Microbial Genetics

MICB404, Spring 2008Lecture #13

Biology of plasmids: II. Modes of replication

• Announcements-Summary due today. -Review Wednesday-Exam Friday

Regulation of copy number by antisense RNA

Plasmid R1Plasmid ColE1

ColE1 plasmids• Copy number regulated by siRNA (RNA I)

inhibiting primer RNA (pRNA, RNA II) availability– pRNA: 550 nt

• RNA Pol product• processed by RNase H

• anti-sense RNA (RNA I) transcribed from opposite strands of the pRNA locus– RNA I: 108 nt– complementary to 5’ end of RNA II

ColE1 plasmids• RNA I:RNA II duplex forms

– step 1, small number of base pairs (“kissing complex”); rate-limiting

– step 2, full-length duplex formed (“hug”)– prevents RNase H processing of RNA II and

formation of RNA:DNA primer complex

• RNA I transcribed from constitutive promoter– Increasing plasmid copy number yields more

RNA I, thus increasing inhibition of replication

ColE1 plasmids

R1 copy number control RepA protein

• Plasmid-specific replicative helicase

R1 copy number control

• RepA required to initiate plasmid replication

• therefore control of Rep protein concentration will control copy number

• Antisense RNA inhibits expression of Rep protein– Plasmid-encoded

R1 copy number control• repA gene transcribed from 2

promoters on plasmid1) prepA: RepA mRNA

• located in copB• repressed by CopB

protein

2) pcopB: CopB-RepA polycistronic mRNA

• Regulatory antisense RNA, CopA, transcribed from pcopA

– constitutive

R1 copy number control• Transcription from prepA only occurs

immediately after transformation– RepA then drives replication until

copy number reached– expression of copB results

in repression of RepA expression from prepA

– repA can now only betranscribed from the pcobB promotor

R1 copy number control• CopA RNA binds to CopB-RepA mRNA

– double-stranded RNA forms over region spanning 5’ end of RepA ORF• upstream of repA is a short leader peptide ORF• translationally coupled with RepA

R1 copy number control• CopA:RepA dsRNA cleaved by RNase III

in leader peptide ORF– interferes with RepA translation

– more plasmid CopA RNA– more CopA RNA less RepA protein– limiting RepA protein no plasmid

replication

Iteron plasmids: copy number control

• Some plasmids contain iterated (repeated) sequences in oriV– e.g. pSC101, F, RK2

• pSC101 first plasmid used for cloning recombinant DNA: 1973, frog rRNA genes cloned into EcoRI site

– 17 to 22 bp– 3 to 7 copies per plasmid

Iteron plasmids• ori contains repA gene

– Sole plasmid-encoded protein required for replication

– 3 iteron sequences, R1, R2, & R3

Iteron plasmids

• Two-part copy number regulationI. RepA protein multi-functional– Required for replication– Represses transcription of repA gene

• Transcriptional auto-regulation• Increasing plasmid copy number

increasing RepA protein increasing repression of repA expression

Iteron plasmidsII. Coupling

– RepA protein binds to iteron sequences• Low plasmid concentrations

– bimolecular interaction– replication activated

• High plasmid concentrations– multimolecular interaction– “handcuffed” or “coupled”

plasmids prevented from replication

– Results in replication control according to [RepA] and [plasmid]

Iteron plasmids

Eukaryote plasmid 2μ

• Typically, 50 to 100 copies per cell• Replication initiated only once per

cell cycle• Bidirectional and rolling circle

replication• Regulation of recombinase

expression.

Eukaryote 2μ

Inverted repeats

Partitioning into daughter cellsDuring mitosis and meiosis

“Flip protein”Site-directed recombinase

Proteins repressing expression of FLP(constitutive)

Plasmid 2μ

Plasmid maintenance

• Curing– Loss of all plasmids from cell after

cytokinesis– Prevented by

• plasmid addiction• multimer resolution• partitioning

Plasmid addiction• Plasmid-encoded factor that kills

cells cured of plasmid– plasmid also encodes “antidotes” to

toxic protein– upon curing, antidotes are lost and cell

is killed by toxic protein– Toxicity

• aberrant DNA gyrase• disrupt membrane

potential• etc

Restriction endonuclease toxicity

CH3 |GTATGCTCACCATACGAGTG

Methylase CH3 endonucleaseX

Plasmid curing

GTATGCTCACCATACGAGTG

endonucleaseMethylase

Multimer resolution

• Plasmid replication can result in formation of dimers & multimers– Result in increased curing

• Prevented by site-specific recombination – Resolve multimers into monomers

• Plasmid or chromosomeencoded

Multimer resolution• Site-specific recombinase

– XerC and XerD proteins• encoded by chromosomal

genes

– Promote recombination between cer sites on plasmid

– Irreversible• recombination does not occur

between cer sites on monomers

– Cytokinesis delayed until recombination complete

Partitioning

• System that segregates plasmids into each daughter cell– Probability of segregation– 50:50 chance per

plasmid; either cell:

2.(1/2)2n

n = copy number= 1/128

R1 ParM-based segregation

ATP hydrolysis is proposed to induce a structural change in ParM. ParR is released and reassociates with ParM-ATP.

ParR N-terminal binds specifically to parC while the C-terminal interacts with ParM-ATP.

R1 ParM mediated partitioning

ParM foci

ParR bound to parC site

DNA rep. apparatus

Plasmid tethered to pole via ParM and ParR/parC

Movement to mid-cell, replication, ParR binding

Rapid movement to cell poles

Dissociation of filament

Incompatibility

• Some plasmids are incompatible in the same cell– mutual interference in replication or

partitioning• Inc group defines plasmids which are unable

to coexist in same cell

Compatibleplasmids

Incompatibility• Replication control

– Two plasmids of same Inc group and same replication control will share copy number between them• unequal replication will

result in declining proportion of one plasmid

• eventually that plasmid is cured from cell

– Particularly with stringent plasmids• low copy number

Incompatibility• Partitioning

– Two plasmids using same par system will be incompatible

– They will be partitioned into one or the other daughter cell at random• one daughter receives only plasmid X, other

receives on plasmid Y

– Stringent plasmids

Incompatibility• Measurement of plasmid curing

– Incompatibility test: two plasmids with different antibiotic resistance genes• Higher rate of curing for 2 plasmids together

indicates they are of same Inc group

Maintaining antibiotic selection for both plasmids can overcome loss of plasmids from same Inc group

• Monday’s lecture:– Conjugation: Mechanisms of plasmid-

mediated gene transfer – Reading

• Snyder and Champness, Chapter 5