lecture 6 microbial genetics: dna replication gene expression
Post on 16-Jan-2016
226 Views
Preview:
TRANSCRIPT
Lecture 6
Microbial Genetics:
DNA Replication
Gene Expression
Genetics
• Genome=
• Cells genome organized into chromosomes
• Chromosome=
• Gene= segment of the DNA that codes for one protein
Bacterial Chromosome
• Single circular chromosome composed of DNA
• Looped and folded and attached at one or more points to the plasma membrane
• Supercoiled
Bacterial Plasmids
• Many prokaryotic cells also contain plasmids
• They replicate independently from the chromosome
Nucleic Acids
• 2 types of nucleic acids:– Deoxyribonucleic acid (DNA)– Ribonucleic acid (RNA)
• Subunit: Nucleotides
Nucleotide
Nitrogen containing bases
• 5 Different:
• Purines: Adenine (A)
Guanine (G)
• Pyrimadines: Thyamine (T)
Cystosine (C)
Uracil (U)
Synthesis of DNA
• Dehydration synthesis- forming of covalent bonds between nucleotides
• Forms between phosphate group of one nucleotide and sugar of another nucleotide
• Phosphate joins #3 carbon of one sugar with #5 carbon of the other
• Results in backbone of alternating sugar and phosphate molecules
Double Helix of DNA
• Strand are held together by hydrogen bonds– A pairs with T– G pairs with C
• # of A= # of T
• # of G=# of C
• DNA sequence: read from 5’ to 3’
• Sequence example: ATTAGCA etc.
DNA Replication
DNA Replication
• Purpose is to create new DNA strand, so that upon binary fission, each of the 2 cells receives a complete copy of DNA
• Bidirectional- from distinct starting point- proceeds in both directions
• Semi- conservative- each of the 2 DNA helix’s generated contains 1 new strand and 1 old strand
First Stage: Initiation
• DNA unwinds and strands separate
• As the DNA unzips, two replication forks form and move in opposite directions away from the origin
Second Stage: Elongation
• Enzymes synthesize a new stand to pair with each original strand
• Nucleotides can only be added in 3’ to 5’ direction
• This creates leading and lagging strands
• The lagging strand is synthesized in Okazaki fragments, which are joined by DNA ligase
Figure 8.4
Third Stage: Termination
• Two DNA helices separate from each other
• Each chromosome now contains one old and one new strand
Figure 8.5
Figure 8.6b
Gene Expression:
Transcription
Translation
Central Dogma of Molecular Biology
• DNA RNA Protein
• Gene Expression: The production of a protein product from a gene– Involves two steps: transcription and
translation
Gene Expression
• Series of two processes that link genes to proteins
1. Transcription: synthesis of RNA from DNA
2. Translation: synthesis of protein from RNA
Transcription
• DNA used as template
• Use one strand of DNA to make mRNA molecule
• mRNA is complementary to one strand of DNA
Initiation of Transcription
• Transcription begins when RNA polymerase recognizes and binds to sequence of nucleotides in the DNA called the promoter
• The promoter orients the RNA polymerase in one of two possible directions, telling it which DNA strand to use
Transcription- Elongation
• RNA polymerase moves along template strand of DNA, synthesizing the complementary single-stranded RNA molecule
• RNA synthesized in 5’ to 3’ direction, nucleotides added to 3’ end
• Very fast: 30 nucleotides per second
Transcription- Termination
• When RNA polymerase encounters terminator it falls off DNA
• Once terminated RNA is called mRNA
Figure 8.7 (Overview) (1 of 7)
mRNA
• Messenger RNA• Temporary copy of genetic information• 3 nucleotides of DNA 3 nucleotides of
RNA
• 3 nucleotides of RNA is a codon• One codon codes for one amino acid• String of amino acids with proper 3-D shape
protein
Translation
• Process by which information on mRNA is decoded to synthesize the specified protein
• Proteins synthesized by adding amino acids sequentially
• Remember: one codon one amino acid• How many amino acids would one protein
contain if it was translated from an mRNA that is 690 nucleotides long?
• AUGCGGCAGACCAAACGAUUGGUUGCGUAA
• How many codons? 10
• List the codons:
AUG CGG CAG ACC AAA CGA UUG GUU
GCG UAA
The Genetic Code: Universal for all living things
Translation
• Process of translation requires three major components– mRNA– Ribosomes– tRNA
Ribosomes
• Serve as sites of translation, or sites of protein synthesis
• Prokaryotic ribosomes are 70S– Large subunit- 50S– Small subunit- 30S
tRNA
• Transfer RNA
• Carries amino acids to the ribosome
• Recognize and base-pair with a specific codon and deliver appropriate amino acid to site
• Recognition occurs because each tRNA has an anti-codon, which is complementary to codon on mRNA
Initiation of Translation
• Translation begins as the mRNA is still being synthesized
• 30S subunit binds to ribosome-binding site
• tRNA and 50S subunit soon join
• AUG- start codon- codes for methionine
Elongation
• Ribosome moves along mRNA
• As the next codon is exposed, a new tRNA with correct anti-codon moves in
• As each tRNA brings in the correct amino acid it forms a covalent bond to it’s neighboring amino acid
• Elongation continues until stop codon is reached
Regulation of Gene Expression
• Protein synthesis requires a huge amount of energy
• Regulation of protein synthesis conserves energy for the cell
• Repression and Induction
• Operon model of gene expression
Repression and Induction
• Repression: inhibits gene expression and decreases the synthesis of enzymes– Mediated by regulatory proteins called
repressors
• Induction: process that turns on the transcription of a gene– Mediated by regulatory proteins called
inducers
Operon model of gene expression
• Read over Operon Model of Gene Expression before class (page 229-231)
• Work in groups to understand the concept
top related