biology 107 macromolecules iii september 7, 2005

Biology 107Biology 107Macromolecules IIIMacromolecules III

September 7, 2005September 7, 2005

Proteins May Be Denatured and Renatured.Proteins May Be Denatured and Renatured.

When proteins are changed from one environment to another When proteins are changed from one environment to another they usually change shape (denature). Return to the original they usually change shape (denature). Return to the original environment commonly results in folding that is different than environment commonly results in folding that is different than normally found under that condition.normally found under that condition.

Protein Protein “Partners” “Partners”

(Chaperones) (Chaperones) Influence Influence FoldingFolding

Protein Chaperones Influence “Correct” FoldingProtein Chaperones Influence “Correct” Folding

Macromolecules IIIMacromolecules III

Student Objectives:Student Objectives: As a result of this lecture and the assigned As a result of this lecture and the assigned reading, you should understand the following:reading, you should understand the following:

1.1. Nucleic Acids are polymers of nucleotides. There are two types of Nucleic Acids are polymers of nucleotides. There are two types of nucleic acids: deoxyribonucleic acid (DNA) and ribonucleic acid nucleic acids: deoxyribonucleic acid (DNA) and ribonucleic acid (RNA).(RNA).

2.2. Nucleic acids function in information coding, storage and transfer. Nucleic acids function in information coding, storage and transfer. DNA does not directly control protein synthesis, instead it works DNA does not directly control protein synthesis, instead it works through intermediates, RNA molecules.through intermediates, RNA molecules.

Macromolecules IIIMacromolecules III3.3. Each nucleotide monomer has three (3) parts: Each nucleotide monomer has three (3) parts:

five carbon sugarfive carbon sugarphosphate groupphosphate groupnitrogenous basenitrogenous base

Nucleic acids contain one of two 5-carbon sugars, either Nucleic acids contain one of two 5-carbon sugars, either deoxyribose (in DNA) or ribose (in RNA). Linked to the one end deoxyribose (in DNA) or ribose (in RNA). Linked to the one end of the sugar is a phosphate group, and linked to the other end of of the sugar is a phosphate group, and linked to the other end of the pentose is one of the nitrogenous bases. DNA has the the pentose is one of the nitrogenous bases. DNA has the nitrogenous bases nitrogenous bases adenineadenine ( (AA), ), guanineguanine ( (GG),), thymine thymine ( (TT), and ), and cytosinecytosine ( (CC). RNA has A, G, C and ). RNA has A, G, C and uraciluracil ( (UU) (instead of thymine).) (instead of thymine).

Macromolecules IIIMacromolecules III4.4. A nucleic acid polymer, a polynucleotide, forms from monomers A nucleic acid polymer, a polynucleotide, forms from monomers

covalently linked by dehydration synthesis. The phosphate group covalently linked by dehydration synthesis. The phosphate group of one nucleotide bonds to the sugar of the next nucleotide, with of one nucleotide bonds to the sugar of the next nucleotide, with the result a repeating sugar-phosphate backbone. the result a repeating sugar-phosphate backbone.

5.5. RNA is normally a single polynucleotide strand, while DNA is a RNA is normally a single polynucleotide strand, while DNA is a double-stranded molecule. double-stranded molecule.

6.6. Nucleic acids form complementary base pairs stabilized by Nucleic acids form complementary base pairs stabilized by hydrogen bonds, with guanine pairing with cytosine and adenine hydrogen bonds, with guanine pairing with cytosine and adenine pairing with thymine or uracil.pairing with thymine or uracil.

Functions of Functions of Nucleic AcidsNucleic Acids

Information coding, Information coding, storage, and transferstorage, and transfer

Synthesis of other nucleic Synthesis of other nucleic acids or proteinsacids or proteins

Central DogmaCentral Dogma

DNADNA

↓↓

RNARNA

↓↓

ProteinProtein

The Flow of Genetic Information The Flow of Genetic Information (The Central Dogma)(The Central Dogma)

We store lots of information using We store lots of information using simple linear codessimple linear codes

Mass Storage of Mass Storage of InformationInformation

CTGGGTTCTGTTCGGGATCCCAGTCACAGGGACAATGGCGCATTCATATGTCACTTCCTTTACCTGCCTGGAGGAGGTGTGGCCACAGACTCTGGTGGCTGCGAACGGGGACTCTGACCCAGTCGACTTTATCGCCTTGACGAAGGGTTGGTTAATCCGTGCATGTGAGCTCCTCAGGGTGGAATCCAGGAGGATCCACGAGGGTGAATTGGCGGCATTCTTGTCTTACGCCATCGCCTACCCCCAAAACTTCCTGTCTGTGATTGACAGCTACAGCGTAGGATGCGGTCTGTTGAACTTCTGCGCGGTGGCTCTGGCTCTCTGTGAACTGGGCTACAGGCCTGTGGGGGTGCGTTTGGACAGCGGTGACCTCTGCAGCCTGTCGGTGGATGTCCGCCAGGTCTTCAGACGCTGCAGCGAGCATTTCTCCGTCCCTGCCTTTGATTCGTTGATCATCGTCGGGACGAATAACATCTCAGAGAAAAGCTTGACGGAGCTCAGCCTGAAGGAGAACCAGATTGACGTTGTCGGAGTCGGAACTCACCTGGTCACCTGTACGACTCAGCCGTCGCTGGGTTGCGTTTACAAGCTGGTGGAGGTGAGGGGGAGGCCCCGGATGAAGATCAGCGAGGATCCGGAAAAGAGCACCGTTCCCGGGAGGAAGCAGGTGTACCGCCTGATGGACACTGATGCTCCTCCAGAACCTGGAGTCCCTCTGAGCTGCTTCCCTCTGTGCTCCGATCGCTCCTCCGTCTCCGTCACCCCGGCGCAGGTTCACCGTCTGCGGCAGGAAGTCTTTGTTGATGGACAGGTCACAGCCCGTCTGTGCAGCGCCACAGAGACCAGAACGGAGGTCCAGACCGCTCTCAAGACCCTCCACCCTCGACACCAGAGGCTGCAGGAGCCAGACTCGTACACGGTGATTCACATTCTGAAGAAAACAACATTGGATCGCGCTTTTCCGCTCTCTTCCCTTAGTTTCCCCTCCGAACTCCGCCGCTGGGCCGGAGGACTGAACCGGCCCCCGACGGTGTCCCAGCGGCGGTGCAATGTGGCCCGGGTCCGGGAGGAGTGCGTGACGCCAGAGCAGAATGGTTCGGTGGACGGGGGCGCACACGCTTCTCGCCGCGGCCGCTCCCCGCGGCCCACGGAACCGCGGGATCGGAGCTGTTTTGTGCCGCCTGAAGGACTCGAAGGGGGACGGATAAATGCTGGATCCCCGAGTCCAGATCTGACCGTCTGCATTCCGCTGGTGAGCTGCCAGACGCATCTGGAAACGAGCGCCGACAGAAGCAGCTCCGGACCATGTCGCCGTCCGCGCACACAGGTCGCGTGTAAAGGGGACTTGGTCAGATCATCTTGCACCGGAACCAGGTCTCCCCTGGAGATGGGGACGGTCATGACCGTCTTCTACCAGAAGAAGTCCCAGCGGCCGGAGAGGAGAACCTTCCAGATCAAGCCTGACACGCGGCTCCTCGTGTGGAGCCGAAACCCCGACAAAAGCGAAGGAGAGAGTGAGTATGAGCAGGCGGGCCGTGCCGGGACCGGGCCCACGCCGCCCAGAACCTCATGTTCCTGGTGTTCCAGCACCGACCGGCCAGTTCTGGCTCAGCTCCACACAACATCTGACAAACCCTCGTGGTTCCTGGTGGTCGACCACACGGCTGGTGAGGCGGCCTCAGGTAGCTCAGGTAGCTCAGGTTAGCGTAAAGGGAGTTTTAAGCATCACCTGGTGACGGGGCAGGTGAGCTCCAGCCACTCAGCAGTGCACGGCCGTGCACATACACACACACCTCTGTGTCGAGGTTACAGGTGGGGCCAAAGCCCAACACCTTCAATGGCCCTCAGAGCTTTGAGGTTTTGAGGAATTGAGCCTTTAATCAGAAAA

Another simple linear code, the Another simple linear code, the DNA sequence, is the basis of lifeDNA sequence, is the basis of life

Mass Storage of Mass Storage of InformationInformation

Dense Information StorageDense Information StorageThis image shows 1 gram of This image shows 1 gram of DNA on a CD that can hold DNA on a CD that can hold 800 MB of data. 800 MB of data.

The 1 gram of DNA can hold The 1 gram of DNA can hold about 1x10about 1x101414 MB of data. MB of data.

The number of CDs required The number of CDs required to hold this amount of to hold this amount of information, lined up edge to information, lined up edge to edge, would circle the Earth edge, would circle the Earth 375 times, and would take 375 times, and would take 163,000 centuries to listen to.163,000 centuries to listen to.

DNA as Mass Storage DeviceDNA as Mass Storage DeviceIf the DNA sequence from a single human sperm cell were If the DNA sequence from a single human sperm cell were typed on a continuous ribbon in ten-pitch type, that ribbon typed on a continuous ribbon in ten-pitch type, that ribbon could be stretched from San Francisco to Chicago to could be stretched from San Francisco to Chicago to Washington to Houston to Los Angeles, and back to San Washington to Houston to Los Angeles, and back to San Francisco, with about 60 miles of ribbon left over.Francisco, with about 60 miles of ribbon left over.

Structure of NucleotidesStructure of Nucleotides

Structure of Structure of NucleotidesNucleotides

Pentose sugarPentose sugar

Phosphate groupPhosphate group

Nitrogenous baseNitrogenous base

Nitrogenous BasesNitrogenous Bases

Chargaff’s RulesErwin Chargaff’s data indicated that in DNA the amount of adenine nearly always equaled the amount of thymine and the amount of cytosine nearly always equaled the amount of guanine.

Sourcemol % of bases  Ratios

 %GC A  G  C  T  A/T  G/C

 Octopus  33.2  17.6  17.6  31.6  1.05  1.00  35.2

 Chicken  28.0  22.0  21.6  28.4  0.99  1.02  43.7

 Rat  28.6  21.4  20.5  28.4  1.01  1.00  42.9

 Human  29.3  20.7  20.0  30.0  0.98  1.04  40.7

Double Helix Structure of DNADouble Helix Structure of DNA

19531953 20032003

Original Original NatureNature paper paper by Watson by Watson and Crick – and Crick – 19531953

Click to Open

Thread of HistoryThread of HistoryBack in my rooms I lit the coal fire, knowing there was no Back in my rooms I lit the coal fire, knowing there was no chance that the sight of my breath would disappear before I chance that the sight of my breath would disappear before I was ready for bed. With my fingers too cold to write legibly was ready for bed. With my fingers too cold to write legibly I huddled next to the fireplace, daydreaming about how I huddled next to the fireplace, daydreaming about how several DNA chains could fold together in a pretty and several DNA chains could fold together in a pretty and hopefully scientific way. Soon, however, I abandoned hopefully scientific way. Soon, however, I abandoned thinking at the molecular level and turned to the much thinking at the molecular level and turned to the much easier job of reading biochemical papers on the easier job of reading biochemical papers on the interrelations of DNA, RNA and protein synthesis.interrelations of DNA, RNA and protein synthesis.

 from Chapter 21 of Chapter 21 of The Double HelixThe Double Helix by James Dewey Watson. by James Dewey Watson.

Thread of HistoryThread of HistoryVirtually all the evidence then available made me believe Virtually all the evidence then available made me believe that DNA was the template upon which RNA chains were that DNA was the template upon which RNA chains were made. In turn, RNA chains were the likely candidates for made. In turn, RNA chains were the likely candidates for the templates for protein synthesis. There was some fuzzy the templates for protein synthesis. There was some fuzzy data using sea urchins, interpreted as a transformation of data using sea urchins, interpreted as a transformation of DNA into RNA, but I preferred to trust other experiments DNA into RNA, but I preferred to trust other experiments showing that DNA molecules, once synthesized, are very showing that DNA molecules, once synthesized, are very very stable. The idea of the genes' being immortal smelled very stable. The idea of the genes' being immortal smelled right, and so on the wall above my desk I taped up a paper right, and so on the wall above my desk I taped up a paper sheet saying DNA -> RNA -> protein. The arrows did not sheet saying DNA -> RNA -> protein. The arrows did not signify chemical transformations, but instead expressed the signify chemical transformations, but instead expressed the transfer of genetic information from the sequences of transfer of genetic information from the sequences of nucleotides in DNA molecules to the sequences of amino nucleotides in DNA molecules to the sequences of amino acids in proteins.acids in proteins.  from Chapter 21 of Chapter 21 of The Double HelixThe Double Helix by James Dewey Watson. by James Dewey Watson.

The EagleThe Eagle

Questions to Consider For Watson Questions to Consider For Watson and Crick Paperand Crick Paper

1.1. What was one of the reasons Watson and Crick did not expect the What was one of the reasons Watson and Crick did not expect the phosphate groups in DNA to be aligned along the axis of the DNA phosphate groups in DNA to be aligned along the axis of the DNA molecule?molecule?

2.2. What is the means by which the individual strands in DNA are joined What is the means by which the individual strands in DNA are joined together?together?

3.3. What is the consequence of knowing the base sequence of one strand? What is the consequence of knowing the base sequence of one strand? What is the implication for copying the genetic material?What is the implication for copying the genetic material?

DNA Is Normally DNA Is Normally Double-StrandedDouble-Stranded

Each strand has polarity (5’ Each strand has polarity (5’ and 3’ ends).and 3’ ends).

In double-stranded DNA In double-stranded DNA each strand is oriented each strand is oriented “anti-parallel” to the other “anti-parallel” to the other strand.strand.

The strands are normally The strands are normally held together by hydrogen held together by hydrogen bonds.bonds.

The optimal hydrogen The optimal hydrogen bonding is when A bonds bonding is when A bonds with T and G bonds with C.with T and G bonds with C.

Base Pairing in DNABase Pairing in DNA

G/C pairs have G/C pairs have three hydrogen three hydrogen bondsbonds

A/T pairs have A/T pairs have two hydrogen two hydrogen bondsbonds

Double HelixDouble Helix

Nucleic Acid Gel ElectrophoresisNucleic Acid Gel Electrophoresis

The Sequence of Nucleotides The Sequence of Nucleotides Encodes InformationEncodes Information

_

+

The Double Helix The Double Helix Structure of Structure of Complementary Complementary Strands Explains Strands Explains The Mechanism The Mechanism of DNA of DNA ReplicationReplication

ATP Is a Nucleotide

ATP Structure and HydrolysisATP Structure and Hydrolysis

Summary of Adenine PhosphatesSummary of Adenine Phosphates1. ATP (adenosine triphosphate) = 3 phosphate groups +

adenine + ribose sugar

a. This is the high energy form

b. The energy is greatest in the bond holding the third phosphate - that bond is easily broken.

2. ADP (adenosine diphosphate) = 2 phosphate groups +

adenine + ribose sugar

a. This is the low energy form

b. ADP can be recharged into ATP by addition of phosphate, if a phosphate source and enough energy are available.

3. AMP (adenosine monophosphate) = 1 phosphate group +

adenine + ribose sugar

a. Intracellular activator of processes

Additional ResourcesAdditional Resources

http://www.nature.com/nature/dna50/ - Anniversary issue of NatureNature celebrating the 50celebrating the 50thth year following the original DNA structure year following the original DNA structure articles. Interesting links. Article about Rosalind Franklin.articles. Interesting links. Article about Rosalind Franklin.

http://www.genome.gov/10001772 - Federal Human Genome Project website.

http://www.time.com/time/time100/scientist/profile/watsoncrick.html - short recount of Watson and Crick at Cambridge.

http://www.dnai.org/index.htm - Home page for DNA Interactive. DNA Interactive. Time Time lines and interesting historical information. Photos at: lines and interesting historical information. Photos at: http://www.dnai.org/album/6/album.html.