A Role of the Epithelial Sodium Channel in Human SaltTaste Transduction?

Frauke Stähler & Katja Riedel & Stefanie Demgensky &

Katrin Neumann & Andreas Dunkel &Alexander Täubert & Barbara Raab & Maik Behrens &

Jan-Dirk Raguse & Thomas Hofmann &

Wolfgang Meyerhof

Received: 14 December 2007 /Accepted: 22 January 2008 /Published online: 20 February 2008# 2008 Springer Science + Business Media, LLC

Abstract Mammals perceive the five different taste qual-ities: bitter, sweet, umami, sour, and salty. At least twodifferent mechanisms contribute to salt taste in rodents. Oneis elicited by various cations and sensitive to cetylpyridi-nium chloride, whereas another is selectively stimulated byNa+ and inhibited by amiloride. The latter pathway hasbeen suggested to involve the epithelial sodium channel,ENaC. In humans, the presence of amiloride-sensitive salttaste transduction is being disputed. In this paper, weaddressed the question whether ENaC may have a role inhuman salt taste perception. Immunohistochemistryrevealed that β-, γ-, and δ-ENaC subunits are present insubsets of circumvallate and fungiform taste bud cells,whereas α-ENaC was confined to cells of circumvallate

taste buds. Alpha-, β-, and γ-subunits were observed inbasolateral intracellular compartments, while δ-ENaC wasexclusively found in all taste pores of both types of papillaeconsistent with a function in taste transduction. To furtherassess the involvement of ENaC in salt taste transduction,we combined sensory studies and functional expression ofENaC in oocytes. With the exception of L-homoarginine,choline chloride, L-arginine, L-lysine, and L-argininyl-L-arginine enhanced both salt taste perception in subjects andsodium currents recorded in αβγ- or δβγ-ENaC express-ing oocytes, whereas L-glutamine did neither show salt-taste-enhancing activity nor did it influence the sodiumcurrents in the oocyte assay. Taken together, our data makeENaC an interesting molecule possibly involved in saltytaste transduction.

Keywords ENaC . Heterologous Expression .

Immunohistochemistry . In Situ Hybridization . Salt Taste .

Tongue

Introduction

Sodium is an essential mineral for vertebrates and plays animportant role in the homeostatic regulation of waterbalance, pH, osmotic pressure, and nerve conductance(Denton 1982). For the regulation of sodium levels, saltytaste serves as a detector for sodium-containing (largely asNaCl) food sources (McCaughey and Scott 1998). Tasteinitiates at the level of taste receptor cells, specializedepithelial cells which are assembled into taste buds. On thetongue, these are organized in taste papillae. Salty tasteappears to be mediated by ion channels that constitutesalty taste “receptors” (Gilbertson and Kinnamon 1996;

Chem. Percept. (2008) 1:78–90DOI 10.1007/s12078-008-9006-4

Electronic supplementary material The online version of this article(doi:10.1007/s12078-008-9006-4) contains supplementary material,which is available to authorized users.

F. Stähler :K. Riedel : S. Demgensky :K. Neumann : B. Raab :M. Behrens :W. Meyerhof (*)Department of Molecular Genetics,German Institute of Human Nutrition Potsdam-Rehbruecke,Arthur-Scheunert-Allee 114-116,14558 Nuthetal, Germanye-mail: meyerhof@dife.de

A. Dunkel :A. Täubert : T. HofmannChair of Food Chemistry und Molecular Sensory Science,Technical University of Munich,Lise-Meitner-Str. 34,85354 Freising, Germany

J.-D. RaguseClinic and Polyclinic for Oraland Maxillofacial Surgery and Plastic Surgery,Charité University for Medical Science of Berlin,Campus Virchow Hospital, Augustenburger Platz 1,13353 Berlin, Germany

Lindemann 1996; Boughter and Gilbertson 1999). Whole-cell patch clamp analysis of taste bud cells of fungiformpapillae of the anterior tongue showed that amiloride-sensitive inward currents were generated by raising theextracellular NaCl or LiCl concentration (DeSimone et al.1984; Doolin and Gilbertson 1996). Such currents were notproduced by other salts (Heck et al. 1984; Miyamoto et al.2001). These findings have been confirmed by nerverecordings. Sodium chloride induced activities of thechorda tympani nerve that innervates the fungiform papillaewere sensitive to amiloride (Brand et al. 1985; Sollars andBernstein 1994). In marked contrast, excitement of circum-vallate taste bud cells or the glossopharyngeal nerveinnervating the foliate and circumvallate papillae elicitedby application of NaCl and various other salts to the tonguewas not suppressed by amiloride (Doolin and Gilbertson1996; Gilbertson and Fontenot 1998; Formaker and Hill1991; Kitada et al. 1998; Ninomiya 1998). From the ionselectivity and amiloride sensitivity of the currents, it wasconcluded that the epithelial sodium channel ENaCmediates the Li+- and Na+-specific salty taste, whereas theamiloride-insensitive taste of Na+ and other ion salts is dueto different transduction pathways involving cetylpyridi-nium-chloride-sensitive ion channels (DeSimone et al.2001). The possible role of ENaC in salty taste transductionwas subsequently supported by detection of the ENaC α-,β-, and γ-subunits in rodent taste receptor cells of all threetypes of papillae through in situ hybridization or immuno-histochemistry (Kretz et al. 1999; Lin et al. 1999;Shigemura et al. 2005). Thus, the data suggest that inrodents, the NaCl-specific salty taste could be mediated byENaC.

Little is known in humans about salty taste transduction(Halpern 1998; McCaughey and Scott 1998). Severalstudies showed an suppressive effect of amiloride on salttaste perception (Schiffman et al. 1983; Avenet andLindemann 1988; Tennissen 1992; Smith and Ossebaard1995). But there are also numerous reports which arecontradictory, demonstrating NaCl as the purest salty tastantwithout any suppression of salty taste evoked by stimula-tion of the anterior human tongue with NaCl (Halpern andDarlington 1998). Furthermore, amiloride influenced thesourness of NaCl and LiCl solutions and declined thebitterness of KCl and quinine-HCl solutions. The situationin humans may also be more complicated than in mice, ashumans have a fourth ENaC gene encoding δ-ENaC(Waldmann et al. 1995) which has not been identified inrodents (Hubbard et al. 2007). In the present study, weinvestigated whether or not ENaC could have a function inhuman salt taste perception. To this end, we combinedexpression analysis by in situ hybridization and immuno-histochemistry with sensory studies and functional expres-sion of ENaC in Xenopus oocytes.

Material and Methods

Tissue Origin

Taste tissue biopsies were taken from subjects with theirgiven consent. The procedure was approved by the localethical committee. Specimens were stored in liquid nitrogenuntil further processing.

RT-PCR and qRT-PCR

Human total cellular RNA was either commercially pur-chased (Clontech-Takara Bio Europe, Saint-Germain-en-Laye, France) or isolated from surgical tongue biopsies withTRIZOL reagent (Invitrogen, Karlsruhe, Germany) accord-ing to the manufacturer’s protocol and followed by digestionwith DNase I (Invitrogen). Complimentary DNA (cDNA)was synthesized with 3 μg/μl random hexamer primers(Invitrogen) and 200 U Superscript II RNase H− (Invitrogen).The following gene-specific primers were used: TAS2R16,forward primer, cctgggattttttatatccttacttctggt; reverse primer,gaagcgcgctttcatgctt; α-ENaC, forward primer, tcagcatgaggaaggaaacc; reverse primer, atgttgactttggccact; β-ENaC, for-ward primer, acaccaactttggcttccag; reverse primer, ttcaggaccaggatcaggac; γ-ENaC, forward primer, ctctacctcctgcagccaac;reverse primer, actcgtcttctctttctacac; δ-ENaC, forward primer,taatacgactcactataggggaaccgcctcaagacgac; reverse primer, cctttgctgaggttgacgttg. For quantitative reverse transcriptase poly-merase chain reaction (RT-PCR), we established the follow-ing gene-specific TaqMan amplicon sets: α-ENaC, forwardprimer, ctggaggaggacacgctgg; reverse primer, catacatcgggtggtggaagtg; TaqMan probe, aacttcatcttcgcctgccgcttcaac; β-ENaC, forward primer, caagaagaaagccatgtggttcc; reverseprimer, agctgaagtaggtcctgatgaag; TaqMan probe, tcaccctgctcttcgccgccct; γ-ENaC, forward primer, gagccttggaccctttggac;reverse primer, atcttctctccgggtgccatg; TaqMan probe, cgcccgtcctcagagtcccgtcct; δ-ENaC, forward primer, tctttgagcgtcactggcac; reverse primer, cctttgctgaggttgacgttg; TaqManprobe, tcaatgttctccctggcaaactcgtcca. Conventional PCR withmanual hot start was performed using 50 ng cDNA in a totalvolume of 25 μl containing 0.2–0.5 μM of each primer, 1×PCR buffer, 1.5 mM MgCl2, 200 μM deoxyribonucleotidetriphosphate (dNTPs) each, and 1.2 U Taq DNA-polymerase(Eppendorf, Hamburg, Germany). Amplification parameterswere: 5 min at 95 °C, followed by 40 cycles of 60 s at 94 °C,60 s at 60–66 °C, and 60 s at 72 °C and a 10-min extensionperiod at 72 °C. For quantification analyses, the humanhousekeeping gene GAPDH served as internal control.GAPDH primers were designed and synthesized by AppliedBiosystems “TaqMan Gene Expression Assay” customerservice. Quantitative real-time PCR (qRT-PCR) analysis wasperformed on a TaqMan ABI Prism 7300 Real Time PCRSystem (Applied Biosystems, Darmstadt, Germany). For all

Chem. Percept. (2008) 1:78–90 7979

qRT-PCR analyses, both forward and reverse primers wereused at concentrations of 0.72 μM, while the concentration ofthe probe was 0.2 μM. For the PCR reaction, 6.25 ng ofcDNA template was incubated with TaqMan UniversalMaster Mix containing dNTPs with dUTP and AmpliTaqGold DNA polymerase (P/N 4324018 Applied Biosystems)in a final volume of 25 μl. Cycling parameters were asfollows: 50 °C for 2 min for probe and primer activation,95 °C for 10 min of DNA strand denaturation, followed by40 cycles of 15 s at 95 °C, 60 s at 60 °C. Each cDNA sample(+RT) and, for control, RNA preparation not incubated withreverse transcriptase (−RT), was tested in triplicate, and meanCt values were reported. For each experiment, a “notemplate” sample was included as negative control. Raw datawere acquired and processed with the Applied Biosystems7300 System software (Applied Biosystems) and furtheranalyzed with Microsoft (Seattle, WA) Excel.

In Situ Hybridization

In situ hybridization of 10-μm cross-sections of humancircumvallate papillae was mainly performed as describedpreviously (Kuhn et al. 2004). Digoxigenin-labeled senseand antisense riboprobes for the different ENaC subunitswere generated from linearized pUC-vector containingcoding sequences of α- (800-bp fragment) or β-ENaC(fragments of 580, 570, 490, 300 bp). In the case of γ-(fragments of 553, 400, 231 bp) and δ-ENaC (fragments of519, 497, 507 bp), PCR fragments were used as templatesfor in vitro transcription of digoxigenin-labeled riboprobes.PCR fragments were generated with oligonucleotide pri-mers extended by sequences encoding the T3 or T7 phageRNA polymerase promoters. For α-ENaC, one riboprobewas used, while for the β-, γ- and δ-subunits, mixtures offour and three riboprobes were used, respectively. Probeswere used for hybridization at final concentrations of 75 ng/ml(α-ENaC), 200 ng/ml (β-ENaC), 500 ng/ml (γ-ENaC), and800 ng/ml (δ-ENaC). Photomicrographs were taken with aCCD camera (RT slider; Diagnostic Instruments, SterlingHeights, MI) mounted to a Zeiss (Oberkochen, Germany)Axioplan microscope.

Immunohistochemistry

Immunohistochemistry of 2-μm paraffin sections fromhuman circumvallate papillae was mainly performed asdescribed previously (Hager et al. 2001). Polyclonal anti-bodies (Calbiochem Temecula, USA; Chemicon,Schwalbach Germany) were used for immunohistochemicaldetection of α- (Calbiochem 627–643), β- (ChemiconAB3532P), γ- (Chemicon AB3534P), and δ-ENaC (Chem-icon AB3536P). Incubations of the sections with theprimary anti-ENaC antisera (1:100–200) were performed

overnight at 4 °C followed by incubation with thebiotinylated anti-rabbit secondary antiserum (1:400; VectorLaboratories, Burlingame, CA). This procedure was fol-lowed by incubating the sections with avidin peroxidase(ABC Standard Elite Kit; Vector Laboratories) and thechromogenic substrate 3′,3-diaminobenzidine (Sigma, Dei-senhofen, Germany). In control experiments, specimenswere incubated without primary antibody or with primaryantibody after pre-absorption with the appropriate blockingpeptide. In addition, immunostaining for δ-ENaC (1:1,000)was amplified using tyramide following instructions pro-vided by the manufacturer (Perkin Elmer, Waltham,Massachusetts, USA, NEL700). For this protocol, biotiny-lated goat anti-rabbit antibodies (1:400, Vector Laborato-ries) were incubated 1 h at room temperature. After rinsingthe slides in 1× Tris buffered saline, streptavidin-conjugatedhorseradish-peroxidase (1:100) was added for 30 min.Subsequent to wash steps, the tyramide working solutionwas applied (1:100, 5 min), and δ-ENaC was detected byavidin-conjugated fluorescein (1:200, 1 h). The nuclei werecounterstained with the fluorescence dye 4′,6-diamidino-2-phenylindole (DAPI; Vector Laboratories). Photomicro-graphs were taken with a CCD camera (RT slider;Diagnostic Instruments) mounted to a Zeiss (Oberkochen,Germany) Axioplan microscope.

Human Sensory Studies

Twelve assessors (seven male, five female, 22–38 yearsold), who gave the informed consent to participate in thesensory tests of the present investigation and had no historyof known taste disorders, were trained to evaluate thesaltiness of aqueous NaCl solutions. The panelists had tocompare test solutions including NaCl and a test compoundto control solutions containing NaCl in increasing concen-trations (30–120 mM) and to identify isointense concen-trations as described earlier (Rotzoll et al. 2006). Sensoryanalyses were performed in a sensory panel room at 22 °Cin three different sessions using bottled water (Evian, lowmineralization, 500 mg/l) as the solvent matrix. Toinvestigate the salt-taste-modulating activity of L-glutamine(Fluka, Taufkirchen, Germany), L-lysine (Fluka), L-arginine(Fluka), L-homoarginine (Bachem, Weil am Rhein, Ger-many), L-argininyl-L-arginine (Bachem), and choline chlo-ride (Fluka), the sensory panel evaluated the saltiness ofaqueous binary solutions (pH 6.5) containing one of thesetest compounds (10 or 40 mM) and NaCl (30 or 60 mM)and compared them to control solutions containing onlyNaCl in increasing concentrations from 30 to 120 mM. TheNaCl solution showing equal taste intensity as the binarymixture containing the test compound was determined to bethe isointense concentration.

80 Chem. Percept. (2008) 1:78–90

Functional Expression Analyses in Xenopus laevis Oocytes

The human α-, β-, and γ-ENaC subunits were cloned in theplasmid pBK-CMV (Stratagene; La Jolla, CA), and the δ-ENaC subunit was cloned in the oocyte expression plasmidpGEMHE5 (Liman et al. 1992). The full-length α-, β-, andγ-ENaC complimentary RNAs (cRNAs) were synthesizedusing NotI-linearized plasmid-DNAs and the T3 polymer-ase Message Machine (Ambion, Austin, TX) and Poly(A)Tailing kit (Ambion). The δ-ENaC cRNA was synthesizedfrom NheI-linearized plasmid-DNA using the T7 MessageMachine (Ambion) and Poly(A)Tailing kit (Ambion).Quality of cRNA was evaluated by denaturating agarose-gel electrophoresis, and yield was estimated by comparingthe intensities of fluorescence of cRNA bands with those ofsize standard RNAs on ethidiumbromide-stained gels. TheRNAs were stored in aliquots at −80 °C. cRNAs for α-, β-,γ-ENaC or δ-, β-, γ-ENaC were injected into follicle-freeXenopus oocytes (stages V–VI), which were maintained insterile NMDG-KulORI solution (in mM: 10 NaCl, 1 KCl,80 NMDG, 2 CaCl2, 5 HEPES, 2.5 Na-pyruvate, adjustedto pH 7.5 with HCl) supplemented with 10 U/ml penicillinand 10 μg/ml streptomycin at 16 °C for 1–3 days untilelectrophysiological recordings were performed. Whole-cell current recordings were carried out using a conven-tional two-electrode voltage-clamp circuit (OpusXpress,Molecular Devices, Munich, Germany). Voltage recordingand current injection electrodes had dc resistance of 0.5 to2 MΩ. Oocytes were placed in a 200-μl experimentalchamber and continuously superfused with NaCl-NMDG-ORI solution (in mM: 30 NaCl, 60 NMDG, 1 KCl, 2CaCl2, 5 HEPES, pH 6.5). Membrane potential wasvoltage-clamped to −40 mV. Test substances were dissolvedin 0.5 ml NaCl-NMDG-ORI solution and applied within atime period of 1 min.

Results

RT-PCR Analysis of ENaC Subunit mRNAs in Tasteand Non-Chemosensory Lingual Tissues

If ENaC plays a role in taste transduction, it should bepresent in taste buds. Therefore, we examined theexpression of the ENaC subunits in taste tissue and non-chemosensory epithelium of the tongue. To this end, wefirst excluded the possibility that the non-chemosensorytissue was contaminated with taste tissue during surgery.Previous studies showed that circumvallate and fungi-form papillae express bitter taste receptors, whereas theirmessenger RNAs (mRNAs) were not found in non-chemosensory lingual epithelium (Bufe et al. 2002; Kuhn

et al. 2004; Behrens et al. 2007; Rossier et al. 2004).Therefore, we amplified cDNA fragments with primersspecific for the bitter taste receptor TAS2R16. Weobtained amplicons of the predicted size with cDNA fromfungiform and circumvallate tissues, while cDNA fromnon-chemosensory lingual tissue did not give rise to anyamplification products (Fig. 1). In accordance with thehigher expression levels of bitter taste receptors in circum-vallate papillae compared to fungiform papillae (Adler et al.2000), we obtained a stronger band with circumvallate thanwith fungiform tissue. From this experiment, we concludethat the non-chemosensory epithelium preparation has notbeen contaminated with taste tissue and is suited forappropriate control experiments.

Next, we assessed the presence of mRNAs for the α-,β-, γ-, and δ-ENaC subunits in human taste tissue by RT-PCR analysis with gene-specific primers. Figure 2 showsthat fragments corresponding to all four mRNA specieshave been amplified using circumvallate and fungiformtissues as well as non-chemosensory lingual epithelium.The comparatively weak bands that we obtained for δ-ENaCsuggest that the steady-state levels for this mRNA are muchlower than those for the other subunits. This assumptionapplies especially to δ-ENaC mRNA in circumvallatepapillae for which we could amplify fragments only by twosubsequent rounds of PCR amplification.

Quantitative Analysis of Levels of mRNAs for ENaCSubunits

To compare the expression levels of the four ENaC mRNAsin taste tissues and non-chemosensory lingual epithelium,we performed quantitative PCRs with GAPDH as internalcontrol. Figure 3a reveals that all ENaC subunits areexpressed at higher levels in the non-chemosensory tissuethan in fungiform or circumvallate papillae. The order ofrelative mRNA abundance is α ≈ β > γ >> δ subunit in thethree tissues examined. Delta-ENaC mRNA appears to beexpressed at levels less than 1% of those of the other ENaC

Fig. 1 Non-chemosensory lingual epithelium is devoid of TAS2R16bitter taste receptor mRNA. PCR amplification was performed withprimers specific for TAS2R16 sequences (Bufe et al. 2002) on RNAisolated from human circumvallate (cv), fungiform (fgf) papillae, andnon-chemosensory tissue (ncst) previously transcribed (+) or not (−)by reverse transcriptase. The predicted size of the amplified TAS2R16fragment is 449 bp. The negative control (−DNA) contains all reagentsof the RT-PCR except template DNA

Chem. Percept. (2008) 1:78–90 8181

subunits (Fig. 3b). This observation explains the necessityof two subsequent amplifications for δ-ENaC cDNA in theconventional RT-PCR experiment. We also observedvariations in the expression levels among subjects. This

was particularly evident for β- and γ- subunit mRNA infungiform papillae (Fig. 3b).

In Situ Hybridization of mRNAs for ENaC Subunitsin Lingual Epithelium

The above results revealed that ENaC mRNAs are moreabundant in non-chemosensory epithelium than in tissuesfrom taste papillae, raising the possibility that ENaCmRNAs might be absent from taste receptor cells. Todetermine the cell types that express ENaC subunits, weperformed in situ hybridization experiments with probes forall four ENaC mRNAs using sections of circumvallate andfungiform papillae or of non-chemosensory lingual epithe-lium (Fig. 4, Table 1). For this purpose, we used 24fungiform papillae of seven donors and six circumvallatepapillae from six donors. We examined 60 sections fromcircumvallate and 50 sections from fungiform papillae persubunit. We found that the antisense, but not sense, probefor α-ENaC mRNA labeled weakly few taste bud cells in56% of the circumvallate papillae examined (Fig. 4, arrow-heads), whereas cells were not stained in taste buds offungiform papillae. With the probes for the β-, γ-, or δ-subunit mRNAs, we could not reliably label taste cells inboth papilla types. However, we detected expression of allENaC mRNAs in keratinocytes surrounding the tastepapillae (Fig. 4, arrows). Thus, we conclude that thesensitivity of our in situ hybridization experiments wassufficient to identify cellular ENaC mRNA levels, butapparently these are below the detection level in taste budcells. The presence of ENaC mRNAs in the keratinocytesalso explains that our RT-PCR analyses of taste tissues werepositive, although with the exception of the mRNA for the

Fig. 2 Expression analyses of mRNAs for ENaC subunits in humantaste and non-chemosensory tissue. PCR amplification was performedwith gene-specific primers on RNA isolated from human circumvallate(cv), fungiform (fgf) papillae, and non-chemosensory tissue (ncst)previously transcribed (+) or not (−) by reverse transcriptase. Thepredicted sizes of the PCR products of α-, β-, γ-, and δ-ENaC are 448,440, 431, and 269 bp, respectively. Subsequent reamplification (reamp)of δ-ENaC cDNA from circumvallate papillae was necessary to obtain avisible band. We used lung cDNA as positive control for α-, β-, and γ-ENaC mRNAs and brain cDNA for δ-ENaC. The negative control(−DNA) contains all reagents of the RT-PCR except template DNA

Fig. 3 Quantitative expression-analyses of ENaC mRNAs. Expres-sion levels of ENaC mRNAs in human circumvallate (cv) andfungiform (fgf) papillae compared with that of non-chemosensorytissue (ncst). Specific primer pairs and corresponding TaqMan probeswere designed based on the published human sequences (McDonald etal. 1994; Waldmann et al. 1995; McDonald et al. 1995). The amountof each ENaC cDNA was standardized to the housekeeping geneGAPDH and expressed either as 2−ΔΔCt (y-axis, a) or as 2−ΔCt (y-axis,

b). Black columns give the results for human circumvallate papillae,white columns for fungiform papillae, and gray columns for non-chemosensory tissue. Error bars indicate standard deviation of at leasttwo independent experiments with each performed in triplicates. Theexpression levels of ENaC mRNAs normalized to non-chemosensorytissue averaged for all subjects analyzed are shown in a. The data foreach individual (indicated by numbers) are depicted in b

82 Chem. Percept. (2008) 1:78–90

α-subunit in circumvallate taste cells, ENaC mRNAs werenot detected in taste bud cells.

Immunohistochemical Localization of ENaC Subunitsin Lingual Epithelium

To further examine the presence of the various ENaCsubunits in taste tissue, we performed indirect immunohis-tochemistry using seven fungiform papillae and fivecircumvallate papillae from five subjects, respectively.Seventy-five sections from circumvallate papillae and 90from fungiform papillae were analyzed per subunit. Incircumvallate papillae, specific antisera detected α-, β-, andγ-ENaC-like immunoreactivity in small subsets of tastecells in 17%, 9%, and 90% of the analyzed taste buds,respectively, whereas the anti-δ-ENaC antiserum labeled allvisible taste pores (Fig. 5a,b, arrowheads; Table 1). Theresults also revealed that the antisera directed against α- or

γ-ENaC stained more cells per taste bud than that directedagainst the β-subunit (Fig. 5). In addition, immunoreactivityfor all ENaC subunits was detected in epithelial cells outsideof the taste buds in the circumvallate papillae (Fig. 5,arrows). In fungiform papillae, the anti-α-ENaC antiserumdid not reliably label any cells. In contrast, the anti-γ- oranti-β-ENaC-antisera stained cells in 81% and 75% of thefungiform taste buds, respectively, (Fig. 5a, arrowheads;Table 1). Also, in fungiform papillae, the δ-ENaC antiserumspecifically stained all visible taste pores (arrowhead),although less intense than circumvallate pores. The anti-β-,γ-, and δ-ENaC-antisera stained keratinocytes of theepithelium surrounding the fungiform taste buds (Fig. 5a,arrows; Table 1). Control experiments using blockingpeptides (Fig. 5a, rows 2 and 4), or in which the primaryantibodies have been omitted (Electronic supplementarymaterial, Fig. S1), showed either strongly reduced or nolabeling, thereby proving the specificity of the immunohis-tochemical staining.

Fig. 4 Localization of ENaC mRNAs in circumvallate and fungiformpapillae. In situ hybridization experiments with digoxigenin-labeledα-, β-, γ-, and δ-ENaC antisense (as) or, for control, sense (s) RNAprobes were carried out with 10-μm cryo-sections of humancircumvallate (cv) and fungiform papillae. Dotted lines mark taste

buds. Arrows point to selected labeled cells outside of the taste buds.Arrowheads mark stained taste receptor cells within taste budsexpressing ENaC subunits. The inset in the panel showing the datafor δ-ENaC in fungiform papillae demonstrates a stained cell of thenon-chemosensory tissue. Scale bar represents 20 μm

Chem. Percept. (2008) 1:78–90 8383

Several Compounds Enhance Salt Taste Perceptionin Human Sensory Tests

To address the function of ENaC subunits in salt tasteperception, sensory studies in subjects versus functional

expression analysis in oocytes previously microinjectedwith cRNA for the ENaC subunits were performed. IfENaC plays a role in salt taste transduction, modulators ofsalt taste perception identified in human sensory studiesshould also change the ENaC-mediated sodium membrane

Fig. 5 Localization of ENaC subunits in circumvallate and fungiformpapillae. a Indirect immunohistochemistry for α-, β-, γ-, or δ-ENaCpolypeptides was performed with subunit-specific primary andperoxidase-conjugated secondary antibodies using 2-μm sections ofparaffin-embedded human circumvallate and fungiform papillae.Control experiments with peptide-preabsorbed antibodies showedeither significantly reduced labeling or no labeling at all. Dotted linesmark taste buds within taste papillae. Arrows indicate labeled cellsoutside the taste buds. Arrowheads indicate stained taste receptor cells

within taste buds expressing ENaC subunits. The inset in the upperright corner of the panel showing localization of δ-ENaC incircumvallate papillae depicts a stained keratinocyte of the non-chemosensory tissue. The inset on the lower left corner presents ataste pore stained for δ-ENaC immunoreactivity at higher magnifica-tion. b Fluorescence micrograph showing δ-ENaC (green, followingtyramide amplification) in a taste pore taken from a 2-μm paraffinsection of human circumvallate papillae. Cell nuclei are stained withDAPI (blue). Scale bar represents 20 μm

84 Chem. Percept. (2008) 1:78–90

currents in microinjected oocytes. On the basis of the salt-taste-modulating activity reported for L-arginine (Ogawaet al. 2004), we tested L-arginine (R), its dipeptideL-argininyl-L-arginine (RR), the arginine homologue L-homoarginine (hR), the basic amino acid L-lysine (K), aswell as L-glutamine (Q) for possible salt-taste-modulatingactivities. To obtain semi-quantitative data on the salt-taste-enhancing activity of these test compounds, isointensityexperiments were performed with reference solutions

containing increasing concentrations of sodium chloride.An aqueous binary solution of 30 mM NaCl and 10 mM L-arginine showed isointensity for saltiness with an aqueous42 mM NaCl solution (Fig. 6a). L-Argininyl-L-arginine andL-lysine were somewhat less active showing isointensitywith 33 or 34 mM NaCl, respectively, when assayed underthe same conditions (Fig. 6a). Addition of the compoundsat a concentration of 40 mM led to a further moderateincrease in saltiness of the test solution (Fig. 6a). It is

Table 1 Positive taste buds/total taste buds per section

ISH (RNA) IHC (protein)

cv Fungiform cv Fungiform

α 47/84 (56%) 0/39 (0%) 12/69 (17%) 0/25 (%)β 0/90 (0) 0/37 (0%) 7/80 (9%) 6/8 (75%)γ 0/109 (0%) 0/51 (0%) 87/90 (97%) 9/11 (81%)δ 0/154 (0%) 0/25 (0%) 28/112 (25%) 28/28 (100%)a 4/27 (14%) 4/4 (100%)a

a All visible taste pores were stained with the δ-ENaC antibody

Fig. 6 Salt-taste-enhancing effects of test compounds in aqueousNaCl solutions. Ten millimolars (white columns) or 40 mM (blackcolumns) L-glutamine (Q), L-lysine (K), L-arginine (R), L-argininyl-L-arginine (RR), L-homoarginine (hR), and choline chloride (C) wereadded to 30 (a) and 60 mM (b) NaCl, pH 6.5 solutions (graycolumns), respectively, and trained panelists compared these solutionswith various NaCl reference solutions to determine isointensities ofsaltiness. Binary mixtures of L-arginine (10 or 40 mM) and choline

chloride (10 mM; black columns) were added to 30 (c) and 60 mM (d)NaCl solutions (gray columns), respectively, and trained panelistscompared these solutions with various NaCl reference solutions todetermine isointensities of saltiness. The NaCl solution showing equaltaste intensity to the binary mixture containing the test compound wasdetermined to be the isointense concentration [y-axis (in mM)]. Errorbars indicate standard deviations of two independent sensory tests

Chem. Percept. (2008) 1:78–90 8585

interesting to notice that L-homoarginine, differing from L-arginine only by an additional methylene group in the alkylside chain, did not exhibit any salt taste enhancing activityeven at 40 mM (Fig. 6a). Also, L-glutamine was ineffectivein human salt taste modulation (Fig. 6a). As cholinechloride was shown to enhance the salt intake of dilutedsalt solutions of salt-deprived rats and to enhance thesaltiness of foods in human taste trials (Locke and Fielding1994), this quaternary amine was included in the humansensory studies. The addition of 10 mM choline chloride toa 30 mM NaCl solution enhanced the saltiness of the testsolution corresponding to that of a NaCl solution of 36 mM(Fig. 6a). Raising the choline chloride concentration tolevels above 15 mM caused an intensely bitter off-taste andwas, therefore, not further investigated.

As 30 mM NaCl solution induce rather weak salt tastesensations, additional taste enhancement experiments wereperformed with 60 mM NaCl solutions. The addition of L-arginine, L-lysine, L-arginyl-L-arginine, or choline chlorideto a 60 mM NaCl solution concentration-dependentlyevoked the impression of tasting NaCl solutions of higherconcentrations in the subjects (Fig. 6b). Again, neither L-homoarginine nor L-glutamine showed any effect on humansalt taste perception.

To investigate the cooperative interplay of the mostactive salt taste modifiers, L-arginine (10 or 40 mM) andcholine chloride (10 mM) were added to a 30 or a 60 mMNaCl solution. The addition of 10 mM choline chloride tosolutions containing NaCl and L-arginine showed only acomparatively small further increase in saltiness (Fig. 6c,d).This effect was somewhat more pronounced in subjects whotested the 60 mM NaCl solutions.

Functional Expression Studies of αβγ- and δβγ-ENaCin Xenopus laevis Oocytes

Functional expression studies in Xenopus oocytes wereperformed to examine whether those compounds thatenhanced the saltiness of NaCl solutions in sensory studiesalso elevated sodium membrane currents mediated byENaC. The electrophysiological recordings of oocytespreviously microinjected with cRNA for αβγ-ENaC orδβγ-ENaC were done in the presence of 30 mM NaCl atpH 6.5, i.e., the same conditions used in the sensorystudies. First, the oocytes were exposed to a 60 mM NaClsolution, which led to an increase in membrane currents(Fig. 7). This increase was sensitive to amiloride (data notshown) and not seen in mock-injected oocytes, indicatingthat ENaC was functionally expressed in this system. Next,we administered the test compounds to the oocytes’ bath.Figure 7 shows that 10 or 40 mM L-arginine, L-lysine, L-homoarginine, or choline chloride concentration-dependentlyincreased the membrane currents mediated by αβγ-ENaC

or δβγ-ENaC. The same was observed for the dipeptide L-arginyl-L-arginine after application of either 0.1 or 1 mMconcentrated solution. Membrane currents returned to basallevels after the compounds were washed off. All responseswere sensitive to amiloride (data not shown). L-Glutamineat the same concentration was without any effect. Mock-injected oocytes showed no responses. Figure 8 shows themembrane current increase evoked by the test compoundsnormalized to the current increase induced by raising theNaCl concentration from 30 to 60 mM. Application of

Fig. 7 Typical membrane current traces of oocytes challenged withvarious test compounds. Two-electrode voltage clamp recordings wereperformed with oocytes expressing αβγ-ENaC or δβγ-ENaC or withmock-injected oocytes in a perfusion solution containing 30 mM NaCl.Exposure of oocytes to test compounds is indicated by horizontal barsabove the current traces recorded for αβγ-ENaC-expressing oocytes.The application scheme was the same for δβγ-ENaC-expressingoocytes and mock-injected oocytes. The concentration of the appliedcompounds are given in millimolars for choline chloride (C), lysine (K),arginine (R), glutamine (Q), homoarginine (hR), argininyl-arginine (RR),or for a mixture of choline chloride with arginine (C + R). Scale bars:horizontal 1 min, vertical, 0.5 μA

86 Chem. Percept. (2008) 1:78–90

40 mM L-arginine or L-lysine enhanced the ENaC currentapproximately by 23% and 37%, respectively. The increasewas similar in αβγ-ENaC- or δβγ-ENaC-expressingoocytes. L-Glutamine had no effect.

Discussion

In the present study, the possible involvement of theepithelial sodium channel in human salt taste perceptionwas investigated. RT-PCR expression analyses showed thatmRNAs of all four ENaC subunits were present in humanfungiform and circumvallate papillae as well as in non-chemosensory lingual tissue. These results confirm andextend previous studies performed in rodents (Kretz et al.1999; Lin et al. 1999; Shigemura et al. 2005). In theconventional RT-PCR analyses, two subsequent PCRamplifications of the δ-ENaC cDNA fragment werenecessary to obtain visible bands in the agarose-gel images,suggesting that mRNA levels for these subunits areextremely low. This conclusion is supported by the resultsfrom the quantitative RT-PCR experiments, indicating anapproximately 100-fold lower expression level of the δ-ENaC mRNA compared to the other ENaC mRNAs.

The quantitative PCR studies also showed that therelative expression levels for ENaC mRNAs were α ≈β > γ >> δ for both papillae and non-chemosensory lingualtissue. These findings coincide with previous results in rats,

showing differences in expression levels for α-, β-, and γ-ENaC mRNAs across papillae and subunits, with α-ENaCmRNA levels being higher than those of the other subunits(Kretz et al. 1999; Shigemura et al. 2005). For all ENaCsubunit mRNAs, the highest expression was observed fornon-chemosensory lingual tissue, with non-chemosensorylingual tissue > fungiform papillae > circumvallate papillae.The RT-PCR data are consistent with the data from in situhybridizations and immunohistochemical analyses demon-strating stronger staining of non-chemosensory cells. Thenon-chemosensory tissue was dissected from the tonguesurface and consisted largely of epithelial cells. In contrast,the biopsies of taste papillae contained, in addition toENaC-expressing epithelial cells, the lamina propria, atissue that, according to our in situ hybridization experi-ments, did not express ENaC subunits. Therefore, thehigher levels of ENaC subunit mRNAs in non-chemo-sensory lingual tissue could be due to a higher proportionof epithelial cells in this tissue preparation. Moreover,comparatively strong ENaC expression appears to beassociated with the highly differentiated superficial celllayers of the epidermis which are enriched in the non-chemosensory lingual tissue (Guitard et al. 2004; Brouardet al. 1999). This distribution of epidermis cells couldtherefore explain the lower expression levels of ENaCmRNAs in taste papillae compared to the control tissue.

In fungiform papillae, variations in the expression levelsof β- and γ-ENaC mRNAs were observed across subjects.In particular, it is noteworthy that one subject had twofoldelevated levels of γ-ENaC mRNA compared with the othertwo subjects analyzed. This result differs from observationsin rat fungiform papillae based on quantitative immunohis-tochemical analyses which did not reveal inter-individualdifferences in protein levels of the ENaC subunits (Lin etal. 1999). These differences between humans and rodents inENaC expression could be due to the different methodsused which measured RNA or protein levels. Alternatively,they could reflect differences across subjects or species.Furthermore, the differences in ENaC subunit expressionobserved across subjects may reflect differences in saltintake, as adaptation to NaCl abolished the taste of NaCl inhuman subjects (Smith and van der Klaauw 1995) andsodium deprivation shifted the sodium detection thresholdsto lower values in men and mice (Contreras and Catalanotto1980; Beauchamp et al. 1990).

By immunohistochemistry, we detected all ENaC sub-units in taste bud cells. Delta-ENaC immunoreactivitylocalized to the pore region of every taste bud analyzed,consistent with a role for this subunit in taste transduction.Taste pores are somehow “sticky”; meaning an unspecificantibody binding. However, for the staining of the δ-ENaCantiserum, this seems not to be the case, as the other ENaCantisera which were raised in the same species did not

Fig. 8 Membrane current changes of oocytes expressing ENaCinduced by different compounds. Membrane current traces of at leastthree oocytes of one to two different frogs were used to record underconditions specified in the legend to Fig. 7. Amplitudes of currentchanges of oocytes expressing αβγ-ENaC (white) or δβγ-ENaC(black) after administration of test compounds were normalized tocurrent changes induced by raising the NaCl concentration of thesuperfusion solution from 30 to 60 mM. The resulting amplitudes ofbuffer application were summarized for αβγ- and δβγ-ENaC-injectedoocytes (gray). Error bars indicate standard deviations. For abbrevia-tions, please refer to the legend of Fig. 7

Chem. Percept. (2008) 1:78–90 8787

show up any porous labeling (e.g., Fig. 5; γ-ENaC in cvpapillae). In addition, no labeling of the epithelial borderline has been observed using δ-ENaC antisera. Intriguingly,δ-ENaC immunoreactivity appears to form a ring-shapedstructure in the taste pores resembling the staining patternof the tight junction proteins claudin 4 and 8 in rodent tastebuds (Michlig et al. 2007). These claudins have beenreported to impede conductivity of cations through tightjunctions (Van Itallie et al. 2001; Yu et al. 2003; Li et al.2004). If δ-ENaC would localize to tight junctions of thetaste pores (which cannot be unambiguously judged fromthe resolution of our microscopic analyses), it opens aninteresting explanation of how Na+ enters taste cells. In thiscase, Na+ would enter the taste bud by a paracellular shuntinvolving δ-ENaC localized in tight junctions and accessthe taste cells via basolateral ion channels possiblyinvolving α-, β-, and γ-ENaC subunits. Under theseconditions, the accessibility of ENaC for amiloride couldbe reduced and explain the observed amiloride insensitivityof salt taste in human sensory studies (Halpern andDarlington 1998), as δβγ-ENaC is more than 50-fold lesssensitive against the diuretic amiloride than αβγ-EnaC (Jiet al. 2004; Ji et al. 2006). Alternatively, if δ-ENaClocalizes to the apical membrane of taste cells, Na+ wouldenter taste cells directly through ion channels containingthis subunit.

Immunoreactivity for the other subunits was found to beassociated with the basolateral parts of taste bud cells andappeared to label intracellular membrane compartments, anobservation that has also been made in rodents (Kretz et al.1999; Lin et al. 1999; Shigemura et al. 2005). In rats,experimentally increased plasma aldosterone levels led totranslocation of β- and γ-ENaC to the pore region ofcircumvalate and foliate taste buds (Lin et al. 1999). Itremains to be seen whether ENaC subunit localizationchanges also in various physiological situation of humansubjects.

We also found that the number of taste buds and cellswithin taste buds that are labeled with the various anti-bodies varied. It is worth noting that no taste buds werelabeled with the anti-α-ENaC antiserum in fungiformpapillae. Anti-β-ENaC antiserum labeled much fewer budsin the circumvallate papillae than in fungiform papillae,while the anti-γ-ENaC antiserum labeled comparableproportions of taste buds in both types of papillae. Theseobservations raise questions about the subunit compositionof ENaC in taste tissue. In vitro, functional channels areformed by α-subunits alone, although with little activity.Channel activity can largely be enhanced through co-expression in the same cell of α- and γ-subunits or of α-,β-, and γ-subunits, which likely leads to a stoichiometry ofα2, β, γ. As seen for α-ENaC, functional expression invitro of the δ-subunit is increased when it is co-expressed

with β- and γ-ENaC (Waldmann et al. 1995). Subunitcomposition may also affect the sensitivity towards ami-loride (Ji et al. 2006) and contribute to the debate ofamiloride sensitivity of salty taste in humans (Tennissen1992; Ossebaard and Smith 1995; Smith and van derKlaauw 1995; Tennissen and McCutcheon 1996; Anandand Zuniga 1997; Halpern and Darlington 1998; Feldmanet al. 2003).

It also has to be noted that we found immunoreactivityfor all ENaC subunits in the taste tissues with the exceptionof α-ENaC in fungiform papillae. However, we did not seeENaC mRNAs with the exception of α-ENaC mRNA incircumvallate taste cells. This discrepancy is particularlyintriguing for γ- and δ-subunits which showed compara-tively the lowest mRNA levels as determined by quantita-tive PCR but the best signals in immunohistochemistry.From these results, we conclude that under steady-stateconditions, ENaC mRNAs are short-lived and ENaCprotein is comparatively stable. Alternatively, ENaCmRNAs may be confined to transient sets of developingtaste bud cells, whereas the polypeptides are present inmature cells. Still another option would be to assumethat ENaC detection by antibodies is considerably moresensitive than detecting ENaC mRNA by in situhybridization.

Using a combination of human psychophysical studiesand functional expression experiments in Xenopus laevisoocytes, the possible involvement of ENaC in mediatingsalt taste perception was investigated. If ENaC has a role insalty taste, one would expect that compounds that enhancesaltiness of Na+ solutions also enhance Na+ currents inENaC-expressing oocytes. The data showed that the basicamino acids L-arginine and, to a moderate extent, L-argininyl-L-arginine, L-lysine, and choline chloride, butnot L-glutamine, enhanced the saltiness of NaCl solutions.These compounds also enhanced ENaC-mediated Na+

membrane currents in oocytes previously microinjectedwith cRNA for α-, β-, γ- or δ-, β-, γ-ENaC subunits.However, the rank-order of potency was opposite for L-arginine and L-lysine in the two settings. The agreement ofthe results from the in vitro studies with those from in vivostudies would support a role for ENaC in human salt tastetransduction.

It should be noted here, however, that L-homoarginine,which was without effect in the in vivo experiments, was arobust enhancer of ENaC-mediated Na+ currents in micro-injected oocytes. At present, this difference is difficult toreconcile. Perhaps, the subunit composition influencesENaC’s sensitivity to the compounds under study. It couldalso be possible that the interactions of this substance withoral or salivary components diminish its availability forinteraction with lingual ENaC. In summary, our anatomicaldata point to ENaC as playing a role in taste. The functional

88 Chem. Percept. (2008) 1:78–90

data in general do not prove but are consistent with a rolefor ENaC in salt taste transduction, making it an interestingmolecule for further research.

Acknowledgments We thank Ms. Elisabeth Meyer for experttechnical assistance and Dr. Erwin Tareilus for the supply of cDNAsencoding α-, β- and γ-ENaC. This work was supported by grantsfrom the Federal Ministry of Education and Research (BMBF) toW.M. (0313819A) and T.H. (0313819B).

References

Adler E, Hoon MA, Mueller KL, Chandrashekar J, Ryba NJ, ZukerCS (2000) A novel family of mammalian taste receptors. Cell100:693–702

Anand KK, Zuniga JR (1997) Effect of amiloride on suprathreshold NaCl,LiCl, and KCl salt taste in humans. Physiol Behav 62:925–929

Avenet P, Lindemann B (1988) Amiloride-blockable sodium currentsin isolated taste receptor cells. J Membr Biol 105:245–255

Beauchamp GK, Bertino M, Burke D, Engelman K (1990) Experi-mental sodium depletion and salt taste in normal humanvolunteers. Am J Clin Nutr 51:881–889

Behrens M, Stähler F, Shi P, Bufe B, Meyerhof W (2007) Taste: topicsin chemical biology. Wiley Encyclopedia of Chemical Biology

Boughter JD Jr., Gilbertson TA (1999) From channels to behavior: anintegrative model of NaCl taste. Neuron 22:213–215

Brand JG, Teeter JH, Silver WL (1985) Inhibition by amiloride ofchorda tympani responses evoked by monovalent salts. Brain Res334:207–214

Brouard M, Casado M, Djelidi S, Barrandon Y, Farman N (1999)Epithelial sodium channel in human epidermal keratinocytes:expression of its subunits and relation to sodium transport anddifferentiation. J Cell Sci 112(Pt 19):3343–3352

Bufe B, Hofmann T, Krautwurst D, Raguse JD, Meyerhof W (2002)The human TAS2R16 receptor mediates bitter taste in response tobeta-glucopyranosides. Nat Genet 32:397–401

Contreras RJ, Catalanotto FA (1980) Sodium deprivation in rats: saltthresholds are related to salivary sodium concentrations. BehavNeural Biol 29:303–314

Denton D (1982) The hunger for salt. An anthropological, physiolog-ical and medical analysis. Springer, Berlin

DeSimone JA, Heck GL, Mierson S, Desimone SK (1984) The activeion transport properties of canine lingual epithelia in vitro.Implications for gustatory transduction. J Gen Physiol 83:633–656

DeSimone JA, Lyall V, Heck GL, Phan TH, Alam RI, Feldman GM,Buch RM (2001) A novel pharmacological probe links theamiloride-insensitive NaCl, KCl, and NH(4)Cl chorda tympanitaste responses. J Neurophysiol 86:2638–2641

Doolin RE, Gilbertson TA (1996) Distribution and characterization offunctional amiloride-sensitive sodium channels in rat tongue. JGen Physiol 107:545–554

Feldman GM, Mogyorosi A, Heck GL, DeSimone JA, Santos CR,Clary RA, Lyall V (2003) Salt-evoked lingual surface potential inhumans. J Neurophysiol 90:2060–2064

Formaker BK, Hill DL (1991) Lack of amiloride sensitivity in SHRand WKY glossopharyngeal taste responses to NaCl. PhysiolBehav 50:765–769

Gilbertson TA, Fontenot DT (1998) Distribution of amiloride-sensitivesodium channels in the oral cavity of the hamster. Chem Senses23:495–499

Gilbertson TA, Kinnamon SC (1996) Making sense of chemicals.Chem Biol 3:233–237

Guitard M, Leyvraz C, Hummler E (2004) A nonconventional look ationic fluxes in the skin: lessons from genetically modified mice.News Physiol Sci 19:75–79

Hager H, Kwon TH, Vinnikova AK, Masilamani S, Brooks HL,Frokiaer J, Knepper MA, Nielsen S (2001) Immunocytochemicaland immunoelectron microscopic localization of alpha-, beta-,and gamma-ENaC in rat kidney. Am J Physiol Renal Physiol280:F1093–F1106

Halpern BP (1998) Amiloride and vertebrate gustatory responses toNaCl. Neurosci Biobehav Rev 23:5–47

Halpern BP, Darlington RB (1998) Effects of amiloride on gustatoryquality descriptions and temporal patterns produced by NaCl.Chem Senses 23:501–511

Heck GL, Mierson S, DeSimone JA (1984) Salt taste transductionoccurs through an amiloride-sensitive sodium transport pathway.Science 223:403–405

Hubbard TJ, Aken BL, Beal K, Ballester B, Caccamo M, Chen Y,Clarke L, Coates G, Cunningham F, Cutts T, Down T, Dyer SC,Fitzgerald S, Fernandez-Banet J, Graf S, Haider S, Hammond M,Herrero J, Holland R, Howe K, Johnson N, Kahari A, Keefe D,Kokocinski F, Kulesha E, Lawson D, Longden I, Melsopp C,Megy K, Meidl P, Ouverdin B, Parker A, Prlic A, Rice S, Rios D,Schuster M, Sealy I, Severin J, Slater G, Smedley D, Spudich G,Trevanion S, Vilella A, Vogel J, White S, Wood M, Cox T,Curwen V, Durbin R, Fernandez-Suarez XM, Flicek P, KasprzykA, Proctor G, Searle S, Smith J, Ureta-Vidal A, Birney E (2007)Ensembl 2007. Nucleic Acids Res 35:D610–D617

Ji HL, Bishop LR, Anderson SJ, Fuller CM, Benos DJ (2004) The roleof Pre-H2 domains of alpha- and delta-epithelial Na+ channels inion permeation, conductance, and amiloride sensitivity. J BiolChem 279:8428–8440

Ji HL, Su XF, Kedar S, Li J, Barbry P, Smith PR, Matalon S, BenosDJ (2006) Delta-subunit confers novel biophysical features toalpha beta gamma-human ENaC via a physical interaction. J BiolChem 281:8233–8241

Kitada Y, Mitoh Y, Hill DL (1998) Salt taste responses of the IXthnerve in Sprague–Dawley rats: lack of sensitivity to amiloride.Physiol Behav 63:945–949

Kretz O, Barbry P, Bock R, Lindemann B (1999) Differentialexpression of RNA and protein of the three pore-formingsubunits of the amiloride-sensitive epithelial sodium channel intaste buds of the rat. J Histochem Cytochem 47:51–64

Kuhn C, Bufe B, Winnig M, Hofmann T, Frank O, Behrens M,Lewtschenko T, Slack JP, Ward CD, Meyerhof W (2004) Bittertaste receptors for saccharin and acesulfame K. J Neurosci24:10260–10265

Li WY, Huey CL, Yu AS (2004) Expression of claudin-7 and -8 alongthe mouse nephron. Am J Physiol Renal Physiol 286:F1063–F1071

Liman ER, Tytgat J, Hess P (1992) Subunit stoichiometry of amammalian K+ channel determined by construction of multi-meric cDNAs. Neuron 9:861–871

Lin W, Finger TE, Rossier BC, Kinnamon SC (1999) Epithelial Na+

channel subunits in rat taste cells: localization and regulation byaldosterone. J Comp Neurol 405:406–420

Lindemann B (1996) Taste reception. Physiol Rev 76:718–766Locke KW, Fielding S (1994) Enhancement of salt intake by choline

chloride. Physiol Behav 55:1039–1046McCaughey SA, Scott TR (1998) The taste of sodium. Neurosci

Biobehav Rev 22:663–676McDonald FJ, Snyder PM, McCray PB, Jr., Welsh MJ (1994)

Cloning, expression, and tissue distribution of a human amilor-ide-sensitive Na+ channel. Am J Physiol 266:L728–L734

McDonald FJ, Price MP, Snyder PM, Welsh MJ (1995) Cloning andexpression of the beta- and gamma-subunits of the humanepithelial sodium channel. Am J Physiol 268:C1157–C1163

Chem. Percept. (2008) 1:78–90 8989

Michlig S, Damak S, Le Coutre J (2007) Claudin-based permeabilitybarriers in taste buds. J Comp Neurol 502:1003–1011

Miyamoto T, Miyazaki T, Fujiyama R, Okada Y, Sato T (2001)Differential transduction mechanisms underlying NaCl- andKCl-induced responses in mouse taste cells. Chem Senses26:67–77

Ninomiya Y (1998) Reinnervation of cross-regenerated gustatorynerve fibers into amiloride-sensitive and amiloride-insensitivetaste receptor cells. Proc Natl Acad Sci USA 95:5347–5350

Ogawa T, Nakamura T, Tsuji E, Miyanaga Y, Nakagawa H,Hirabayashi H, Uchida T (2004) The combination effect of L-arginine and NaCl on bitterness suppression of amino acidsolutions. Chem Pharm Bull (Tokyo) 52:172–177

Ossebaard CA, Smith DV (1995) Effect of amiloride on the taste ofNaCl, Na-gluconate and KCl in humans: implications for Na+receptor mechanisms. Chem Senses 20:37–46

Rossier O, Cao J, Huque T, Spielman AI, Feldman RS, Medrano JF,Brand JG, le Coutre J (2004) Analysis of a human fungiformpapillae cDNA library and identification of taste-related genes.Chem Senses 29:13–23

Rotzoll N, Dunkel A, Hofmann T (2006) Quantitative studies, tastereconstitution, and omission experiments on the key tastecompounds in morel mushrooms (Morchella deliciosa Fr.). JAgric Food Chem 54:2705–2711

Schiffman SS, Lockhead E, Maes FW (1983) Amiloride reduces thetaste intensity of Na+ and Li+ salts and sweeteners. Proc NatlAcad Sci USA 80:6136–6140

Shigemura N, Islam AA, Sadamitsu C, Yoshida R, Yasumatsu K,Ninomiya Y (2005) Expression of amiloride-sensitive epithelialsodium channels in mouse taste cells after chorda tympani nervecrush. Chem Senses 30:531–538

Smith DV, Ossebaard CA (1995) Amiloride suppression of the tasteintensity of sodium chloride: evidence from direct magnitudescaling. Physiol Behav 57:773–777

Smith DV, van der Klaauw NJ (1995) The perception of saltiness iseliminated by NaCl adaptation: implications for gustatorytransduction and coding. Chem Senses 20:545–557

Sollars SI, Bernstein IL (1994) Amiloride sensitivity in the neonatalrat. Behav Neurosci 108:981–987

Tennissen AM (1992) Amiloride reduces intensity responses of humanfungiform papillae. Physiol Behav 51:1061–1068

Tennissen AM, McCutcheon NB (1996) Anterior tongue stimulationwith amiloride suppresses NaCl saltiness, but not citric acidsourness in humans. Chem Senses 21:113–120

Van Itallie C, Rahner C, Anderson JM (2001) Regulated expression ofclaudin-4 decreases paracellular conductance through a selectivedecrease in sodium permeability. J Clin Invest 107:1319–1327

Waldmann R, Champigny G, Bassilana F, Voilley N, Lazdunski M(1995) Molecular cloning and functional expression of a novelamiloride-sensitive Na+ channel. J Biol Chem 270:27411–27414

Yu AS, Enck AH, Lencer WI, Schneeberger EE (2003) Claudin-8 expression in Madin–Darby canine kidney cells augments theparacellular barrier to cation permeation. J Biol Chem 278:17350–17359

90 Chem. Percept. (2008) 1:78–90