmegakaryocytes. Biochem. J. 359:109.

39. Gagnon, A. W., D. L. Murray, and R. J. Leadley. 2002. Cloning and character-ization of a novel regulator of G protein signalling in human platelets. Cell.Signal. 14:595.

40. Park, I. K., C. A. Klug, K. Li, L. Jerabek, L. Li, M. Nanamori, R. R. Neubig,L. Hood, I. L. Weissman, and M. F. Clarke. 2001. Molecular cloning and char-acterization of a novel regulator of G-protein signaling from mouse hematopoi-etic stem cells. J. Biol. Chem. 276:915.

41. Kimple, R. J., L. De Vries, H. Tronchere, C. I. Behe, R. A. Morris, M. Faquhar,and D. P. Siderovski. 2001. RGS12 and RGS14 GoLoco motifs are G�i inter-action sites with guanine nucleotide dissociation inhibitor activity. J. Biol. Chem.276:29275.

42. Siderovski, D. P., M. Diverse-Pierluissi, and L. De Vries. 1999. The GoLocomotif: a G�i/o binding motif and potential guanine-nucleotide exchange factor.Trends Biochem. Sci. 24:340.

43. Chaussabel, D., R. T. Semnani, M. A. McDowell, D. Sacks, A. Sher, andT. B. Nutman. 2003. Unique gene expression profiles of human macrophages anddendritic cells to phylogenetically distinct parasites. Blood 102:672.

44. Glick, J. L., T. E. Meigs, A. Miron, and P. J. Casey. 1998. RGSZ1, a Gz-selectiveregulator of G protein signaling whose action is sensitive to the phosphorylationstate of Gz�. J. Biol. Chem. 273:26008.

45. Wang, J., A. Ducret, Y. Tu, T. Kozasa, R. Aebersold, and E. M. Ross. 1998.RGSZ1, a Gz-selective RGS protein in brain: structure, membrane association,regulation by G�z phosphorylation, and relationship to a Gz GTPase-activatingprotein subfamily. J. Biol. Chem. 273:26014.

46. Nagahama, M., S. Usui, T. Shinohara, T. Yamaguchi, K. Tani, and M. Tagaya.2002. Inactivation of G�z causes disassembly of the Golgi apparatus. J. Cell. Sci.115:4483.

47. Ackerman, A. L., and P. Cresswell. 2003. Regulation of MHC class I transport inhuman dendritic cells and the dendritic-like cell line KG-1. J. Immunol.170:4178.

48. Lippert, E., D. L. Yowe, J. A. Gonzalo, J. P. Justice, J. M. Webster, E. R. Fedyk,M. R. Hodge, C. Miller, J. C. Gutierrez-Ramos, F. Borrego, et al. 2003. Role ofregulator of G protein signaling 16 in inflammation-induced T lymphocyte mi-gration and activation. J. Immunol. 171:1542.

49. Uhlembrock, K., H. Gassenhuber, and E. Kostenis. 2002. Sphingosine 1-phos-phate is a ligand of the human gpr3, gpr6 and gpr12 family of constitutivelyactive G protein-coupled receptors. Cell. Signal. 14:941.

5184 TLR SIGNALING AND RGS PROTEINS

at Oregon H

ealth & Science U

niversity on Novem

ber 9, 2014http://w

ww

.jimm

unol.org/D

ownloaded from