2013 jacobo, s.m.p., et. al. 1 amd-associated silent polymorphisms

2013 Jacobo, S.M.P., et. al.

1

AMD-associated silent polymorphisms in HtrA1 impair its ability to antagonize IGF-1 1

Sarah Melissa P. Jacobo1, Margaret M. DeAngelis2, Ivana K. Kim3 and Andrius Kazlauskas1,# 2

1Department of Ophthalmology, Harvard Medical School, The Schepens Eye Research Institute 3

and Massachusetts Eye and Ear Infirmary, 20 Staniford St., Boston, MA 02115, USA. 4

2Department of Ophthalmology and Visual Sciences, John A. Moran Eye Center, University of 5

Utah, 50 Mario Capecchi Drive, Salt Lake City, UT 84132, USA. 3Department of 6

Ophthalmology, Harvard Medical School, Massachusetts Eye and Ear Infirmary, 243 Charles St., 7

Boston, MA 02115, USA. #Corresponding author: [email protected], +1 8

617-912-2517 (office), +1 617-912-0101 (Fax) 9

10

RUNNING TITLE: Silent SNPs in HtrA1 ameliorate IGF-1 antagonism 11

12

WORD COUNT 13

Abstract: 166 14

Materials and Methods: 3,325 15

Introduction, Results, Discussion: 4,246 16

17

NONSTANDARD ABBREVIATIONS: 18

AMD – age-related macular degeneration; NvAMD – neovascular AMD; SNPs –single 19

nucleotide polymorphisms; CNV – choroidal neovascularization; HTRA1 – high temperature 20

requirement A1; PDZ – PSD95/Disc1/ZO-1; IGF-1 - Insulin-Like Growth Factor-1; IGFBP – 21

IGF-1 binding protein; IGFR – IGF-1 Receptor; VEGF – vascular endothelial growth factor; 22

CEC – choroidal endothelial cells 23

24

Copyright © 2013, American Society for Microbiology. All Rights Reserved.Mol. Cell. Biol. doi:10.1128/MCB.01283-12 MCB Accepts, published online ahead of print on 11 March 2013

on March 25, 2018 by guest

http://mcb.asm

.org/D

ownloaded from

http://mcb.asm.org/


2

ABSTRACT 25

Synonymous single nucleotide polymorphisms (SNPs) within a transcript’s coding region 26

produce no change in the amino acid sequence of the protein product, and are therefore 27

intuitively assumed to have neutral effect on protein function. We report that two common 28

variants of HTRA1 that increase inherited risk to neovascular age-related macular degeneration 29

(NvAMD) harbor synonymous SNPs within the exon 1 of HTRA1 that convert common codons 30

for Ala34 and Gly36 to less frequently used codons. The frequent-to-rare codon conversion 31

reduced mRNA translation rate and appeared to compromise HtrA1’s conformation and function. 32

The protein product generated from the SNP-containing cDNA displayed enhanced susceptibility 33

to proteolysis and reduced affinity for an anti-HtrA1 antibody. The NvAMD-associated 34

synonymous polymorphisms lie within HtrA1’s putative insulin-like growth factor-1 (IGF-1) 35

binding domain. They reduced HtrA1’s ability to associate with IGF-1, and to ameliorate IGF-1-36

stimulated signaling events and cellular responses. These observations highlight the relevance of 37

synonymous codon usage to protein function, and implicate homeostatic protein quality control 38

mechanisms that may go awry in NvAMD. 39

40


http://mcb.asm

.org/D

ownloaded from

http://mcb.asm.org/


3

INTRODUCTION 41

Single nucleotide polymorphisms (SNPs) that fall within the coding region have the 42

potential to alter the amino acid sequence of the gene product, and therefore can serve as a 43

Rosetta stone for understanding the pathogenesis of human disorders (68, 77). A curiosity that 44

emerged from human genome-wide association studies is that exonic SNPs that do not alter the 45

amino acid sequence of the protein product (i.e. synonymous) are as common as SNPs that do 46

(i.e. nonsynonymous) (8). Furthermore, some of the disease-associated synonymous SNPs 47

constitute the molecular underpinnings of pathology, meaning that they are enriched in affected 48

human subjects and alter the gene product. For the majority (95%) of disease-associated 49

synonymous SNPs, aberrant gene products were attributed to unstable mRNA transcripts with 50

reduced half-life, or mutations in splice sites that resulted in exon skipping (10, 11). In other 51

cases, synonymous SNPs caused translational defects independently of mRNA splicing errors (6, 52

14, 42, 57). 53

A parsimonious mechanism by which synonymous SNPs impact the integrity of protein 54

products involves the alteration of codon usage. In vivo, folding of nascent proteins proceeds co-55

translationally (21, 53), and is influenced by the rate of ribosome transit through the mRNA 56

template. What distinguishes synonymous codons that encode a given degenerate amino acid is 57

the abundance of their corresponding tRNA, which is lower for infrequently used codons than 58

for the frequently used codons (7, 71). Consequently, codon frequency can influence the rate of 59

translation. Of note, codon bias has been widely described for prokaryotes and single-celled 60

eukaryotes, but less extensively so in complex eukaryotes. 61

In humans, correlations between optimum codon usage and either protein expression (17, 62

57), or function (42, 76) have been reported. For instance, differences in translation rates for the 63


http://mcb.asm

.org/D

ownloaded from

http://mcb.asm.org/


4

β- and γ-actin isoforms were found to be due to enrichment of rare, slowly translated codons in 64

γ-, but not β-actin at identical positions within the first 100 codons. This, in turn, was the 65

determinant for altered nascent peptide conformations that rendered γ-actin amenable to 66

proteasomal degradation (76). Divergent tumor dynamics resulting from KRAS or HRAS 67

oncogene activation, in spite of functional redundancy within these family members, was partly 68

attributable to enrichment of rare codons that impeded protein translation of the KRAS isoform 69

(49). SNPs in the multidrug resistance 1 (MDR1) gene that convert common to rare codons 70

without altering the amino acid sequence did not affect expression levels, but modified substrate 71

specificity of the drug transporter P-glycoprotein, its protein product (42). 72

Recent genome-wide association studies revealed new and unexpected culprits associated 73

with inherited risk to age-related macular degeneration (AMD), the most common form of 74

blindness worldwide (4). The incidence of AMD in America is 25 million, and of these, ~75% of 75

cases involve genetic variation (19, 22, 24, 25, 44). Nearly 90% of individuals with severe vision 76

loss suffer from the neovascular form of AMD (NvAMD), which involves lesions of the Bruch’s 77

membrane and neovascularization emanating from the choroidal vasculature (1, 27, 35). SNPs 78

within the 10q26 locus (50, 59) wherein high temperature requirement A1 (HTRA1) resides, are 79

the variants most strongly associated with AMD risk overall, and in particular NvAMD (13, 14, 80

73). The protein product HtrA1 is a ubiquitously expressed protein that is enriched in fibroblasts 81

and mature epithelia, and moderately expressed in vascular endothelial cells. In the mammalian 82

eye, HtrA1 expression is highest in the epithelial layers of the avascular lens and cornea (15, 16). 83

HtrA1 has a multidomain architecture, wherein the evolutionarily conserved core domains 84

consisting of the catalytic and C-terminal PDZ binding domains are flanked at the N-terminus by 85

regulatory domains encoded by the first exon: an extracellular export signal, a Mac25 domain 86


http://mcb.asm

.org/D

ownloaded from

http://mcb.asm.org/


5

similar to that found in the insulin-like growth factor binding protein (IGFBP) superfamily, and a 87

Kazal-type Inhibitor (30, 78). In addition to its protease activity and ability to associate with 88

PDZ domain-containing ligands, HtrA1 is also capable of associating with growth factors (24, 89

31, 55, 59, 61, 70). Thus far, these annotated spectrum of functions are ascribed to the core 90

domains. The function of the less conserved N-terminal domains are less understood. 91

Two high-frequency and high-risk SNPs within the exon 1 of HTRA1, rs1049331 and 92

rs2293870, are highly penetrant and are strongly associated with increased inherited 93

susceptibility NvAMD (13). The minor, less frequent alleles of rs1049331 and rs2293870 are 94

synonymous SNPs and do not change the amino acid sequence at Ala34 and Gly36 within 95

HtrA1’s Mac25 domain. Instead, they convert codons for Ala34 (GCC to GCT; T is a minor 96

allele) and Gly36 (GGG to GGT; T is a minor allele) from common to rare (65), which in turn, 97

may influence the rate of translation and conformation of the protein product, and hence its 98

function. 99

In the course of testing this hypothesis, we discovered that the NvAMD-associated 100

synonymous SNPs within the Mac25 domain compromised HtrA1’s previously unappreciated 101

function of sequestering IGF-1, and thereby implicate new pathways and contributors to the 102

pathogenesis of NvAMD. To the best of authors’ knowledge, this is the first report ascribing a 103

function to these two high-risk exonic SNPs in NvAMD pathogenesis. 104

105

RESULTS 106

HTRA1 SNPs in NvAMD subjects 107

Previously, in a matched sibling-pair case-control study, we reported that the HTRA1 108

variants rs1049331 and rs2293870 increased inherited risk to developing NvAMD (13). Here, we 109


http://mcb.asm

.org/D

ownloaded from

http://mcb.asm.org/


6

validate our previous findings after an increase in sample size (n =270 subjects in (13) to 539 110

subjects here, Table I), and find that rs1049331 and rs2293870 were in Hardy Weinberg 111

Equilibrium (HWE) and are part of a common haplotype block. Genotype and allele frequencies 112

for rs1049331 and rs2293870 are shown in Table II. Each SNP was significantly associated 113

with increased risk to NvAMD (p <10-9 for rs1049331 and p<10-7 for rs2293870 respectively, 114

Table III). Specifically, the minor alleles of rs1049331 increased risk of AMD approximately 6-115

fold, while the minor alleles of rs2293870 increased risk of AMD approximately 3.5-fold. The 116

SNPs are in high linkage disequilibrium (LD; r2>0.75, D’>95), and each SNP was associated 117

with disease. Furthermore, the combination of homozygous minor alleles at rs1049331 and 118

rs2293870 resulted in much higher odds of NvAMD (OR = 10.6 vs. ~6 or ~3.5) than either SNP 119

alone. Given that rs1049331 and rs2293870 are in high LD and that one in every three of the 120

NvAMD subjects in our study is a homozygous carrier of both risk variants, it follows that they 121

should be examined together functionally. 122

123

NvAMD-associated SNPs in HTRA1 reduced its translation speed. 124

We determined the effect of rs1049331 (“SNP1”) and rs2293870 (“SNP2”) on mRNA 125

and protein expression. In leukocytes obtained from patients who are homozygotic for SNP1 and 126

SNP2 (“dSNP”), HTRA1 mRNA expression was comparable with age-matched unaffected 127

controls (Figure 1A). This is consistent with our previous study (13), and supports the idea that 128

these synonymous SNPs correlate with increased risk to NvAMD without altering HTRA1 129

transcription. 130

To evaluate the effect of the NvAMD-linked synonymous SNPs on secretion of HtrA1, 131

we monitored that amount of HtrA1 that accumulated in the conditioned media of unaffected vs. 132


http://mcb.asm

.org/D

ownloaded from

http://mcb.asm.org/


7

NvAMD patient-derived leukocytes after extracellular export. As shown in Figure 1B there was 133

no difference in this parameter. Figure 1B also shows that there was considerable variability 134

within cell lines of each given genotype, and thus precluded our ability to detect any small effect 135

of the NvAMD-linked synonymous SNPs on protein levels of HtrA1. As an alternative 136

approach, we measured steady-state levels of secreted HtrA1 from HEK 293T cells that were 137

transfected with empty vector (“EV”) control or HTRA1 cDNA that differed only in two single 138

nucleotide substitutions (WT vs. dSNP). We found a 1.5-fold reduction in secreted dSNP relative 139

to WT. Under these conditions, these secreted protein levels likely reflected steady-state levels 140

reached in the absence of significant autoproteolysis; parallel quantifications of the catalytically 141

inactive mutant HtrA1, S328A, showed no significant difference from WT (Figure 1C). 142

Consistent with this, measurements of HtrA1 enzymatic activity towards a validated substrate (β-143

casein) revealed that HtrA1 was a relatively slow and weak enzyme (23, 32); maximum substrate 144

degradation was reached after ~7h, and had only ~10% of the activity of an equal quantity of 145

trypsin (for which maximum substrate degradation was complete after 90 min) (Figure 1D). 146

Furthermore, dSNP was slower than WT to achieve maximal catalysis, and had comparable 147

activity to a truncation mutant of HtrA1, dMac25, which lacked amino acids 33-100 (Figure 148

1C). These studies indicate that NvAMD-linked SNPs modestly impacted the secretion of 149

HtrA1 and its catalytic activity, despite the fact that they did not change the amino acid 150

sequence. 151

We considered whether the impact of NvAMD-linked synonymous SNPs on secretion 152

and enzymatic activity may arise from slowed mRNA translation and compromised protein 153

folding. In humans, the GCC codon for alanine and GGG codon for glycine appear more 154

frequently in the exome than GCT or GGT, respectively. Thus, while SNP1 and SNP2 within 155


http://mcb.asm

.org/D

ownloaded from

http://mcb.asm.org/


8

exon 1 do not change the amino acid sequence of HtrA1, they nonetheless convert codons for 156

Ala34 and Gly36 to the genomically underrepresented, less commonly used codons for these 157

amino acids (65). Rare codons may slow translation speed because the abundance of tRNAs is 158

lower than for tRNAs utilized by common codons (7, 71). To test the hypothesis that the 159

NvAMD-associated synonymous SNPs influence the translation rate of human HtrA1, we 160

compared the rate of accumulation of full-length HtrA1 protein translated from either WT or 161

dSNP transcript, which harbors SNP1 and SNP2. We found that the rate of accumulation of 162

dSNP was significantly reduced relative to WT (Figure 1E and F). We conclude that NvAMD-163

associated SNPs have the potential to slow the rate of HtrA1 translation. This result is 164

reminiscent of a schizophrenia-associated synonymous SNP in the dopamine receptor D2 gene 165

(DRD2), which also altered the rate of translation (17). 166

167

Evidence that NvAMD-associated SNPs altered the conformation of HtrA1 168

In a previous report, changing the translation rate of chloramphenicol acetyltransferase by 169

making rare-to-common synonymous codon conversions in the mRNA template, without 170

perturbing the amino acid sequence of the enzyme, impaired its catalytic activity (46). Similarly, 171

altered protein conformation and defective drug transport function resulted from two 172

synonymous codon substitutions in the multiple drug resistance 1 (MDR1) gene (42). These 173

precedent studies suggested that dSNP HtrA1, which is translated from a transcript containing 174

NvAMD-associated SNPs, may also have altered protein conformation. To consider this 175

possibility, we subjected WT and dSNP HtrA1 produced in HEK 293T cells to partial proteolysis 176

(41, 71, 58, 56). dSNP HtrA1 was more susceptible to proteolysis than WT HtrA1 (Figure 2A). 177

The same conclusion was drawn from data obtained with a modified version of the partial 178


http://mcb.asm

.org/D

ownloaded from

http://mcb.asm.org/


9

proteolysis assay (Figure 2C). Autoproteolysis of HtrA1 was negligible under the conditions of 179

the partial proteolysis assays, and therefore unlikely to contribute to differences observed 180

between WT and dSNP HtrA1. To assess if these results were dependent on forcefully and 181

transiently expressing HtrA1 in HEK 293T cells, we performed the partial proteolysis assay on 182

endogenous HtrA1 that was secreted by dSNP leukocytes obtained from NvAMD patients or 183

age-matched unaffected controls (13, 36, 59, 62). Consistent with our findings described above, 184

human patient-derived dSNP HtrA1 displayed enhanced proteolytic susceptibility as compared 185

with HtrA1 from unaffected patients (Figure 2B and D). 186

A second approach that we used to investigate conformation was antibody recognition. 187

While an antibody to the C-terminal PDZ binding domain immunoprecipitated WT and dSNP 188

HtrA1 equally, a second antibody was much less able to recognize dSNP HtrA1 (Figure 3). This 189

second antibody was raised against a portion of HtrA1 that includes the Mac25/KI domains 190

(amino acids 33-155), which encompass Ala34 and Gly36. This finding suggests that the anti-191

Mac25/KI antibody recognizes a structural epitope within WT HtrA1 that is not present in dSNP 192

HtrA1 (71). Therefore, the conformation of dSNP HtrA1 is distinct from WT HtrA1, at least 193

within a portion of the Mac25/KI region recognized by the second antibody. 194

We conclude that NvAMD-linked synonymous SNPs in HtrA1 reduced the rate of 195

mRNA translation, increased its susceptibility to proteolysis, and diminished its affinity for an 196

antibody raised against the Mac25/KI domains. These results support the idea that NvAMD-197

linked SNPs altered HtrA1’s protein conformation. 198

199

Evidence that NvAMD-associated SNPs compromised the previously unappreciated ability 200

of HtrA1 to titer IGF-1 201


http://mcb.asm

.org/D

ownloaded from

http://mcb.asm.org/


10

Given that the NvAMD-linked synonymous SNPs reside in HtrA1's Mac25 domain, and 202

that deficits in this domain – whether by local domain misfolding or truncation - appear to 203

compromise proteolytic activity (Figure 1D), we further characterized the effect of the 204

synonymous SNPs on the ability of HtrA1 to engage a candidate binding partner. The following 205

findings suggest that HtrA1 associates with IGF-1, and that this interaction depends on the 206

Mac25 domain. Comparison of the crystal structure of the HtrA1 Mac25/KI fragment with the 207

crystal structure of the Mac25-containing IGFBP4 in complex with IGF-1 reveals that this 208

portion of HtrA1 is very likely to bind IGF-1. Surface residues in IGFBP4 that contact IGF-1 209

within 3.5Å proximity are preserved in HtrA1 (18), including the Ala34 and Gly36 positions, 210

which are within the N-terminal hydrophobic stretch that constitutes part of the high-affinity 211

binding site for IGF-1 (67). These structural studies also indicate that HtrA1’s Ala34 and Gly36 212

probably contact IGF-1’s Phe37-Tyr38-Phe39 motif, which is important for associating with the 213

IGF-1 receptor I (IGFRI) (9). These observations suggest that HtrA1 binds IGF-1, and that the 214

NvAMD-linked dSNPs may compromise this ability. 215

To determine whether HtrA1’s Mac25 domain is necessary or sufficient to bind IGF-1, 216

we expressed human HtrA1’s Mac25 and Mac25-KI domains as glutathione-S-transferase (GST) 217

fusion proteins. In GST pull down assays with recombinant purified human IGF-1, HtrA1’s 218

Mac25 and Mac25-KI domains captured IGF-1, whereas GST alone did not (Figure 4A). These 219

findings indicate that HtrA1’s Mac25 domain was capable of associating with IGF-1. 220

We also tested if full-length HtrA1 associated with IGF-1, and whether this function was 221

affected by NvAMD-linked SNPs. To this end we immunoprecipitated HtrA1 from the 222

conditioned media of HEK 293T cells that were transfected with EV, WT or dSNP HTRA1 223


http://mcb.asm

.org/D

ownloaded from

http://mcb.asm.org/


11

cDNA, and found that IGF-1 co-immunoprecipitated with WT, but not dSNP HtrA1 (Figure 224

4B). 225

To complement the above-described studies, we tested if IGF-1 influenced the proteolytic 226

susceptibility of HtrA1. Association with a ligand may alter protein conformation by induced fit 227

and thus influence protease susceptibility (62). As shown in Figure 4C and D, pre-equilibration 228

of recombinant purified human HtrA1 with a two-fold molar excess of purified IGF-1 enhanced 229

its protease susceptibility. Similar results were obtained when this experiment was repeated with 230

HtrA1 produced by cell lines derived from unaffected patients (Figure 4E and F). In contrast, 231

IGF-1 failed to alter the protease susceptibility of HtrA1 produced by cell lines from patients that 232

harbor the NvAMD-linked SNPs (Figure 4E and F). This differential enhancement of protease 233

susceptibility upon ligand association, in spite of identical amino acid sequences, is reminiscent 234

of the effects of synonymous rare codon substitutions in MDR1 on the ligand interactions of its 235

gene product P-glycoprotein (42). 236

Mac25-encoding members of the IGFBP superfamily promote or inhibit IGF-1 237

bioactivity (37, 20, 33, 30). To investigate whether HtrA1 influences the potency of IGF-1 238

directly, we evaluated the effect of HtrA1 on IGF-1-induced activation of IGFR and Akt. Acute 239

(5 min) stimulation of primary human choroidal endothelial cells (CECs) with IGF-1 increased 240

IGFR phosphorylation and Akt activation. Furthermore, when IGF-1 (5 ng) was pre-equilibrated 241

with increasing concentrations of purified HtrA1, IGFR autophosphorylation and Akt activation 242

were reduced in a dose-dependent manner (Figure 5A to C). We do not think that HtrA1 243

reduced the potency of IGF-1 by cleaving it because attempts to proteolyze IGF-1 with HtrA1 244

failed, even under much more favorable conditions than those used in Figure 5 (unpublished 245

observation). 246


http://mcb.asm

.org/D

ownloaded from

http://mcb.asm.org/


12

In contrast to WT HtrA1, both dSNP and dMac25 failed to antagonize IGF-1-mediated 247

IGFR and Akt activation (Figure 5D to F). Furthermore, HtrA1 produced by leukocytes from 248

unaffected patients, but not from dSNP NvAMD patients, also suppressed IGF-1-mediated 249

signaling events (Figure 5H to I). HtrA1 was essential to the activity of the patient-derived 250

leukocyte conditioned media; adding an anti-HtrA1 neutralizing antibody before CEC 251

stimulation ameliorated the antagonism of IGF-1-mediated signaling events (Figure 5H to I). 252

Taken together, these data indicate that HtrA1 is capable of binding IGF-1 and thereby 253

antagonizing its ability to activate IGFR-mediated signaling events. Furthermore, the NvAMD-254

associated SNPs compromised the ability of HtrA1 to ameliorate IGF-1-mediated signaling. 255

256

NvAMD-associated SNPs diminished HtrA1’s ability to govern angiogenesis-related 257

functions 258

In healthy eyes, HtrA1 is most abundantly expressed in the avascular lens and corneal 259

epithelia. More moderate expression has been detected in the retinal pigment epithelia and 260

photoreceptor layers of the posterior eye (15, 16, 73). This appears to overlap with IGF-1/IGFR 261

expression. IGF-1 is produced by the photoreceptors and RPE (51). In vascular endothelial cells, 262

IGFR activation has been shown to modulate angiogenesis via multiple mechanisms (5): by 263

directly stimulating endothelial proliferation and survival (2), by augmenting the expression of 264

VEGF-A (58, 64), and by modulation of VEGF-A receptor activation (47, 28). Given these 265

precedence, and in light of the fact that IGF-1 and IGFR immunoreactivity are detected in 266

choroidal neovessels of NvAMD subjects (48), we considered if IGF-1 promotes angiogenesis of 267

cultured choroidal endothelial cells, and whether HtrA1 influences this activity. 268


http://mcb.asm

.org/D

ownloaded from

http://mcb.asm.org/


13

Indeed, in an in vitro model of angiogenesis, IGF-1 promoted primary human CECs to 269

organize into tubes (Figure 6A and B). We next evaluated the impact of HtrA1 on this IGF-1-270

driven system, and more importantly, asked whether NvAMD-associated SNPs uncouple HtrA1 271

from this function. Consistent with our hypothesis, HEK 293T-derived WT, but not dSNP, 272

antagonized IGF-1-mediated tube formation. The observation that dMac25 HtrA1 was unable to 273

influence this IGF-1-dependent response further supported the idea that association with IGF-1 274

was dependent on the Mac25 domain (Figure 6C). 275

In addition, given that blood-borne infiltrating leukocytes are present in CNV lesions of 276

NvAMD patients (74) and contribute to pathological angiogenesis (60), we asked whether 277

patient leukocyte-derived HtrA1 influenced choroidal tube formation in vitro. Complementary to 278

the results described above, HtrA1 from unaffected patients attenuated IGF-1-mediated tube 279

formation, and this response was diminished when an anti-HtrA1 antibody was added (Figure 280

6D). Finally, dSNP HtrA1 derived from NvAMD affected patients was unable to prevent IGF-1-281

driven organization of CECs into tubes (Figure 6D). Our results indicate that HtrA1 suppressed 282

IGF-1-mediated CEC tube formation, and that NvAMD-associated synonymous SNPs within the 283

Mac25 domain compromised this function. 284

285

DISCUSSION 286

The existing catalogue of NvAMD-associated SNPs mapped within HTRA1 at the 10q26 287

locus serves as a starting point to investigate the pathogenesis of NvAMD. Herein we report the 288

functional consequences of two high frequency, high risk, and highly penetrant synonymous 289

SNPs in HTRA1, rs1049331 and rs2293870, which are in high linkage disequilibrium and part of 290

a common haplotype block. Our in vitro studies presented here demonstrate the subtle but 291


http://mcb.asm

.org/D

ownloaded from

http://mcb.asm.org/


14

deleterious tandem contribution of synonymous substitutions at Ala34 and Gly36. Translation of 292

HtrA1 from a transcript harboring these NvAMD-associated SNPs is slower. The protein product 293

appears to have altered conformation and is dysfunctional, in spite of having an amino acid 294

sequence identical to the WT. More specifically, while WT HtrA1 titrates IGF-1 and thereby 295

governs IGF-1-driven signaling events and cellular responses, dSNP HtrA1 is uncoupled from 296

these functions. 297

The contribution of HTRA1 genetic variants to inherited susceptibility to NvAMD that we 298

described here increases with gene dosage; homozygotic individuals are at greater risk than 299

heterozygotic carriers. Specifically, the combination of homozygous risk alleles at both these 300

SNPs (found in 1 out of 3 of the total NvAMD affected subjects in our study) together account 301

for the greatest risk of NvAMD then either SNP alone (Tables I-III). Although our results reveal 302

that either rs1049331 or rs229870 was highly penetrant in heterozygotes (Tables II, III), we 303

have not looked into the independent contribution of synonymous substitutions to each position, 304

nor determined the minimum number of copies of each SNP that is required for observable 305

modifications in protein function. 306

The differences we observed in protease-exposed surface and affinity for domain-specific 307

antibodies between WT and dSNP HtrA1 are consistent with the idea that a lag in protein 308

translation due to common-to-rare codon conversion influences the attainment of a 309

conformationally mature protein (3, 42, 46, 75). Our qualitative assays of protein structure 310

suggest that misfolding of dSNP HtrA1 as a result of impeded mRNA translation is local, rather 311

than global. This is supported by the fact that we were able to overexpress and detect dSNP 312

HtrA1 in HEK 293T cells without vast differences (>1.5) in steady-state protein levels. An anti-313

C-terminal tail antibody, but not an anti-Mac25/KI antibody immunoprecipitated WT and dSNP 314


http://mcb.asm

.org/D

ownloaded from

http://mcb.asm.org/


15

comparably. Moreover, dSNP HtrA1 remained capable of digesting a validated substrate, albeit 315

less efficiently than did WT. Therefore, dSNP likely represents a partially mature intermediate 316

that is unlikely to be terminally misfolded, and thus able to escape degradative protein quality 317

control mechanisms that would have otherwise cleared the nascent dSNP polypeptide 318

immediately after ribosome exit (76) or dramatically reduced protein half-life. These results are 319

reminiscent of a coding-region SNP in CFTR, which resulted in local domain misfolding, 320

prolonged ER residence time, and prevented complex glycosylation (3, 75). Although heat-321

shock proteins are known to be rapidly upregulated in response ER stress, we have not assessed 322

to what extent – if at all - dSNP can activate the unfolded protein response. The local domain 323

misfolding as a result of the NvAMD-linked synonymous SNPs thus allows the long and slow 324

accumulation of conformationally and functionally defective HtrA1 over time. 325

Our observation that deficits in HtrA1’s Mac25 domain - whether by local domain 326

misfolding or truncation - compromise the catalytic activity suggests positive cooperation 327

between the N-terminal domains and the catalytic domain. Whether this allosteric relationship is 328

significant in vivo, or will hold true towards physiological HtrA1 substrates remains to be tested. 329

HtrA1 polymorphic variants with reduced catalytic activity have been previously found in human 330

subjects afflicted with a lethal monogenic cerebral vasculopathy (26, 55, 59) 331

In spite of the critical role for the IGF-1/IGFR pathway in the vasculature (47), and our 332

existing knowledge of the IGF binding protein superfamily (33), gaps remain in our 333

understanding of IGF-1 regulation. For instance, in a previous study that mapped the 334

complement of proteins involved in the IGF-1/IGFR pathway in the human retina (51), it was 335

interesting to note that of the different IGFBPs detected (IGFBP2, -3, -4, -5,-7), expression of 336

only IGFBP3 changed during pathological retinal angiogenesis (51). These findings suggest the 337


http://mcb.asm

.org/D

ownloaded from

http://mcb.asm.org/


16

existence of a hierarchy within the IGFBP family. How HtrA1 interfaces with canonical IGFBPs 338

to govern IGF-1 activity and angiogenesis will require additional investigation. 339

Our findings support the idea that HtrA1 keeps IGF-1 levels in check and therefore 340

regulates angiogenic homeostasis (36). Furthermore, if this function is compromised, as is the 341

case in patients harboring dSNPs, the balance shifts to favor angiogenesis and thereby permits 342

accumulation of the choroidal neovessels. This hypothesis predicts that suppressing IGF-1 has 343

the potential to protect patients from developing NvAMD (48). These findings offer a 344

complementary understanding of HtrA1’s multiple functions, based on the catalogue of 345

NvAMD-associated SNPs (77) and existing HtrA1 animal models (38, 72). For instance, the 346

most prevalent HTRA1 variant, rs11200638, harbors a SNP within the promoter region, and 347

thereby suggests that increased expression of HTRA1 may contribute to NvAMD (14, 73). 348

Taking this lead from human epidemiological findings, two groups subsequently overexpressed 349

HtrA1 specifically in RPE cells (38, 72). Although both groups found that the RPE cells were 350

intact, one group found atrophic choriocapillaris (38). This is consistent with our proposed 351

function in the eye; in these mice, HtrA1 overexpressed in the RPE possibly served as an IGF-1 352

sink, and therefore compromised photoreceptor and choriocapillaris survival. It is interesting to 353

note that in these animal models, the Bruch’s membrane remained relatively intact, in spite of the 354

fact that various components such as collagen (54, 70) and fibronectin (23) have been validated 355

as HtrA1 substrates. This is consistent with the lack of spontaneous neovascularization or 356

basement membrane lesions in the lens or cornea, wherein HtrA1 expression far exceeds that in 357

the RPE. Inevitably, the activity of HtrA1 in vivo depends on the balance between binding 358

partners that act like scaffolds to trap HtrA1 and effectively increase its local concentration (e.g. 359


http://mcb.asm

.org/D

ownloaded from

http://mcb.asm.org/


17

fibronectin (23)), and those that may directly influence the catalytic domain, such as the inhibitor 360

heparin (31) or Serpin A1 (32). 361

The IGF-1/IGFR signaling axis constitutes one of the best-characterized and highly 362

conserved aging pathways (40). Antagonism of the IGF-1/IGFR signaling axis is associated with 363

longevity in various model organisms (29, 40, 43). Pharmacological or genetic ablation of IGFR 364

protects mice from age-related disorders (12, 21, 30, 64). This function of IGF-1 supports the 365

concept that HtrA1 function may protect from an age-related disease (23, 69) such as NvAMD. 366

In addition to NvAMD, HtrA1 has been implicated in other age-related disorders like arthritis 367

(32) and Alzheimer’s disease (23, 69). HtrA1 expression increases with age (52). It is thus 368

interesting to note that the NvAMD-linked SNPs described here are germline; carriers who 369

harbor the HTRA1 risk variants have them from birth, and yet their deleterious consequences do 370

not develop until later in life in those patients who develop NvAMD. This may be indicative of 371

the time it takes for the manifestation of the pathological consequences of conformationally 372

defective HtrA1. It is conceivable that in NvAMD-afflicted patients who harbor dSNP HtrA1, 373

the protein folding machinery in the ER may be jammed with an ensemble of partially unfolded 374

proteins that escape little by little over time, and that cumulative ER damage (upregulated but 375

underperforming components) may be a contributing risk factor in age-related macular 376

degeneration (79, 80). 377

378

MATERIALS AND METHODS 379

Ethics Statement. This study was reviewed and approved by the Institutional Review Boards 380

(IRBs) at the Massachusetts Eye and Ear Infirmary and the University of Utah, and conforms to 381


http://mcb.asm

.org/D

ownloaded from

http://mcb.asm.org/


18

the tenets of the Declaration of Helsinki. Written informed consent was obtained from all 382

participants. 383

384

Subjects and Phenotypes. Our study had 500 sibling pairs comprised of 656 individuals as 385

previously described. Details of recruitment diagnostic criteria and subject classification are 386

described elsewhere (39, 63). 387

388

Genotyping Analysis. Leukocyte DNA was purified by using either the standard phenol 389

chloroform or the DNAzol (Invitrogen Corp., Carlsbad, CA) extraction protocol. Previously 390

reported oligonucleotide primers were used to amplify exon 1 and the flanking intronic sequence 391

for HTRA1 (13). For sequencing reactions, PCR products were digested according to the 392

manufacturer’s protocol with exonuclease I and shrimp alkaline phosphatase (USB Products, 393

Affymetrix, Inc., Cleveland, OH), then subjected to a cycle sequencing reaction using the Big 394

Dye Terminator 3.1 Cycle Sequencing kit (Applied Biosystems, Foster City, CA) according to 395

the manufacturer’s protocol. Products were purified with Performa DTR Ultra 96-well plates 396

(Edge Biosystems, Gaithersburg, MD) to remove excess dye terminators. Samples were 397

sequenced on an ABI Prism 3100 DNA sequencer (Applied Biosystems). Electropherograms 398

generated from the ABI Prism 3100 were analyzed using the Lasergene DNA and protein 399

analysis software (DNASTAR, Inc., Madison, WI). Electropherograms were read by 2 400

independent evaluators without knowledge of the subject’s disease status. All patients were 401

sequenced in the forward direction (5’–3’) unless additional variants, polymorphisms, or 402

mutations were identified, in which case confirmation was obtained in some cases by sequencing 403

in the reverse direction. 404


http://mcb.asm

.org/D

ownloaded from

http://mcb.asm.org/


19

405

Statistical Analysis. SNPs were tested for association with all AMD subtypes and neovascular 406

AMD alone using the minor allele, as defined by the allele occurring less frequently in the 407

normal subjects. Odds ratios and corresponding 95% confidence interval and p values were 408

obtained using SAS (v9.1) and conditional logistic regression (CLR) under an additive genetic 409

model. Linkage disequilibrium (LD) (r2) between each of the SNPs was determined using 410

Haploview (http://www.broad.mit.edu/mpg/haploview/). Deviation from Hardy–Weinberg 411

equilibrium was tested on each SNP using the chi-square test in the unaffected population. 412

413

Cell Culture and Transfection. All reagents are from Life Technologies (Grand Island, NY) 414

unless indicated otherwise. Epstein-Barr Virus (EBV) transformed human lymphoblastoid cell 415

lines derived from neovascular AMD subjects homozygotic for rs1049331 and rs2293870 or age-416

matched unaffected controls were collected and genotyped as described above. Cultures were 417

maintained in Iscove’s Modified Eagle Medium supplemented with 10% fetal bovine serum 418

(FBS, Lonza, Walkersville, MD). Primary adult human choroidal endothelial cells (a generous 419

gift from Dr. Mary Elizabeth Hartnett, University of Utah, USA) were seeded on tissue culture 420

dishes coated with 0.2 % gelatin (Sigma, St. Louis, MO) and maintained in Medium 199 421

supplemented with 20% bovine calf serum (BCS, Hyclone, Logan, UT), 100 μg/ml heparin, 12 422

μg/ml bovine pituitary extract (Hammond Cell Tech, Windsor, CA), and 100 U/ml Penicillin G 423

and 100 μg/ml Streptomycin C (Gemini Bioproducts, West Sacramento, CA). For all 424

experiments, CECs between passages 2 to 8 were used. Human Embryonic Kidney 293T cells 425

were cultured in Dulbecco’s Modified Eagle Medium with 4.5 g/ml D-glucose and 10% FBS. 426

For transient overexpression of recombinant HtrA1, 2x106 HEK 293T cells were transfected with 427


http://mcb.asm

.org/D

ownloaded from

http://mcb.asm.org/


20

8 μg pCINeo-encoded constructs using Trans-IT 293 (Mirus) according to the manufacturer’s 428

recommendation. 429

430

Quantitative Real-Time PCR. Total RNA from human leukocytes (10cell lines for each 431

genotype) was harvested with the RNeasy kit followed by cDNA synthesis using Omniscript 432

reverse transcriptase (Qiagen, Valencia, CA). To quantify HTRA1 mRNA, we performed real-433

time quantitative PCR with human HtrA1- (Hs01016151_ml) or GAPDH-specific 434

(Hs99999905_ml) TaqMan Gene probes (Applied Biosystems) on ABI 7900 HT. For each of the 435

cell lines, mRNA expression was analyzed in triplicate. HtrA1 expression levels were expressed 436

as the cycle threshold double derivative, normalized to GAPDH levels. 437

438

HtrA1 secretion assay. Human leukocytes from unaffected (5 cell lines) or NvAMD-affected (5 439

cell lines) subjects were cultured in suspension at a density of 10x106 in IMDM. At each 440

indicated time point, serum-free conditioned media was collected, and cells were lysed in RIPA 441

buffer (150 mM NaCl, 10 mM Na2HPO4, 10 mM NaH2PO4, 2 mM EDTA, 1% sodium 442

deoxycholate, 1% NP-40, 0.21% SDS, 20 μg/ml aprotinin, 50 mM NaF, 2 mM Na3VO4, 1 mM 443

PMSF, 14 mM β-mercaptoethanol). For quantification of secreted HtrA1, equal volumes (50 μl 444

aliquots) of the conditioned media were loaded on a protein gel. HtrA1 was quantified by 445

immunoblot, and the membranes were stripped and reprobed with Serpin A1 as loading control 446

(ab9373, Abcam). For quantification of cellular HtrA1, total protein concentration in the lysates 447

was measured by BCA assay (Pierce Protein Products, Rockford, IL), and equal proteins levels 448

were resolved on a gel. RasGAP (45) was used as loading control. HtrA1 levels are expressed as 449

[secreted HtrA1]/[secreted+cellular HtrA1] after normalizing to loading controls and correcting 450


http://mcb.asm

.org/D

ownloaded from

http://mcb.asm.org/


21

for dilution. Each data point represents the mean + SEM of 3 independent experiments for each 451

cell line. 452

453

Preparation of Plasmids. Human HtrA1 cDNA (brain clone, IMAGE accession ID: 5289018) 454

was purchased from Open Biosystems (Hunstville, AL). For all experiments requiring 455

recombinant HtrA1, this clone was modified to remove the 5’ and 3’ untranslated regions. The 456

point substitutions C144>T and T775>G were introduced by site directed mutagenesis to 457

construct “WT” human HtrA1 identical to RefSeq NM_002775. The coding region of HtrA1 was 458

PCR-amplified with Phusion High Fidelity DNA Polymerase (New England Biolabs, Beverly, 459

MA). The EcoRI and XbaI fragment generated with the forward oligo 460

TATGAATTCGCCCACCATGCAGATCCCGCGC and the reverse oligo 461

ATATCTAGACTATGGGTCAATTTCTTC was ligated with the pCINeo mammalian 462

expression vector (Promega, Madison, WI), downstream of a T7 RNA promoter and a Kozak 463

sequence. “WT” human HtrA1 was constructed by splice overlap extension using two-step PCR 464

to improve the efficiency of amplifying the GC-rich template. In the first step, the EcoRI forward 465

or XbaI reverse “outer oligos” were paired with the appropriate “inner oligos” listed below to 466

amplify the 5’ half or the 3’ half of full-length HtrA1. To generate the full-length HtrA1 coding 467

region in the second step, 5’ and 3’ PCR products from the preceding step were used as 468

templates for amplification with the “outer oligos”. 469

470

For C144>T: 471

forward oligo: GCCTTTGGCCGCCGGGTGCCCAGACCGCTG 472

reverse oligo: CAGCGGTCTGGGCACCCGGCGGCCAAAGGC 473


http://mcb.asm

.org/D

ownloaded from

http://mcb.asm.org/


22

474

For T775>G 475

forward oligo: ATCAAGGATGTGGATGAGAAAGCAGACATC 476

reverse oligo: GATGTCTGCTTTCTCATCCACATCCTTGAT 477

478

All oligo syntheses and validation of nucleotide sequences were done by the DNA core facility 479

of Massachusetts General Hospital (Cambridge, MA). 480

481

Expression Cloning - The panel of constructs that encode the synonymous mutations Ala34 482

(GCC>GCT) and Gly36 (GGG>GGT) or the Mac25 domain truncation mutant, dMac25 were 483

constructed by splice overlap extension using two-step PCR as described above using the 484

following oligos: 485

486

For the double mutant Ala34 (GCC to GCT) + Gly36 (GGG to GGT): 487

forward oligo - CGCTCGGCGCCTTTGGCtGCCGGtTGCCCAGACCG 488

reverse oligo - CTCGCAGCGGTCTGGGCAaCCGGCaGCCAAAGGCGCC 489

490

For dMac25 (retains the signal peptide but lacks amino acids 33-100): 491

forward oligo - GGCCGCTCGGCGCCTGTGCGGCGGCGCGCG 492

reverse oligo - CGCGCGCCGCCGCACAGGCGCCGAGCGGCC 493

494

For S328A 495

forward oligo - GCCATCATCAACTATGGAAACGCGGGAGGCCCGTTAGTG 496


http://mcb.asm

.org/D

ownloaded from

http://mcb.asm.org/


23

reverse oligo - CACTAACGGGCCTCCCGCGTTTCCATAGTTGATGATGGC 497

498

Enzyme activity assays – Conditioned media (serum, phenol red-free DMEM) from transiently 499

transfected HEK 293T cells that contained HtrA1 was supplemented with protease inhibitors, 500

buffered to pH 8.5 with TBS, and used to digest FITC-labeled β-Casein (10 μg/ml final; 500 501

ng/well) according to manufacturer’s instructions. For comparison, TPCK-Trypsin (1 μg/ml 502

final; 200 ng/well) served as a positive control. The HEK 293T-derived HtrA1 constructs, WT, 503

dSNP, dMac25, and S328A (1 μg/ml final; 200 ng/well), were assayed in parallel to empty 504

vector “EV” conditioned media. Reaction components were mixed on ice. Enzyme activity at 505

370C was measured by monitoring the time-dependent increase in fluorescence of the labeled 506

substrate. At each time point, Relative Fluorescence Units were expressed as % of maximum 507

(defined as the RFU for WT HtrA1 at the endpoint) after baseline subtraction (“baseline” wells 508

for each reaction mix component were set up: TBS, DMEM, β-Casein, or conditioned media). 509

RFUs were measured every 10 minutes from duplicate wells. Data acquisition was performed 510

with a Synergy 2 plate reader interfaced with Gen 5 software (Biotek Instruments, Inc., 511

Winooski, VT). Data points were analyzed by non-linear regression after curve-fitting to a 512

pseudo first-order enzyme reaction. For those HtrA1 constructs that retained catalytic activity, 513

the goodness-of-fit are as follows: WT, r2 = 0.95; dSNP, r2 = 0.92; and dMac25, r2 = 0.89. The 514

RFUs measured for S328A were not significantly different from EV. 515

516

In Vitro Transcription and Translation - pCINeo-encoded HtrA1 constructs were blunted by 517

HpaI-linearization to include the SV40 late polyadenylation signal, and used as template for 518

capped cRNA synthesis for 2 hrs at 370C using the T7 mMessage MaxiScript kit (Ambion, Life 519


http://mcb.asm

.org/D

ownloaded from

http://mcb.asm.org/


24

Technologies). cRNA products were purified by ammonium acetate precipitation after cDNA 520

template digestion with Turbo DNAse for 30 min at 370C. Equal amounts of HtrA1 cRNA 521

products were visualized on a 5% acrylamide/8M urea gel to validate transcript yield and size. 522

The in vitro transcription yields were typically 5.48 + 0.55 μg/μl. cRNA templates were diluted 523

to equal stock concentrations (2.0 μg/μl) and 1.0 μl of the diluted cRNA was used in a 25 μL in 524

vitro translation reaction at 250C using the Flexi Rabbit Reticulocyte Lysate (Promega) in the 525

presence of biotinylated Transcend tRNA (Promega), and supplemented with the 26S 526

proteasome blocker MG132 (25 μM final) and 20S proteasome inhibitor IV Z-GPFL-CHP (100 527

μM final) (EMD Biosciences, La Jolla, CA). Linearized Renilla Luciferase cRNA or nuclease-528

free water was used as positive or negative control, respectively. Reaction components were 529

mixed on ice before 2.5 μL aliquots were removed from the master mix at the indicated time 530

points. To stop the translation, samples were returned on ice, immediately mixed with sample 531

buffer containing SDS and DTT, and immediately boiled for 5 min before SDS-PAGE and 532

immunoblot analysis. The amount of full-length HtrA1 or Renilla Luciferase was visualized by 533

immunoblot with anti-HtrA1 antibody (sc-130780, Santa Cruz Biotechnology, CA) or 534

streptavidin-HRP and Transcend Non-Radioactive Translation Detection System (Promega). The 535

amount of full-length HtrA1 is expressed as % of maximum concentration synthesized after 120 536

min and normalized to RasGAP. Full-length HtrA1 accumulation with time was analyzed after 537

curve-fitting to the pseudo-first order kinetic equation to calculate the time constant from the 538

reciprocal of the rate constant: C = (Cmax)*(1-exp(-Kt)); Where C is the amount of full-length 539

HtrA1 at any time t, Cmax is the amount at 120 min, and K is the rate constant. The goodness-of-540

fit are as follows: For WT, r2 = 0.89; dSNP, r2 = 0.81. 541

542


http://mcb.asm

.org/D

ownloaded from

http://mcb.asm.org/


25

Partial Proteolysis Assays. Human leukocytes from unaffected or affected subjects were 543

cultured in suspension at a density of 10x106 in serum-free IMDM for ten days. Conditioned 544

media from each cell line was first assayed for HtrA1 expression by immunoblot and measured 545

against known quantities of purified recombinant human HtrA1 as standard (B-Bridge 546

International, Cupertino, CA). Cell lines with matched or comparable secreted HtrA1 protein 547

levels were chosen for partial proteolysis assays. For unaffected (pool of 3) or dSNP (pool of 4) 548

cell lines, a master mix of pooled conditioned media containing approximately 5 μg HtrA1 was 549

buffered with ice-cold TBS (150 mM Tris-HCl pH 8.0, 100 mM NaCl) supplemented with 1% 550

final β-mercaptoethanol to stop HtrA1 degradation. The master mix was exposed to 250 μg/ml 551

TPCK-Trypsin (Boehringer-Ingleheim, Ridgefield, CT) or an equal volume of buffer at 370C. 552

This amount of TPCK-Trypsin retained >90% protease activity in the presence of β-553

mercaptoethanol. Aliquots (50 μl) were removed from the master mix at the indicated time points 554

and immediately mixed with ice-cold sample buffer containing SDS and DTT, boiled for 5 min, 555

and thereafter analyzed for levels of full-length HtrA1 by immunoblot. For partial proteolysis of 556

293T-derived HtrA1, pCINeo-encoded WT or double mutant was transfected into cells. Serum-557

free DMEM was conditioned for 72h and first assayed for HtrA1 protein levels to ensure equal 558

protein levels of WT and dSNP. Conditioned media containing approximately 1 μg WT or dSNP 559

was used in a master mix, exposed to 10 μg/ml TPCK-Trypsin and analyzed as described above. 560

The amount of full-length, undigested HtrA1 remaining was visualized by western blot with anti-561

HtrA1 antibody. 562

563

Rapid Partial Proteolysis Assay. HtrA1-containing conditioned media from human leukocytes 564

or HEK 293T cells were pre-incubated at the indicated partial denaturation temperatures for 10 565


http://mcb.asm

.org/D

ownloaded from

http://mcb.asm.org/


26

min before exposure to 25 μg/ml or 1 μg/ml TPCK-Trypsin at 370C for 5 min. For all partial 566

proteolysis assays, PVDF membranes were stripped of antibodies and reprobed with rabbit anti-567

Serpin A1 antibody (Abcam, Cambridge, MA) as loading control. Protease exposed surface was 568

expressed as remaining full-length undigested HtrA1 in the presence or absence of trypsin, and 569

normalized to loading control. 570

571

GST pull-down assays. The first step in generation of the GST fusion proteins was PCR 572

amplification of nucleotide sequences that encode HtrA1’s Mac25 (amino acids 33-100) and 573

Mac25-KI (amino acids 33-155). A five amino acid linker (AARVA) and BamH1/EcoR1 cloning 574

sites were included to facilitate in frame ligation into the pGEX-2T vector (GE Healthcare, 575

Piscataway, NJ), downstream of the GST cassette. The following PCR primers were used: 576

577

For Mac25 (amino acids 33-100) 578

forward oligo: ATGGATCCGCCGCCAGAGTCGCCATGCAGATC 579

reverse oligo: ATTGAATTCCGTGGCCGAGGCTGG 580

581

For Mac25-KI (amino acids 33-157) 582

forward oligo: ATGGATCCGCCGCCAGAGTCGCCATGCAGATC 583

reverse oligo: ATTGAATTCCTGCCCTTGGCCGCAGGC 584

585

Expression of the GST fusion peptide in E.coli was induced by isopropylthiogalactopyranoside 586

(IPTG, 0.1 mM) overnight at 250C. GST fusions were affinity purified from the soluble fraction 587

using glutathione-agarose 4B beads according to the manufacturer’s instructions (GE 588


http://mcb.asm

.org/D

ownloaded from

http://mcb.asm.org/


27

Healthcare). The washed glutathione-agarose 4B beads that had been loaded with the desired 589

fusion proteins were resuspended in PBS supplemented with protease inhibitors. GST (empty 590

vector control) and GST-HtrA1 fusion proteins were percolated with excess IGF-1 for 8 h at 40C. 591

The agarose slurry was washed three times with RIPA buffer. Bound proteins were recovered by 592

boiling in sample buffer. Proteins were resolved by SDS-PAGE and transferred to PVDF 593

membranes. GST and GST fusion proteins were probed with custom rabbit polyclonal antibodies 594

(described below). To assay IGF-1 pull-down, the bottom portion of the PVDF membrane below 595

the 15 kDa Mr marker was probed with a monoclonal anti-IGF-1 antibody (clone Sm1.2, 05-172, 596

EMD Millipore, Billerica, MA). 597

598

Generation of HtrA1 Antibody. The Mac25/KI domain-specific anti-HtrA1 antibody was 599

raised against a fusion peptide of GST and HtrA1 fragment (described above). After GST 600

pulldown, the purity of the GST-Mac25/KI peptide was verified by SDS-PAGE followed by 601

Coomassie staining, before 1 mg aliquots were submitted for rabbit immunization and antisera 602

preparation (Alpha Diagnostics, San Antonio, TX). 603

604

Immunoprecipitation of HtrA1. Conditioned media from HEK293T cells transfected with 605

pCINeo empty vector, WT or dSNP HtrA1 cDNA was incubated overnight at 40C with rabbit 606

polyclonal antibody specific for the HtrA1 C-terminal tail from Santa Cruz Bioctechnology (sc-607

130780), or custom rabbit antisera (11276, Alpha Diagnostics). For pull-down assays, the 608

immune complex was precipitated with Protein A/G Plus agarose beads (Santa Cruz 609

Biotechnology) and washed twice with extraction buffer (EB, 10 mM Tris-HCl pH 7.4, 5 mM 610

EDTA, 50 mM NaCl, 50 mM NaF, 1% Triton X-100, 20 μg/ml Aprotinin, 2mM Na3VO4, 1 mM 611


http://mcb.asm

.org/D

ownloaded from

http://mcb.asm.org/


28

PMSF) and PAN buffer (10 mM PIPES pH 7.0, 150 mM NaCl, 10 μg/ml Aprotinin, 1 mM 612

PMSF). Bound proteins were eluted by boiling in sample buffer, resolved on a protein gel, and 613

immunoblotted with mouse monoclonal anti-HtrA1 antibody (R & D systems, Minneapolis, 614

MN). 615

For co-immunoprecipitation of HtrA1 with IGF-1, HEK 293T-derived WT or dSNP 616

HtrA1 (1 μg) was pre-incubated with three-fold molar excess of recombinant human IGF-1 617

(Peprotech, Rocky Hill, NJ) for 2 hrs at 40C. HtrA1 was immunoprecipitated with rabbit 618

polyclonal antibody (sc-130780, Santa Cruz Biotechnology) after overnight incubation. To 619

visualize IGF-1, the corresponding bottom half of the PVDF membrane was probed with mouse 620

monoclonal anti-IGF-1. 621

622

Effect of IGF-1 on the Protease Susceptibility of HtrA1. Human leukocytes from unaffected 623

or NvAMD affected subjects were cultured in suspension at a density of 10x106 in serum-free 624

IMDM for ten days. Conditioned media from each cell line was first assayed for HtrA1 625

expression against known quantities of standard, purified HtrA1 by immunoblot, and cell lines 626

with matched or comparable secreted HtrA1 protein levels were chosen for partial proteolysis 627

assays. For unaffected (pool of 3) or dSNP (pool of 4) cell lines, a master mix of pooled 628

conditioned media containing approximately 500 ng HtrA1 was buffered with ice-cold TBS (150 629

mM Tris-HCl pH 8.0, 100 mM NaCl) and pre-equilibrated with two-fold molar excess of IGF-1 630

for 2 hrs at 40C. Alternatively, we prepared a similar master mix containing 1 μg recombinant 631

purified HtrA1. After pre-equilibration with IGF-1, this mix was transferred to ice and 632

supplemented with 1% final β-mercaptoethanol to stop HtrA1 degradation. The master mix was 633

exposed to 100 μg/ml TLCK-Chymotrypsin (Boehringer-Ingleheim, Ridgefield, CT) or an equal 634


http://mcb.asm

.org/D

ownloaded from

http://mcb.asm.org/


29

volume of buffer at 370C. Under these conditions, chymotrypsin retained >90% enzyme activity. 635

Aliquots (50 μl) were removed from the master mix at the indicated time points and immediately 636

mixed with ice-cold sample buffer containing SDS and DTT, boiled for 5 min, and thereafter 637

analyzed for levels of full-length HtrA1 by immunoblot. Protease susceptibility was expressed as 638

the amount of the remaining, undigested full-length HtrA1 at the indicated time points. 639

640

Cell Signaling Assays. CECs at a density of 3x105 were seeded on gelatin-coated 24-well plates 641

18h prior to the assay. On the day of the assay, cells were serum-starved for 6h in minimum 642

M199 medium before exposure to purified recombinant human IGF-1, for the indicated duration 643

at 370C. For tests of growth factor bioavailability, IGF-1 (5 ng/well) was co-incubated with 644

recombinant purified human HtrA1 at 1-50x molar excess of IGF-1, or HtrA1- containing 293T 645

conditioned media (10x molar excess) for 2 hrs at 40C prior to CEC stimulation. IGF-1-mediated 646

IGFR activation was terminated by immediately aspirating the stimulus, and lysing cells in EB 647

supplemented with 10 mM PMSF and 10 mM Na3VO4. Equal amounts of total lysate were 648

resolved by SDS-PAGE and analyzed for IGF1R and Akt activation by immunoblot. 649

650

Immunoblots. Rabbit anti-phospho IGFRβ (3024S) and anti-phospho Akt (4058S) were from 651

Cell Signaling Technology (Danvers, MA). Blots were reprobed by stripping off antibodies with 652

buffer containing 6M Tris, pH 6.8, 2% SDS and 100 mM β-mercaptoethanol at 650C for 30 min. 653

PVDF membranes were reprobed with rabbit anti-IGFRβ antibody (sc-713, Santa Cruz 654

Biotechnology) or anti-Akt antibody (9272, Cell Signaling Technology). Non-immune isotype 655

IgG controls, anti-mouse, and anti-rabbit horseradish peroxidase secondary antibodies were 656

purchased from Santa Cruz Biotechnology. For immunoblot quantification, X-ray films were 657


http://mcb.asm

.org/D

ownloaded from

http://mcb.asm.org/


30

scanned grayscale at 600 dpi resolution and analyzed using the gel function of NIH ImageJ 658

(http://rsbweb.nih.gov/ij/). 659

660

In Vitro Tube Formation Assay. Two-dimensional tube assays were performed as previously 661

described (34). Briefly, CECs (6 x 105) were plated between two layers of collagen gel in 662

endothelial basal media (with 0.5% serum, Lonza). For IGF-1-driven tube formation, the purified 663

recombinant growth factor was pre-incubated with five-fold molar excess of HtrA1 derived from 664

human leukocyte or HEK 293T conditioned media before addition to the tube assay. 665

Alternatively, to determine the specific contribution of HtrA1 in human leukocyte-derived 666

conditioned media, the pools were pre-cleared with Protein A/G Plus-agarose beads for 1 hr at 667

40C, followed by clearance of HtrA1 by immunodepletion with five-fold molar excess anti-668

HtrA1 antibody or an isotype control for 1hr at 40C. The HtrA1-antibody complex was captured 669

with Protein A/G Plus-agarose beads for 1hr at 40C, and removed by centrifugation. The 670

resulting supernatant was used for IGF-1 pre-incubation. Each assay was done in two to four 671

replicates, and repeated three times. CEC tubes were allowed to reach peak tube length 12-14 672

hours after treatment. Phase-contrast images at 100X magnification were acquired with Spot 673

Advanced for Mac OS X (Diagnostic Instruments, Sterling Heights, MI) using a Nikon Eclipse 674

TE2000-S inverted microscope (Melville, NY) equipped with Diagnostic Instruments RT Slider 675

CCD camera. Tube length was quantified using NIH Image J and expressed as Mean + SEM 676

after normalizing to baseline. 677

678

Data Analysis and Statistics. Data analyses were performed with Prism 4.0 (GraphPad 679

Software, San Diego, CA). Where appropriate, two-way analysis of variance or two-tailed 680


http://mcb.asm

.org/D

ownloaded from

http://mcb.asm.org/


31

student’s t test was used for paired comparisons. One-way ANOVA followed by Tukey’s post-681

hoc test was used for comparison of more than two groups. For nonlinear regression, data points 682

with R2>0.80 were considered to be acceptable for good curve-fitting. Comparisons wherein 683

p<0.05 at α≥0.05 were considered statistically significant. 684

685

ACKNOWLEDGEMENTS 686

We thank Anton Komar at Cleveland State University for productive discussions 687

regarding relative synonymous codon usage. Patricia D’Amore, Magali Saint-Geniez, Allen 688

Tseng, and Leo Kim at the AMD Center for Excellence provided constructive feedback. 689

Members of the Kazlauskas lab at The Schepens Eye Research Institute and Massachusetts Eye 690

and Ear Infirmary provided troubleshooting and technical and advice. Guo-Xiang Ruan 691

carefully reviewed and copy-edited the manuscript. Scott Adams, Margaux Morrison, and 692

Rosann Robinson from the DeAngelis lab provided technical support. 693

The AMD Center for Excellence provided support for this project, as did EY014458 and 694

Thome Memorial Foundation Bank of America grants to MMD. 695

696

AUTHOR CONTRIBUTIONS 697

A.K. and S.M.P.J. designed and analyzed biochemistry experiments. I.K. diagnosed patients and 698

collected blood samples. M.M.D. genotyped patients, performed all genetic analyses, and 699

provided immortalized leukocytes. S.M.P.J. performed biochemistry experiments. S.M.P.J , 700

A.K., and M.M.D. and wrote the manuscript. 701

702

CONFLICT OF INTEREST STATEMENT 703


http://mcb.asm

.org/D

ownloaded from

http://mcb.asm.org/


32

One of the SNPs is included in Patent No US 7,972,787, B2 to M.M.D. and MEEI. 704

705


http://mcb.asm

.org/D

ownloaded from

http://mcb.asm.org/


33

REFERENCES 706

1. Ambati, J., Anand, A., Fernandez, S., Sakurai, E., Lynn, B.C., Kuziel, W.A., Rollins, 707

B.J., and Ambati, B.K. 2003. An animal model of age-related macular degeneration in 708

senescent Ccl-2- or Ccr-2-deficient mice. Nat. Med. 9, 1390-1397. 709

710

2. Bar, R., Boes, M., Dake, B., Booth, B., Henley, S., and Sandra, A. 1989. Insulin, insulin-711

like growth factors, and vascular endothelium. Exp. Mol. Pathol. 50, 125-138. 712

713

3. Bartoszewski, R.A., Jablonsky, M., Bartoszewska, S., Stevenson, L., Dai, Q., Kappes, J., 714

Collawn, J.F., and Bebok, Z. 2010. A synonymous single nucleotide polymorphism in 715

ΔF508 CFTR alters the secondary structure of the mRNA and the expression of the mutant 716

protein. J. Biol. Chem. 285, 28741-28748. 717

718

4. Bird, A.C. 2010. Therapeutic targets in age-related macular disease. J. Clin. Invest. 120, 719

3033-3042. 720

721

5. Bjorndahl, M., Cao, R., Nissen, L.J., Clasper, S., Johnson, L.A., Xue, Y., Zhou, Z., 722

Jackson, D., and Cao, Y. 2005. Insulin-like growth factors 1 and 2 induce 723

lymphangiogenesis in vivo. Proc. Natl. Acad. Sci. USA 102, 15593–15598. 724

725

6. Brest, P., Lapaquette, P., Souidi, M., Lebrigand, K., Cesaro, A., Vouret-Craviari, V., 726

Mari, B., Barbry, P., Mosnier, J.F., Hébuterne, X., Harel-Bellan, A., Mograbi, B., 727

Darfeuille-Michaud, A., and Hofman, P. 2011. A synonymous variant in IRGM alters a 728


http://mcb.asm

.org/D

ownloaded from

http://mcb.asm.org/


34

binding site for miR-196 and causes deregulation of IRGM-dependent xenophagy in Crohn's 729

disease. Nat. Genet. 43, 242-245. 730

731

7. Cannarozzi, G., Schraudolph, N.N., Faty, M., Rohr, P.V., Friberg, M.T., Roth, A.C., 732

Gonnet, P., Gonnet, G., and Barral, Y. 2010. A role for codon order in translation 733

dynamics. Cell 141, 355-367. 734

735

8. Cargill, M., Altshuler, D., Ireland, J., Sklar, P., Ardlie, K., Patil, N., Lane, C. R., Lim, 736

E. P., Kalyanaraman, N., Nemesh, J., Ziaugr, L., Friedland, L., Rolfe, A., Warrington, 737

J., Lipshutz, R., Daley, G. Q., and Lander, E. S. 1999. Characterization of single-738

nucleotide polymorphisms in coding regions of human genes. Nat. Genet. 22, 231-238. 739

740

9. Cascieri, M., Chicchi, G., Applebaum, J., Hayes, N., Green, B., and Bayne, M. 1988. 741

Mutants of human insulin-like growth factor I with reduced affinity for the type 1 insulin-like 742

growth factor receptor. Biochem. 27, 3229-3233. 743

744

10. Chamary, J.V., Parmley, J.L., and Hurst, L.D. 2006. Hearing silence: non-neutral 745

evolution at synonymous sites in mammals. Nat. Rev. Genet. 7, 98-108. 746

747

11. Chamary, J.V. and Hurst, L.D. 2009. The price of silent mutations. Sci. Am. 300, 46-53. 748

749


http://mcb.asm

.org/D

ownloaded from

http://mcb.asm.org/


35

12. Cohen, E., Paulsson, J. F., Blinder, P., Burstyn-Cohen, T., Du, D., Estepa, G., Adame, 750

A., Pham, H.M., Holzenberger, M., Kelly, J. W., Masliah, E., and Dillin, A. 2009. 751

Reduced IGF-1 signaling delays age-associated proteotoxicity in mice. Cell 139, 1157-1169. 752

753

13. DeAngelis, M.M., Ji, F., Adams, S., Morrison, M. A., Harring, A. J., Sweeney, M. O., 754

Capone Jr., A., Miller, J. W., Dryja, T. P., Ott, J., and Kim, I. K. 2008. Alleles in the 755

HTRA Serine Peptidase 1 gene alter the risk of neovascular age-related macular degeneration. 756

Ophthalmol. 115, 12009-1215.e7. 757

758

14. Dewan, A., Liu, M., Hartman, S., Zhang, S. S.M., Liu D. T. L., Zhao, C., Tam, P. O. S., 759

Chan, W M., Lam, D. S. C., Snyder, M., Barnstable, C., Pang, C. P., and Hoh, J. 2006. 760

HTRA1 Promoter polymorphism in wet age-related macular degeneration. Science 314, 989-761

992. 762

763

15. De Luca, A., De Falco, M., Severino, A., Campioni, M., Santini, D., Baldi, F., Paggi, 764

M.G., Baldi, A. Distribution of the serine protease HtrA1 in normal human tissues. 2003. J. 765

Histochem. Cytochem. 51, 1279-1294 766

767

16. De Luca, A., De Falco, M., De Luca, L., Penta, R., Shridhar, B., Baldi, F., Campioni, 768

M., Paggi, M.G., Baldi, A. 2004. Pattern of expression of HtrA1 during mouse 769

development. J. Histochem. Cytochem. 52, 1609-1617. 770

771


http://mcb.asm

.org/D

ownloaded from

http://mcb.asm.org/


36

17. Duan, J., Wainwright, M.S., Comeron, J.M., Saitou, N., Sanders, A.R., Gelernter, J., 772

and Gejman, P.V. 2003. Synonymous mutations in the human dopamine receptor D2 773

(DRD2) affect mRNA stability and synthesis of the receptor. Hum. Mol. Genet. 12, 205-774

216.6. 775

776

18. Eigenbrot, C., Ultsch, M., Lipari, M. T., Moran, P., Lin, S. J., Ganesan, R., Quan, C., 777

Tom, J., Sandoval, W., van Lookeren Campagne, M., and Kirchhofer, D. 2012. 778

Structural and functional analysis of HtrA1 and its subdomains. Structure 20, 1-11. 779

780

19. Fisher, S.A., Abecasis, G.R., Yashar, B.M., Zareparsi, S., Swaroop, A., Iyengar, S.K., 781

Klein, B.E., Klein, R., Lee, K.E., Majewski, J., Schultz, D.W., Klein, M.L., Seddon, 782

J.M., Santangelo, S.L., Weeks, D.E., Conley, Y.P., Mah, T.S., Schmidt, S., Haines, J.L., 783

Pericak-Vance, M.A., Gorin, M.B., Schulz, H.L., Pardi, F., Lewis, C.M., and Weber, 784

B.H. 2005. Meta-analysis of genome scans of age-related macular degeneration. Hum. Mol. 785

Genet. 15, 2257-2264. 786

787

20. Fowlkes, J.L., and Serra, D.M. 1996. Characterization of glycosaminoglycan-binding 788

domains present in insulin-like growth factor-binding protein-3. J. Biol. Chem. 271, 14676-789

14679. 790

791

21. Frydman, J., Nimmesgern, E., Ohtsuka, K. and Hartl, F.U. 1994. Folding of nascent 792

polypeptide chains in a high molecular mass assembly with molecular chaperones. Nature 793

370, 111-117. 794


http://mcb.asm

.org/D

ownloaded from

http://mcb.asm.org/


37

795

22. Gorin, M.B. 2012. Genetic insights into age-related macular degeneration: Controversies 796

addressing risk, causality, and therapeutics. Mol. Aspects Med. 33, 467-486. 797

798

23. Grau, S., Baldi, A., Bussan, R., Tian, X., Stefanescu, R., Przybylski, M., Richards, P., 799

Jones, S. A., Shridhar, V., Clausen, T., and Ehrmann, M. 2005. Implications of the serine 800

protease HtrA1 in amyloid precursor protein processing. Proc. Natl. Acad. Sci. USA 102, 801

6021-6026 802

803

24. Hageman, G.S., Anderson, D.H., Johnson, L.V., Hancox, L.S., Taiber, A.J., Hardisty, 804

L.I., Hageman, J.L., Stockman, H.A., Borchardt, J.D., Gehrs, K.M., Smith, R.J.H., 805

Silvestri, G., Russell, S.R., Klaver, C.C.W., Barbazetto, I., Chang, S., Yannuzzi, L.A., 806

Barile, G.R., Merriam, J.C., Smith, R.T., Olsh, A.K., Bergeron, J., Zernant, J., 807

Merriam, J.E., Gold, B., Dean, M., and Allikmets, R. 2005. A common haplotype in the 808

complement regulatory gene factor H (HF1/CFH) predisposes individuals to age-related 809

macular degeneration. Proc. Natl. Acad. Sci. USA 102, 7227-7232. 810

811

25. Haines, J.L., Hauser, M. A., Schmidt, S., Scott, W. K., Olson, L. M., Gallins, P., 812

Spencer, K. L., Kwan, S. Y., Noureddine, M., Gilbert, J. R., Schnetz-Boutaud, N., 813

Agarwal, A., Postel, E. A., and Pericak-Vance, M. 2005. Complement Factor H Variant 814

Increases the Risk of Age-Related Macular Degeneration. Science 308, 419-421. 815

816


http://mcb.asm

.org/D

ownloaded from

http://mcb.asm.org/


38

26. Hara, K., Shiga, A., Fukutake, T., Nozaki, H., Miyashita, A., Yokoseki, A., Kawata, H., 817

Koyama, A., Arima, K., Takahashi, T., Ikeda, M., Shiota, H., Tamura, M., Shimoe, U., 818

Hirayama, M., Arisato, A., Yanagawa, S., Tanaka, A., Nakano, I., Ikeda, S.-I., Yoshida, 819

Y., Yamamoto, T., Ikeuchi,T., Kuwano, R., Nishizawa, M., Tsuji, S., and Onodera, O. 820

2009. Association of HTRA1 mutations and familial ischemic cerebral small-vessel disease. 821

New Engl. J. Med. 360, 1729-1739. 822

823

27. Heckenlively, J., Hawes, N., Friedlander, M., Nusinowitz, S., Hurd, R., Davisson, M., 824

and Chang, B. 2003. Mouse model of subretinal neovascularization with choroidal 825

anastomosis. Retina 23, 518-522. 826

827

28. Hellstrom, A., Perruzzi, C., Ju, M., Engstrrom, E., Hard, A.L., Liu, J. L., Albertsson-828

Wikland, K., Carlsson, B., Niklasson, A., Sjodell, L., LeRoit, D., Senger, D. R., and 829

Smith, L. E. H. 2001. Low IGF-I suppresses VEGF-survival signaling in retinal endothelial 830

cells: Direct correlation with clinical retinopathy of prematurity. Proc. Natl. Acad. Sci. USA 831

98, 5804-5808. 832

833

29. Holzenberger, M., Dupont, J., Ducos, B., Leneuve, P., Géloën, A., Even, P.C., Cervera, 834

P., and Le Bouc, Y. 2003. IGF-1 receptor regulates lifespan and resistance to oxidative 835

stress in mice. Nature 421, 182-187. 836

837


http://mcb.asm

.org/D

ownloaded from

http://mcb.asm.org/


39

30. Hou, J., Clemmons, D.R., and Smeekens, S. 2005. Expression and characterization of a 838

serine protease that preferentially cleaves insulin-like growth factor binding protein-5. J. 839

Cell. Biochem. 96, 470-484. 840

841

31. Hou, S., Maccarana, M., Min, T.H., Strate, I., and Pera, E.M. 2007. The secreted serine 842

protease xHtrA1 stimulates long-range FGF signaling in the early Xenopus embryo. Dev. 843

Cell 13, 226-241. 844

845

32. Hu, S.-I., Carozza, M., Klein, M., Nantermet, P., Luk, D., and Crowl, R.M. 1998. Human 846

HtrA, an evolutionarily conserved serine protease identified as a differentially expressed 847

gene product in osteoarthritic cartilage. J. Biol. Chem. 273, 34406-34412. 848

849

33. Hwa, V., Oh, Y., and Rosenfeld, R.G. 1999. The insulin-like growth factor-binding protein 850

(IGFBP) superfamily. Endo. Rev. 20, 761-787. 851

852

34. Im, E., Venkatakrishnan, A., and Kazlauskas, A. 2005. Cathepsin B regulates the intrinsic 853

angiogenic threshold of endothelial cells. Mol. Biol. Cell. 16, 3488-3500. 854

855

35. Imamura, Y., Noda, S., Hashizume, K., Shinoda, K., Yamaguchi, M., Uchiyama, S., 856

Shimizu, T., Mizushima, Y., Shirasawa, T., and Tsubota, K. 2006. Drusen, choroidal 857

neovascularization, and retinal pigment epithelium dysfunction in SOD1-deficient mice: A 858

model of age-related macular degeneration. Proc. Natl. Acad. Sci. USA 103, 11282-11287. 859

860


http://mcb.asm

.org/D

ownloaded from

http://mcb.asm.org/


40

36. Jiang, J, Huang, L., Yu, W., Wu, X., Zhou, P., Li, X. 2012. Overexpression of HRA1 861

leads to down-regulation of fibronectin and functional changes in RF/6A cells and HUVECs. 862

PLoS One. 7, e46115. 863

864

37. Jones, A., Kumar, S., Zhang, N., Tong, Z., Yang, J. H., Watt, C., Anderson, J., Amrita, 865

Fillerup, H., McCloskey, M., Luo, L., Yang, Z., Ambati, B., Marc, R., Oka, C., Zhang, 866

K., and Fu, Y. 2011. Increased expression of multifunctional serine protease, HTRA1, in 867

retinal pigment epithelium induces polypoidal choroidal vasculopathy in mice. Proc. Natl. 868

Acad. Sci. USA 108, 14578-14583. 869

870

38. Jones J.I., Gockerman A., Busby Jr. W.H., Camacho-Hubner C., and Clemmons, D.R. 871

1993. Extracellular matrix contains insulin-like growth factor binding protein-5: potentiation 872

of the effects of IGF-I. J. Cell Biol. 121, 679-687. 873

874

39. Jun, G., Nicolaou, M., Morrison, M.A., Buros, J., Morgan, D.J., Radeke, M.J., 875

Yonekawa, Y., Tsironi, E.E., Kotoula, M.G., Zacharaki, F., Mollema, N., Yuan, Y., 876

Miller, J.W., Haider, N. B., Hageman, G.S., Kim, I.K., Schaumberg, D.A., Farrer, L.A., 877

and DeAngelis, M.M. 2011. Influence of ROBO1 and RORA on risk of age-related macular 878

degeneration reveals genetically distinct phenotypes in disease pathophysiology. PLoS One 879

6, e25775. 880

881

40. Kenyon, C., Chang, J., Gensch, E., Rudner, A. and Tabtiang, R. 1993. A C. elegans 882

mutant that lives twice as long as wild type. Nature 366, 461-464.8. 883


http://mcb.asm

.org/D

ownloaded from

http://mcb.asm.org/


41

884

41. Kim, M.-S., Song, J., and Park, C. 2009. Determining protein stability in cell lysates by 885

pulse proteolysis and Western blotting. Prot. Sci. 18, 1051-1059. 886

887

42. Kimchi-Sarfaty, C., Oh, J.M., Kim, I.-W., Sauna, Z.E., Calcagno, A.M., Ambudkar, 888

S.V., and Gottesman, M.M. 2006. A "silent" polymorphism in the MDR1 gene changes 889

substrate specificity. Science 315, 525-528. 890

891

43. Kimura, K.D., Tissenbaum, H.A. Liu, Y., and Ruvkun, G. 1997. daf-2, an insulin 892

receptor-like gene that regulates longevity and diapause in Caenorhabditis elegans. Science 893

277, 942-946.14. 15. 894

895

44. Klein, R.J., Zeiss, C., Chew, E. Y., Tsai, J. Y., Sackler, R. S., Haynes, C., Henning, A. 896

K., San Giovanni, J. P., Mane, S. M., Mayne, S. T., Bracken, M. B., Ferris, F. L., Ott, J., 897

Barnstable, C., and Hoh, J. 2005. Complement Factor H polymorphism in age-related 898

macular degeneration. Science 208, 385-389. 899

900

45. Klinghoffer, R., Duckworth, B., Valius, M., Cantley, L., and Kazlauskas, A. 1996. 901

Platelet-derived growth factor-dependent activation of phosphatidylinositol 3-kinase is 902

regulated by receptor binding of SH2-domain-containing proteins which influence Ras 903

activity. J. Cell Biol. 16, 5909-5914. 904

905


http://mcb.asm

.org/D

ownloaded from

http://mcb.asm.org/


42

46. Komar, A.A., Lesnik, T., and Reiss, C. 1999. Synonymous codon substitutions affect 906

ribosome traffic and protein folding during in vitro translation. FEBS Letters 462, 387-391. 907

908

47. Kondo T., Vicent D., Suzuma K., Yanagisawa, M., King G.L., Holzenberger, M., and 909

Kahn, C.R. 2003. Knockout of insulin and IGF-1 receptors on vascular endothelial cells 910

protects against retinal neovascularization. J. Clin. Invest. 111, 1835-1842. 911

912

48. Lambooij, A.C., Lindenbergh-Kortleve, Van Wely, K.H.M., Lindenbergh-Kortleve, 913

D.J., Kuijpers, R.W.A.M., Kliffen, M., and Mooy, C.M. 2003. Insulin-like growth factor-I 914

and its receptor in neovascular age-related macular degeneration. Invest. Ophthalmol. Vis. 915

Sci. 44, 2192-2198. 916

917

49. Lampson, B.L., Pershing, N.L.K., Prinz, J.A., Lacsina, J.R., Marzluff, W.F., Nicchitta, 918

C.V., MacAlpine, D.M., and Counter, C.M. 2013. Rare codons regulate KRas oncogenesis. 919

Curr. Biol. 23, 70-75. 920

921

50. Leveziel, N., Souied, E.H., Richard, F., Barbu, V., Zourdani, A., Morineau, G., Zerbib, 922

J., Coscas, G., Soubrane, G., and Benlian, P. 2007. PLEKHA1-LOC387715-HTRA1 923

polymorphisms and exudative age-related macular degeneration in the French population. 924

Mol. Vis. 13, 2153-2159. 925

926

51. Lofqvist, C., Willett, K.L., Aspegren, O., Smith, A.C.H., Aderman, C.M., Connor, K.M., 927

Chen, J., Hellstrom, A., and Smith, L.E.H. 2009. Quantification and localization of the 928


http://mcb.asm

.org/D

ownloaded from

http://mcb.asm.org/


43

IGF/insulin system expression in retinal blood vessels and neurons during oxygen-induced 929

retinopathy in mice. Invest. Ophthalmol. Vis. Sci. 50, 1831-1837. 930

931

52. Ly, D.H., Lockhart, D.J., Lerner, R.A., and Schultz, P.G. 2000. Mitotic misregulation and 932

human aging. Science 287, 2486-2492. 933

934

53. Makeyev, E.V., Kolb V.A., and Spirin, A.S. 1996. Enzymatic activity of the ribosome-935

bound nascent polypeptide. FEBS Letters 378, 166-170. 936

937

54. Mauney, J., Olsen, B. R., and Volloch, V. 2010. Matrix remodeling as stem cell recruitment 938

event: a novel in vitro model for homing of human bone marrow stromal cells to the site of 939

injury shows a crucial role of extracellular collagen matrix. Matrix Biol. 29, 657-663. 940

941

55. Mendioroz, M., Fernández-Cadenas, I., del Río-Espinola, A., Rovira, A., Solé, E., 942

Fernández-Figueras, M. T., García-Patos, V., Sastre-Garriga, J., Domingues-943

Montanari, S., Álvarez-Sabín, J., and Montaner, J. 2010. A missense HTRA1 mutation 944

expands CARASIL syndrome to the Caucasian population. Neurology 75, 2033-2035. 945

946

56. Na, Y.-R., and Park, C. 2009. Investigating protein unfolding kinetics by pulse proteolysis. 947

Prot. Sci. 18, 268-276. 948

949

57. Nackley, A.G., Shabalina, A., Tchivileva, E., Satterfield, K., Korchynskyi, O., Makarov, 950

S.S., Maixner, W., and Diatckorchynskihenko, L. 2006. Human Catechol-O-951


http://mcb.asm

.org/D

ownloaded from

http://mcb.asm.org/


44

Methyltransferase haplotypes modulate protein expression by altering mRNA secondary 952

structure. Science 314, 1930-1933. 953

954

58. Nakao-Hayashi, J., Ito, H., Kanayasu, T., Morita, I., and Murota, S. 1992. Stimulatory 955

effects of insulin and insulin-like growth factor I on migration and tube formation by 956

vascular endothelial cells. Atherosclerosis 92, 141-149. 957

958

59. Nishimoto, Y., Shibata, M., Nihonmatsu, M., Nozaki, H., Shiga, A., Shirata, A., 959

Yamane, K., Kosakai, A., Takahashi, K., Nishizawa, M., Onodera, O., and Suzuki, N. 960

2011. A novel mutation in the HTRA1 gene causes CARASIL without alopecia. Neurology 961

76, 1353-1355. 962

963

60. Nozaki, M., Raisler, B.J., Sakurai, E., Sarma, J.V., Barnum, S.R., Lambris, J.D., Chen, 964

Y., Zhang, K., Ambati, B.K., Baffi, J., Ambati, J. 2006. Drusen complement components 965

C3a and C5a promote choroidal neovascularization. Proc. Natl. Acad. Sci. USA 103, 2328-966

2333 967

968

61. Oka, C., Tsujimoto, R., Kajikawa, M., Koshiba-Takeuchi, K., Ina, J., Yano, M., 969

Tsuchiya, A., Ueta, Y., Soma, A., Kanda, H., Matsumoto, M., and Kawaichi, M. 2003. 970

HtrA1 serine protease inhibits signaling mediated by TGFβ family proteins. Development 971

131, 1041-1053. 972

973


http://mcb.asm

.org/D

ownloaded from

http://mcb.asm.org/


45

62. Park, C., and Marqusee, S. 2005. Pulse proteolysis: A simple method for quantitative 974

determination of protein stability and ligand binding. Nat. Meth. 2, 207-212. 975

976

63. Rivera, A., Fisher, S.A., Fritsche, L.G., Keilhauer, C.N., Lichtner, P., Mettinger, T., and 977

Weber, B.H.F. 2005. Hypothetical LOC387715 is a second major susceptibility gene for 978

age-related macular degeneration, contributing independently of complement factor H to 979

disease risk. Hum. Mol. Genet. 14, 3227-3236. 980

981

64. Ruberte, J., Ayuso, E., Navarro, M., Carretero, A., Nacher, V., Haurigot, V., George, 982

M., Llombart, C., Casellas, A., Costa, C., Bosch, A., and Bosch, F. 2004. Increased ocular 983

levels of IGF-1 in transgenic mice lead to diabetes-like eye disease. J. Clin. Invest. 113, 984

1149-1157. 985

986

65. Sharp, P., Tuohy, T., and Mosurski, K. 1986. Codon usage in yeast: cluster analysis 987

clearly differentiates highly and lowly expressed genes. Nuc. Acid Res. 14, 5125-5143. 988

989

66. Silveira, A., Morrison, M.A., Ji, F., Xu, H., Reinecke, J.B., Adams, S.M., Arneberg, 990

T.M., Janssian, M., Lee, J.E., Yuan, Y., Schaumberg, D.A., Kotoula, M.G., Tsironi, 991

E.E., Tsiloulis, A.N., Chatzoulis, D.Z., Miller, J.W., Kim, I.K., Hageman, G.S., Farrer, 992

L.A., Haider, N.B., and DeAngelis, M.M. 2010. Convergence of linkage, gene expression 993

and association data demonstrates the influence of the RAR-related orphan receptor alpha 994

(RORA) gene on neovascular AMD: a systems biology based approach. Vis. Res. 50, 698-995

715. 996


http://mcb.asm

.org/D

ownloaded from

http://mcb.asm.org/


46

997

67. Sitar, T., Popowicz, G.M., Siwanowicz, I., Huber, R., and Holak, TA 2006. Structural 998

basis for the inhibition of insulin-like growth factors by insulin-like growth factor-binding 999

proteins. Proc. Natl. Acad. Sci. USA 103, 13028-13033. 1000

1001

68. Swaroop, A., Branham, K., Chen, W., and Abecasis, G. 2007. Genetic susceptibility to 1002

age-related macular degeneration: a paradigm for dissecting complex disease traits. Hum. 1003

Mol. Genet. 16, R174-R182. 1004

1005

69. Tennstaedt, A., Pöpsel, S., Truebestein, L., Hauske, P., Brockmann, A., Schmidt, N., 1006

Irle, I., Sacca, B., Niemeyer, C. M., Brandt, R., Ksiezak-Reding, H., Tirniceriu, A. L., 1007

Egensperger, R., Baldi, A., Dehmelt, L., Kaiser, M., Huber, R., Clausen, T., and 1008

Ehrmann, M. 2012. Human high temperature requirement serine protease A1 (HTRA1) 1009

degrades tau protein aggregates. J. Biol. Chem. 287, 20931-20941. 1010

1011

70. Tsuchiya, A., Yano, M., Tocharus, J., Kojima, H., Fukumoto, M., Kawaichi, M., and 1012

Oka, C. 2005. Expression of HtrA1 serine protease in normal bone and cartilage and its 1013

upregulation in joint cartilage damaged by experimental arthritis. Bone 37, 323-336. 1014

1015

71. Tuller, T., Carmi, A., Vestsigian, K., Navon, S., Dorfan, Y., Zaborske, J., Pan, T., 1016

Dahan, O., Furman, I., and Pilpel, Y. 2010. An evolutionarily conserved mechanism for 1017

controlling the efficiency of protein translation. Cell 141, 344-354. 1018

1019


http://mcb.asm

.org/D

ownloaded from

http://mcb.asm.org/


47

72. Vierkotten, S., Muether, P.S., and Fauser, S. 2011. Overexpression of HTRA1 leads to 1020

ultrastructural changes in the elastic layer of Bruch’s membrane via cleavage of extracellular 1021

matrix components. PLoS One 6, e22959. 1022

1023

73. Yang, Z., Camp, N. J., Sun, H., Tong, Z., Gibbs, D., Cameron, D. J., Chen, H., Zhao, Y., 1024

Pearson, E., Li, X., Chien, J., DeWan, A., Harmon, J., Bernstein, P. S., Shridhar, V., 1025

Zabriskie, N. A., Hoh, J., Howes, K., and Zhang, K. 2006. A Variant of the HTRA1 gene 1026

increases susceptibility to age-related macular degeneration. Science 314, 992-993. 1027

1028

74. Yeh, D.C., Bula, D.V., Miller, J.W., Gragoudas, E.S., Arroyo, J.G. 2004. Expression of 1029

leukocyte adhesion molecules in human subfoveal choroidal neovascular membranes treated 1030

with and without photodynamic therapy. Invest. Ophthalmol. Vis. Sci. 45, 2368-2373. 1031

1032

75. Zhang, F., Kartner, N., and Lukacs, G. 1998. Limited proteolysis as a probe for arrested 1033

conformational maturation of ΔF508 CFTR. Nat. Struct. Biol. 5, 180-183. 1034

1035

76. Zhang, F., Saha, S., Shabalina, S.A., and Kashina, A. 2010. Differential arginylation of 1036

actin isoforms is regulated by coding sequence–dependent degradation. Science 329, 1534-1037

1537. 1038

1039

77. Zhang, H., Morrison, M.A., DeWan, A., Adams, S., Andreoli, M., Huynh, N., Regan, 1040

M., Brown, A., Miller, J. W., Kim, I. K., Hoh, J., and DeAngelis, M.M. 2008. The 1041


http://mcb.asm

.org/D

ownloaded from

http://mcb.asm.org/


48

NEI/NCBI dbGAP database: genotypes and haplotypes that may specifically predispose to 1042

risk of neovascular age-related macular degeneration. BMC Med. Genet. 9:51 (online only) 1043

1044

78. Zumbrunn, J., and Trueb, B. 1996. Primary structure of a putative serine protease specific 1045

for IGF-binding proteins. FEBS Letters 398, 187-192. 1046

1047

79. Salminen, A., Kaupinnen, A., Hyttinen, J.H., Toropainen, E., Kaarniranta, K., 2010. 1048

Endoplasmic reticulum stress in age-related macular degeneration: Trigger for 1049

neovascularization. Mol. Med., 16, 535-542. 1050

1051

80. Sauer, T., Patel, M., Chan, C.C., and Tuo, J., 2008, Unfolding the therapeutic potential of 1052

chemical chaperones for age-related macular degeneration. Expert Rev. Ophthalmol. 3, 29-1053

42. 1054

1055


http://mcb.asm

.org/D

ownloaded from

http://mcb.asm.org/


49

FIGURE LEGENDS 1056

Figure 1. NvAMD-linked synonymous SNPs at Ala34 and Gly36 of HTRA1 reduced mRNA 1057

translation speed. A and B. NvAMD-linked synonymous SNPs in HtrA1’s Mac25 domain did 1058

not alter mRNA (A) or protein (B) expression in leukocytes derived from NvAMD human 1059

subjects (“dSNP”) homozygotic for rs1049331 and rs2293870, relative to unaffected age-1060

matched controls. Each data point represents the mean + SEM (n=3 independent experiment). 1061

Paired t-test, *p<0.05. C. The synonymous substitutions at Ala34 (GCC>GCT) and Gly36 1062

(GGG>GGT) were introduced into human HTRA1 cDNA by site-directed mutagenesis to 1063

generate dSNP. 72 hours post-transfection, equal volumes of conditioned medium was subjected 1064

to an anti-HtrA1 Western blot. We found that WT accumulated in the HEK 293T conditioned 1065

media at higher (1.5x) levels than dSNP HtrA1 (n=13 independent transfections, *p<0.05). D. 1066

NvAMD-linked synonymous SNPs in HtrA1 compromised enzymatic activity. Conditioned 1067

medium from HEK293 cells transfected with the indicated plasmid was tested for ability to 1068

proteolyze β-casein. The results from a quantitative anti-HtrA1 Western blot were used to 1069

ensure that the same amount of HtrA1 was present in all cases. Compared to WT, the enzymatic 1070

activity of HtrA1 that harbored dSNP or lacked the Mac25 domain was reduced. While WT 1071

reached 50% digestion of β-casein after 1h, dSNP or dMac25 achieved this after 1.8h or 2.1h, 1072

respectively. Compared to WT, time points <6h were significantly different for dSNP and 1073

dMac25 (***p<0.001, two-way ANOVA with Bonferroni post-hoc test, n = 3 independent 1074

experiments). E. Polyadenylated complementary RNA transcripts that correspond to WT and 1075

dSNP were synthesized by in vitro transcription downstream of a T7 RNA promoter. For cell-1076

free in vitro translation, equal amounts of WT or dSNP cRNA were added to the reaction master 1077

mixes of rabbit reticulocyte lysate that was supplemented with 26S (25 μM) and 20S (100 μM) 1078


http://mcb.asm

.org/D

ownloaded from

http://mcb.asm.org/


50

proteasome inhibitors to protect nascent polypeptides from degradation. To compare the time 1079

course of accumulation of full-length HtrA1 protein, aliquots were removed from the master 1080

mixes at the indicated time points and immediately boiled and subjected to immunoblot analysis. 1081

The half maximal concentration of full-length WT is reached at 9.23 + 1.61 min, vs. 32.08 + 6.05 1082

min for dSNP. Each data point represents the mean + SEM. Paired t-test: ***p<0.001, n = 3 1083

independent experiments. 1084

1085

Figure 2. NvAMD-linked synonymous SNPs at Ala34 and Gly36 of HtrA1 increased 1086

susceptibility to partial proteolysis. Comparison of trypsin susceptibilities of WT vs. dSNP 1087

HtrA1 from HEK293T cells (A) or human leukocytes derived from NvAMD patients and 1088

unaffected controls (B). A. HEK 293T-derived dSNP displayed enhanced trypsin susceptibility 1089

relative to WT. HtrA1-containing conditioned media from WT- or dSNP-transfected HEK 293T 1090

cells were prepared in a master mix and exposed to 10 μg/ml trypsin or an equivalent volume of 1091

buffer at 370C. Aliquots were removed at the indicated time points, and immediately boiled in 1092

sample buffer to stop the reaction. B. HtrA1 from NvAMD patients who are homozygotic for the 1093

SNPs displayed enhanced susceptibility to proteolysis. HtrA1-containing conditioned media 1094

from human leukocytes were exposed to 250 μg/ml trypsin or an equivalent volume of buffer at 1095

370C. Aliquots were removed at the indicated time points, and immediately boiled in sample 1096

buffer to stop the reaction. At each time point, protease susceptibility was expressed as the 1097

amount of remaining full-length, undigested HtrA1 after normalizing to -trypsin controls. C. and 1098

D. Differential pre-denaturation temperature and trypsin susceptibility of WT vs. dSNP HtrA1 1099

after rapid partial proteolysis. A. HEK 293T-derived dSNP displayed enhanced susceptibility to 1100

trypsin. At each temperature, protease susceptibility was expressed as the amount of remaining 1101


http://mcb.asm

.org/D

ownloaded from

http://mcb.asm.org/


51

full-length, undigested HtrA1 after normalizing to -trypsin controls. Representative immunoblots 1102

in the absence (vehicle, top panels) or presence of trypsin (bottom panels) are shown. Each data 1103

point represents the mean + SEM (n=3). For each time point, paired t-test, *p<0.05. 1104

1105

Figure 3. NvAMD-linked synonymous SNPs at Ala34 and Gly36 of HtrA1 compromised 1106

recognition by antibodies against the Mac25/KI domains. Conditioned media containing ~1 1107

μg HtrA1 from transiently transfected HEK 293T cells were incubated overnight at 40C with 1108

antibodies (1 μg) targeted against the Mac25/KI (“MacKI”) domains or a proximal segment of 1109

the PDZ binding domain (PDZbd). Non-immune IgG was used as negative control. Immune 1110

complexes were precipitated with Protein A/G beads, washed four times, and boiled in sample 1111

buffer. The amount of immunoprecipitated WT or dSNP was determined after immunoblot 1112

analysis with a monoclonal antibody against the core (catalytic + PDZbd) domains of HtrA1. 1113

Under these conditions, the anti-PDZbd antibody recognized both WT and dSNP, whereas the 1114

anti-MacKI recognized WT but not dSNP. The data are representative of three repeats. 1115

1116

Figure 4. NvAMD-linked synonymous SNPs in HtrA1 impaired association with IGF-1. 1117

A. GST pull-down in the presence or absence of IGF-1 shows that HtrA1’s Mac25 and 1118

Mac25/KI domains were sufficient to capture IGF-1. Arrowheads indicate the GST fusion 1119

peptides. “In” refers to the input 10% aliquot removed from the GST pull-down master mix after 1120

8h co-incubation with IGF-1 at 40C. “PD” refers to the total pull-down fraction recovered after 1121

the agarose-bound GST fusion peptides were pelleted, washed, and boiled in sample buffer. B. 1122

Conditioned media from HEK 293T cells that contained 1 μg of WT or dSNP HtrA1 was 1123

buffered in PBS and pre-equilibrated with IGF-1 (3x molar excess) for 8h before addition of IP 1124


http://mcb.asm

.org/D

ownloaded from

http://mcb.asm.org/


52

antibodies against the C-terminal PDZ binding domain, or a non immune isotype control for 1125

overnight incubation. This antibody immunoprecipitated WT and dSNP comparably. IGF-1 was 1126

present in the IP fraction of WT but not dSNP. C and D. IGF-1 enhanced the chymotrypsin 1127

susceptibility of purified HtrA1. Recombinant human HtrA1 (1 μg) was pre-equilibrated with 2x 1128

molar excess IGF-1 at 40C, 2hr before chymotryptic digest. E and F. Comparison of 1129

chymotrypsin susceptibilities of HtrA1 derived from human leukocytes of NvAMD patients who 1130

are homozygotic for dSNP and unaffected controls in the presence (triangles) or absence 1131

(squares) of IGF-1. HtrA1-containing conditioned media was pre-incubated with two-fold molar 1132

excess of IGF-1 or an equivalent volume of buffer at 40C before exposure to chymotrypsin. A 1133

and B. In the absence of IGF-1, dSNP (open squares) showed enhanced susceptibility to 1134

chymotrypsin relative to unaffected control (closed squares). In the presence of IGF-1, 1135

chymotrypsin susceptibility of unaffected HtrA1 (closed triangles) was enhanced. IGF-1 did not 1136

influence the chymotrypsin susceptibility of dSNP (open triangles). C. Representative 1137

immunoblots (n =3) of parallel partial proteolysis assays in the absence (top panels) or presence 1138

(bottom panels) of IGF-1. Each time point represents the mean + SEM of three repeats. Paired t-1139

test, **p<0.01. 1140

1141

Figure 5. NvAMD-linked synonymous SNPs in HtrA1’s Mac25 domain impaired its ability 1142

to antagonize IGF-1-stimulated IGFR activation and signaling in primary human 1143

choroidal endothelial cells. A to C. HtrA1 attenuated IGF-1-stimulated IGFR and Akt 1144

activation in primary human choroidal endothelial cells. CECs were cultured on gelatin and 1145

serum-starved for 6 hrs prior to the assay. Recombinant purified human IGF-1 (5 ng) was pre-1146

equilibrated with varying doses of recombinant purified human HtrA1 at 40C for 2 hrs in PBS 1147


http://mcb.asm

.org/D

ownloaded from

http://mcb.asm.org/


53

before stimulation of CECs for 5 min at 370C. In parallel experiments, IGF-1 (5 ng) was pre-1148

incubated with HEK 293T (D to F) or human leukocyte (G to I) conditioned media that 1149

contained HtrA1 at 10-fold molar excess of IGF-1 for 2 hrs with percolation at 40C. Serum-1150

starved primary human CECs were stimulated with this mix for 5 min at 370C, and thereafter 1151

subjected to immunoblot analysis. D to F. HEK 293T-derived WT HtrA1 reduced IGFR 1152

phosphorylation, whereas dSNP failed to prevent IGFR activation. Deletion of human HtrA1’s 1153

Mac25 domain (residues 33-100) slightly (17%) attenuated IGFR autophosphorylation 1154

(*p<0.05). G to I. IGF-1 was pre-incubated with HtrA1-containing conditioned media from 1155

unaffected or NvAMD human leukocytes. Compared to vehicle control, HtrA1 from unaffected 1156

human leukocytes attenuated IGFR autophosphorylation. Immunodepletion of HtrA1 from this 1157

conditioned media with a specific antibody, but not an isotype control, restored IGFR 1158

phosphorylation by only ~60%. By contrast, pre-incubating IGF-1 with dSNP-containing 1159

conditioned media attenuated IGFR phosphorylation by ~65%. Immunodepletion of HtrA1 from 1160

this conditioned media with a specific antibody or an isotype resulted IGF-1-stimulated IGFR 1161

phosphorylation that was not significantly different from vehicle control. For all assays, the data 1162

represent the mean + SEM of n = 4 with three replicates. One-way ANOVA with Tukey’s post-1163

hoc test, ***p<0.001. 1164

1165

Figure 6. NvAMD-linked synonymous SNPs at Ala34 and Gly36 in HtrA1 impaired its 1166

ability to suppress IGF-1-driven choroidal tube formation. A and B. Primary human CECs 1167

were cultured in a collagen gel sandwich and stimulated with varying doses of IGF-1 (50 – 200 1168

ng). CECs stably organized into tubes 12-16 hrs after stimulation with >75 ng IGF-1. Panel B 1169

shows representative photos of the tubes that formed. C and D. For all assays, HtrA1 in the 1170


http://mcb.asm

.org/D

ownloaded from

http://mcb.asm.org/


54

conditioned media was first quantified by immunoblot, and an aliquot containing five-fold molar 1171

excess of IGF-1 (100 ng) was co-incubated with the growth factor for 2 hr at 40C. Peak tube 1172

lengths were observed after 12-16 hrs. IGF-1 that was pre-treated with empty vector (EV) 1173

conditioned media potently stimulated tube formation (>3-fold above baseline). HEK 293T-1174

derived WT significantly attenuated IGF-1-driven CEC tube formation, whereas dSNP failed to 1175

mitigate this effect. Deletion of Mac25 domain impaired HtrA1’s ability to suppress IGF-1-1176

stimulated CEC tube formation (C). IGF-1 was incubated with conditioned media from 1177

unaffected or NvAMD human leukocytes for 2 hr at 40C. Pre-treatment of IGF-1 with unaffected 1178

conditioned media suppressed CEC tube formation. Immunodepletion of HtrA1 from this 1179

conditioned media with a specific antibody, but not an isotype control, restored IGF-1-stimulated 1180

CEC tube formation. By contrast, human leukocyte-derived dSNP HtrA1 failed to mitigate IGF-1181

1-stimulated hCEC neovessel formation (D). For all assays, three random fields per well were 1182

photographed for quantification. The data represent the mean + SEM of three repeats, each with 1183

three replicates. One-way ANOVA with Tukey’s post-hoc test, ***p<0.001. 1184

1185


http://mcb.asm

.org/D

ownloaded from

http://mcb.asm.org/


55

Table I. Subject characteristics. Details of patient recruitment and assessment of age-related 1186

macular degeneration status according to the Age-Related Eye Disease Study (AREDS) scale 1187

were described previously (DeAngelis, et. al., 2008). Normal, unaffected macula is defined as 1188

having 0 to 5 small drusen (<63 μm in diameter), no pigment abnormalities, no geographic 1189

atrophy, and no neovascularization (DeAngelis, et. al., 2008). 1190

Characteristic Unaffected

Neovascular AMD

Total, N 198 341 Average age at exam(SD) 75.40 (8.25) 73.30 (7.73) Gender (% of female) 56.10% 59.40%

Abbreviations: SD, standard deviation. 1191

1192


http://mcb.asm

.org/D

ownloaded from

http://mcb.asm.org/


56

Table II. The HTRA1 variants rs1049331 and rs2293870 are enriched in NvAMD affected 1193

subjects. A and B. Approximately 70% of the NvAMD subjects in this study are homozygotic 1194

for rs1049331 (A, ~36%) or rs2293870 (B, ~35%) vs. only 28% of unaffected controls 1195

(highlighted in grey). C. NvAMD subjects who are homozygotic for both rs1049331 and 1196

rs22943870 account for >33% of the subjects. Immortalized leukocytes used for subsequent 1197

functional analysis in this study are derived from this pool of subjects and unaffected controls 1198

(highlighted in grey). 1199

Unaffected Neovascular AMD

A HTRA1 Frequency % No. Frequency % No.

rs10

4933

1

Genotype, “T” is rare alleleCC 53.61% 104 28.96% 97 TC 32.47% 63 35.82% 120 TT 13.92% 27 35.22% 118

Total 194 335

Allele C 69.85% 271 46.87% 314 T 30.15% 117 53.13% 356

Total 388 670


B HTRA1 Frequency % No. Frequency % No.

rs22

9387

0

Genotype “T” and “C” are rare alleles

GG 40.31% 79 21.99% 73 TG 29.59% 58 32.53% 108 CG 10.20% 20 5.42% 18 CT 4.59% 9 4.82% 16 TT 13.78% 27 34.64% 115 CC 1.53% 3 0.60% 2

Total 196 332

Allele G 60.20% 236 40.96% 272 T 30.87% 121 53.31% 354 C 8.93% 35 5.72% 38

Total 392 664


C HTRA1 Frequency % No. Frequency % No.

rs10

4933

1 +

rs

2293

870

Genotypes Homozygous risk at both 13.78% 27 34.34% 114

At least 1 risk allele at both 60.20% 118 78.01% 259

Total 196 332

1200


http://mcb.asm

.org/D

ownloaded from

http://mcb.asm.org/


57

Table III. Homozygosity for the minor alleles of rs1049331 and rs22293870 increases the 1201

inherited risk for developing NvAMD. rs1049331 or rs2293870 alone is strongly associated 1202

with NvAMD (p value <1.0E-7), and increases inherited NvAMD risk relative to unaffected 1203

controls by 6x or 3.5x, respectively. Individuals who are homozygous for both rs1049331 and 1204

rs2293870 are 10.6x more likely to develop NvAMD. 1205

Neovascular vs. Normal

Risk Factor Risk Odds Ratio 95% CI Low 95% CI High p value

rs1049331 (Additive) T 6.636 3.557 12.378 2.69E-09

rs2293870 (Additive) T or C 3.603 2.227 5.829 1.76E-07

rs1049331 + rs2293870 Homozygous risk at both 10.608 3.676 30.613 1.26E-05

rs1049331 + rs2293870 At least 1 risk allele at both 3.661 1.874 7.155 1.46E-04

1206


http://mcb.asm

.org/D

ownloaded from

http://mcb.asm.org/


http://mcb.asm

.org/D

ownloaded from

http://mcb.asm.org/

2013 jacobo, s.m.p., et. al. 1 amd-associated silent polymorphisms

Documents