Lecture 6

Microbial Genetics:

DNA Replication

Gene Expression

Genetics

• Genome=

• Cells genome organized into chromosomes

• Chromosome=

• Gene= segment of the DNA that codes for one protein

Bacterial Chromosome

• Single circular chromosome composed of DNA

• Looped and folded and attached at one or more points to the plasma membrane

• Supercoiled

Bacterial Plasmids

• Many prokaryotic cells also contain plasmids

• They replicate independently from the chromosome

Nucleic Acids

• 2 types of nucleic acids:– Deoxyribonucleic acid (DNA)– Ribonucleic acid (RNA)

• Subunit: Nucleotides

Nucleotide

Nitrogen containing bases

• 5 Different:

• Purines: Adenine (A)

Guanine (G)

• Pyrimadines: Thyamine (T)

Cystosine (C)

Uracil (U)

Synthesis of DNA

• Dehydration synthesis- forming of covalent bonds between nucleotides

• Forms between phosphate group of one nucleotide and sugar of another nucleotide

• Phosphate joins #3 carbon of one sugar with #5 carbon of the other

• Results in backbone of alternating sugar and phosphate molecules

Double Helix of DNA

• Strand are held together by hydrogen bonds– A pairs with T– G pairs with C

• # of A= # of T

• # of G=# of C

• DNA sequence: read from 5’ to 3’

• Sequence example: ATTAGCA etc.

DNA Replication

DNA Replication

• Purpose is to create new DNA strand, so that upon binary fission, each of the 2 cells receives a complete copy of DNA

• Bidirectional- from distinct starting point- proceeds in both directions

• Semi- conservative- each of the 2 DNA helix’s generated contains 1 new strand and 1 old strand

First Stage: Initiation

• DNA unwinds and strands separate

• As the DNA unzips, two replication forks form and move in opposite directions away from the origin

Second Stage: Elongation

• Enzymes synthesize a new stand to pair with each original strand

• Nucleotides can only be added in 3’ to 5’ direction

• This creates leading and lagging strands

• The lagging strand is synthesized in Okazaki fragments, which are joined by DNA ligase

Figure 8.4

Third Stage: Termination

• Two DNA helices separate from each other

• Each chromosome now contains one old and one new strand

Figure 8.5

Figure 8.6b

Gene Expression:

Transcription

Translation

Central Dogma of Molecular Biology

• DNA RNA Protein

• Gene Expression: The production of a protein product from a gene– Involves two steps: transcription and

translation

Gene Expression

• Series of two processes that link genes to proteins

1. Transcription: synthesis of RNA from DNA

2. Translation: synthesis of protein from RNA

Transcription

• DNA used as template

• Use one strand of DNA to make mRNA molecule

• mRNA is complementary to one strand of DNA

Initiation of Transcription

• Transcription begins when RNA polymerase recognizes and binds to sequence of nucleotides in the DNA called the promoter

• The promoter orients the RNA polymerase in one of two possible directions, telling it which DNA strand to use

Transcription- Elongation

• RNA polymerase moves along template strand of DNA, synthesizing the complementary single-stranded RNA molecule

• RNA synthesized in 5’ to 3’ direction, nucleotides added to 3’ end

• Very fast: 30 nucleotides per second

Transcription- Termination

• When RNA polymerase encounters terminator it falls off DNA

• Once terminated RNA is called mRNA

Figure 8.7 (Overview) (1 of 7)

mRNA

• Messenger RNA• Temporary copy of genetic information• 3 nucleotides of DNA 3 nucleotides of

RNA

• 3 nucleotides of RNA is a codon• One codon codes for one amino acid• String of amino acids with proper 3-D shape

protein

Translation

• Process by which information on mRNA is decoded to synthesize the specified protein

• Proteins synthesized by adding amino acids sequentially

• Remember: one codon one amino acid• How many amino acids would one protein

contain if it was translated from an mRNA that is 690 nucleotides long?

• AUGCGGCAGACCAAACGAUUGGUUGCGUAA

• How many codons? 10

• List the codons:

AUG CGG CAG ACC AAA CGA UUG GUU

GCG UAA

The Genetic Code: Universal for all living things

Translation

• Process of translation requires three major components– mRNA– Ribosomes– tRNA

Ribosomes

• Serve as sites of translation, or sites of protein synthesis

• Prokaryotic ribosomes are 70S– Large subunit- 50S– Small subunit- 30S

tRNA

• Transfer RNA

• Carries amino acids to the ribosome

• Recognize and base-pair with a specific codon and deliver appropriate amino acid to site

• Recognition occurs because each tRNA has an anti-codon, which is complementary to codon on mRNA

Initiation of Translation

• Translation begins as the mRNA is still being synthesized

• 30S subunit binds to ribosome-binding site

• tRNA and 50S subunit soon join

• AUG- start codon- codes for methionine

Elongation

• Ribosome moves along mRNA

• As the next codon is exposed, a new tRNA with correct anti-codon moves in

• As each tRNA brings in the correct amino acid it forms a covalent bond to it’s neighboring amino acid

• Elongation continues until stop codon is reached

Regulation of Gene Expression

• Protein synthesis requires a huge amount of energy

• Regulation of protein synthesis conserves energy for the cell

• Repression and Induction

• Operon model of gene expression

Repression and Induction

• Repression: inhibits gene expression and decreases the synthesis of enzymes– Mediated by regulatory proteins called

repressors

• Induction: process that turns on the transcription of a gene– Mediated by regulatory proteins called

inducers

Operon model of gene expression

• Read over Operon Model of Gene Expression before class (page 229-231)

• Work in groups to understand the concept