a crispr with roles in myxococcus xanthus development …...a crispr with roles in myxococcus...

A CRISPR with Roles in Myxococcus xanthus Development andExopolysaccharide Production

Regina A. Wallace, Wesley P. Black, Xianshuang Yang, Zhaomin Yang

Department of Biological Sciences, Virginia Polytechnic Institute and State University, Blacksburg, Virginia, USA

The Gram-negative soil bacterium Myxococcus xanthus utilizes its social (S) gliding motility to move on surfaces during its vege-tative and developmental cycles. It is known that S motility requires the type IV pilus (T4P) and the exopolysaccharide (EPS) tofunction. The T4P is the S motility motor, and it powers cell movement by retraction. As the key regulator of the S motor, EPS isproposed to be the anchor and trigger for T4P retraction. The production of EPS is regulated in turn by the T4P in M. xanthus,and T4P� mutants are S� and EPS�. In this study, a �pilA strain (T4P� and EPS�) was mutagenized by a transposon andscreened for EPS� mutants. A pilA suppressor isolated as such harbored an insertion in the 3rd clustered regularly interspacedshort palindromic repeat (CRISPR3) in M. xanthus. Evidence indicates that this transposon insertion, designated CRISPR3*, is again-of-function (GOF) mutation. Moreover, CRISPR3* eliminated developmental aggregation in both the wild-type and thepilA mutant backgrounds. Upstream of CRISPR3 are genes encoding the repeat-associated mysterious proteins (RAMPs). TheseRAMP genes are indispensable for CRISPR3* to affect development and EPS in M. xanthus. Analysis by reverse transcription(RT)-PCR suggested that CRISPR3* led to an increase in the processing of the RNA transcribed from CRISPR3. We propose thatcertain CRISPR3 transcripts, once expressed and processed, target genes critical for M. xanthus fruiting body development andEPS production in a RAMP-dependent manner.

The soil bacterium Myxococcus xanthus is adapted to move andlive on solid surfaces during both its vegetative and develop-mental cycles (1). In the vegetative cycle, this predatory organismspreads out or swarms over surfaces to consume other bacteriaand organic matter in its environment as nutrients. Starvationconditions trigger the developmental cycle, which involves thecoordinated movements of hundreds of thousands of cells to forma dome-shaped fruiting body on surfaces (2, 3). In the fruitingbody, vegetative cells differentiate into metabolically dormant andenvironmentally resistant myxospores (3). M. xanthus relies ontwo genetically distinct forms of gliding motility to move. Adven-turous (A) gliding enables the movement of well-isolated cells.Social (S) gliding, which is powered by the type IV pilus (T4P),requires cells to be in groups or in close physical proximity (4–6).The T4P is a polymeric protein filament composed of pilin mono-mers encoded by the pilA gene. It is the retraction of the assembledT4P filament that results in the movement of the cell on a surface.

Exopolysaccharide (EPS), another structural component onthe cell surface, is required for S motility and M. xanthus develop-ment (2, 6). M. xanthus EPS may be associated with the outer cellsurface and is thought to function as the anchor and trigger forT4P retraction (7). Many genes have been demonstrated to regu-late EPS production in M. xanthus. In particular, the Dif che-motaxis-like proteins form a membrane-anchored signaling com-plex that positively regulates EPS production. Deletions of difAand difE, which encode methyl-accepting chemotaxis protein(MCP) and CheA kinase homologues, respectively, lead to a lackof EPS production. Elimination of SglK, an Hsp70/DnaK homo-logue, also results in an EPS� phenotype. Interestingly, the T4P,whose retraction is modulated by EPS, also regulates the produc-tion of EPS; T4P� mutants such as a pilA deletion mutant exhibitan EPS� phenotype. It has been demonstrated that the T4P func-tions upstream of Dif in the EPS regulatory pathway.

In an attempt to better understand the regulation of EPS, wecarried out a genetic screen to identify transposon (Tn) mutations

that could restore EPS production to a pilA deletion mutant. Here,we describe a transposon insertion in a CRISPR (clustered regu-larly interspaced short palindromic repeats) array that suppressedthe EPS defect of a pilA mutant. CRISPRs are noncoding regionsprevalent in the genomes of prokaryotes, and they have been dem-onstrated to function as an adaptive immune system against in-vading nucleic acids in certain organisms (8). A CRISPR typicallyconsists of an array of identical repeats interspaced with spacersthat are variable in length and sequence (9, 10). The repeats insome but not all of the CRISPRs harbor short palindromesequences. Some of the spacers were found to be identical in se-quence to various genetic elements such as phages and trans-posons (11–14). Most CRISPR loci have a set of CRISPR-associ-ated (cas) genes that are adjacent to the CRISPR array (9, 10).Based on the current model, a CRISPR array may acquire a newspacer from an invading element as the first step toward resistanceor immunity. To defend against an attack, a long transcript orpre-CRISPR RNA (pre-crRNA) is first produced from a CRISPR.The pre-crRNA is then processed into short and mature crRNAs,which may target corresponding mobile elements for destruction.The Cas proteins are proposed to function in the acquisition ofnew spacers and the processing of pre-crRNA, as well as targetingand destruction of foreign nucleic acids using crRNA as a guide.

In this study, we report our finding that a transposon insertionin a CRISPR suppressed the EPS defect of a pilA deletion in M.xanthus. This insertion occurred in CRISPR3, one of three arrayspresent in the organism. CRISPR3 consists of 53 repeats and 52

Received 27 June 2014 Accepted 3 September 2014

Published ahead of print 8 September 2014

Address correspondence to Zhaomin Yang, [email protected].

Copyright © 2014, American Society for Microbiology. All Rights Reserved.

doi:10.1128/JB.02035-14

4036 jb.asm.org Journal of Bacteriology p. 4036 – 4043 December 2014 Volume 196 Number 23

on October 2, 2015 by U

niversity Libraries, Virginia T

echhttp://jb.asm

.org/D

ownloaded from

http://dx.doi.org/10.1128/JB.02035-14http://jb.asm.orghttp://jb.asm.org/

spacers in the wild-type (WT) strain. The transposon inserted intothe 13th spacer of CRISPR3 (3SP13). Interestingly, this insertion,designated CRISPR3* here, is a gain-of-function (GOF) ratherthan a loss-of-function (LOF) mutation. While CRISPR3* re-stored EPS production to a pilA mutant, it led to no obvious EPSphenotype in a WT background. On the other hand, it adverselyaffected fruiting body development in both the �pilA and the WTbackgrounds. The genes upstream of CRISPR3 encode the repeat-associated mysterious proteins (RAMPs). These RAMP genesclassify CRISPR3 as a type IIIB CRISPR, which has been demon-strated to target RNA instead of DNA in vitro. Deletion analysisindicated that these RAMP genes are required for CRISPR3* toexert its function in both EPS production and fruiting body de-velopment. Based on analysis by reverse transcription (RT)-PCR,it appears that CRISPR3* altered the processing of the CRISPR3pre-crRNA. We propose that one or more of the resulting crRNAsmay target the RNA transcripts from certain M. xanthus chromo-somal genes. As such, this novel type IIIB CRISPR influences cel-lular processes, such as EPS production and fruiting body devel-opment, that extend beyond the canonical function of prokaryoticimmunity.

MATERIALS AND METHODSBacterial strains and growth conditions. The M. xanthus strains andplasmids used in this study are listed in Table 1. The medium for M.xanthus was Casitone-yeast extract (CYE) (2). The Escherichia coli strainsused were XL1-Blue (Stratagene) and DH5� �pir (15), both grown inLuria-Bertani (LB) medium (16). The M. xanthus and E. coli strains weregrown at 32°C and 37°C, respectively; 1.5% agar plates were used to growM. xanthus and E. coli unless otherwise indicated. Media were supple-mented with kanamycin at 100 �g/ml and/or oxytetracycline at 15 �g/mlwhen appropriate. Clone fruiting (CF) medium (17) was used to examineM. xanthus development.

Isolation of a pilA suppressor mutant. DK10407 (�pilA) (18) wasmutagenized with the mariner transposon magellan4 (19, 20). This trans-poson contains the E. coli R6K� origin of replication and nptII, whichconfers kanamycin resistance (Kanr) (19). pMycoMar, a plasmid carryingthe transposon, was transformed into DK10407 by electroporation (21).Transformants were plated on CYE plates with kanamycin and Congo red(CR) at 30 �g/ml (22). Red colonies, potentially EPS� mutants, werefurther examined using CYE plates with calcofluor white (CW) at 50�g/ml (23).

To clone the transposon insertions, genomic DNA of a transposonmutant was isolated and digested with SacII, which does not cut within themagellan4 transposon (20). The digestion mixture was then used for liga-tion and subsequent transformation of the E. coli strain DH5� �pir byselection on kanamycin. Plasmids from the transformants were se-quenced using MarR1 and MarL1 (24), and the sequence flanking thetransposon was compared with the genome sequence of M. xanthusDK1622 (25) to identify the insertion site.

Construction of plasmids. Two plasmids were constructed to deletetwo M. xanthus gene clusters, the RAMP and MXAN_7275 toMXAN_7270 (MXAN_7275-7270) genes. One additional plasmid wasconstructed to delete CRISPR3. PCR primers were designed to amplifyregions upstream and downstream of the target for deletion. The frag-ments were then joined by overlapping PCR to generate the deletion allele,which was cloned into pMY7 using HindIII and XbaI. pMY7 containsnptII and the E. coli galK gene (unpublished data). The primer pairs todelete the CRISPR3 array were �CRISPR3_F1 (GCATAAGCTTGCGCTGTTCACCGGAGGT) and �CRISPR3_R1 (TTCGCTCATGGAGGCCCTGTAGCCCATCTGAATCTCCCAG) for the upstream fragment and�CRISPR3_F2 (ACAGGGCCTCCATGAGCGAA) and �CRISPR3_R2(TAGCTCTAGAAGGCACGGAGCAACTCGGA) for the downstream

fragment. The primers to delete MXAN_7275-7270 were �MXAN_F1(GACCAAGCTTTCAACATATCGCCGTCGA) and �MXAN_R1 (GTATTCGTTCCAGAACCGGG) for the upstream and �MXAN_F2 (CCCGGTTCTGGAACGAATACGAGAAGCCTACGGCGAGTTC) and�MXAN_R2 (GCTCTAGATGTTGGTTGCGTGCATGG) for the down-stream. The primers to delete the RAMP genes were �RAMP_F1 (GAT-TACAAGCTTCTCGCTCCTGGTGCGGAT) and �RAMP_R1 (CGGAGCGAGTGGTTGCCGAA) for the upstream and �RAMP_F2 (ACAGGGCCTCCATGAGCGAA) and �RAMP_R2 (CGTCCTCTCTAGATTCCAAACCCCATGGAA) for the downstream. The resulting plasmids with�CRISPR3, �MXAN_7275-7270, and �RAMP alleles were pRW100,pRW107, and pRW112, respectively.

pXY105 was constructed to express CRISPR3 from PnptII, the pro-moter of the Kanr gene. CRISPR3 was amplified using CRISPR3_F1 andCRISPR3_R (AGGTCTAGATGGCCTCGCAGCTTCCAGAT). It was di-gested with HindIII and XbaI and cloned into pWB425 (20) at the samerestriction sites to produce pXY105.

Construction of M. xanthus mutants. The deletion plasmids men-tioned above were used in a two-step procedure (26) to replace theirtargets on the chromosome (Table 1). pRW100 was used to deleteCRISPR3 from DK1622 (WT) and DK10407 (�pilA) to construct YZ1202(�CRISPR3) and YZ1200 (�pilA �CRISPR3), respectively. pRW107 wasused to delete �MXAN_7275-7270 from DK1622 and DK10407 to con-struct YZ1263 (�MXAN) and YZ1267 (�pilA �MXAN), respectively.pRW112 was used to delete the RAMP genes from DK1622 and DK10407to construct YZ1203 (�RAMP) and YZ1201 (�pilA �RAMP), respec-tively.

TABLE 1 M. xanthus strains and plasmids

Strain orplasmid Genotype/description Reference

StrainsBY802 �pilA::tet CRISPR3* This studyBY850 CRISPR3* This studyDK1622 Wild type 2DK10407 �pilA::tet 18DK10416 �pilB 44YZ601 �difA 45YZ603 �difE 46YZ811 �sglK 47YZ1200 �pilA::tet �CRISPR3 This studyYZ1201 �pilA::tet �RAMP This studyYZ1202 �CRISPR3 This studyYZ1203 �RAMP This studyYZ1261 �pilA::tet �RAMP CRISPR3* This studyYZ1262 �RAMP CRISPR3* This studyYZ1263 �MXAN This studyYZ1267 �pilA::tet �MXAN This studyYZ1270 �pilA::tet �CRISPR3 att::pXY105 This studyYZ1273 �pilA::tet �MXAN CRISPR3* This studyYZ1279 �pilB CRISPR3* This studyYZ1280 �sglK CRISPR3* This studyYZ1281 �difA CRISPR3* This studyYZ1282 �difE CRISPR3* This study

PlasmidspMY7 Cloning vector; Kanr; E. coli galK Unpublished datapMycoMar magellan4 mutagenesis vector 19pRW100 CRISPR3 deletion in pMY7 This studypRW107 MXAN deletion in pMY7 This studypRW112 RAMP deletion in pMY7 This studypWB425 M. xanthus expression vector 20pXY105 CRISPR3 in pWB425 This studypZErO-2 Cloning vector; Kanr Invitrogen

Noncanonical Role of CRISPR in Development and EPS

December 2014 Volume 196 Number 23 jb.asm.org 4037



echhttp://jb.asm

.org/D

ownloaded from

http://jb.asm.orghttp://jb.asm.org/

Genomic DNA from the �pilA suppressor strain BY802 was trans-formed into DK1622, YZ1267, YZ1201, YZ1203, DK10416 (�pilB),YZ601 (�difA), YZ603 (�difE), and YZ811 (�sglK) to construct the fol-lowing strains: BY850 (CRISPR3*), YZ1273 (�pilA �MXAN CRISPR3*),YZ1261 (�pilA �RAMP), YZ1262 (�RAMP CRISPR3*), YZ1279 (�pilBCRISPR3*), YZ1280 (�sglK CRISPR3*), YZ1281 (�difA CRISPR3*), andYZ1282 (�difE CRISPR3*), respectively. pXY105 was transformed intoYZ1200 (�pilA �CRISPR3) to construct YZ1270 (�pilA �CRISPR3 att::pXY105).

Examination of EPS production and fruiting body development.EPS production and fruiting body development were examined on CYE-plus-CW and CF plates, respectively. Briefly, cells were resuspended at5 109 cells/ml in CYE, and 5 �l was spotted on CYE-plus-CW plates forEPS assays. For the examination of development, cells were resuspendedat 2.5 109 cells/ml in MOPS buffer (10 mM morpholinepropanesulfo-nic acid [pH 7.6], 2 mM MgSO4), and 5 �l was spotted on CF plates. Bothsets of plates were incubated at 32°C for 5 days before documentation.

Examination of CRISPR3 expression by RT-PCR. To perform RT-PCR, overnight cultures in CYE were used to inoculate a culture to anoptical density of 0.15 at 600 nm. Cells were harvested after 20 h of growthand resuspended at 5 108 cells/ml in CYE. A CYE plate with 1.0% agarwas inoculated with 100 �l of the cell suspension by spreading and incu-bated for 4 days at 32°C. The cells were then scraped off and resuspendedin MOPS buffer. Samples from five plates for each strain were pooled forRNA isolation using a TriSure RNA isolation kit (Bioline). These RNApreparations were treated with DNase I (Promega), repurified using theTriSure RNA isolation kit, and resuspended in RNase-free water. RT-PCRwas performed using Moloney murine leukemia virus (MMLV) reversetranscriptase (Promega) for reverse transcription and Taq DNA polymer-ase (New England BioLabs) for PCR. For RT-PCR two pairs of primerstargeting different regions of CRISPR3 relative to the CRISPR3* insertionwere used. The primers upstream of the insertion were CRISPR3_UF(TGGGAGATTCAGATGGGCT) and CRISPR3_UR (TGCTCGTCGTCACGATGCTGGA). Those downstream were CRISPR3_DF (CGTCTGGCCTTCGCCGTCGT) and CRISPR3_DR (TGGACGGGAGAAGACGTTCA). Only the reverse primers CRISPR3_UR and CRISPR3_DR, re-spectively, were used in the two RT reactions. The PCR products were re-solved on a 1.4% agarose gel, and ImageJ (27) was used for quantification. Todetermine the sequences of the RT-PCR products, the bands of interest wereexcised from the agarose gel, cloned into pZErO-2 (Invitrogen), and se-quenced.

RESULTSIsolation of a pilA suppressor in EPS production. M. xanthuspilA mutants are EPS� because they do not assemble the T4P dueto a lack of pilin. To better understand EPS regulation in M. xan-thus, a genetic screen was carried out to isolate suppressors of pilAin EPS production. Briefly, a pilA deletion (�pilA) mutant(DK10407) was mutagenized with a mariner Tn, and mutantswere selected on plates supplemented with the dye CR. EPS� col-onies appear yellowish orange, while EPS� colonies are red due tothe binding of CR to M. xanthus EPS. Here, we report studies ofBY802, one of two pilA suppressor mutants isolated from screen-ing 20,000 colonies using this method. The other suppressor willbe reported elsewhere.

The EPS� phenotype of BY802 was confirmed by binding ofthe fluorescent dye CW as an alternative EPS assay. As shown inFig. 1A, the WT (DK1622) and BY802 fluoresced under UV illu-mination while the pilA mutant did not. The genomic DNA ofBY802 was transformed into the parental �pilA mutant to verifythat the EPS� phenotype was linked to one locus with a Tn inser-tion(s). All resulting transformants examined were found to beEPS� by dye binding assays (data not shown), demonstrating thatBY802 harbors a single Tn insertion responsible for the restora-

tion of EPS to the pilA mutant. This insertion is designatedCRISPR3* here (see below). It should be noted that the suppressorstrain, despite being EPS�, is still S� due to a lack of the T4P.Consequently, the colony morphology of BY802 differs from thatof the WT, which is EPS� and S�.

CRISPR3* suppressed �pilB and �sglK but not �difA or�difE. Many genes are known to play roles in EPS regulation in M.xanthus. They include the sglK and dif genes. To examine the ge-netic relationship of CRISPR3* with these genes, genomic DNA ofBY802 was used to transform �sglK, �difA, and �difE mutantstrains. A �pilB mutant was also transformed to determine thespecificity of the suppression of T4P� mutations by CRISPR3*.The resulting double mutants were examined on CW plates (Fig.1B). The �pilB CRISPR3* and �sglK CRISPR3* strains fluoresced,while �difA CRISPR3* and �difE CRISPR3* did not. The resultsdescribed here demonstrate that in EPS regulation, CRISPR3* isepistatic to �pilA, �pilB, and �sglK but not to �difA and �difEmutations in M. xanthus.

CRISPR3* is a gain-of-function mutation. The site of the Tninsertion in BY802 was identified by cloning and sequencing. Theinsertion occurred in CRISPR3, the 3rd of three CRISPR regionson the M. xanthus chromosome (Fig. 2). CRISPR3 contains 53

FIG 1 CRISPR3* is a gain-of-function mutation that suppresses �pilA, �pilB,and �sglK in EPS production. Five microliter samples of cell suspensions of vari-ous strains at 5 109 cells/ml were spotted on CYE-plus-CW plates and incubatedfor 5 days at 32°C. The photographs were taken under UV illumination. Thefluorescence intensity approximates the level of EPS production. (A) CRISPR3*suppresses a pilA deletion. Strains: WT (DK1622), �pilA (DK10407), and �pilACRISPR3* (BY802). (B) CRISPR3* suppresses pilB and sglK but not difA or difEmutations. Strains: �pilB (DK10416), �pilB CRISPR3* (YZ1279), �sglK (YZ811),�sglK CRISPR3* (YZ1280), �difA (YZ601), �difA CRISPR3* (YZ1281), �difE(YZ603), and �difE CRISPR3* (YZ1282). (C) Expression of CRISPR3 suppresses�pilA. Strains: �CRISPR3 (YZ1202), �pilA �CRISPR3 (YZ1200), and �pilA�CRISPR3 pXY105 (YZ1270). The scale bars in all three panels represent 1 cm.

Wallace et al.

4038 jb.asm.org Journal of Bacteriology



echhttp://jb.asm

.org/D

ownloaded from


nearly identical repeats, each 36 bp long. Between these repeats are52 spacers ranging from 33 to 40 bp in length. The Tn insertedafter a TA dinucleotide at the 2nd and 3rd positions of the 13thspacer of CRISPR3 (3SP13). At the 5= end of the CRISPR3 array isa typical A/T-rich leader sequence (L), which is where the pro-moter is anticipated to be for this CRISPR array. This insertion inCRISPR3 was surprising, as we had expected mutations in or nearprotein-coding sequences.

We sought to determine the genetic nature of the 3SP13 inser-tion in BY802. Tn insertions tend to result in LOF mutations moreoften than GOF mutations. In principle, however, a Tn insertionmay result in either type. We first deleted the entire CRISPR3array to examine if a CRISPR3-null or LOF mutation could sup-press a pilA deletion. The �CRISPR3 allele, which deleted all 53repeats and 52 spacers, was constructed in a �pilA mutant back-ground as well as in a WT background. In the WT background, the�CRISPR3 allele did not affect EPS production appreciably inqualitative (Fig. 1C) and quantitative (not shown) assays underour experimental conditions. Unexpectedly, the �pilA �CRISPR3double mutant lacked EPS production, as indicated by its lack offluorescence on CW plates. Since the deletion of CRISPR3 is un-able to suppress �pilA, the original 3SP13 insertion in BY802 isunlikely to be a LOF mutation of CRISPR3.

We considered the alternative that the 3SP13 insertion couldbe a GOF mutation next. One possibility is that the insertion ac-tivates the function of CRISPR3 by increasing the level ofCRISPR3 crRNA. We sought to express CRISPR3 from PnptII, thepromoter for the kanamycin resistance gene in the Tn used formutagenesis. PnptII in the CRISPR3* mutant is oriented in thesame direction as the predicted promoter for CRISPR3 in the Lsequence (Fig. 2). As such, it could lead to the expression of theCRISPR3 region downstream of the insertion. CRISPR3 wascloned in its entirety into an expression vector with PnptII and theMx8 phage attachment site (28) (Fig. 2). The resulting expressionplasmid (pXY105) was transformed into a �pilA mutant with thechromosomal CRISPR3 deleted to circumvent homologous re-combination. As shown in Fig. 1C, the resulting strain (YZ1270)fluoresced on the CW plate, indicating that the artificial expres-sion of CRISPR3 is sufficient to suppress �pilA. It was noted thatthis suppression is not as strong as the 3SP13 insertion in BY802.As a control, the same CRISPR3 fragment cloned in the invertedorientation in the same vector did not result in suppression (datanot shown). These results with the deletion and expression of

CRISPR3 (Fig. 1C) led to the conclusion that the CRISPR3 inser-tion in BY802 is a GOF mutation. This mutation is therefore des-ignated CRISPR3* to differentiate it from a LOF mutation.

CRISPR3* led to defects in fruiting body development. Thedevelopment of CRISPR3* mutants was examined because defectsin EPS have been directly tied to M. xanthus fruiting (29). Asshown in Fig. 3, the WT strain formed regular fruiting bodies.When the CRISPR3* mutation was introduced into the WT, theresulting strain showed no obvious aggregation under the sameconditions. Consistent with previous reports, the pilA single mu-tant formed developmental aggregates. The pilA suppressorstrain, however, showed no obvious sign of aggregation, like theCRISPR3* single mutant. Similarly, when pXY105 was introducedinto the �pilA �CRISPR3 double-mutant background, it resulted

FIG 2 M. xanthus CRISPR3 locus. A region of 20.1 kb at the CRISPR3 locus is shown at the top, with genetic elements drawn to scale. The arrows represent ORFs,and the rectangle represents the CRISPR3 array. Upstream of CRISPR3 are seven RAMP genes: cmr1, cas10, cmr3, cmr4, cmr5 (indicated by 5), cmr6, and cas6(indicated by 6). Downstream are six ORFs: MXAN_7275-7270 (MXAN_7272 is indicated by 72). Below is a closeup of CRISPR3. It contains 53 repeats(diamonds), 52 spacers (horizontal lines), and a leader sequence (L). The double slash indicates the omission of repeats 28 through 49. The arrowhead indicatesthe CRISPR3* Tn insertion in the 13th spacer. The solid arrows indicate the positions of the primers used for RT-PCR. These primers are CRISPR3_UF (UF),CRISPR3_UR (UR), CRISPR3_DF (DF), and CRISPR3_DR (DR). The open arrow indicates where CRISPR3_UR (UR) annealed in RT-PCR to produce asmaller product (shown in Fig. 5). pXY105 contains the entire CRISPR3 region, including 746 bp upstream of the first repeat and 1,542 bp downstream of the lastrepeat.

FIG 3 CRISPR3* adversely affects development in a RAMP-dependent man-ner. Five microliter samples of cell suspensions at 2.5 109 cells/ml of theindicated strains were spotted on CF plates. The photographs were taken after5 days. Strains: WT (DK1622), CRISPR3* (BY850), �RAMP CRISPR3*(YZ1262), �pilA (DK10407), �pilA CRISPR3* (BY802), �pilA �RAMPCRISPR3* (YZ1261), �CRISPR3 (YZ1202), �pilA �CRISPR3 (YZ1200), and�pilA �CRISPR3 pXY105 (YZ1270). �RAMP (YZ1203) is wild type in devel-opment (not shown).





echhttp://jb.asm

.org/D

ownloaded from


in significantly diminished aggregation under developmentalconditions (Fig. 3). In contrast, the �CRISPR3 null allele had noobvious effect on development in either the WT or the pilA mu-tant background. Thus, CRISPR3* is a GOF mutation in develop-ment, which argues that CRISPR3 can function to deter fruitingbody formation. Because CRISPR3* results in developmental de-fects with no effect on EPS in the WT background, CRISPR3* mayinfluence development and EPS production through distinctmechanisms.

RAMP genes are required for CRISPR3* to exert its function.Further upstream of the CRISPR3 array are seven cas genes, cmr1,cas10, cmr3, cmr4, cmr5, cmr6, and cas6 (Fig. 2). Their products arealso known as RAMPs. The presence of cas10 classifies the M.xanthus CRISPR3 system as type III, and cmr5 further defines it astype IIIB. Downstream of CRISPR3 are six open reading frames(ORFs), MXAN_7275 to MXAN_7270. These ORFs read in thesame direction as the RAMP genes and CRISPR3. We examinedwhether the ORFs were related to CRISPR3 function by construct-ing a deletion allele of the MXAN_7275-7270 gene cluster(�MXAN) in the WT, the �pilA, and the �pilA CRISPR3* back-grounds. As shown in Fig. 3, �MXAN did not alter the fluores-cence of any of these strains on CW plates. These results indicatethat the MXAN_7275-7270 genes are not required for CRISPR3*to suppress �pilA and are unlikely to be related to CRISPR3 func-tion or EPS production.

The seven RAMP genes were also examined for their roles inthe function of CRISPR3*. A deletion allele of all seven RAMPgenes (�RAMP) was constructed in the �pilA CRISPR3* back-ground. As shown in Fig. 4, the resulting mutant (YZ1261) failedto fluoresce on CW plates. The EPS� phenotype of this mutant

indicates that the RAMP genes are required for the suppression ofpilA by CRISPR3*. As controls, the deletion of RAMP genes didnot affect EPS production in the WT and the �pilA backgroundsas analyzed on CW plates (Fig. 4). The same strains were alsoexamined for development to determine if CRISPR3* required theRAMP genes to adversely affect fruiting body formation. Asshown in Fig. 3, the deletion of the RAMP genes alleviated thedetrimental effect of CRISPR3* on development in both the WTand the �pilA backgrounds. These results demonstrate that theseRAMP genes are required for CRISPR3* to exert its effect on bothfruiting body development and EPS production.

CRISPR3* may lead to increased processing of pre-crRNA.How does CRISPR3* influence both fruiting body developmentand EPS production? One scenario was that the CRISPR3* muta-tion might activate the transcription of CRISPR3 downstream ofthe insertion. This would lead to increased or artificial productionof CRISPR3 pre-crRNA and crRNA. The CRISPR3 crRNA couldaffect both EPS production and development by targeting thetranscripts of certain genes that function in these processes. Thisscenario was consistent with the orientation of the PnptII pro-moter in the Tn and the suppression of �pilA by the CRISPR3expression construct (pXY105) (Fig. 1C).

Two pairs of primers were used in RT-PCR to examine thetranscripts from CRISPR3 both down- and upstream of theCRISPR3* mutation. The first pair, CRISPR3_UF andCRISPR3_UR, target a region from the leader sequence to the 6thspacer upstream of CRISPR3* (Fig. 2). The second pair,CRISPR3_DF and CRISPR3_DR, are complementary to spacers16 and 25, respectively, downstream of the mutation (Fig. 2). Noobvious differences between CRISPR3 and CRISPR3* strains wereobserved when the downstream pair was used in RT-PCR (datanot shown). In contrast, there were reproducible differences whenthe upstream pair was used (Fig. 5). This pair was expected toamplify a fragment of 441 bp. A band of similar size was present inall but the �CRISPR3 strain, as anticipated. However, there was asmaller band around 350 bp long in the two strains with theCRISPR3* allele. Estimations from multiple experiments withtechnical replications indicated that the upper band is consistentlyless intense in CRISPR3* mutants than in strains with the WT

FIG 4 RAMP genes, but not MXAN_7275-7270, are required for CRISPR3*to suppress �pilA. Experiments were performed as for Fig. 1. Strains: WT(DK1622), �pilA (DK10407), �MXAN (YZ1263), �pilA �MXAN (YZ1267),�pilA �MXAN CRISPR3* (YZ1273), �RAMP (YZ1203), �pilA �RAMP(YZ1201), and �pilA �RAMP CRISPR3* (YZ1261). The scale bar represents 1cm. The suppressor strain BY802 (Fig. 1) is indistinguishable from YZ1273.

FIG 5 CRISPR3* mutation may affect processing of CRISPR3 RNA tran-scripts upstream of the insertion. RT-PCR was performed using the primersCRISPR3_UF and CRISPR3_UR (Fig. 2) as described in Materials and Meth-ods. RT-PCR products were resolved on a 1.4% agarose gel and visualized byethidium bromide staining and UV illumination. The sizes of DNA standards(S) in base pairs are indicated on the left. The arrow indicates the extra band inCRISPR3* mutants. Strains: WT (DK1622), �CRISPR3 (YZ1202) �pilA(DK10407), �pilA �RAMP (YZ1201), �pilA CRISPR3* (BY802), and �pilA�RAMP CRISPR3* (YZ1261).

Wallace et al.




echhttp://jb.asm

.org/D

ownloaded from


CRISPR3 allele. These results suggested that the CRISPR3* muta-tion may have led to an increase in processing of pre-crRNA up-stream of its insertion site.

The DNA fragments from RT-PCR were cloned and sequencedto investigate their identities and origins. The upper band (Fig. 5)from the suppressor strain (�pilA CRISPR3*) was identical to theone from the WT. Both were 441 bp long, with the anticipatedsequence flanked by the two upstream primers (Fig. 2). The lowerband from the suppressor strain was 351 bp long, and both its 5=and 3= ends matched CRISPR3_UR (Fig. 2), the primer used inboth the RT and the PCRs (Fig. 6). This primer, which is comple-mentary to the 6th spacer, serendipitously matched 15 out of 22positions in the CRISPR3 repeat (Fig. 6). As a consequence, it alsoannealed with the second repeat, in addition to the 6th spacer, togive rise to the 351-bp fragment in the suppressor strain. Thesmaller RT-PCR fragment from YZ1261 (�pilA CRISPR3*�RAMP) was also examined, and it was identical to the 351-bpfragment from the suppressor strain (�pilA CRISPR3*). The ob-servations with RT-PCR indicate that the CRISPR3* mutationresulted in the production of RNA species that are not present inthe WT CRISPR3 strains. We suggest that CRISPR3* led to anincrease or change in the processing of CRISPR3 pre-crRNA,which is possibly responsible for the effect of CRISPR3* on fruit-ing and EPS in M. xanthus.

DISCUSSION

CRISPRs have been demonstrated to function as adaptive im-mune systems in prokaryotes in three steps (30): adaptation,crRNA biogenesis, and targeting or interference. During adapta-tion, a new spacer is acquired from exogenous nucleic acids, alongwith the addition of a new repeat adjacent to the leader sequence.crRNA biogenesis begins with the transcription of the CRISPRarray from a promoter in the leader sequence. The resulting pre-crRNA is then processed to generate the small and mature inter-fering crRNA. In targeting or interference, a crRNA-Cas nucleo-protein complex with nuclease activity targets and cleaves DNA or

RNA homologous to the crRNA (10). There are three major typesof CRISPRs, defined mainly by their associated Cas proteins. TypeI has six subtypes, IA through IF. Types II and III each have twosubtypes, IIA and IIB, and IIIA and IIIB. All subtypes of types I andII cleave DNA, as does type IIIA. Type IIIB has been demonstratedto target RNA rather than DNA. Regardless of their targets, allCRISPRs are proposed to go through these three steps to confer onprokaryotes immunity or resistance to invading nucleic acids. It isnoteworthy that Cas9 and its associated type II CRISPR systemshave been developed for genome editing (31); it has generatedconsiderable excitement, as it has been successfully applied to or-ganisms from bacteria to mammals and from worms to plants(31).

Besides its ability to function in immunity, a CRISPR systemmay also regulate other cellular functions in bacteria. Of the or-ganisms possessing CRISPRs, 18% were found to have spacersoriginating from their genomes (14, 32), suggesting that CRISPRsystems could affect chromosomal genes not involved in immu-nity. There are indeed a few such examples in the literature. DevRand DevS, which are essential for M. xanthus development (33,34), are now known as CRISPR-associated proteins Cas7 andCas5. They have been found to be affiliated with most of the typeI CRISPR systems (35, 36). In M. xanthus, they are associated withCRISPR2, a type IC CRISPR. devR and devS are regulated by de-velopmental progression, along with other genes at the same locusin M. xanthus (33, 34). While the functions of Cas5 and Cas7 haveyet to be elucidated, they contain RNA binding domains (35) andmay potentially influence gene expression or directly performfunctions crucial for M. xanthus development. Early studies of aPseudomonas aeruginosa lysogen provided additional and moredirect evidence that CRISPR systems may regulate chromosomalgenes (37, 38). A WT P. aeruginosa strain produces biofilm anddisplays swarming motility. However, its lysogen with the DMS3prophage loses both biofilm formation and swarming motility.Disruption of a type IF CRISPR or its associated cas genes restoredbiofilm formation and swarming to the lysogen. These results sug-gest that a type IF CRISPR system may regulate the functions ofgenes that are not directly related to bacterial immunity.

A more recent example came from a type II CRISPR in Fran-cisella novicida, an intracellular bacterial pathogen of animals. Inthis case, Cas9, as well as its associated transactivating crRNA(tracrRNA) and small CRISPR/Cas-associated RNA (scaRNA),was found to repress the expression of a bacterial lipoprotein(BLP). Such BLPs are the ligands for the Toll-like receptor TLR2for the activation of innate immunity of the animal host. It ap-pears that Cas9 and its associated RNAs destabilize the mRNA forBLP to subvert detection of the bacterium by its host. The abro-gation of this regulatory mechanism of BLP attenuates the patho-genesis of F. novicida. Cas9 had been engineered previously toregulate gene expression in an artificial setting (39–41). The newdiscovery indicated that Cas9 can directly influence the level oftranscripts and proteins in a natural and biologically relevant con-text. These observations provide evidence that type II CRISPRsystems can regulate genes involved in critical cellular processesdistinct from prokaryotic immunity.

This study provides strong evidence that a type IIIB CRISPRsystem can regulate EPS production and fruiting body develop-ment in M. xanthus. A CRISPR3 Tn insertion, CRISPR3*, restoredEPS production to a pilA mutant in M. xanthus. It was also foundto suppress pilB and sglK in EPS production. CRISPR3* is a GOF

FIG 6 Alignments of the repeats and two Cas6 proteins from M. xanthusCRISPR2 and CRISPR3. (A) Comparison of the CRISPR2 repeat (IIR) andthe CRISPR3 repeat (IIIR). They have two mismatches, indicated in bold-face. The last line is the sequence of the CRISPR3_UR primer (3UR)aligned with the CRISPR3 repeat. The underlined nucleotides match thesequence of the repeat. (B) Alignment of CRISPR2 Cas6 (Cas6=) andCRISPR3 Cas6 over 195 amino acids. Identical and conserved residues areindicated by colons and periods, respectively.





echhttp://jb.asm

.org/D

ownloaded from


mutation because the artificial expression of CRISPR3, but notCRISPR3 deletion, resulted in the suppression of the �pilA EPSdefect. Moreover, the CRISPR3* mutation itself was also found tohave a detrimental effect on fruiting body development in boththe pilA mutant and the WT backgrounds. Our findings hereclearly indicate that CRISPR3 is involved in the regulation of fruit-ing body development and EPS production in M. xanthus, neitherof which is directly related to the canonical function of CRISPR inimmunity.

We propose a molecular model to explain how CRISPR3 mayregulate EPS production and fruiting body development in M.xanthus. We propose that CRISPR3, like other CRISPR arrays, canbe transcribed as a long pre-crRNA. crRNAs are then produced bypre-crRNA processing. One or more CRISPR3 crRNAs can targetmRNAs from genes involved in the regulation of EPS productionand fruiting body development, possibly by cleavage or degrada-tion. Because EPS and fruiting are not typical responses to phageinfection, the target genes here can be inferred to be M. xanthuschromosomal genes critical for these normal cellular processes.Because the deletion of CRISPR3 led to no obvious phenotype inM. xanthus (Fig. 1), CRISPR3 pre-crRNA is likely not producedand/or processed at sufficient levels to affect fruiting or EPS pro-duction in a WT background. In contrast, the expression ofCRISPR3 from a heterologous promoter affected both fruitingbody development and EPS production, similarly to CRISPR3*(Fig. 1 and 3). Because the deletion of RAMP genes abrogated theeffect of CRISPR3* in both processes, it is proposed that one ormore of the RAMP proteins are indispensable for regulation of thetargeted genes to affect EPS production and development.

It was surprising that the deletion of RAMP genes, includingcas6, did not eliminate the new CRISPR3 RNA species detected byRT-PCR in the CRISPR3* strains (Fig. 5). In Pyrococcus furiosus,the riboendonuclease Cas6 appears to be the first enzyme involvedin the processing of pre-crRNA (42, 43). It cleaves RNA in therepeat 8 nucleotides upstream of a spacer. This produces an RNAintermediate with a spacer flanked by part of the repeat at bothends (43). The 3= end of this intermediate is believed to be furtherprocessed by other RAMP proteins to generate crRNA, yet in theM. xanthus RAMP deletion, CRISPR3 pre-crRNA appeared to beprocessed, at least to some degree, in the CRISPR3* mutants (Fig.5). It is possible that CRISPR3 Cas6 (MXAN_7276) does not cat-alyze the first processing step or that the later steps do not requirepriming by Cas6, at least in M. xanthus CRISPR3* mutants. Alter-natively, the Cas6 associated with CRISPR2 in M. xanthus maypartially process CRISPR3 pre-crRNA. CRISPR2 is about 21 kbaway from CRISPR3. CRISPR2 Cas6 (MXAN_7265) is 65% iden-tical and 86% similar to CRISPR3 Cas6 (Fig. 6). The repeats ofthese two CRISPRs are both 36 bp long, and they differ at only twopositions. Future studies may determine if there are biochemicaland functional overlaps between these two CRISPR systems in M.xanthus.

ACKNOWLEDGMENTS

This work was partially supported by National Science Foundation grantsMCB-1239889 and MCB-1417726, as well as by National Institutes ofHealth grant GM071601 and by the Fralin Life Science Institute. R.A.W.was partially supported by the Post Baccalaureate Research and EducationProgram (PREP) and the Multicultural Academic Opportunities Program(MAOP) at Virginia Tech.

REFERENCES1. Dworkin M, Kaiser D. 1993. Myxobacteria II. ASM Press, Washing-

ton, DC.2. Kaiser D. 1979. Social gliding is correlated with the presence of pili in

Myxococcus xanthus. Proc. Natl. Acad. Sci. U. S. A. 76:5952–5956. http://dx.doi.org/10.1073/pnas.76.11.5952.

3. Kuner JM, Kaiser D. 1982. Fruiting body morphogenesis in submergedcultures of Myxococcus xanthus. J. Bacteriol. 151:458 – 461.

4. Hodgkin J, Kaiser D. 1979. Genetics of gliding motility in Myxococcusxanthus (Myxobacterales): genes controlling movements of single cells.Mol. Gen. Genet. 171:167–176. http://dx.doi.org/10.1007/BF00270003.

5. Hodgkin J, Kaiser D. 1979. Genetics of gliding motility in Myxococcusxanthus (Myxobacterales): two gene systems control movement. Mol.Gen. Genet. 171:177–191. http://dx.doi.org/10.1007/BF00270004.

6. Shimkets LJ. 1986. Correlation of energy-dependent cell cohesion withsocial motility in Myxococcus xanthus. J. Bacteriol. 166:837– 841.

7. Li Y, Sun H, Ma X, Lu A, Lux R, Zusman D, Shi W. 2003. Extracellularpolysaccharides mediate pilus retraction during social motility of Myxo-coccus xanthus. Proc. Natl. Acad. Sci. U. S. A. 100:5443–5448. http://dx.doi.org/10.1073/pnas.0836639100.

8. Barrangou R, Fremaux C, Deveau H, Richards M, Boyaval P, MoineauS, Romero DA, Horvath P. 2007. CRISPR provides acquired resistanceagainst viruses in prokaryotes. Science 315:1709 –1712. http://dx.doi.org/10.1126/science.1138140.

9. Jansen R, Embden JD, Gaastra W, Schouls LM. 2002. Identification ofgenes that are associated with DNA repeats in prokaryotes. Mol. Micro-biol. 43:1565–1575. http://dx.doi.org/10.1046/j.1365-2958.2002.02839.x.

10. Makarova KS, Grishin NV, Shabalina SA, Wolf YI, Koonin EV. 2006. Aputative RNA-interference-based immune system in prokaryotes: com-putational analysis of the predicted enzymatic machinery, functional anal-ogies with eukaryotic RNAi, and hypothetical mechanisms of action. Biol.Direct 1:7. http://dx.doi.org/10.1186/1745-6150-1-7.

11. Bolotin A, Quinquis B, Sorokin A, Ehrlich SD. 2005. Clustered regularlyinterspaced short palindrome repeats (CRISPRs) have spacers of extrach-romosomal origin. Microbiology 151:2551–2561. http://dx.doi.org/10.1099/mic.0.28048-0.

12. Mojica FJ, Diez-Villasenor C, Garcia-Martinez J, Soria E. 2005. Inter-vening sequences of regularly spaced prokaryotic repeats derive from for-eign genetic elements. J. Mol. Evol. 60:174 –182. http://dx.doi.org/10.1007/s00239-004-0046-3.

13. Pourcel C, Salvignol G, Vergnaud G. 2005. CRISPR elements in Yersiniapestis acquire new repeats by preferential uptake of bacteriophage DNA,and provide additional tools for evolutionary studies. Microbiology 151:653– 663. http://dx.doi.org/10.1099/mic.0.27437-0.

14. Cui Y, Li Y, Gorgé O, Platonov ME, Yan Y, Guo Z, Pourcel C,Dentovskaya SV, Balakhonov SV, Wang X, Song Y, Anisimov AP,Vergnaud G, Yang R. 2008. Insight into microevolution of Yersinia pestisby clustered regularly interspaced short palindromic repeats. PLoS One3:e2652. http://dx.doi.org/10.1371/journal.pone.0002652.

15. Kolter R, Helinski DR. 1978. Activity of the replication terminus ofplasmid R6K in hybrid replicons in Escherichia coli. J. Mol. Biol. 124:425–441. http://dx.doi.org/10.1016/0022-2836(78)90180-8.

16. Miller JH. 1972. Experiments in molecular genetics. Cold Spring HarborLaboratory, Cold Spring Harbor, NY.

17. Hagen DC, Bretscher AP, Kaiser D. 1978. Synergism between morpho-genetic mutants of Myxococcus xanthus. Dev. Biol. 64:284 –296. http://dx.doi.org/10.1016/0012-1606(78)90079-9.

18. Wall D, Wu SS, Kaiser D. 1998. Contact stimulation of Tgl and type IVpili in Myxococcus xanthus. J. Bacteriol. 180:759 –761.

19. Rubin EJ, Akerley BJ, Novik VN, Lampe DJ, Husson RN, Mekalanos JJ.1999. In vivo transposition of mariner-based elements in enteric bacteriaand mycobacteria. Proc. Natl. Acad. Sci. U. S. A. 96:1645–1650. http://dx.doi.org/10.1073/pnas.96.4.1645.

20. Black WP, Xu Q, Cadieux CL, Suh S-J, Shi W, Yang Z. 2009. Isolationand characterization of a suppressor mutation that restores Myxococcusxanthus exopolysaccharide production. Microbiology 155:3599 –3610.http://dx.doi.org/10.1099/mic.0.031070-0.

21. Kashefi K, Hartzell PL. 1995. Genetic suppression and phenotypic mask-ing of a Myxococcus xanthus frzF� defect. Mol. Microbiol. 15:483– 494.http://dx.doi.org/10.1111/j.1365-2958.1995.tb02262.x.

22. Dana JR, Shimkets LJ. 1993. Regulation of cohesion-dependent cell in-teractions in Myxococcus xanthus. J. Bacteriol. 175:3636 –3647.

Wallace et al.




echhttp://jb.asm

.org/D

ownloaded from

http://dx.doi.org/10.1073/pnas.76.11.5952http://dx.doi.org/10.1073/pnas.76.11.5952http://dx.doi.org/10.1007/BF00270003http://dx.doi.org/10.1007/BF00270004http://dx.doi.org/10.1073/pnas.0836639100http://dx.doi.org/10.1073/pnas.0836639100http://dx.doi.org/10.1126/science.1138140http://dx.doi.org/10.1126/science.1138140http://dx.doi.org/10.1046/j.1365-2958.2002.02839.xhttp://dx.doi.org/10.1186/1745-6150-1-7http://dx.doi.org/10.1099/mic.0.28048-0http://dx.doi.org/10.1099/mic.0.28048-0http://dx.doi.org/10.1007/s00239-004-0046-3http://dx.doi.org/10.1007/s00239-004-0046-3http://dx.doi.org/10.1099/mic.0.27437-0http://dx.doi.org/10.1371/journal.pone.0002652http://dx.doi.org/10.1016/0022-2836(78)90180-8http://dx.doi.org/10.1016/0012-1606(78)90079-9http://dx.doi.org/10.1016/0012-1606(78)90079-9http://dx.doi.org/10.1073/pnas.96.4.1645http://dx.doi.org/10.1073/pnas.96.4.1645http://dx.doi.org/10.1099/mic.0.031070-0http://dx.doi.org/10.1111/j.1365-2958.1995.tb02262.xhttp://jb.asm.orghttp://jb.asm.org/

23. Ramaswamy S, Dworkin M, Downard J. 1997. Identification and char-acterization of Myxococcus xanthus mutants deficient in calcofluor whitebinding. J. Bacteriol. 179:2863–2871.

24. Youderian P, Burke N, White DJ, Hartzell PL. 2003. Identification ofgenes required for adventurous gliding motility in Myxococcus xanthuswith the transposable element mariner. Mol. Microbiol. 49:555–570. http://dx.doi.org/10.1046/j.1365-2958.2003.03582.x.

25. Goldman BS, Nierman WC, Kaiser D, Slater SC, Durkin AS, Eisen JA,Ronning CM, Barbazuk WB, Blanchard M, Field C, Halling C, HinkleG, Iartchuk O, Kim HS, Mackenzie C, Madupu R, Miller N, Shvarts-beyn A, Sullivan SA, Vaudin M, Wiegand R, Kaplan HB. 2006. Evolu-tion of sensory complexity recorded in a myxobacterial genome. Proc.Natl. Acad. Sci. U. S. A. 103:15200 –15205. http://dx.doi.org/10.1073/pnas.0607335103.

26. Ueki T, Inouye S, Inouye M. 1996. Positive-negative KG cassettes forconstruction of multi-gene deletions using a single drug marker. Gene183:153–157. http://dx.doi.org/10.1016/S0378-1119(96)00546-X.

27. Schneider CA, Rasband WS, Eliceiri KW. 2012. NIH Image to ImageJ: 25years of image analysis. Nat. Methods 9:671– 675. http://dx.doi.org/10.1038/nmeth.2089.

28. Beck E, Ludwig G, Auerswald EA, Reiss B, Schaller H. 1982. Nucleotidesequence and exact localization of the neomycin phosphotransferase genefrom transposon Tn5. Gene 19:327–336. http://dx.doi.org/10.1016/0378-1119(82)90023-3.

29. Bonner PJ, Black WP, Yang Z, Shimkets LJ. 2006. FibA and PilA actcooperatively during fruiting body formation of Myxococcus xanthus.Mol. Microbiol. 61:1283–1293. http://dx.doi.org/10.1111/j.1365-2958.2006.05298.x.

30. Bhaya D, Davison M, Barrangou R. 2011. CRISPR-Cas systems in bac-teria and archaea: versatile small RNAs for adaptive defense and regula-tion. Annu. Rev. Genet. 45:273–297. http://dx.doi.org/10.1146/annurev-genet-110410-132430.

31. Pennisi E. 2013. The CRISPR craze. Science 341:833– 836. http://dx.doi.org/10.1126/science.341.6148.833.

32. Stern A, Keren L, Wurtzel O, Amitai G, Sorek R. 2010. Self-targeting byCRISPR: gene regulation or autoimmunity? Trends Genet. 26:335–340.http://dx.doi.org/10.1016/j.tig.2010.05.008.

33. Thony-Meyer L, Kaiser D. 1993. devRS, an autoregulated and essentialgenetic locus for fruiting body development in Myxococcus xanthus. J.Bacteriol. 175:7450 –7462.

34. Viswanathan P, Murphy K, Julien B, Garza AG, Kroos L. 2007. Regu-lation of dev, an operon that includes genes essential for Myxococcus xan-thus development and CRISPR-associated genes and repeats. J. Bacteriol.189:3738 –3750. http://dx.doi.org/10.1128/JB.00187-07.

35. Makarova KS, Aravind L, Wolf YI, Koonin EV. 2011. Unification of Casprotein families and a simple scenario for the origin and evolution of

CRISPR-Cas systems. Biol. Direct 6:38. http://dx.doi.org/10.1186/1745-6150-6-38.

36. Makarova KS, Haft DH, Barrangou R, Brouns SJ, Charpentier E,Horvath P, Moineau S, Mojica FJ, Wolf YI, Yakunin AF, van derOost J, Koonin EV. 2011. Evolution and classification of the CRISPR-Cas systems. Nat. Rev. Microbiol. 9:467– 477. http://dx.doi.org/10.1038/nrmicro2577.

37. Zegans ME, Wagner JC, Cady KC, Murphy DM, Hammond JH,O’Toole GA. 2009. Interaction between bacteriophage DMS3 and hostCRISPR region inhibits group behaviors of Pseudomonas aeruginosa. J.Bacteriol. 191:210 –219. http://dx.doi.org/10.1128/JB.00797-08.

38. Cady KC, O’Toole GA. 2011. Non-identity-mediated CRISPR-bacteriophage interaction mediated via the Csy and Cas3 proteins. J. Bac-teriol. 193:3433–3445. http://dx.doi.org/10.1128/JB.01411-10.

39. Qi LS, Larson MH, Gilbert LA, Doudna JA, Weissman JS, Arkin AP,Lim WA. 2013. Repurposing CRISPR as an RNA-guided platform forsequence-specific control of gene expression. Cell 152:1173–1183. http://dx.doi.org/10.1016/j.cell.2013.02.022.

40. Gilbert LA, Larson MH, Morsut L, Liu Z, Brar GA, Torres SE, Stern-Ginossar N, Brandman O, Whitehead EH, Doudna JA, Lim WA,Weissman JS, Qi LS. 2013. CRISPR-mediated modular RNA-guidedregulation of transcription in eukaryotes. Cell 154:442– 451. http://dx.doi.org/10.1016/j.cell.2013.06.044.

41. Fineran PC, Dy RL. 2014. Gene regulation by engineered CRISPR-Cassystems. Curr. Opin. Microbiol. 18:83– 89. http://dx.doi.org/10.1016/j.mib.2014.02.007.

42. Hale CR, Zhao P, Olson S, Duff MO, Graveley BR, Wells L, Terns RM,Terns MP. 2009. RNA-guided RNA cleavage by a CRISPR RNA-Casprotein complex. Cell 139:945–956. http://dx.doi.org/10.1016/j.cell.2009.07.040.

43. Carte J, Wang R, Li H, Terns RM, Terns MP. 2008. Cas6 is an endori-bonuclease that generates guide RNAs for invader defense in prokaryotes.Genes Dev. 22:3489 –3496. http://dx.doi.org/10.1101/gad.1742908.

44. Wu SS, Wu J, Kaiser D. 1997. The Myxococcus xanthus pilT locusis required for social gliding motility although pili are still produced.Mol. Microbiol. 23:109 –121. http://dx.doi.org/10.1046/j.1365-2958.1997.1791550.x.

45. Xu Q, Black WP, Ward SM, Yang Z. 2005. Nitrate-dependent acti-vation of the Dif signaling pathway of Myxococcus xanthus mediated bya NarX-DifA interspecies chimera. J. Bacteriol. 187:6410 – 6418. http://dx.doi.org/10.1128/JB.187.18.6410-6418.2005.

46. Black WP, Yang Z. 2004. Myxococcus xanthus chemotaxis homologs DifDand DifG negatively regulate fibril polysaccharide production. J. Bacteriol.186:1001–1008. http://dx.doi.org/10.1128/JB.186.4.1001-1008.2004.

47. Li Z. 2007. Demonstration of interactions among Dif proteins and the iden-tification of KapB as a regulator of exopolysaccharide in Myxococcus xanthus.Virginia Polytechnic Institute and State University, Blacksburg, VA.





echhttp://jb.asm

.org/D

ownloaded from

http://dx.doi.org/10.1046/j.1365-2958.2003.03582.xhttp://dx.doi.org/10.1046/j.1365-2958.2003.03582.xhttp://dx.doi.org/10.1073/pnas.0607335103http://dx.doi.org/10.1073/pnas.0607335103http://dx.doi.org/10.1016/S0378-1119(96)00546-Xhttp://dx.doi.org/10.1038/nmeth.2089http://dx.doi.org/10.1038/nmeth.2089http://dx.doi.org/10.1016/0378-1119(82)90023-3http://dx.doi.org/10.1016/0378-1119(82)90023-3http://dx.doi.org/10.1111/j.1365-2958.2006.05298.xhttp://dx.doi.org/10.1111/j.1365-2958.2006.05298.xhttp://dx.doi.org/10.1146/annurev-genet-110410-132430http://dx.doi.org/10.1146/annurev-genet-110410-132430http://dx.doi.org/10.1126/science.341.6148.833http://dx.doi.org/10.1126/science.341.6148.833http://dx.doi.org/10.1016/j.tig.2010.05.008http://dx.doi.org/10.1128/JB.00187-07http://dx.doi.org/10.1186/1745-6150-6-38http://dx.doi.org/10.1186/1745-6150-6-38http://dx.doi.org/10.1038/nrmicro2577http://dx.doi.org/10.1038/nrmicro2577http://dx.doi.org/10.1128/JB.00797-08http://dx.doi.org/10.1128/JB.01411-10http://dx.doi.org/10.1016/j.cell.2013.02.022http://dx.doi.org/10.1016/j.cell.2013.02.022http://dx.doi.org/10.1016/j.cell.2013.06.044http://dx.doi.org/10.1016/j.cell.2013.06.044http://dx.doi.org/10.1016/j.mib.2014.02.007http://dx.doi.org/10.1016/j.mib.2014.02.007http://dx.doi.org/10.1016/j.cell.2009.07.040http://dx.doi.org/10.1016/j.cell.2009.07.040http://dx.doi.org/10.1101/gad.1742908http://dx.doi.org/10.1046/j.1365-2958.1997.1791550.xhttp://dx.doi.org/10.1046/j.1365-2958.1997.1791550.xhttp://dx.doi.org/10.1128/JB.187.18.6410-6418.2005http://dx.doi.org/10.1128/JB.187.18.6410-6418.2005http://dx.doi.org/10.1128/JB.186.4.1001-1008.2004http://jb.asm.orghttp://jb.asm.org/

A CRISPR with Roles in Myxococcus xanthus Development and Exopolysaccharide ProductionMATERIALS AND METHODSBacterial strains and growth conditions.Isolation of a pilA suppressor mutant.Construction of plasmids.Construction of M. xanthus mutants.Examination of EPS production and fruiting body development.Examination of CRISPR3 expression by RT-PCR.

RESULTSIsolation of a pilA suppressor in EPS production.CRISPR3* suppressed pilB and sglK but not difA or difE.CRISPR3* is a gain-of-function mutation.CRISPR3* led to defects in fruiting body development.RAMP genes are required for CRISPR3* to exert its function.CRISPR3* may lead to increased processing of pre-crRNA.

DISCUSSIONACKNOWLEDGMENTSREFERENCES

a crispr with roles in myxococcus xanthus development …...a crispr with roles in myxococcus...

Documents