1 running head: the role of ethylene in virus-vector interactions 2 · 2015-07-06 · 162 (ethylene...

1

Running head: The role of ethylene in virus-vector interactions 1

2

To whom correspondence should be addressed: 3

Clare L. Casteel 4

Department of Plant Pathology 5

University of California 6

1 Shields Avenue 7

Davis, CA 95616 8

Phone: (530)-752-6897 9

Email: [email protected] 10

11

12

13

14

15

16

Plant Physiology research area: Signaling and Response 17

18

Plant Physiology Preview. Published on July 6, 2015, as DOI:10.1104/pp.15.00332

Copyright 2015 by the American Society of Plant Biologists

www.plantphysiol.orgon October 1, 2020 - Published by Downloaded from Copyright © 2015 American Society of Plant Biologists. All rights reserved.

http://www.plantphysiol.org

2

Title: Disruption of ethylene responses by Turnip mosaic virus mediates suppression of 19

plant defense against the aphid vector, Myzus persicae 20

21

Authors: Clare L. Casteel1, Manori De Alwis2, Aurelie Bak1, Haili Dong3, Steven A. 22

Whitham3 and Georg Jander2 23

24 1Department of Plant Pathology, University of California, Davis, CA, 95616, USA 25 2Boyce Thompson Institute for Plant Research, Ithaca, NY, 14853, USA 26 3Department of Plant Pathology and Microbiology, Iowa State University, Ames, IA 27

50011, USA 28

29

30

31

32

33

34

35

36

37

38

39

40

41

42

43

44

45

46

Summary: A plant virus suppresses plant defense against insect vectors by modulating 47

ethylene responses. 48



3

49

Footnotes: 50

This publication was supported by the United States Department of Agriculture award 51

2013-2013-03265 to CLC, University of California start-up funds to CLC, and a grant 52

from the US National Science Foundation, IOS-1121788 to GJ and SAW.53



4

Abstract 54

Plants employ diverse responses mediated by phytohormones to defend themselves 55

against pathogens and herbivores. Adapted pathogens and herbivores often manipulate 56

these responses to their benefit. Previously we demonstrated that Turnip mosaic virus 57

(TuMV) infection suppresses callose deposition, an important plant defense induced in 58

response to feeding by its aphid vector (Myzus persicae), and increases aphid fecundity 59

compared to uninfected control plants. Further, we determined that production of a single 60

TuMV protein, NIa-Pro (Nuclear Inclusion a - Protease domain), was responsible for 61

changes in host plant physiology and increased M. persicae reproduction. To characterize 62

the underlying molecular mechanisms of this phenomenon, we examined the role of three 63

phytohormone signaling pathways, jasmonic acid, salicylic acid, and ethylene, in TuMV-64

infected Arabidopsis thaliana (Arabidopsis), with and without aphid herbivory. 65

Experiments with Arabidopsis mutants, ethylene insensitive2 (ein2) and ethylene 66

response1 (etr1), as well as chemical inhibitors of ethylene synthesis and perception 67

(aminoethoxyvinylglycine and 1-methylcyclopropene, respectively), show that the 68

ethylene signaling pathway is required for TuMV-mediated suppression of Arabidopsis 69

resistance to M. persicae. Additionally, transgenic expression of NIa-Pro in Arabidopsis 70

alters ethylene responses and suppresses aphid-induced callose formation in an ethylene-71

dependent manner. Thus, disruption of ethylene responses in plants is an additional 72

function of NIa-Pro, a highly conserved Potyvirus protein. Virus-induced changes in 73

ethylene responses may mediate vector-plant interactions more broadly and thus 74

represent a conserved mechanism for increasing transmission by insect vectors across 75

generations. 76

77

78

79

80



5

Introduction 81

Plants suffer from numerous pathogen and herbivore challenges in both natural and 82

agricultural environments, often facing multiple simultaneous threats (Casteel and 83

Hansen, 2014). For example, many plant pathogens depend of insect vectors for 84

transmission, including over 75% of all described plant viruses (Nault, 1997). Thus, 85

plants must recognize, prioritize, and mount the most appropriate response to both the 86

insect that is feeding and the pathogen being transmitted. Despite constant attack, plants 87

persist, largely due to a sophisticated surveillance system that is orchestrates an arsenal of 88

defenses that may be morphological, biochemical, or molecular in nature (Jones and 89

Dangl, 2006; Jander and Howe, 2008). Nevertheless, pathogens and insects successfully 90

colonize plants by actively compromising plant perception and/or defense responses. 91

Recent studies show that synergisms exist between challengers, where both 92

parties benefit during dual attack. For example, some virus infections can decrease plant 93

defenses against insects, increasing plant palatability and vector fitness. Consequently, 94

improved insect performance will increase the number of viruliferous vectors, promoting 95

virus transmission to new hosts (Mauck et al., 2010; Casteel and Jander, 2013; Casteel et 96

al., 2014; Li et al., 2014). Thus, vector-plant interactions represent a critical and 97

synergistic relationship, ultimately determining survival and host range. Although 98

numerous studies have examined virus-plant interactions, few have examined the 99

molecular and genetic mechanisms mediating plant-virus-vector interactions and 100

alterations in plant defenses (Li et al., 2014; Mauck et al., 2014). 101

While defenses vary wildly across plant species, the phytohormones that regulate 102

their production are somewhat conserved (Mauck et al., 2014). Modulation of hormone 103

composition, timing, and concentration specifies plant responses to an attack (Mur et al., 104

2006; Verhage et al., 2010) and represents an excellent target for compromising defenses. 105

Numerous studies have demonstrated that at least three phytohormones, jasmonic acid 106

(JA), salicylic acid (SA) and ethylene (ET), have major roles in orchestrating plant 107

defense responses (Bari and Jones, 2009; Erb et al., 2012; Pieterse et al., 2012). In 108

general, SA signaling is critical for defense responses against a wide range of pathogens, 109

including viruses (Glazebrook, 2005; Carr et al., 2010). Production of JA and ET, 110

meanwhile, are involved in regulation of plant response to herbivores, necrotrophic 111



6

pathogens, and non-pathogenic microbes (Glazebrook, 2005; Howe and Jander, 2008; 112

Van der Ent et al., 2009). Virus infection can also alter JA and ET signaling (Carr et al., 113

2010; Lewsey et al., 2010; Wei et al., 2010; Mauck et al., 2014). 114

Together, Arabidopsis thaliana (Arabidopsis), Myzus persicae (green peach 115

aphid), and Turnip mosaic virus (TuMV) constitute an excellent model system for 116

investigating the molecular and biochemical mechanisms that underlie plant-aphid-virus 117

interactions. As a well-studied model plant, Arabidopsis provides numerous genetic 118

resources that can be used to investigate responses to aphid feeding and virus infection. 119

M. persicae is a broad host range aphid and the world’s most prolific plant virus vector, 120

transmitting more than 100 different viral species (Kennedy et al., 1962). M. persicae is 121

the most common aphid pest on Arabidopsis in greenhouses and growth chambers (Bush 122

et al., 2006), and we also have observed it feeding from Arabidopsis growing in nature. 123

Due to the agricultural relevance of M. persicae, there is a large body of literature about 124

the biology of this insect and its interactions with host plants, going back more than 100 125

years. More recently, several research groups have initiated projects to study plant 126

defense against aphids using Arabidopsis and M. persicae as a model system (De Vos et 127

al., 2007; Louis and Shah, 2013). TuMV is a positive-strand RNA virus that infects not 128

only Arabidopsis but also hundreds of other species in more than forty plant families 129

(Walsh and Jenner, 2002). It is considered to be one of the most damaging viruses for 130

vegetable crops worldwide (Tomlinson, 1987; Nguyen et al., 2013; Yasaka et al., 2015) 131

and is transmitted by M. persicae and many other aphid species in both natural and 132

agricultural settings (Shattuck, 1992). Largely due to its ability to systemically infect 133

Arabidopsis (Sanchez et al., 1998; Martin Martin et al., 1999), TuMV has become a 134

model for potyvirus-host interactions (Walsh and Jenner, 2002). 135

In this study, we investigate the role of phytohormone signals in TuMV’s ability 136

to suppress plant defense and enhance aphid fecundity during infection of host plants. 137

First we show that TuMV infection induces SA and ET accumulation in Arabidopsis. 138

Next, using genetic and pharmacological analyses, we demonstrate that ET signaling is 139

necessary for TuMV-initiated suppression of plant defense responses and enhanced aphid 140

reproduction in plants. Further, we show that expression of the viral protein, NIa-Pro, 141

alters ET responses and that ET is also required for NIa-Pro’s role in suppressing aphid-142



7

induced defense in virus-infected plants. This molecular, biochemical, and genetic 143

evidence reveals that TuMV may modulate ET responses not only to increase plant 144

susceptibility to infection but also to increase vector performance. 145

146

Results 147

SA, JA, and ET were quantified in Arabidopsis plants challenged with TuMV, aphids, 148

and the combination of the two (Fig. 1). TuMV-GFP infection more than doubled SA and 149

ET production in host plants relative to controls. Aphid feeding had no significant impact 150

on SA or ET accumulation (Fig. 1A, C), but induced JA accumulation more than four-151

fold relative to control plants (Fig. 1B). There were no significant impacts of TuMV in 152

combination with aphids on SA, JA, and ET. 153

To determine the biological relevance of these phytohormone changes, we 154

surveyed Arabidopsis mutants that were compromised in individual signaling pathways 155

for enhanced aphid fecundity on TuMV-infected plants. Aphids produced significantly 156

more progeny on TuMV-infected wildtype Arabidopsis and mutants compromised in SA 157

signaling controls (salicylic acid induction deficient2, sid2-1; non-expresser of pr1, npr1-158

2; Fig. 2). This suggests that a functioning SA signaling pathway is not required for 159

TuMV’s ability to enhance aphid fecundity. In contrast to SA signaling mutants, aphid 160

reproduction was not enhanced by TuMV-GFP infection of mutants insensitive to ET 161

(ethylene insensitive2, ein2-1; ethylene receptor1, etr1-3; Fig. 2). Although aphid 162

performance was not enhanced on the JA-insensitive mutant coronatine insensitive1 163

(coi1) infected with TuMV-GFP compared to the mock-inoculated mutant, aphids 164

generally performed better on coi1 plants compared to wild type controls without TuMV-165

GFP. This was not observed in another JA insensitive mutant (jasmonate insensitive 1, 166

jin1; Fig. 2). As reported previously, M. persicae produced more progeny on plants with 167

defects in JA signaling (Mewis et al., 2005). Together, these results indicate that 168

induction of ET and components of jasmonic signaling may be critical to TuMV’s ability 169

to enhance aphid fecundity during infection of host plants, whereas the induction of 170

salicylic acid is not. 171

To further investigate the role of ET signaling in virus-vector interactions, we 172

used a pharmacological approach to inhibit ET signaling. TuMV-infected Arabidopsis 173



8

plants were treated with aminoethoxyvinylglycine (AVG), which inhibits ET biosynthesis 174

(Amrhein and Wenker, 1979) or with 1-methylcyclopropene (MCP), which blocks ET 175

perception by binding to ET receptors (Sisler, 2006). Two chemical inhibitors were used 176

in experiments because, although AVG is easier to work with, it is known to also impact 177

auxin signaling in host plants (Soeno et al., 2010). Aphids were then caged on these 178

plants and allowed to develop and reproduce over time. TuMV-GFP infection did not 179

enhance aphid fecundity when ET perception (Fig. 3A, C; MCP) or biosynthesis (Fig. 180

3B,D; AVG) was inhibited in Arabidopsis and Nicotiana benthamiana, further 181

confirming the genetic approaches described above (Fig. 2). 182

Previously, we demonstrated that TuMV infection inhibits aphid-induced callose 183

production in host plants (Casteel et al., 2014). Since ET plays a major role in bacteria-184

triggered callose deposition (Clay et al., 2009), it may be required for inhibition of aphid-185

induced callose deposition by TuMV. Consistent with this hypothesis, aphid-induced 186

callose was inhibited in wildtype plants infected with TuMV, while aphids induced 187

callose deposition significantly in ET signaling mutants infected with TuMV-GFP (Fig. 188

4A). Next, we treated plants challenged with TuMV-GFP using the ET inhibitors MCP 189

and AVG, as described above, and quantified aphid-induced callose accumulation. While 190

TuMV-GFP infection inhibited aphid-induced callose deposition in wild type plants, 191

aphid feeding induced significant callose deposition in infected plants treated with ET 192

biosynthesis or perception inhibitors (Fig. 4B, C). Additionally, callose induction in 193

TuMV-infected plants was generally higher in plants with compromised ET signaling as 194

compared to corresponding controls (Fig. 4), suggesting that induction of ET during virus 195

infection (Fig. 1C) may play a major role in inhibition of virus-induced callose formation. 196

To determine the role of ET induction in enhanced aphid fecundity, we treated mock- and 197

TuMV-infected plants with 20 ppm of ET. Aphids were then added as previously 198

described and fecundity quantified. Treatment of plants with ET did not enhance aphid 199

fecundity in either treatment significantly (Fig. 5), suggesting that the amount of ET 200

added is beyond the threshold required to increase aphid performance and aphids will not 201

benefit further. 202

NIa-Pro is the major protease needed to process the TuMV polyprotein into 203

individual functioning proteins (Urcuqui-Inchima et al., 2001). Recently, we 204



9

demonstrated the additional ability of NIa-Pro to inhibit plant defenses and increase aphid 205

performance (Casteel et al., 2014). Further experiments were designed to determine 206

whether ET signaling is required for NIa-Pro’s ability to enhance aphid performance and 207

inhibit plant defenses (Fig. 6). Consistent with previous results, aphid-induced callose 208

was inhibited and aphids were significantly more fecund on plants expressing NIa-Pro 209

compared to empty vector controls (Fig. 6A, B, C). However, when ET signaling was 210

inhibited in plants expressing NIa-Pro, aphid fecundity was not increased (Fig. 6A, B). 211

While inhibition of aphid-induced callose was prevented in transgenic plants expressing 212

NIa-Pro treated with AVG, the same pattern was not observed with MCP (Fig. 6B, C). 213

Surprisingly, all plants treated with MCP had greater amounts of callose (Fig. 6B). 214

However, this is consistent with a lack of significant difference in aphid fecundity 215

observed on these plants (Fig. 6A). These results suggest that ET signaling is required for 216

NIa-Pro’s ability to enhance aphid performance. 217

To test the hypothesis that NIa-Pro expression alters ET production in plants, we 218

conducted experiments with transgenic Arabidopsis expressing NIa-Pro. While there was 219

no significant difference in ET production between wild type plants and plants expressing 220

the empty vector, plants expressing NIa-Pro produced greater amounts of constitutive ET 221

compared to both controls (Fig. 7). Next we examined ethylene-dependent and ethylene-222

independent changes in transcript abundance to determine the generality of the response. 223

We measured accumulation of EIN2, a positive regulator of the ET signaling pathway 224

(Qiao et al., 2009), EIN3, a key transcription factor mediating ethylene-regulated gene 225

expression (Guo and Ecker, 2003), ERF1, a transcription factor induced by ET 226

production and targeted by EIN3 (Solano et al., 1998), acting down-stream of EIN2 227

(Stepanova and Alonso, 2005), and an ethylene inducible plant defensin (PDF1.2) 228

(Penninckx et al., 1998). We did not observe a major modification of EIN2 or EIN3 229

transcript abundance in TuMV or aphid treatments (Fig 8A, B). However, EIN2 transcript 230

accumulation was increased in the plants expressing EV and NIa-Pro with aphid feeding 231

(Fig. 8A). EIN2 and EIN3 accumulation are not regulated by ethylene production as 232

evident in previous studies (Alonso et al., 1999; Guo and Ecker, 2003). In contrast to 233

EIN2 and EIN3, ERF1 and PDF1.2 are induced by ethylene production (Brown et al., 234

2003; Lorenzo et al., 2003). ERF1 transcript abundance is increased in plants by aphid 235



10

feeding, TuMV infection, and NIa-Pro expression (Fig. 8C). Additionally, aphid feeding 236

on plants expressing NIa-Pro increased ERF1 transcript abundance the most compared to 237

all other treatments (Fig. 7C). Surprisingly, PDF1.2 was not induced by TuMV infection, 238

but was significantly increased in plants expressing NIa-Pro (Fig. 8D) compared to 239

controls. However, PDF1.2 was not induced in plants expressing NIa-Pro with aphid 240

feeding compared to controls (Fig. 8D). Next we measured the accumulation of OSR1 241

and AZI1, two transcripts not related to ethylene signaling or ethylene-induced defense 242

responses, but robustly induced in response to ethylene treatment (Hall et al., 2012). 243

TuMV infection increased OSR1 accumulation, while aphid feeding induced AZI1 244

accumulation compared to controls (Fig. 9). However, in contrast to the ethylene-induced 245

transcripts related to plant defenses (ERF1 and PDF1.2), NIa-Pro expression did not alter 246

accumulation of OSR1 and AZI1 (Fig. 9). These results show that NIa-Pro expression 247

interferes with a specific set of ET-induced defense responses. 248

Induction of ET by TuMV may indirectly benefit the virus by increasing vector 249

performance and thus the number of inoculated vectors available for transmission. ET 250

induction also may benefit the virus directly by increasing infection efficiency or 251

performance. To determine whether ET induction is directly beneficial to TuMV, we 252

challenged three-week-old Arabidopsis mutants that were insensitive to ET (ein2-1; etr1-253

3) and mutants that constitutively induce ET (eto1-2; Fig. 10) with TuMV. Next, the 254

number of infected plants was quantified after 5 days. Significantly greater numbers of 255

ET-insensitive mutants were infected compared to wild type controls (Fig. 10). However, 256

in mutants that constitutively produce ET, there was no difference in infection rate (Fig. 257

10). These findings indicate that induction of ET signaling is important for successful 258

TuMV infection of Arabidopsis. 259

260

Discussion 261

Our results demonstrate that ET responses are critical for TuMV-vector 262

synergisms. TuMV induces ET production (Fig. 1), and ET biosynthesis and perception 263

are required for NIa-Pro to suppress plant defenses and increase insect performance on 264

infected host plants (Fig. 2, 3, 4, 6). Further, expression of NIa-Pro directly increases ET 265

production (Fig. 7) and alters a specific set of ethylene-induced defense transcripts (Fig. 8 266



11

and 9). Additionally, plants with compromised ET signaling are more resistant to TuMV 267

(Fig. 8). Taken together, these results suggest that TuMV may be inducing ET production 268

in order to increase plant susceptibility. Alterations in ET also benefit aphids, increasing 269

insect fecundity on infected plants, and therefore the number of viruliferous aphids. Virus 270

infection and aphid feeding have been shown to influence the production of ET (Love et 271

al., 2005; Love et al., 2007; Kim et al., 2008; Mantelin et al., 2009; Chen et al., 2013; 272

Haikonen et al., 2013; Mandadi et al., 2014; Mauck et al., 2014), though ET’s role in 273

vector-virus-plant interactions has not yet been demonstrated. Virus-induced changes in 274

ET responses may mediate vector-plant interactions more broadly and thus represent a 275

conserved mechanism for increasing transmission by insect vectors across generations. 276

ET regulates plant responses to biotic and abiotic stress and mediates plant 277

development and senescence (van Loon et al., 2006; Koyama, 2014). No generalized role 278

of ET in plant-virus interactions has been established. Also, only a few systems have 279

been investigated with significant variation across interactions (van Loon et al., 2006; 280

Love et al., 2007; Kim et al., 2008; Endres et al., 2010; Haikonen et al., 2013; Mauck et 281

al., 2014). However, ET may play an important role in antiviral defense. Recent studies 282

found that Arabidopsis ein2 and etr1 mutations increased resistance to Tobacco mosaic 283

virus and Cauliflower mosaic virus (Love et al., 2005; Love et al., 2007; Chen et al., 284

2013), consistent with our results. Further, overexpression of ERF5, an ET response 285

transcription factor, from Nicotiana tabacum conferred reduced susceptibility to Tobacco 286

mosaic virus, indicating an important role of ET in plant-virus interactions. Increases in 287

ET production following aphid feeding also have been reported in various plant–aphid 288

interactions. However, ET production has been associated with both increased 289

susceptibility and resistance to aphids (Miller et al., 1994; Argandoña et al., 2001; 290

Mantelin et al., 2009; Lu et al., 2014; Wu et al., 2015). The role of ET in both plant-virus 291

and plant-aphid interactions may be mediated by the compatibility of the interactions, 292

although additional studies are needed to confirm this. 293

NIa-Pro is the main protease for TuMV, cleaving the TuMV polyprotein into 294

individual proteins (Urcuqui-Inchima et al., 2001). NIa-Pro possesses relatively strict 295

substrate specificity, cleaving after Gln at Val-Xaa-His-Gln (Kang et al., 2001). A 296

previous study demonstrated that the same consensus sequence site, Val-Xaa-His-Gln, 297



12

exists in an amyloid-β peptide from animals and NIa-Pro has activity against this site 298

(Han et al., 2010). It is possible that NIa-Pro also cleaves a plant protein that possesses 299

the NIa-Pro cleavage substrate. Yet NIa-Pro also has other functions, including non-300

specific DNAse activity (Anindya and Savithri, 2004; Rajamäki and Valkonen, 2009), 301

and may possess additional unknown functions that are critical to aphid-virus-plant 302

interactions. 303

Relatively few studies have identified the host plant genes that mediate virus-304

plant-vector interactions. However, two host proteins have been identified that may 305

mediate plant interactions with Tomato yellow leaf curl China virus (TYLCCNV) and its 306

whitefly vector (Bemisia tabaci). TYLCCNV-infected plants have reduced defense 307

responses and impaired JA signaling, benefiting whitefly vectors and increasing 308

attraction. TYLCCNV is transmitted with a betasatellite pathogenicity factor, βC1, which 309

mediates suppression of plant signaling and defense responses (Yang et al., 2008; Zhang 310

et al., 2012). Recently, host proteins were identified that interact with βC1 and mediate 311

suppression of plant signaling and defense responses. βC1 interacts with the 312

ASYMMETRIC LEAVES1 (ASI), which suppress JA signaling, and with the 313

transcription factor MYC2, compromising activation of plant defense responses (Yang et 314

al., 2008; Li et al., 2014). Future identification of host proteins that interact with NIa-Pro 315

will shed light on this novel function. 316

While ET signaling is required for TuMV’s ability to increase aphid fecundity, it 317

does not appear that NIa-Pro is targeting a key regulator of ethylene signaling, as NIa-Pro 318

alters a specific set of ethylene-induced defense transcripts (Fig. 8 and 9). Signaling by 319

other hormones could also be involved. Virus infection alters the accumulation of many 320

plant hormones, which can be viewed as either a disruption to a susceptible host, or a 321

coordination of responses by a resistant host (Alazem and Lin, 2014). Consistent with 322

previous findings (Ellis et al., 2002), aphids produced more progeny on a coi1 mutant, 323

which lacks a receptor for JA-isoleucine conjugates, than on wildtype Arabidopsis. 324

Additionally, TuMV-enhanced aphid fecundity was not observed on the coi1 mutant, 325

suggesting the involvement of JA signaling in virus-vector-plant interactions (Fig. 2). In 326

contrast to coi1, TuMV-GFP infection in jin1, another JA signaling mutant, still 327

enhanced aphid fecundity (Fig. 2). These results suggest that NIa-Pro may target 328



13

components of this pathway in addition to ET. Significant cross talk exists between the 329

ET and JA pathways. However changes may not be directly related to JA. For example, 330

ethylene-dependent inhibition of root growth (Adams and Turner, 2010) and 331

susceptibility to Verticillium longisporum (Ralhan et al., 2012) are altered in the coi1 332

mutant independently of JA biosynthesis and related signaling. Thus, alterations in as yet 333

unknown components of COI1 signaling may explain our observed results. 334

Although genetic resistance in the host plants is currently the best approach for 335

TuMV management, such resistance is not available for all crop species or it may fail 336

because it is not effective against all strains of the virus (Shattuck, 1992). Therefore, 337

research on the interactions between TuMV, its aphid vectors, and host plants is 338

necessary for the development of new strategies to combat viral infections in agricultural 339

crops. Although further research on the interactions between M. persicae, TuMV, and 340

their host plants will be needed, the results presented here suggest that manipulation of 341

ethylene signaling in response to virus infection may provide a means to limit the spread 342

and transmission of TuMV in plants. 343

344

Materials and Methods 345

Plants and growth conditions - Wild type Arabidopsis thaliana (Arabidopsis) 346

Columbia-0 (Col-0) and Arabidopsis mutants in the Col-0 background (sid2-1, npr1-2, 347

jin1-1, coi1-1, ein2-1, eto1-2, and etr1-3) were obtained from the Arabidopsis Biological 348

Resource Center (www.arabidopsis.org). Nicotiana benthamiana seeds were obtained 349

from Peter Moffett (Université de Sherbrooke, Quebec, Canada). Plants were grown in 350

Conviron growth chambers in 20 × 40-cm nursery flats using Cornell Mix (by weight 351

56% peat moss, 35% vermiculite, 4% lime, 4% Osmocoat slow-release fertilizer [Scotts, 352

Marysville, OH], and 1% Unimix [Scotts, Marysville, OH]) at 23°C and a 16:8-h 353

light:dark photoperiod, as previously described (Casteel et al., 2014). Seeds from 354

COI1/coi1-1 Arabidopsis were planted and grown as previously described (Rasmann et 355

al., 2012). Plants were grown for 3 weeks and were used in experiments before flowering, 356

unless otherwise noted. All experiments were conducted at least 2 times, with varying 357

numbers of biological replicates per treatment per experiment. 358



14

TuMV infection - TuMV-GFP was propagated from infectious clone p35TuMVGFP 359

(Lellis et al., 2002). To prepare inoculum, fully infected N. benthamiana leaves were 360

collected three weeks after inoculation and weighed. Leaves were then ground in 2 361

volumes 20 mM sodium phosphate buffer (pH 7.2), filtered through organza mesh cloth, 362

and frozen in aliquots at –80ºC. For inoculations, one leaf from each plant was dusted 363

with carborundum (Sigma, St. Louis, MO) and rub-inoculated with TuMV-GFP sap using 364

a cotton-stick applicator. A corresponding set of control plants was dusted with 365

carborundum and mock-inoculated with a cotton-stick applicator that was soaked in 366

uninfected N. benthamiana sap in 20 mM phosphate buffer, prepared in the same manner 367

as the virus-infected sap (mock inoculation treatment throughout the manuscript). Ten 368

days after inoculation, a UV lamp (UV Products, Upland, CA, Blak Ray model B 100AP) 369

was used to identify fully infected leaves. For infection rate bioassays, a UV light was 370

used after 5 day post inoculation to identify infected plants. 371

Insects - All experiments were conducted with a tobacco-adapted red strain of Myzus 372

persicae (green peach aphid) that was obtained from Stewart Gray (USDA Plant Soil and 373

Nutrition Laboratory, Ithaca, NY, USA). Aphids were reared on tobacco (N. tabacum) 374

with a 16:8-h light:dark photoperiod at 24 °C (150 mmol m-2 s -1). 375

Aphid bioassays - To assess the effect of TuMV infection on aphid fecundity, one 376

apterous adult aphid was placed in a plastic clip cage on the underside of a fully infected 377

or mock-inoculated N. benthamiana or the full leaf of Arabidopsis. After 24 hours, all 378

aphids except one nymph were removed. The single nymph was allowed to develop and 379

progeny were counted after 7 to 9 days to determine fecundity. 380

Jasmonic acid and salicylic acid analysis – Wildtype Arabidopsis were planted as 381

described above and, after three weeks of growth, half of the plants were infected with 382

TuMV-GFP as described above. After one week, infected plants were identified by 383

fluorescence under UV light. For aphid induction, 15 adult apterous aphids were caged 384

on one leaf per plant on six plants with TuMV-GFP infection and six mock-inoculated 385

plants. Corresponding sets of individual leaves received cages with no aphids as a control 386

(six plants with TuMV-GFP infection and six mock-inoculated plants). Caged leaves 387

were developmentally matched and infected leaves were verified for full infection before 388



15

caging based on GFP visualization. Twenty-four hours after aphid placement, each caged 389

leaf was harvested individually. Harvested leaves were weighed and placed in tubes 390

containing two steel balls, before being flash-frozen in liquid nitrogen and stored at -391

80°C until further use. One mL extraction buffer (iso-propanol:H2O:HCl , 2:1:0.005, v/v) 392

was added to each sample. d4-SA and d5-JA (CDN isotopes, Point-Claire, Canada) were 393

added as internal standards and samples were homogenized in a paint shaker for 45 s. 394

Samples were dissolved in 200 µL methanol after extraction with dichloromethane and 395

solvent evaporation, and 15 µL were analyzed using a triple-quadrupole LC-MS/MS 396

system (Quantum Access; Thermo Scientific, Waltham, MA, USA). Samples were 397

separated on a C18 reversed phase HPLC column (Gemini-NX, 3µ, 150 x 2.00 mm; 398

Phenomenex, Torrance, CA, USA) using a gradient of 0.1% formic acid in water and 399

0.1% formic acid in acetonitrile at a flow rate of 300 µL min-1, as previously described 400

(Rasmann et al., 2012). 401

Ethylene analysis - Four leaves were cut from each of twelve mock-inoculated plants 402

and from twelve TuMV-GFP-infected plants and weighed. Only fully infected leaves 403

were used and all leaves were developmentally matched, as previously described. The 404

four leaves from each individual plant were then placed in a gas-tight 10 ml glass jar with 405

1 ml of water. To allow wound-induced ethylene to dissipate, jars were left open for two 406

hours. After this period, 15 adult apterous aphids each were added half of the jars for 407

each treatment and all jars were sealed. Twenty-four hours after jars were sealed, a 1 ml 408

sample of head space was injected using a loop injector and in analyzed using a gas 409

chromatograph equipped with a flame ionization detector (Agilent, Santa Clara, CA; 410

column: GS-GAS PRO, Custom Column 5" Cage, Length 30, Diameter 0.32 mm, Limits 411

from –80 to 260 (isothermal) program 300). Samples were compared to a standard of 412

known concentration and values (nl/h g fresh weight) representing averages from several 413

independent plants of treatment (n = 6 per line). Ethylene production in Arabidopsis 414

mutants and in the inhibition experiment below was verified by this method as well. 415

Ethylene inhibition experiments - To examine the role of ethylene in virus-vector 416

interactions ethylene signaling was inhibited using 1-methylcyclopropene (MCP), which 417

blocks ethylene perception by binding to ethylene receptors and 418



16

aminoethoxyvinylglycine (AVG), which inhibits ethylene biosynthesis. For MCP 419

treatment 1 mg of MCP (0.14%) was dissolved in 100 mL of distilled water. Next, each 420

flat of plants was enclosed in an airtight container and twenty ml of the MCP solution 421

was immediately placed in each glass jar in the container with the plants. As a control, a 422

similar experiment was set up with water. Plants were removed after 24 hours. MCP 423

treatment was done thrice: once the day after infecting, once the day before aphids were 424

put on the plants, and once four days after aphids were added. For AVG treatment, 1 425

gram of AVG was dissolved in 1 liter of water with 0.05% Silwet (Momentive 426

Performance Materials, Waterford, New York). Plants were treated on the day after 427

infecting, and every four days until experiments were finished. 428

Ethylene induction experiments - We challenged plants with TuMV, as previously 429

described (Casteel et al., 2014). The plants were divided equally into two airtight 430

chambers and ethylene was injected to a concentration of 20 ppm. Four days later, aphids 431

were added as described above and plants were treated again with ethylene. A final 432

ethylene treatment was applied four days after aphids were added. At the end of the 433

experiment, aphid progeny were counted. 434

Callose staining - Arabidopsis leaves were collected 24 hours after infestation with 25 435

aphids, depending on the experiment. Callose accumulation was visualized as previously 436

described (Casteel et al., 2014). Briefly, leaves were cleared in 95% ethanol overnight 437

and stained with 150 mM K2P04 (pH 9.5), 0.01% aniline blue for 2 h. The leaves were 438

examined for UV fluorescence using a Leica fluorescence compound microscope (365 439

nm excitation, 396 nm chromatic beam splitter, 420 nm barrier filter), and callose spots 440

were quantified manually. 441

Arabidopsis transgenic plants - The transformation vectors harboring pMDC32 NIa-442

Pro or the pMDC32 empty vector were introduced into Agrobacterium tumefaciens and 443

transferred into wildtype Arabidopsis plants by floral dip transformation (Clough and 444

Bent, 1998). Positive transgenic lines were screened on kanamycin Murashige and Skoog 445

(MS) agar plates and then confirmed by reverse-transcription PCR. Single leaves of four–446

week-old Arabidopsis transformed with the pMDC32 empty vector, or constitutively 447

expressing NIa-Pro, were used in experiments as described above. 448



17

Transcript abundance analysis - Total RNA was extracted from frozen tissue samples 449

using the SV Total RNA Isolation system with on-column DNAse treatment (Promega, 450

Madison, WI). RNA integrity was verified using a 1.2% agarose gel. After RNA 451

extraction and DNAse treatment, 1µg of total RNA was reverse transcribed with SMART 452

MMLV reverse transcriptase (Clonetech, Mountain View, CA) using an oligo-dT12-18 453

primer. Transcript abundance was analyzed with quantitative real-time RT-PCR (qRT-454

PCR), with UBQ10 (ubiquitin 10, At4g05320; 455

AAGAGATAACAGGAACGGAAACATA; 456

GGCCTTGTATAATCCCTGATGAATAA) as the reference gene. Primers were 457

synthesized following the recommendation of Primer-Blast 458

(http://www.ncbi.nlm.nih.gov/tools/primer-blast/; EIN2; At5g03280; 459

GCTCTGTTAGGGCTTCCTCCA; AGCCACTCTAACGCTTACTTGTT; ERF1; 460

At3g23240; AAAGCAGCTTGATCGTAGGC; 461

ATTCGACTAGAAACGGTATTAGGG; EIN3; At3g20770; 462

TTGATCGTAATGGTCCTGCG; TCCTCTTTCCCATTAGGCCA; OSR1; At2g41230; 463

GAACCTCTCGACCCCTGAT; TGACATGATCTTACTTGCACGA; PDF1.2; 464

At5g44420; TTTCGACGCACCGGCAATG; TGCTGGGAAGACATAGTTGCATGA; 465

AZI1; At4g12470; GTCTATGCACTGCTCTGAGG; ACGATATTGTGCACTGGCAT). 466

Quantitative RT-PCR was performed using the QuantStudio™ 6 Flex Real-Time PCR 467

System in a 10 μL mixture containing SYBR® Green PCR master mix (Applied Bio-468

systems, http://www.lifetechnologies.com). The cycling conditions comprised 10 min 469

polymerase activation at 95°C followed by 40 cycles at 95°C for 15 sec, 55°C for 1 min 470

and 72°C for 40 sec. Following cycling, the melting curve was determined. Each assay 471

was conducted in triplicate and included a no-template control. Ct values were 472

automatically determined for all plates and genes using the QuantStudio™ 6 Flex Real-473

Time PCR System Software. In order to ensure comparability between data obtained 474

from different genes, all samples were in a same plate. Analysis of qRT-PCR 475

fluorescence data was then performed using the standard curve method. 476

Statistical analysis - Aphid fecundity on phytohormone signaling mutants was analyzed 477

with t-tests comparing mock- and TuMV-infected treatments for each mutant. All 478



18

remaining aphid fecundity and callose induction data were analyzed by ANOVA, with 479

infection /NIa-Pro expression status, and aphid feeding as main factors. Virus infection 480

rate was analyzed with chi-squared tests. Phytohormone induction data were analyzed by 481

ANOVA. Transcript abundance data were analyzed byANOVA, followed by a Tukey’s 482

HSD post-hoc test. All analyses were performed in JMP 8 software (SAS Institute, Cary, 483

NC, USA). Phytohormone experiments included 4-6 experimental units per treatment. 484

All fecundity experiments were repeated at least twice and consisted of 12-30 485

experimental units per treatment. All callose experiments included 4-6 experimental units 486

per treatment. TuMV-GFP infection experiments were repeated 3 times and consisted of 487

30-40 experimental units per treatment. For qRT-PCR three biological replicates were 488

analyzed per treatment for two separate experiments. 489

Acknowledgments 490

We thank Julia Vrebalov, Jim Giovannoni, and Lee Ann Richmond for valuable advice 491

on ethylene measurements, induction experiments, and for use of a gas chromatograph, 492

M.R. Sudarshana for use of the qPCR machine, and William Miller for a donation of 1-493

methylcyclopropene. 494

495

496

497

498

499

500

501

502



19

Literature Cited 503

Adams E, Turner J (2010) COI1, a jasmonate receptor, is involved in ethylene-induced 504 inhibition of Arabidopsis root growth in the light. J Exp Bot 61: 4373-4386 505

Alazem M, Lin NS (2014) Roles of plant hormones in the regulation of host-virus 506 interactions. Mol Plant Pathol 507

Alonso JM, Hirayama T, Roman G, Nourizadeh S, Ecker JR (1999) EIN2, a 508 bifunctional transducer of ethylene and stress responses in arabidopsis. Science 509 284: 2148-2152 510

Amrhein N, Wenker D (1979) Novel inhibitors of ethylene production in higher plants. 511 Plant Cell Physiol 20: 1635-1642 512

Anindya R, Savithri HS (2004) Potyviral NIa proteinase, a proteinase with novel 513 deoxyribonuclease activity. J Biol Chem 279: 32159-32169 514

Argandoña VH, Chaman M, Cardemil L, Muñoz O, Zúñiga GE, Corcuera LJ 515 (2001) Ethylene production and peroxidase activity in aphid-infested barley. J 516 Chem Ecol 27: 53-68 517

Bari R, Jones JD (2009) Role of plant hormones in plant defence responses. Plant Mol 518 Biol 69: 473-488 519

Brown RL, Kazan K, McGrath KC, Maclean DJ, Manners JM (2003) A role for the 520 GCC-box in jasmonate-mediated activation of the PDF1.2 gene of Arabidopsis. 521 Plant Physiol 132: 1020-1032 522

Bush J, Jander G, Ausubel FM (2006) Prevention and control of pests and diseases. In 523 J Salinas, JJ Sanchez-Serrano, eds, Arabidopsis protocols, second edition. 524 Humana Press, Totowa, pp 13-25 525

Carr JP, Lewsey MG, Palukaitis P (2010) Signaling in induced resistance. Adv Virus 526 Res 76: 57-121 527

Casteel C, Hansen A (2014) Evaluating insect-microbiomes at the plant-insect interface. 528 J Chem Ecol 40: 836-847 529

Casteel CL, Jander G (2013) New synthesis: Investigating mutualisms in virus-vector 530 interactions. J Chem Ecol 39: 809 531

Casteel CL, Yang C, Nanduri AC, De Jong HN, Whitham SA, Jander G (2014) The 532 NIa-Pro protein of Turnip mosaic virus improves growth and reproduction of the 533 aphid vector, Myzus persicae (green peach aphid). Plant J 77: 653-663 534

Chen L, Zhang L, Li D, Wang F, Yu D (2013) WRKY8 transcription factor functions 535 in the TMV-CG defense response by mediating both abscisic acid and ethylene 536 signaling in Arabidopsis. Proc Natl Acad Sci U S A 110: E1963-1971 537

Clay NK, Adio AM, Denoux C, Jander G, Ausubel FM (2009) Glucosinolate 538 metabolites required for an Arabidopsis innate immune response. Science 323: 539 95-101 540

Clough SJ, Bent AF (1998) Floral dip: A simplified method for Agrobacterium-541 mediated transformation of Arabidopsis thaliana. Plant J 16: 735-743 542

De Vos M, Kim JH, Jander G (2007) Biochemistry and molecular biology of 543 Arabidopsis-aphid interactions. BioEssays 29: 871-883 544

Ellis C, Karafyllidis L, Turner JG (2002) Constitutive activation of jasmonate 545 signaling in an Arabidopsis mutant correlates with enhanced resistance to 546 Erysiphe cichoracearum, Pseudomonas syringae, and Myzus persicae. Mol Plant 547 Microbe Interact 15: 1025-1030 548



20

Endres MW, Gregory BD, Gao Z, Foreman AW, Mlotshwa S, Ge X, Pruss GJ, 549 Ecker JR, Bowman LH, Vance V (2010) Two plant viral suppressors of 550 silencing require the ethylene-inducible host transcription factor RAV2 to block 551 RNA silencing. PLoS Pathog 6: e1000729 552

Erb M, Meldau S, Howe GA (2012) Role of phytohormones in insect-specific plant 553 reactions. Trends Plant Sci 17: 250-259 554

Glazebrook J (2005) Contrasting mechanisms of defense against biotrophic and 555 necrotrophic pathogens. In Annu Rev Phytopath, Vol 43, pp 205-227 556

Guo H, Ecker JR (2003) Plant responses to ethylene gas are mediated by 557 SCF(EBF1/EBF2)-dependent proteolysis of EI3 transcription factor. Cell 115: 558 667-677 559

Haikonen T, Rajamaki ML, Tian YP, Valkonen JP (2013) Mutation of a short 560 variable region in HCPro protein of Potato virus A affects interactions with a 561 microtubule-associated protein and induces necrotic responses in tobacco. Mol 562 Plant Microbe Interact 26: 721-733 563

Hall BP, Shakeel SN, Amir M, Ul Haq N, Qu X, Schaller GE (2012) Histidine kinase 564 activity of the ethylene receptor ETR1 facilitates the ethylene response in 565 Arabidopsis. Plant Physiol 159: 682-695 566

Han HE, Sellamuthu S, Shin BH, Lee YJ, Song S, Seo JS, Baek IS, Bae J, Kim H, 567 Yoo YJ, Jung YK, Song WK, Han PL, Park WJ (2010) The Nuclear Inclusion 568 A (NIa) protease of Turnip mosaic virus (TuMV) cleaves amyloid-beta. PloS one 569 5: e15645 570

Howe GA, Jander G (2008) Plant immunity to insect herbivores. Annu Rev Plant Biol 571 59: 41-66 572

Jander G, Howe G (2008) Plant interactions with arthropod herbivores: State of the 573 field. Plant Physiol 146: 801-803 574

Jones JD, Dangl JL (2006) The plant immune system. Nature 444: 323-329 575 Kang H, Lee YJ, Goo JH, Park WJ (2001) Determination of the substrate specificity of 576

Turnip mosaic virus NIa protease using a genetic method. J Gen Virol 82: 3115-577 3117 578

Kennedy JS, Day MF, Eastop VF (1962) A conspectus of aphids as vectors of plant 579 viruses. Commonwealth Institute of Entomology, London 580

Kim B, Masuta C, Matsuura H, Takahashi H, Inukai T (2008) Veinal necrosis 581 induced by Turnip mosaic virus infection in Arabidopsis is a form of defense 582 response accompanying HR-like cell death. Mol Plant Microbe Interact 21: 260-583 268 584

Koyama T (2014) The roles of ethylene and transcription factors in the regulation of 585 onset of leaf senescence. Front Plant Sci 5: 650 586

Lellis AD, Kasschau KD, Whitham SA, Carrington JC (2002) Loss-of-susceptibility 587 mutants of Arabidopsis thaliana reveal an essential role for eIF(iso)4E during 588 potyvirus infection. Curr Biol 12: 1046-1051 589

Lewsey MG, Murphy AM, Maclean D, Dalchau N, Westwood JH, Macaulay K, 590 Bennett MH, Moulin M, Hanke DE, Powell G, Smith AG, Carr JP (2010) 591 Disruption of two defensive signaling pathways by a viral RNA silencing 592 suppressor. Mol Plant Microbe Interact 23: 835-845 593



21

Li R, Weldegergis BT, Li J, Jung C, Qu J, Sun Y, Qian H, Tee C, van Loon JJ, 594 Dicke M, Chua NH, Liu SS, Ye J (2014) Virulence factors of geminivirus 595 interact with MYC2 to subvert plant resistance and promote vector performance. 596 Plant Cell 26: 4991-5008 597

Louis J, Shah J (2013) Arabidopsis thaliana-Myzus persicae interaction: Shaping the 598 understanding of plant defense against phloem-feeding aphids. Front Plant Sci 4: 599 213 600

Lorenzo O, Piqueras R, Sánchez-Serrano JJ, Solano R (2003) Ethylene response 601 factor1 integrates signals from ethylene and jasmonate pathways in plant defense. 602 The Plant Cell 15: 165-178 603

Love AJ, Laval V, Geri C, Laird J, Tomos AD, Hooks MA, Milner JJ (2007) 604 Components of Arabidopsis defense- and ethylene-signaling pathways regulate 605 susceptibility to Cauliflower mosaic virus by restricting long-distance movement. 606 Mol Plant Microbe Interact 20: 659-670 607

Love AJ, Yun BW, Laval V, Loake GJ, Milner JJ (2005) Cauliflower mosaic virus, a 608 compatible pathogen of Arabidopsis, engages three distinct defense-signaling 609 pathways and activates rapid systemic generation of reactive oxygen species. 610 Plant Physiol 139: 935-948 611

Lu J, Li J, Ju H, Liu X, Erb M, Wang X, Lou Y (2014) Contrasting effects of ethylene 612 biosynthesis on induced plant resistance against a chewing and a piercing-sucking 613 herbivore in rice. Mol Plant 7: 1670-1682 614

Mandadi KK, Pyle JD, Scholthof KB (2014) Comparative analysis of antiviral 615 responses in Brachypodium distachyon and Setaria viridis reveals conserved and 616 unique outcomes among C3 and C4 plant defenses. Mol Plant Microbe Interact 617 27: 1277-1290 618

Mantelin S, Bhattarai KK, Kaloshian I (2009) Ethylene contributes to potato aphid 619 susceptibility in a compatible tomato host. New Phytol 183: 444-456 620

Martin A, Cabrera y Poch HL, Martinez Herrera D, Ponz F (1999) Resistances to 621 Turnip mosaic potyvirus in Arabidopsis thaliana. Mol Plant Microbe Interact 12: 622 1016-1021 623

Mauck KE, De Moraes CM, Mescher MC (2010) Deceptive chemical signals induced 624 by a plant virus attract insect vectors to inferior hosts. Proc Natl Acad Sci USA 625 107: 3600-3605 626

Mauck KE, De Moraes CM, Mescher MC (2014) Biochemical and physiological 627 mechanisms underlying effects of Cucumber mosaic virus on host-plant traits that 628 mediate transmission by aphid vectors. Plant Cell Environ 37: 1427-1439 629

Mewis I, Appel HM, Hom A, Raina R, Schultz JC (2005) Major signaling pathways 630 modulate Arabidopsis glucosinolate accumulation and response to both phloem-631 feeding and chewing insects. Plant Physiol 138: 1149-1162 632

Miller HL, Neese PA, Ketring DL, Dillwith JW (1994) Involvement of ethylene in 633 aphid infestation of barley. J Plant Growth Regul 13: 167-171 634

Mur LAJ, Kenton P, Atzorn R, Miersch O, Wasternack C (2006) The outcomes of 635 concentration-specific interactions between salicylate and jasmonate signaling 636 include synergy, antagonism, and oxidative stress leading to cell death. Plant 637 Physiol 140: 249-262 638



22

Nault LR (1997) Arthropod transmission of plant viruses: A new synthesis. Ann 639 Entomol Soc Am 90: 521-541 640

Nguyen HD, Tomitaka Y, Ho SY, Duchene S, Vetten HJ, Lesemann D, Walsh JA, 641 Gibbs AJ, Ohshima K (2013) Turnip mosaic potyvirus probably first spread to 642 Eurasian Brassica crops from wild orchids about 1000 years ago. PloS one 8: 643 e55336 644

Penninckx IA, Thomma BP, Buchala A, Metraux JP, Broekaert WF (1998) 645 Concomitant activation of jasmonate and ethylene response pathways is required 646 for induction of a plant defensin gene in Arabidopsis. Plant Cell 10: 2103-2113 647

Pieterse CM, Van der Does D, Zamioudis C, Leon-Reyes A, Van Wees SC (2012) 648 Hormonal modulation of plant immunity. Annual Review of Cell and 649 Developmental Biology 28: 489-521 650

Qiao H, Chang KN, Yazaki J, Ecker JR (2009) Interplay between ethylene, 651 ETP1/ETP2 F-box proteins, and degradation of EIN2 triggers ethylene responses 652 in Arabidopsis. Genes & Dev 23: 512-521 653

Rajamäki M-L, Valkonen JPT (2009) Control of nuclear and nucleolar localization of 654 nuclear inclusion protein a of picorna-like Potato virus A in Nicotiana species. 655 Plant Cell 21: 2485-2502 656

Ralhan A, Schottle S, Thurow C, Iven T, Feussner I, Polle A, Gatz C (2012) The 657 vascular pathogen Verticillium longisporum requires a jasmonic acid-independent 658 coi1 function in roots to elicit disease symptoms in Arabidopsis shoots. Plant 659 Physiol 159: 1192-1203 660

Rasmann S, De Vos M, Casteel CL, Tian D, Halitschke R, Sun JY, Agrawal AA, 661 Felton GW, Jander G (2012) Herbivory in the previous generation primes plants 662 for enhanced insect resistance. Plant Physiol 158: 854-863 663

Sanchez F, Martinez-Herrera D, Aguilar I, Ponz F (1998) Infectivity of Turnip mosaic 664 potyvirus cDNA clones and transcripts on the systemic host Arabidopsis thaliana 665 and local lesion hosts. Virus Res 55: 207-219 666

Shattuck VI (1992) The biology, epidemiology, and control of Turnip mosaic virus. 667 Horticult Rev 14: 199-238 668

Sisler EC (2006) The discovery and development of compounds counteracting ethylene 669 at the receptor level. Biotech Adv 24: 357-367 670

Soeno K, Goda H, Ishii T, Ogura T, Tachikawa T, Sasaki E, Yoshida S, Fujioka S, 671 Asami T, Shimada Y (2010) Auxin biosynthesis inhibitors, identified by a 672 genomics-based approach, provide insights into auxin biosynthesis. Plant Cell 673 Physiol 51: 524-536 674

Solano R, Stepanova A, Chao Q, Ecker JR (1998) Nuclear events in ethylene 675 signaling: A transcriptional cascade mediated by ETHYLENE-INSENSITIVE3 676 and ETHYLENE-RESPONSE-FACTOR1. Genes & development 12: 3703-3714 677

Stepanova AN, Alonso JM (2005) Arabidopsis ethylene signaling pathway. Science's 678 STKE : Signal Transduction Knowledge Environment 2005: cm4 679

Tomlinson JA (1987) Epidemiology and control of viral diseases of vegetables. Ann 680 Appl Biol 110: 661-681 681

Urcuqui-Inchima S, Haenni AL, Bernardi F (2001) Potyvirus proteins: A wealth of 682 functions. Virus Res 74: 157-175 683



23

Van der Ent S, Van Wees SC, Pieterse CM (2009) Jasmonate signaling in plant 684 interactions with resistance-inducing beneficial microbes. Phytochem 70: 1581-685 1588 686

van Loon LC, Geraats BPJ, Linthorst HJM (2006) Ethylene as a modulator of disease 687 resistance in plants. Trends Plant Sci 11: 184-191 688

Verhage A, van Wees SCM, Pieterse CMJ (2010) Plant immunity: It’s the hormones 689 talking, but what do they say? Plant Physiol 154: 536-540 690

Walsh JA, Jenner CE (2002) Turnip mosaic virus and the quest for durable resistance. 691 Mol Plant Pathol 3: 289-300 692

Wei T, Zhang C, Hong J, Xiong R, Kasschau KD, Zhou X, Carrington JC, Wang A 693 (2010) Formation of complexes at plasmodesmata for potyvirus intercellular 694 movement is mediated by the viral protein P3N-PIPO. PLoS Patho 6 695

Wu C, Avila CA, Goggin FL (2015) The ethylene response factor PTI5 contributes to 696 potato aphid resistance in tomato independent of ethylene signalling. J Exp Bot 697 66: 559-570 698

Yang JY, Iwasaki M, Machida C, Machida Y, Zhou X, Chua NH (2008) βC1, the 699 pathogenicity factor of TYLCCNV, interacts with AS1 to alter leaf development 700 and suppress selective jasmonic acid responses. Genes & Dev 22: 2564-2577 701

Yasaka R, Ohba K, Schwinghamer MW, Fletcher J, Ochoa-Corona FM, Thomas 702 JE, Ho SY, Gibbs AJ, Ohshima K (2015) Phylodynamic evidence of the 703 migration of Turnip mosaic potyvirus from Europe to Australia and New Zealand. 704 J Gen Virol 96: 701-713 705

Zhang T, Luan JB, Qi JF, Huang CJ, Li M, Zhou XP, Liu SS (2012) Begomovirus-706 whitefly mutualism is achieved through repression of plant defences by a virus 707 pathogenicity factor. Mol Ecol 21: 1294-1304 708

709



24

Figure Legends 710

Figure 1. Concentrations of phytohormones in Arabidopsis plants, with or without 711

TuMV infection and aphid herbivory. Shown are (A) salicylic acid, (B) jasmonic acid, 712

and (C) ethylene accumulation in mock-inoculated or TuMV-GFP-infected Arabidopsis 713

plants, with or without 24 hours of the feeding by the green peach aphid (Myzus persicae) 714

(mean +/- s.e. of N =4-6, letters represent significant differences, ANOVA and Tukey’s 715

HSD post hoc test). 716

717

Figure 2. Involvement of plant defense signaling in TuMV-aphid-plant interactions. 718

Number of progeny produced by a single aphid after 9 days on TuMV-GFP-infected or 719

mock-inoculated Arabidopsis wildtype controls (wt) or hormone signaling mutants (mean 720

+/- s.e., N =15-30,*P < 0.05, two-tailed Student’s t-test comparing infected and 721

uninfected plants of the same genotype). 722

723

Figure 3. Ethylene perception and biosynthesis is required for TuMV infection to 724

increase M. persicae fecundity on host plants. Number of progeny produced by a single 725

aphid after 9 days on TuMV-GFP-infected or mock-inoculated (A,C) Arabidopsis and 726

(D,B) N. benthamiana treated with 1-methylcyclopropene (MCP), which blocks ethylene 727

perception or aminoethoxyvinylglycine (AVG), which inhibits ethylene biosynthesis 728

(mean +/- s.e., N =15-18, letters represent significant differences, ANOVA and Tukey’s 729

HSD post hoc). 730

731

Figure 4. Ethylene signaling is required for TuMV infection to reduce callose 732

accumulation. (A) Callose deposition in Arabidopsis wildtype controls (wt) or ethylene 733

insensitive mutants that were mock-inoculated or TuMV-GFP-infected, with and without 734

M. persicae infestation. Callose deposition in Arabidopsis leaves that were mock-735

inoculated or TuMV-GFP-infected, with and without M. persicae infestation and treated 736

with (B) 1-methylcyclopropene (MCP), which blocks ethylene perception or (C) 737

aminoethoxyvinylglycine (AVG), which inhibits ethylene biosynthesis (mean +/- s.e. of 738

N = 4-6, different letters indicate significant differences by ANOVA and Tukey’s HSD 739

post hoc). 740



25

741

Figure 5. Ethylene treatment does not enhance M. persicae fecundity on host plants. 742

Number of progeny produced by a single aphid after 7 days on TuMV-GFP-infected or 743

mock-inoculated (A) Arabidopsis and (B) N. benthamiana treated with 20 ppm of 744

ethylene (mean +/- s.e. N =15-28, letters represent significant differences, ANOVA and 745

Tukey’s HSD post hoc test). 746

747

Figure 6. Expression of the TuMV protein NIa-Pro requires ethylene signaling to 748

increase aphid growth and reduce callose accumulation. (A) Number of progeny 749

produced by aphids on Arabidopsis expressing NIa-Pro or the EV control treated with 750

(A) 1-methylcyclopropene (MCP), which blocks ethylene perception or (B) 751

aminoethoxyvinylglycine (AVG), which inhibits ethylene biosynthesis (mean +/- s.e., N 752

= 12-18, letters represent significant differences, ANOVA and Tukey HSD post hoc). (C) 753

Callose accumulation on Arabidopsis expressing NIa-Pro or the EV control treated with 754

MCP or AVG (mean +/- s.e., N = 4-6, letters represent significant differences, ANOVA 755

and Tukey HSD post hoc test). 756

757

Figure 7. Expression of the TuMV protein NIa-Pro increases ethylene production. 758

Concentrations of ethylene in wildtype Arabidopsis and transgenic plants expressing the 759

empty vector (EV) control or NIa-Pro. (mean +/- s.e., N = 6, letters represent significant 760

differences, ANOVA and Tukey’s HSD post hoc test). 761

762

Figure 8. Expression of the TuMV protein NIa-Pro alters ethylene signaling. Relative 763

(A) EIN2, (B) EIN3, (C) ERF1, and (D) PDF1.2 transcript abundance was measured by 764

quantitative RT-PCR in mock-inoculated and TuMV-GFP-inoculated plants, with or 765

without aphid feeding for 24 hrs and in leaves of plants expressing the empty vector or 766

NIa-Pro, with and without aphids feeding for 24 hrs. (mean +/- s.e., N = 3, letters indicate 767

significant differences by analysis of variance (ANOVA) and Tukey’s post-hoc test, with 768

transcript abundance in mock-inoculated and EV plants set to 1. 769

770



26

Figure 9. Expression of the TuMV protein NIa-Pro does not alter ethylene-induced 771

transcripts. Relative (A) OSR1 and (B) AZI1 transcript abundance was measured by 772

quantitative RT-PCR in mock-inoculated and TuMV-GFP-inoculated plants, with or 773

without aphid feeding for 24 hrs and in leaves of plants expressing the empty vector or 774

NIa-Pro with and without aphids feeding for 24 hrs. (mean +/- s.e., N = 3, letters indicate 775

significant differences by analysis of variance (ANOVA) and Tukey’s post-hoc test, with 776

transcript abundance in mock-inoculated and EV plants set to 1. 777

778

Figure 10. Ethylene signaling is required for plant susceptibility to TuMV. Percent 779

TuMV-GFP infection for Arabidopsis (A) ethylene insensitive mutants (ein2-1, etr1-3), 780

(B) mutants that constitutively produce ethylene (eto1-2). (N = 30-48, *P<0.05, chi-781

squared test relative to wildtype control). 782

783

784

785

786

787

788

789

790

791

792

793

794

795



Parsed CitationsAdams E, Turner J (2010) COI1, a jasmonate receptor, is involved in ethylene-induced inhibition of Arabidopsis root growth in thelight. J Exp Bot 61: 4373-4386

Pubmed: Author and TitleCrossRef: Author and TitleGoogle Scholar: Author Only Title Only Author and Title

Alazem M, Lin NS (2014) Roles of plant hormones in the regulation of host-virus interactions. Mol Plant PatholPubmed: Author and TitleCrossRef: Author and TitleGoogle Scholar: Author Only Title Only Author and Title

Alonso JM, Hirayama T, Roman G, Nourizadeh S, Ecker JR (1999) EIN2, a bifunctional transducer of ethylene and stress responsesin arabidopsis. Science 284: 2148-2152


Amrhein N, Wenker D (1979) Novel inhibitors of ethylene production in higher plants. Plant Cell Physiol 20: 1635-1642Pubmed: Author and TitleCrossRef: Author and TitleGoogle Scholar: Author Only Title Only Author and Title

Anindya R, Savithri HS (2004) Potyviral NIa proteinase, a proteinase with novel deoxyribonuclease activity. J Biol Chem 279: 32159-32169


Argandoña VH, Chaman M, Cardemil L, Muñoz O, Zúñiga GE, Corcuera LJ (2001) Ethylene production and peroxidase activity inaphid-infested barley. J Chem Ecol 27: 53-68


Bari R, Jones JD (2009) Role of plant hormones in plant defence responses. Plant Mol Biol 69: 473-488Pubmed: Author and TitleCrossRef: Author and TitleGoogle Scholar: Author Only Title Only Author and Title

Brown RL, Kazan K, McGrath KC, Maclean DJ, Manners JM (2003) A role for the GCC-box in jasmonate-mediated activation of thePDF1.2 gene of Arabidopsis. Plant Physiol 132: 1020-1032


Bush J, Jander G, Ausubel FM (2006) Prevention and control of pests and diseases. In J Salinas, JJ Sanchez-Serrano, eds,Arabidopsis protocols, second edition. Humana Press, Totowa, pp 13-25


Carr JP, Lewsey MG, Palukaitis P (2010) Signaling in induced resistance. Adv Virus Res 76: 57-121Pubmed: Author and TitleCrossRef: Author and TitleGoogle Scholar: Author Only Title Only Author and Title

Casteel C, Hansen A (2014) Evaluating insect-microbiomes at the plant-insect interface. J Chem Ecol 40: 836-847Pubmed: Author and TitleCrossRef: Author and TitleGoogle Scholar: Author Only Title Only Author and Title

Casteel CL, Jander G (2013) New synthesis: Investigating mutualisms in virus-vector interactions. J Chem Ecol 39: 809Pubmed: Author and TitleCrossRef: Author and TitleGoogle Scholar: Author Only Title Only Author and Title

Casteel CL, Yang C, Nanduri AC, De Jong HN, Whitham SA, Jander G (2014) The NIa-Pro protein of Turnip mosaic virus improvesgrowth and reproduction of the aphid vector, Myzus persicae (green peach aphid). Plant J 77: 653-663


Chen L, Zhang L, Li D, Wang F, Yu D (2013) WRKY8 transcription factor functions in the TMV-CG defense response by mediatingboth abscisic acid and ethylene signaling in Arabidopsis. Proc Natl Acad Sci U S A 110: E1963-1971



http://www.ncbi.nlm.nih.gov/pubmed?term=%28COI%5BTitle%5D%29 AND 1%5BVolume%5D AND Adams E%2C Turner J%5BAuthor%5D&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Adams E, Turner J (2010) COI1, a jasmonate receptor, is involved in ethylene-induced inhibition of Arabidopsis root growth in the light. J Exp Bot 61: 4373-4386

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Adams&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Adams&as_ylo=2010&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=%28Roles of plant hormones in the regulation of host%2Dvirus interactions%2E%5BTitle%5D%29 AND Alazem M%2C Lin NS%5BAuthor%5D&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Alazem M, Lin NS (2014) Roles of plant hormones in the regulation of host-virus interactions. Mol Plant Pathol

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Alazem&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=Roles of plant hormones in the regulation of host-virus interactions.&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=Roles of plant hormones in the regulation of host-virus interactions.&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Alazem&as_ylo=2014&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=%28EIN%5BTitle%5D%29 AND 2%5BVolume%5D AND a bifunctional transducer of ethylene and stress responses in arabidopsis%2E Science 284%3A 2148%5BPagination%5D AND Alonso JM%2C Hirayama T%2C Roman G%2C Nourizadeh S%2C Ecker JR%5BAuthor%5D&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Alonso JM, Hirayama T, Roman G, Nourizadeh S, Ecker JR (1999) EIN2, a bifunctional transducer of ethylene and stress responses in arabidopsis. Science 284: 2148-2152

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Alonso&hl=en&c2coff=1


http://scholar.google.com/scholar?as_q=&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Alonso&as_ylo=1999&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=%28Plant Cell Physiol%5BTitle%5D%29 AND 20%5BVolume%5D AND 1635%5BPagination%5D AND Amrhein N%2C Wenker D%5BAuthor%5D&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Amrhein N, Wenker D (1979) Novel inhibitors of ethylene production in higher plants. Plant Cell Physiol 20: 1635-1642

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Amrhein&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=Novel inhibitors of ethylene production in higher plants&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=Novel inhibitors of ethylene production in higher plants&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Amrhein&as_ylo=1979&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=%28J Biol Chem%5BTitle%5D%29 AND 279%5BVolume%5D AND 32159%5BPagination%5D AND Anindya R%2C Savithri HS%5BAuthor%5D&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Anindya R, Savithri HS (2004) Potyviral NIa proteinase, a proteinase with novel deoxyribonuclease activity. J Biol Chem 279: 32159-32169

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Anindya&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=Potyviral NIa proteinase, a proteinase with novel deoxyribonuclease activity&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=Potyviral NIa proteinase, a proteinase with novel deoxyribonuclease activity&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Anindya&as_ylo=2004&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=%28J Chem Ecol%5BTitle%5D%29 AND 27%5BVolume%5D AND 53%5BPagination%5D AND Argando�a VH%2C Chaman M%2C Cardemil L%2C Mu�oz O%2C Z��iga GE%2C Corcuera LJ%5BAuthor%5D&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Argando�a VH, Chaman M, Cardemil L, Mu�oz O, Z��iga GE, Corcuera LJ (2001) Ethylene production and peroxidase activity in aphid-infested barley. J Chem Ecol 27: 53-68

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Argando�a&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=Ethylene production and peroxidase activity in aphid-infested barley&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=Ethylene production and peroxidase activity in aphid-infested barley&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Argando�a&as_ylo=2001&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=%28Plant Mol Biol%5BTitle%5D%29 AND 69%5BVolume%5D AND 473%5BPagination%5D AND Bari R%2C Jones JD%5BAuthor%5D&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Bari R, Jones JD (2009) Role of plant hormones in plant defence responses. Plant Mol Biol 69: 473-488

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Bari&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=Role of plant hormones in plant defence responses&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=Role of plant hormones in plant defence responses&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Bari&as_ylo=2009&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=%282 gene of Arabidopsis%2E Plant Physiol%5BTitle%5D%29 AND 132%5BVolume%5D AND 1020%5BPagination%5D AND Brown RL%2C Kazan K%2C McGrath KC%2C Maclean DJ%2C Manners JM%5BAuthor%5D&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Brown RL, Kazan K, McGrath KC, Maclean DJ, Manners JM (2003) A role for the GCC-box in jasmonate-mediated activation of the PDF1.2 gene of Arabidopsis. Plant Physiol 132: 1020-1032

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Brown&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=A role for the GCC-box in jasmonate-mediated activation of the PDF1&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=A role for the GCC-box in jasmonate-mediated activation of the PDF1&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Brown&as_ylo=2003&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=%28Prevention and control of pests and diseases%2E%5BTitle%5D%29 AND Bush J%2C Jander G%2C Ausubel FM%5BAuthor%5D&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Bush J, Jander G, Ausubel FM (2006) Prevention and control of pests and diseases. In J Salinas, JJ Sanchez-Serrano, eds, Arabidopsis protocols, second edition. Humana Press, Totowa, pp 13-25

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Bush&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=Prevention and control of pests and diseases.&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=Prevention and control of pests and diseases.&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Bush&as_ylo=2006&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=%28Adv Virus Res%5BTitle%5D%29 AND 76%5BVolume%5D AND 57%5BPagination%5D AND Carr JP%2C Lewsey MG%2C Palukaitis P%5BAuthor%5D&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Carr JP, Lewsey MG, Palukaitis P (2010) Signaling in induced resistance. Adv Virus Res 76: 57-121

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Carr&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=Signaling in induced resistance&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=Signaling in induced resistance&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Carr&as_ylo=2010&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=%28J Chem Ecol%5BTitle%5D%29 AND 40%5BVolume%5D AND 836%5BPagination%5D AND Casteel C%2C Hansen A%5BAuthor%5D&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Casteel C, Hansen A (2014) Evaluating insect-microbiomes at the plant-insect interface. J Chem Ecol 40: 836-847

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Casteel&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=Evaluating insect-microbiomes at the plant-insect interface&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=Evaluating insect-microbiomes at the plant-insect interface&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Casteel&as_ylo=2014&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=%28New synthesis%3A Investigating mutualisms in virus%2Dvector interactions%2E%5BTitle%5D%29 AND Casteel CL%2C Jander G%5BAuthor%5D&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Casteel CL, Jander G (2013) New synthesis: Investigating mutualisms in virus-vector interactions. J Chem Ecol 39: 809


http://scholar.google.com/scholar?as_q=New synthesis: Investigating mutualisms in virus-vector interactions.&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=New synthesis: Investigating mutualisms in virus-vector interactions.&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Casteel&as_ylo=2013&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=%28Plant J%5BTitle%5D%29 AND 77%5BVolume%5D AND 653%5BPagination%5D AND Casteel CL%2C Yang C%2C Nanduri AC%2C De Jong HN%2C Whitham SA%2C Jander G%5BAuthor%5D&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Casteel CL, Yang C, Nanduri AC, De Jong HN, Whitham SA, Jander G (2014) The NIa-Pro protein of Turnip mosaic virus improves growth and reproduction of the aphid vector, Myzus persicae (green peach aphid). Plant J 77: 653-663


http://scholar.google.com/scholar?as_q=The NIa-Pro protein of Turnip mosaic virus improves growth and reproduction of the aphid vector, Myzus persicae (green peach aphid)&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=The NIa-Pro protein of Turnip mosaic virus improves growth and reproduction of the aphid vector, Myzus persicae (green peach aphid)&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Casteel&as_ylo=2014&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=%28Proc Natl Acad Sci U S A%5BTitle%5D%29 AND 110%5BVolume%5D AND E1963%5BPagination%5D AND Chen L%2C Zhang L%2C Li D%2C Wang F%2C Yu D%5BAuthor%5D&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Chen L, Zhang L, Li D, Wang F, Yu D (2013) WRKY8 transcription factor functions in the TMV-CG defense response by mediating both abscisic acid and ethylene signaling in Arabidopsis. Proc Natl Acad Sci U S A 110: E1963-1971

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Chen&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=WRKY8 transcription factor functions in the TMV-CG defense response by mediating both abscisic acid and ethylene signaling in Arabidopsis&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=WRKY8 transcription factor functions in the TMV-CG defense response by mediating both abscisic acid and ethylene signaling in Arabidopsis&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Chen&as_ylo=2013&as_allsubj=all&hl=en&c2coff=1


Clay NK, Adio AM, Denoux C, Jander G, Ausubel FM (2009) Glucosinolate metabolites required for an Arabidopsis innate immuneresponse. Science 323: 95-101


Clough SJ, Bent AF (1998) Floral dip: A simplified method for Agrobacterium-mediated transformation of Arabidopsis thaliana. PlantJ 16: 735-743


De Vos M, Kim JH, Jander G (2007) Biochemistry and molecular biology of Arabidopsis-aphid interactions. BioEssays 29: 871-883Pubmed: Author and TitleCrossRef: Author and TitleGoogle Scholar: Author Only Title Only Author and Title

Ellis C, Karafyllidis L, Turner JG (2002) Constitutive activation of jasmonate signaling in an Arabidopsis mutant correlates withenhanced resistance to Erysiphe cichoracearum, Pseudomonas syringae, and Myzus persicae. Mol Plant Microbe Interact 15:1025-1030


Endres MW, Gregory BD, Gao Z, Foreman AW, Mlotshwa S, Ge X, Pruss GJ, Ecker JR, Bowman LH, Vance V (2010) Two plant viralsuppressors of silencing require the ethylene-inducible host transcription factor RAV2 to block RNA silencing. PLoS Pathog 6:e1000729


Erb M, Meldau S, Howe GA (2012) Role of phytohormones in insect-specific plant reactions. Trends Plant Sci 17: 250-259Pubmed: Author and TitleCrossRef: Author and TitleGoogle Scholar: Author Only Title Only Author and Title

Glazebrook J (2005) Contrasting mechanisms of defense against biotrophic and necrotrophic pathogens. In Annu Rev Phytopath,Vol 43, pp 205-227


Guo H, Ecker JR (2003) Plant responses to ethylene gas are mediated by SCF(EBF1/EBF2)-dependent proteolysis of EI3transcription factor. Cell 115: 667-677


Haikonen T, Rajamaki ML, Tian YP, Valkonen JP (2013) Mutation of a short variable region in HCPro protein of Potato virus Aaffects interactions with a microtubule-associated protein and induces necrotic responses in tobacco. Mol Plant Microbe Interact26: 721-733


Hall BP, Shakeel SN, Amir M, Ul Haq N, Qu X, Schaller GE (2012) Histidine kinase activity of the ethylene receptor ETR1 facilitatesthe ethylene response in Arabidopsis. Plant Physiol 159: 682-695


Han HE, Sellamuthu S, Shin BH, Lee YJ, Song S, Seo JS, Baek IS, Bae J, Kim H, Yoo YJ, Jung YK, Song WK, Han PL, Park WJ(2010) The Nuclear Inclusion A (NIa) protease of Turnip mosaic virus (TuMV) cleaves amyloid-beta. PloS one 5: e15645


Howe GA, Jander G (2008) Plant immunity to insect herbivores. Annu Rev Plant Biol 59: 41-66Pubmed: Author and TitleCrossRef: Author and TitleGoogle Scholar: Author Only Title Only Author and Title

Jander G, Howe G (2008) Plant interactions with arthropod herbivores: State of the field. Plant Physiol 146: 801-803Pubmed: Author and TitleCrossRef: Author and TitleGoogle Scholar: Author Only Title Only Author and Title

Jones JD, Dangl JL (2006) The plant immune system. Nature 444: 323-329Pubmed: Author and TitleCrossRef: Author and TitleGoogle Scholar: Author Only Title Only Author and Title www.plantphysiol.orgon October 1, 2020 - Published by Downloaded from

Copyright © 2015 American Society of Plant Biologists. All rights reserved.

http://www.ncbi.nlm.nih.gov/pubmed?term=%28Science%5BTitle%5D%29 AND 323%5BVolume%5D AND 95%5BPagination%5D AND Clay NK%2C Adio AM%2C Denoux C%2C Jander G%2C Ausubel FM%5BAuthor%5D&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Clay NK, Adio AM, Denoux C, Jander G, Ausubel FM (2009) Glucosinolate metabolites required for an Arabidopsis innate immune response. Science 323: 95-101

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Clay&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=Glucosinolate metabolites required for an Arabidopsis innate immune response&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=Glucosinolate metabolites required for an Arabidopsis innate immune response&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Clay&as_ylo=2009&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=%28Plant J%5BTitle%5D%29 AND 16%5BVolume%5D AND 735%5BPagination%5D AND Clough SJ%2C Bent AF%5BAuthor%5D&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Clough SJ, Bent AF (1998) Floral dip: A simplified method for Agrobacterium-mediated transformation of Arabidopsis thaliana. Plant J 16: 735-743

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Clough&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=Floral dip: A simplified method for Agrobacterium-mediated transformation of Arabidopsis thaliana&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=Floral dip: A simplified method for Agrobacterium-mediated transformation of Arabidopsis thaliana&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Clough&as_ylo=1998&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=%28BioEssays%5BTitle%5D%29 AND 29%5BVolume%5D AND 871%5BPagination%5D AND De Vos M%2C Kim JH%2C Jander G%5BAuthor%5D&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=De Vos M, Kim JH, Jander G (2007) Biochemistry and molecular biology of Arabidopsis-aphid interactions. BioEssays 29: 871-883

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=De&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=Biochemistry and molecular biology of Arabidopsis-aphid interactions&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=Biochemistry and molecular biology of Arabidopsis-aphid interactions&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=De&as_ylo=2007&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=%28Mol Plant Microbe Interact%5BTitle%5D%29 AND 15%5BVolume%5D AND 1025%5BPagination%5D AND Ellis C%2C Karafyllidis L%2C Turner JG%5BAuthor%5D&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Ellis C, Karafyllidis L, Turner JG (2002) Constitutive activation of jasmonate signaling in an Arabidopsis mutant correlates with enhanced resistance to Erysiphe cichoracearum, Pseudomonas syringae, and Myzus persicae. Mol Plant Microbe Interact 15: 1025-1030

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Ellis&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=Constitutive activation of jasmonate signaling in an Arabidopsis mutant correlates with enhanced resistance to Erysiphe cichoracearum, Pseudomonas syringae, and Myzus persicae&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=Constitutive activation of jasmonate signaling in an Arabidopsis mutant correlates with enhanced resistance to Erysiphe cichoracearum, Pseudomonas syringae, and Myzus persicae&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Ellis&as_ylo=2002&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=%28Two plant viral suppressors of silencing require the ethylene%2Dinducible host transcription factor RAV2 to block RNA silencing%2E%5BTitle%5D%29 AND Endres MW%2C Gregory BD%2C Gao Z%2C Foreman AW%2C Mlotshwa S%2C Ge X%2C Pruss GJ%2C Ecker JR%2C Bowman LH%2C Vance V%5BAuthor%5D&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Endres MW, Gregory BD, Gao Z, Foreman AW, Mlotshwa S, Ge X, Pruss GJ, Ecker JR, Bowman LH, Vance V (2010) Two plant viral suppressors of silencing require the ethylene-inducible host transcription factor RAV2 to block RNA silencing. PLoS Pathog 6: e1000729

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Endres&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=Two plant viral suppressors of silencing require the ethylene-inducible host transcription factor RAV2 to block RNA silencing.&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=Two plant viral suppressors of silencing require the ethylene-inducible host transcription factor RAV2 to block RNA silencing.&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Endres&as_ylo=2010&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=%28Trends Plant Sci%5BTitle%5D%29 AND 17%5BVolume%5D AND 250%5BPagination%5D AND Erb M%2C Meldau S%2C Howe GA%5BAuthor%5D&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Erb M, Meldau S, Howe GA (2012) Role of phytohormones in insect-specific plant reactions. Trends Plant Sci 17: 250-259

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Erb&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=Role of phytohormones in insect-specific plant reactions&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=Role of phytohormones in insect-specific plant reactions&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Erb&as_ylo=2012&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=%28In Annu Rev Phytopath%2C Vol%5BTitle%5D%29 AND 43%5BVolume%5D AND pp 205%5BPagination%5D AND Glazebrook J%5BAuthor%5D&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Glazebrook J (2005) Contrasting mechanisms of defense against biotrophic and necrotrophic pathogens. In Annu Rev Phytopath, Vol 43, pp 205-227

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Glazebrook&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=Contrasting mechanisms of defense against biotrophic and necrotrophic pathogens&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=Contrasting mechanisms of defense against biotrophic and necrotrophic pathogens&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Glazebrook&as_ylo=2005&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=%28Cell%5BTitle%5D%29 AND 115%5BVolume%5D AND 667%5BPagination%5D AND Guo H%2C Ecker JR%5BAuthor%5D&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Guo H, Ecker JR (2003) Plant responses to ethylene gas are mediated by SCF(EBF1/EBF2)-dependent proteolysis of EI3 transcription factor. Cell 115: 667-677

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Guo&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=Plant responses to ethylene gas are mediated by SCF(EBF1/EBF2)-dependent proteolysis of EI3 transcription factor&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=Plant responses to ethylene gas are mediated by SCF(EBF1/EBF2)-dependent proteolysis of EI3 transcription factor&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Guo&as_ylo=2003&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=%28Mol Plant Microbe Interact%5BTitle%5D%29 AND 26%5BVolume%5D AND 721%5BPagination%5D AND Haikonen T%2C Rajamaki ML%2C Tian YP%2C Valkonen JP%5BAuthor%5D&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Haikonen T, Rajamaki ML, Tian YP, Valkonen JP (2013) Mutation of a short variable region in HCPro protein of Potato virus A affects interactions with a microtubule-associated protein and induces necrotic responses in tobacco. Mol Plant Microbe Interact 26: 721-733

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Haikonen&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=Mutation of a short variable region in HCPro protein of Potato virus A affects interactions with a microtubule-associated protein and induces necrotic responses in tobacco&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=Mutation of a short variable region in HCPro protein of Potato virus A affects interactions with a microtubule-associated protein and induces necrotic responses in tobacco&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Haikonen&as_ylo=2013&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=%28Plant Physiol%5BTitle%5D%29 AND 159%5BVolume%5D AND 682%5BPagination%5D AND Hall BP%2C Shakeel SN%2C Amir M%2C Ul Haq N%2C Qu X%2C Schaller GE%5BAuthor%5D&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Hall BP, Shakeel SN, Amir M, Ul Haq N, Qu X, Schaller GE (2012) Histidine kinase activity of the ethylene receptor ETR1 facilitates the ethylene response in Arabidopsis. Plant Physiol 159: 682-695

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Hall&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=Histidine kinase activity of the ethylene receptor ETR1 facilitates the ethylene response in Arabidopsis&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=Histidine kinase activity of the ethylene receptor ETR1 facilitates the ethylene response in Arabidopsis&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Hall&as_ylo=2012&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=%28The Nuclear Inclusion A NIa protease of Turnip mosaic virus TuMV cleaves amyloid%2Dbeta%2E%5BTitle%5D%29 AND Han HE%2C Sellamuthu S%2C Shin BH%2C Lee YJ%2C Song S%2C Seo JS%2C Baek IS%2C Bae J%2C Kim H%2C Yoo YJ%2C Jung YK%2C Song WK%2C Han PL%2C Park WJ%5BAuthor%5D&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Han HE, Sellamuthu S, Shin BH, Lee YJ, Song S, Seo JS, Baek IS, Bae J, Kim H, Yoo YJ, Jung YK, Song WK, Han PL, Park WJ (2010) The Nuclear Inclusion A (NIa) protease of Turnip mosaic virus (TuMV) cleaves amyloid-beta. PloS one 5: e15645

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Han&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=The Nuclear Inclusion A (NIa) protease of Turnip mosaic virus (TuMV) cleaves amyloid-beta.&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=The Nuclear Inclusion A (NIa) protease of Turnip mosaic virus (TuMV) cleaves amyloid-beta.&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Han&as_ylo=2010&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=%28Annu Rev Plant Biol%5BTitle%5D%29 AND 59%5BVolume%5D AND 41%5BPagination%5D AND Howe GA%2C Jander G%5BAuthor%5D&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Howe GA, Jander G (2008) Plant immunity to insect herbivores. Annu Rev Plant Biol 59: 41-66

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Howe&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=Plant immunity to insect herbivores&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=Plant immunity to insect herbivores&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Howe&as_ylo=2008&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=%28Plant Physiol%5BTitle%5D%29 AND 146%5BVolume%5D AND 801%5BPagination%5D AND Jander G%2C Howe G%5BAuthor%5D&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Jander G, Howe G (2008) Plant interactions with arthropod herbivores: State of the field. Plant Physiol 146: 801-803

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Jander&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=Plant interactions with arthropod herbivores: State of the field&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=Plant interactions with arthropod herbivores: State of the field&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Jander&as_ylo=2008&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=%28Nature%5BTitle%5D%29 AND 444%5BVolume%5D AND 323%5BPagination%5D AND Jones JD%2C Dangl JL%5BAuthor%5D&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Jones JD, Dangl JL (2006) The plant immune system. Nature 444: 323-329

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Jones&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=The plant immune system&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=The plant immune system&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Jones&as_ylo=2006&as_allsubj=all&hl=en&c2coff=1


Kang H, Lee YJ, Goo JH, Park WJ (2001) Determination of the substrate specificity of Turnip mosaic virus NIa protease using agenetic method. J Gen Virol 82: 3115-3117


Kennedy JS, Day MF, Eastop VF (1962) A conspectus of aphids as vectors of plant viruses. Commonwealth Institute of Entomology,London


Kim B, Masuta C, Matsuura H, Takahashi H, Inukai T (2008) Veinal necrosis induced by Turnip mosaic virus infection in Arabidopsisis a form of defense response accompanying HR-like cell death. Mol Plant Microbe Interact 21: 260-268


Koyama T (2014) The roles of ethylene and transcription factors in the regulation of onset of leaf senescence. Front Plant Sci 5:650


Lellis AD, Kasschau KD, Whitham SA, Carrington JC (2002) Loss-of-susceptibility mutants of Arabidopsis thaliana reveal anessential role for eIF(iso)4E during potyvirus infection. Curr Biol 12: 1046-1051


Lewsey MG, Murphy AM, Maclean D, Dalchau N, Westwood JH, Macaulay K, Bennett MH, Moulin M, Hanke DE, Powell G, Smith AG,Carr JP (2010) Disruption of two defensive signaling pathways by a viral RNA silencing suppressor. Mol Plant Microbe Interact 23:835-845


Li R, Weldegergis BT, Li J, Jung C, Qu J, Sun Y, Qian H, Tee C, van Loon JJ, Dicke M, Chua NH, Liu SS, Ye J (2014) Virulencefactors of geminivirus interact with MYC2 to subvert plant resistance and promote vector performance. Plant Cell 26: 4991-5008


Louis J, Shah J (2013) Arabidopsis thaliana-Myzus persicae interaction: Shaping the understanding of plant defense againstphloem-feeding aphids. Front Plant Sci 4: 213


Lorenzo O, Piqueras R, Sánchez-Serrano JJ, Solano R (2003) Ethylene response factor1 integrates signals from ethylene andjasmonate pathways in plant defense. The Plant Cell 15: 165-178


Love AJ, Laval V, Geri C, Laird J, Tomos AD, Hooks MA, Milner JJ (2007) Components of Arabidopsis defense- and ethylene-signaling pathways regulate susceptibility to Cauliflower mosaic virus by restricting long-distance movement. Mol Plant MicrobeInteract 20: 659-670


Love AJ, Yun BW, Laval V, Loake GJ, Milner JJ (2005) Cauliflower mosaic virus, a compatible pathogen of Arabidopsis, engagesthree distinct defense-signaling pathways and activates rapid systemic generation of reactive oxygen species. Plant Physiol 139:935-948


Lu J, Li J, Ju H, Liu X, Erb M, Wang X, Lou Y (2014) Contrasting effects of ethylene biosynthesis on induced plant resistanceagainst a chewing and a piercing-sucking herbivore in rice. Mol Plant 7: 1670-1682


Mandadi KK, Pyle JD, Scholthof KB (2014) Comparative analysis of antiviral responses in Brachypodium distachyon and Setariaviridis reveals conserved and unique outcomes among C3 and C4 plant defenses. Mol Plant Microbe Interact 27: 1277-1290

Pubmed: Author and TitleCrossRef: Author and Title


http://www.ncbi.nlm.nih.gov/pubmed?term=%28J Gen Virol%5BTitle%5D%29 AND 82%5BVolume%5D AND 3115%5BPagination%5D AND Kang H%2C Lee YJ%2C Goo JH%2C Park WJ%5BAuthor%5D&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Kang H, Lee YJ, Goo JH, Park WJ (2001) Determination of the substrate specificity of Turnip mosaic virus NIa protease using a genetic method. J Gen Virol 82: 3115-3117

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Kang&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=Determination of the substrate specificity of Turnip mosaic virus NIa protease using a genetic method&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=Determination of the substrate specificity of Turnip mosaic virus NIa protease using a genetic method&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Kang&as_ylo=2001&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=%28A conspectus of aphids as vectors of plant viruses%2E%5BTitle%5D%29 AND Kennedy JS%2C Day MF%2C Eastop VF%5BAuthor%5D&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Kennedy JS, Day MF, Eastop VF (1962) A conspectus of aphids as vectors of plant viruses. Commonwealth Institute of Entomology, London

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Kennedy&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=A conspectus of aphids as vectors of plant viruses.&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=A conspectus of aphids as vectors of plant viruses.&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Kennedy&as_ylo=1962&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=%28Mol Plant Microbe Interact%5BTitle%5D%29 AND 21%5BVolume%5D AND 260%5BPagination%5D AND Kim B%2C Masuta C%2C Matsuura H%2C Takahashi H%2C Inukai T%5BAuthor%5D&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Kim B, Masuta C, Matsuura H, Takahashi H, Inukai T (2008) Veinal necrosis induced by Turnip mosaic virus infection in Arabidopsis is a form of defense response accompanying HR-like cell death. Mol Plant Microbe Interact 21: 260-268

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Kim&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=Veinal necrosis induced by Turnip mosaic virus infection in Arabidopsis is a form of defense response accompanying HR-like cell death&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=Veinal necrosis induced by Turnip mosaic virus infection in Arabidopsis is a form of defense response accompanying HR-like cell death&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Kim&as_ylo=2008&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=%28The roles of ethylene and transcription factors in the regulation of onset of leaf senescence%2E%5BTitle%5D%29 AND Koyama T%5BAuthor%5D&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Koyama T (2014) The roles of ethylene and transcription factors in the regulation of onset of leaf senescence. Front Plant Sci 5: 650

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Koyama&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=The roles of ethylene and transcription factors in the regulation of onset of leaf senescence.&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=The roles of ethylene and transcription factors in the regulation of onset of leaf senescence.&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Koyama&as_ylo=2014&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=%28Curr Biol%5BTitle%5D%29 AND 12%5BVolume%5D AND 1046%5BPagination%5D AND Lellis AD%2C Kasschau KD%2C Whitham SA%2C Carrington JC%5BAuthor%5D&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Lellis AD, Kasschau KD, Whitham SA, Carrington JC (2002) Loss-of-susceptibility mutants of Arabidopsis thaliana reveal an essential role for eIF(iso)4E during potyvirus infection. Curr Biol 12: 1046-1051

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Lellis&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=Loss-of-susceptibility mutants of Arabidopsis thaliana reveal an essential role for eIF(iso)4E during potyvirus infection&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=Loss-of-susceptibility mutants of Arabidopsis thaliana reveal an essential role for eIF(iso)4E during potyvirus infection&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Lellis&as_ylo=2002&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=%28Mol Plant Microbe Interact%5BTitle%5D%29 AND 23%5BVolume%5D AND 835%5BPagination%5D AND Lewsey MG%2C Murphy AM%2C Maclean D%2C Dalchau N%2C Westwood JH%2C Macaulay K%2C Bennett MH%2C Moulin M%2C Hanke DE%2C Powell G%2C Smith AG%2C Carr JP%5BAuthor%5D&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Lewsey MG, Murphy AM, Maclean D, Dalchau N, Westwood JH, Macaulay K, Bennett MH, Moulin M, Hanke DE, Powell G, Smith AG, Carr JP (2010) Disruption of two defensive signaling pathways by a viral RNA silencing suppressor. Mol Plant Microbe Interact 23: 835-845

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Lewsey&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=Disruption of two defensive signaling pathways by a viral RNA silencing suppressor&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=Disruption of two defensive signaling pathways by a viral RNA silencing suppressor&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Lewsey&as_ylo=2010&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=%28Plant Cell%5BTitle%5D%29 AND 26%5BVolume%5D AND 4991%5BPagination%5D AND Li R%2C Weldegergis BT%2C Li J%2C Jung C%2C Qu J%2C Sun Y%2C Qian H%2C Tee C%2C van Loon JJ%2C Dicke M%2C Chua NH%2C Liu SS%2C Ye J%5BAuthor%5D&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Li R, Weldegergis BT, Li J, Jung C, Qu J, Sun Y, Qian H, Tee C, van Loon JJ, Dicke M, Chua NH, Liu SS, Ye J (2014) Virulence factors of geminivirus interact with MYC2 to subvert plant resistance and promote vector performance. Plant Cell 26: 4991-5008

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Li&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=Virulence factors of geminivirus interact with MYC2 to subvert plant resistance and promote vector performance&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=Virulence factors of geminivirus interact with MYC2 to subvert plant resistance and promote vector performance&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Li&as_ylo=2014&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=%28Arabidopsis thaliana%2DMyzus persicae interaction%3A Shaping the understanding of plant defense against phloem%2Dfeeding aphids%2E%5BTitle%5D%29 AND Louis J%2C Shah J%5BAuthor%5D&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Louis J, Shah J (2013) Arabidopsis thaliana-Myzus persicae interaction: Shaping the understanding of plant defense against phloem-feeding aphids. Front Plant Sci 4: 213

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Louis&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=Arabidopsis thaliana-Myzus persicae interaction: Shaping the understanding of plant defense against phloem-feeding aphids.&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=Arabidopsis thaliana-Myzus persicae interaction: Shaping the understanding of plant defense against phloem-feeding aphids.&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Louis&as_ylo=2013&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=%28The Plant Cell%5BTitle%5D%29 AND 15%5BVolume%5D AND 165%5BPagination%5D AND Lorenzo O%2C Piqueras R%2C S�nchez%2DSerrano JJ%2C Solano R%5BAuthor%5D&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Lorenzo O, Piqueras R, S�nchez-Serrano JJ, Solano R (2003) Ethylene response factor1 integrates signals from ethylene and jasmonate pathways in plant defense. The Plant Cell 15: 165-178

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Lorenzo&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=Ethylene response factor1 integrates signals from ethylene and jasmonate pathways in plant defense&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=Ethylene response factor1 integrates signals from ethylene and jasmonate pathways in plant defense&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Lorenzo&as_ylo=2003&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=%28Mol Plant Microbe Interact%5BTitle%5D%29 AND 20%5BVolume%5D AND 659%5BPagination%5D AND Love AJ%2C Laval V%2C Geri C%2C Laird J%2C Tomos AD%2C Hooks MA%2C Milner JJ%5BAuthor%5D&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Love AJ, Laval V, Geri C, Laird J, Tomos AD, Hooks MA, Milner JJ (2007) Components of Arabidopsis defense- and ethylene-signaling pathways regulate susceptibility to Cauliflower mosaic virus by restricting long-distance movement. Mol Plant Microbe Interact 20: 659-670

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Love&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=Components of Arabidopsis defense- and ethylene-signaling pathways regulate susceptibility to Cauliflower mosaic virus by restricting long-distance movement&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=Components of Arabidopsis defense- and ethylene-signaling pathways regulate susceptibility to Cauliflower mosaic virus by restricting long-distance movement&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Love&as_ylo=2007&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=%28Plant Physiol%5BTitle%5D%29 AND 139%5BVolume%5D AND 935%5BPagination%5D AND Love AJ%2C Yun BW%2C Laval V%2C Loake GJ%2C Milner JJ%5BAuthor%5D&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Love AJ, Yun BW, Laval V, Loake GJ, Milner JJ (2005) Cauliflower mosaic virus, a compatible pathogen of Arabidopsis, engages three distinct defense-signaling pathways and activates rapid systemic generation of reactive oxygen species. Plant Physiol 139: 935-948

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Love&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=Cauliflower mosaic virus, a compatible pathogen of Arabidopsis, engages three distinct defense-signaling pathways and activates rapid systemic generation of reactive oxygen species&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=Cauliflower mosaic virus, a compatible pathogen of Arabidopsis, engages three distinct defense-signaling pathways and activates rapid systemic generation of reactive oxygen species&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Love&as_ylo=2005&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=%28Mol Plant%5BTitle%5D%29 AND 7%5BVolume%5D AND 1670%5BPagination%5D AND Lu J%2C Li J%2C Ju H%2C Liu X%2C Erb M%2C Wang X%2C Lou Y%5BAuthor%5D&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Lu J, Li J, Ju H, Liu X, Erb M, Wang X, Lou Y (2014) Contrasting effects of ethylene biosynthesis on induced plant resistance against a chewing and a piercing-sucking herbivore in rice. Mol Plant 7: 1670-1682

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Lu&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=Contrasting effects of ethylene biosynthesis on induced plant resistance against a chewing and a piercing-sucking herbivore in rice&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=Contrasting effects of ethylene biosynthesis on induced plant resistance against a chewing and a piercing-sucking herbivore in rice&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Lu&as_ylo=2014&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=%28Mol Plant Microbe Interact%5BTitle%5D%29 AND 27%5BVolume%5D AND 1277%5BPagination%5D AND Mandadi KK%2C Pyle JD%2C Scholthof KB%5BAuthor%5D&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Mandadi KK, Pyle JD, Scholthof KB (2014) Comparative analysis of antiviral responses in Brachypodium distachyon and Setaria viridis reveals conserved and unique outcomes among C3 and C4 plant defenses. Mol Plant Microbe Interact 27: 1277-1290


Google Scholar: Author Only Title Only Author and Title

Mantelin S, Bhattarai KK, Kaloshian I (2009) Ethylene contributes to potato aphid susceptibility in a compatible tomato host. NewPhytol 183: 444-456


Martin A, Cabrera y Poch HL, Martinez Herrera D, Ponz F (1999) Resistances to Turnip mosaic potyvirus in Arabidopsis thaliana.Mol Plant Microbe Interact 12: 1016-1021


Mauck KE, De Moraes CM, Mescher MC (2010) Deceptive chemical signals induced by a plant virus attract insect vectors toinferior hosts. Proc Natl Acad Sci USA 107: 3600-3605


Mauck KE, De Moraes CM, Mescher MC (2014) Biochemical and physiological mechanisms underlying effects of Cucumber mosaicvirus on host-plant traits that mediate transmission by aphid vectors. Plant Cell Environ 37: 1427-1439


Mewis I, Appel HM, Hom A, Raina R, Schultz JC (2005) Major signaling pathways modulate Arabidopsis glucosinolate accumulationand response to both phloem-feeding and chewing insects. Plant Physiol 138: 1149-1162


Miller HL, Neese PA, Ketring DL, Dillwith JW (1994) Involvement of ethylene in aphid infestation of barley. J Plant Growth Regul 13:167-171


Mur LAJ, Kenton P, Atzorn R, Miersch O, Wasternack C (2006) The outcomes of concentration-specific interactions betweensalicylate and jasmonate signaling include synergy, antagonism, and oxidative stress leading to cell death. Plant Physiol 140: 249-262


Nault LR (1997) Arthropod transmission of plant viruses: A new synthesis. Ann Entomol Soc Am 90: 521-541Pubmed: Author and TitleCrossRef: Author and TitleGoogle Scholar: Author Only Title Only Author and Title

Nguyen HD, Tomitaka Y, Ho SY, Duchene S, Vetten HJ, Lesemann D, Walsh JA, Gibbs AJ, Ohshima K (2013) Turnip mosaicpotyvirus probably first spread to Eurasian Brassica crops from wild orchids about 1000 years ago. PloS one 8: e55336


Penninckx IA, Thomma BP, Buchala A, Metraux JP, Broekaert WF (1998) Concomitant activation of jasmonate and ethyleneresponse pathways is required for induction of a plant defensin gene in Arabidopsis. Plant Cell 10: 2103-2113


Pieterse CM, Van der Does D, Zamioudis C, Leon-Reyes A, Van Wees SC (2012) Hormonal modulation of plant immunity. AnnualReview of Cell and Developmental Biology 28: 489-521


Qiao H, Chang KN, Yazaki J, Ecker JR (2009) Interplay between ethylene, ETP1/ETP2 F-box proteins, and degradation of EIN2triggers ethylene responses in Arabidopsis. Genes & Dev 23: 512-521


Rajamäki M-L, Valkonen JPT (2009) Control of nuclear and nucleolar localization of nuclear inclusion protein a of picorna-likePotato virus A in Nicotiana species. Plant Cell 21: 2485-2502


Ralhan A, Schottle S, Thurow C, Iven T, Feussner I, Polle A, Gatz C (2012) The vascular pathogen Verticillium longisporum www.plantphysiol.orgon October 1, 2020 - Published by Downloaded from Copyright © 2015 American Society of Plant Biologists. All rights reserved.

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Mandadi&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=Comparative analysis of antiviral responses in Brachypodium distachyon and Setaria viridis reveals conserved and unique outcomes among C3 and C4 plant defenses&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=Comparative analysis of antiviral responses in Brachypodium distachyon and Setaria viridis reveals conserved and unique outcomes among C3 and C4 plant defenses&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Mandadi&as_ylo=2014&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=%28New Phytol%5BTitle%5D%29 AND 183%5BVolume%5D AND 444%5BPagination%5D AND Mantelin S%2C Bhattarai KK%2C Kaloshian I%5BAuthor%5D&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Mantelin S, Bhattarai KK, Kaloshian I (2009) Ethylene contributes to potato aphid susceptibility in a compatible tomato host. New Phytol 183: 444-456

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Mantelin&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=Ethylene contributes to potato aphid susceptibility in a compatible tomato host&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=Ethylene contributes to potato aphid susceptibility in a compatible tomato host&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Mantelin&as_ylo=2009&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=%28Mol Plant Microbe Interact%5BTitle%5D%29 AND 12%5BVolume%5D AND 1016%5BPagination%5D AND Martin A%2C Cabrera y Poch HL%2C Martinez Herrera D%2C Ponz F%5BAuthor%5D&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Martin A, Cabrera y Poch HL, Martinez Herrera D, Ponz F (1999) Resistances to Turnip mosaic potyvirus in Arabidopsis thaliana. Mol Plant Microbe Interact 12: 1016-1021

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Martin&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=Resistances to Turnip mosaic potyvirus in Arabidopsis thaliana&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=Resistances to Turnip mosaic potyvirus in Arabidopsis thaliana&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Martin&as_ylo=1999&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=%28Proc Natl Acad Sci USA%5BTitle%5D%29 AND 107%5BVolume%5D AND 3600%5BPagination%5D AND Mauck KE%2C De Moraes CM%2C Mescher MC%5BAuthor%5D&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Mauck KE, De Moraes CM, Mescher MC (2010) Deceptive chemical signals induced by a plant virus attract insect vectors to inferior hosts. Proc Natl Acad Sci USA 107: 3600-3605

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Mauck&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=Deceptive chemical signals induced by a plant virus attract insect vectors to inferior hosts&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=Deceptive chemical signals induced by a plant virus attract insect vectors to inferior hosts&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Mauck&as_ylo=2010&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=%28Plant Cell Environ%5BTitle%5D%29 AND 37%5BVolume%5D AND 1427%5BPagination%5D AND Mauck KE%2C De Moraes CM%2C Mescher MC%5BAuthor%5D&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Mauck KE, De Moraes CM, Mescher MC (2014) Biochemical and physiological mechanisms underlying effects of Cucumber mosaic virus on host-plant traits that mediate transmission by aphid vectors. Plant Cell Environ 37: 1427-1439

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Mauck&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=Biochemical and physiological mechanisms underlying effects of Cucumber mosaic virus on host-plant traits that mediate transmission by aphid vectors&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=Biochemical and physiological mechanisms underlying effects of Cucumber mosaic virus on host-plant traits that mediate transmission by aphid vectors&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Mauck&as_ylo=2014&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=%28Plant Physiol%5BTitle%5D%29 AND 138%5BVolume%5D AND 1149%5BPagination%5D AND Mewis I%2C Appel HM%2C Hom A%2C Raina R%2C Schultz JC%5BAuthor%5D&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Mewis I, Appel HM, Hom A, Raina R, Schultz JC (2005) Major signaling pathways modulate Arabidopsis glucosinolate accumulation and response to both phloem-feeding and chewing insects. Plant Physiol 138: 1149-1162

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Mewis&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=Major signaling pathways modulate Arabidopsis glucosinolate accumulation and response to both phloem-feeding and chewing insects&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=Major signaling pathways modulate Arabidopsis glucosinolate accumulation and response to both phloem-feeding and chewing insects&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Mewis&as_ylo=2005&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=%28J Plant Growth Regul%5BTitle%5D%29 AND 13%5BVolume%5D AND 167%5BPagination%5D AND Miller HL%2C Neese PA%2C Ketring DL%2C Dillwith JW%5BAuthor%5D&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Miller HL, Neese PA, Ketring DL, Dillwith JW (1994) Involvement of ethylene in aphid infestation of barley. J Plant Growth Regul 13: 167-171

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Miller&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=Involvement of ethylene in aphid infestation of barley&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=Involvement of ethylene in aphid infestation of barley&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Miller&as_ylo=1994&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=%28Plant Physiol%5BTitle%5D%29 AND 140%5BVolume%5D AND 249%5BPagination%5D AND Mur LAJ%2C Kenton P%2C Atzorn R%2C Miersch O%2C Wasternack C%5BAuthor%5D&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Mur LAJ, Kenton P, Atzorn R, Miersch O, Wasternack C (2006) The outcomes of concentration-specific interactions between salicylate and jasmonate signaling include synergy, antagonism, and oxidative stress leading to cell death. Plant Physiol 140: 249-262

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Mur&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=The outcomes of concentration-specific interactions between salicylate and jasmonate signaling include synergy, antagonism, and oxidative stress leading to cell death&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=The outcomes of concentration-specific interactions between salicylate and jasmonate signaling include synergy, antagonism, and oxidative stress leading to cell death&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Mur&as_ylo=2006&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=%28Ann Entomol Soc Am%5BTitle%5D%29 AND 90%5BVolume%5D AND 521%5BPagination%5D AND Nault LR%5BAuthor%5D&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Nault LR (1997) Arthropod transmission of plant viruses: A new synthesis. Ann Entomol Soc Am 90: 521-541

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Nault&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=Arthropod transmission of plant viruses: A new synthesis&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=Arthropod transmission of plant viruses: A new synthesis&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Nault&as_ylo=1997&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=%28Turnip mosaic potyvirus probably first spread to Eurasian Brassica crops from wild orchids about 1000 years ago%2E%5BTitle%5D%29 AND Nguyen HD%2C Tomitaka Y%2C Ho SY%2C Duchene S%2C Vetten HJ%2C Lesemann D%2C Walsh JA%2C Gibbs AJ%2C Ohshima K%5BAuthor%5D&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Nguyen HD, Tomitaka Y, Ho SY, Duchene S, Vetten HJ, Lesemann D, Walsh JA, Gibbs AJ, Ohshima K (2013) Turnip mosaic potyvirus probably first spread to Eurasian Brassica crops from wild orchids about 1000 years ago. PloS one 8: e55336

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Nguyen&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=Turnip mosaic potyvirus probably first spread to Eurasian Brassica crops from wild orchids about 1000 years ago.&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=Turnip mosaic potyvirus probably first spread to Eurasian Brassica crops from wild orchids about 1000 years ago.&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Nguyen&as_ylo=2013&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=%28Plant Cell%5BTitle%5D%29 AND 10%5BVolume%5D AND 2103%5BPagination%5D AND Penninckx IA%2C Thomma BP%2C Buchala A%2C Metraux JP%2C Broekaert WF%5BAuthor%5D&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Penninckx IA, Thomma BP, Buchala A, Metraux JP, Broekaert WF (1998) Concomitant activation of jasmonate and ethylene response pathways is required for induction of a plant defensin gene in Arabidopsis. Plant Cell 10: 2103-2113

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Penninckx&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=Concomitant activation of jasmonate and ethylene response pathways is required for induction of a plant defensin gene in Arabidopsis&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=Concomitant activation of jasmonate and ethylene response pathways is required for induction of a plant defensin gene in Arabidopsis&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Penninckx&as_ylo=1998&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=%28Annual Review of Cell and Developmental Biology%5BTitle%5D%29 AND 28%5BVolume%5D AND 489%5BPagination%5D AND Pieterse CM%2C Van der Does D%2C Zamioudis C%2C Leon%2DReyes A%2C Van Wees SC%5BAuthor%5D&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Pieterse CM, Van der Does D, Zamioudis C, Leon-Reyes A, Van Wees SC (2012) Hormonal modulation of plant immunity. Annual Review of Cell and Developmental Biology 28: 489-521

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Pieterse&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=Hormonal modulation of plant immunity&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=Hormonal modulation of plant immunity&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Pieterse&as_ylo=2012&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=%28Genes %26 Dev%5BTitle%5D%29 AND 23%5BVolume%5D AND 512%5BPagination%5D AND Qiao H%2C Chang KN%2C Yazaki J%2C Ecker JR%5BAuthor%5D&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Qiao H, Chang KN, Yazaki J, Ecker JR (2009) Interplay between ethylene, ETP1/ETP2 F-box proteins, and degradation of EIN2 triggers ethylene responses in Arabidopsis. Genes & Dev 23: 512-521

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Qiao&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=Interplay between ethylene, ETP1/ETP2 F-box proteins, and degradation of EIN2 triggers ethylene responses in Arabidopsis&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=Interplay between ethylene, ETP1/ETP2 F-box proteins, and degradation of EIN2 triggers ethylene responses in Arabidopsis&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Qiao&as_ylo=2009&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=%28Plant Cell%5BTitle%5D%29 AND 21%5BVolume%5D AND 2485%5BPagination%5D AND Rajam�ki M%2DL%2C Valkonen JPT%5BAuthor%5D&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Rajam�ki M-L, Valkonen JPT (2009) Control of nuclear and nucleolar localization of nuclear inclusion protein a of picorna-like Potato virus A in Nicotiana species. Plant Cell 21: 2485-2502

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Rajam�ki&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=Control of nuclear and nucleolar localization of nuclear inclusion protein a of picorna-like Potato virus A in Nicotiana species&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=Control of nuclear and nucleolar localization of nuclear inclusion protein a of picorna-like Potato virus A in Nicotiana species&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Rajam�ki&as_ylo=2009&as_allsubj=all&hl=en&c2coff=1


requires a jasmonic acid-independent coi1 function in roots to elicit disease symptoms in Arabidopsis shoots. Plant Physiol 159:1192-1203


Rasmann S, De Vos M, Casteel CL, Tian D, Halitschke R, Sun JY, Agrawal AA, Felton GW, Jander G (2012) Herbivory in theprevious generation primes plants for enhanced insect resistance. Plant Physiol 158: 854-863


Sanchez F, Martinez-Herrera D, Aguilar I, Ponz F (1998) Infectivity of Turnip mosaic potyvirus cDNA clones and transcripts on thesystemic host Arabidopsis thaliana and local lesion hosts. Virus Res 55: 207-219


Shattuck VI (1992) The biology, epidemiology, and control of Turnip mosaic virus. Horticult Rev 14: 199-238Pubmed: Author and TitleCrossRef: Author and TitleGoogle Scholar: Author Only Title Only Author and Title

Sisler EC (2006) The discovery and development of compounds counteracting ethylene at the receptor level. Biotech Adv 24: 357-367


Soeno K, Goda H, Ishii T, Ogura T, Tachikawa T, Sasaki E, Yoshida S, Fujioka S, Asami T, Shimada Y (2010) Auxin biosynthesisinhibitors, identified by a genomics-based approach, provide insights into auxin biosynthesis. Plant Cell Physiol 51: 524-536


Solano R, Stepanova A, Chao Q, Ecker JR (1998) Nuclear events in ethylene signaling: A transcriptional cascade mediated byETHYLENE-INSENSITIVE3 and ETHYLENE-RESPONSE-FACTOR1. Genes & development 12: 3703-3714


Stepanova AN, Alonso JM (2005) Arabidopsis ethylene signaling pathway. Science's STKE : Signal Transduction KnowledgeEnvironment 2005: cm4


Tomlinson JA (1987) Epidemiology and control of viral diseases of vegetables. Ann Appl Biol 110: 661-681Pubmed: Author and TitleCrossRef: Author and TitleGoogle Scholar: Author Only Title Only Author and Title

Urcuqui-Inchima S, Haenni AL, Bernardi F (2001) Potyvirus proteins: A wealth of functions. Virus Res 74: 157-175Pubmed: Author and TitleCrossRef: Author and TitleGoogle Scholar: Author Only Title Only Author and Title

Van der Ent S, Van Wees SC, Pieterse CM (2009) Jasmonate signaling in plant interactions with resistance-inducing beneficialmicrobes. Phytochem 70: 1581-1588


van Loon LC, Geraats BPJ, Linthorst HJM (2006) Ethylene as a modulator of disease resistance in plants. Trends Plant Sci 11: 184-191


Verhage A, van Wees SCM, Pieterse CMJ (2010) Plant immunity: It's the hormones talking, but what do they say? Plant Physiol 154:536-540


Walsh JA, Jenner CE (2002) Turnip mosaic virus and the quest for durable resistance. Mol Plant Pathol 3: 289-300Pubmed: Author and TitleCrossRef: Author and TitleGoogle Scholar: Author Only Title Only Author and Title

Wei T, Zhang C, Hong J, Xiong R, Kasschau KD, Zhou X, Carrington JC, Wang A (2010) Formation of complexes at plasmodesmata www.plantphysiol.orgon October 1, 2020 - Published by Downloaded from Copyright © 2015 American Society of Plant Biologists. All rights reserved.

http://www.ncbi.nlm.nih.gov/pubmed?term=%28Plant Physiol%5BTitle%5D%29 AND 159%5BVolume%5D AND 1192%5BPagination%5D AND Ralhan A%2C Schottle S%2C Thurow C%2C Iven T%2C Feussner I%2C Polle A%2C Gatz C%5BAuthor%5D&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Ralhan A, Schottle S, Thurow C, Iven T, Feussner I, Polle A, Gatz C (2012) The vascular pathogen Verticillium longisporum requires a jasmonic acid-independent coi1 function in roots to elicit disease symptoms in Arabidopsis shoots. Plant Physiol 159: 1192-1203

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Ralhan&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=The vascular pathogen Verticillium longisporum requires a jasmonic acid-independent coi1 function in roots to elicit disease symptoms in Arabidopsis shoots&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=The vascular pathogen Verticillium longisporum requires a jasmonic acid-independent coi1 function in roots to elicit disease symptoms in Arabidopsis shoots&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Ralhan&as_ylo=2012&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=%28Plant Physiol%5BTitle%5D%29 AND 158%5BVolume%5D AND 854%5BPagination%5D AND Rasmann S%2C De Vos M%2C Casteel CL%2C Tian D%2C Halitschke R%2C Sun JY%2C Agrawal AA%2C Felton GW%2C Jander G%5BAuthor%5D&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Rasmann S, De Vos M, Casteel CL, Tian D, Halitschke R, Sun JY, Agrawal AA, Felton GW, Jander G (2012) Herbivory in the previous generation primes plants for enhanced insect resistance. Plant Physiol 158: 854-863

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Rasmann&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=Herbivory in the previous generation primes plants for enhanced insect resistance&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=Herbivory in the previous generation primes plants for enhanced insect resistance&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Rasmann&as_ylo=2012&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=%28Virus Res%5BTitle%5D%29 AND 55%5BVolume%5D AND 207%5BPagination%5D AND Sanchez F%2C Martinez%2DHerrera D%2C Aguilar I%2C Ponz F%5BAuthor%5D&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Sanchez F, Martinez-Herrera D, Aguilar I, Ponz F (1998) Infectivity of Turnip mosaic potyvirus cDNA clones and transcripts on the systemic host Arabidopsis thaliana and local lesion hosts. Virus Res 55: 207-219

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Sanchez&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=Infectivity of Turnip mosaic potyvirus cDNA clones and transcripts on the systemic host Arabidopsis thaliana and local lesion hosts&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=Infectivity of Turnip mosaic potyvirus cDNA clones and transcripts on the systemic host Arabidopsis thaliana and local lesion hosts&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Sanchez&as_ylo=1998&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=%28Horticult Rev%5BTitle%5D%29 AND 14%5BVolume%5D AND 199%5BPagination%5D AND Shattuck VI%5BAuthor%5D&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Shattuck VI (1992) The biology, epidemiology, and control of Turnip mosaic virus. Horticult Rev 14: 199-238

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Shattuck&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=The biology, epidemiology, and control of Turnip mosaic virus&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=The biology, epidemiology, and control of Turnip mosaic virus&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Shattuck&as_ylo=1992&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=%28Biotech Adv%5BTitle%5D%29 AND 24%5BVolume%5D AND 357%5BPagination%5D AND Sisler EC%5BAuthor%5D&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Sisler EC (2006) The discovery and development of compounds counteracting ethylene at the receptor level. Biotech Adv 24: 357-367

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Sisler&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=The discovery and development of compounds counteracting ethylene at the receptor level&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=The discovery and development of compounds counteracting ethylene at the receptor level&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Sisler&as_ylo=2006&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=%28Plant Cell Physiol%5BTitle%5D%29 AND 51%5BVolume%5D AND 524%5BPagination%5D AND Soeno K%2C Goda H%2C Ishii T%2C Ogura T%2C Tachikawa T%2C Sasaki E%2C Yoshida S%2C Fujioka S%2C Asami T%2C Shimada Y%5BAuthor%5D&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Soeno K, Goda H, Ishii T, Ogura T, Tachikawa T, Sasaki E, Yoshida S, Fujioka S, Asami T, Shimada Y (2010) Auxin biosynthesis inhibitors, identified by a genomics-based approach, provide insights into auxin biosynthesis. Plant Cell Physiol 51: 524-536

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Soeno&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=Auxin biosynthesis inhibitors, identified by a genomics-based approach, provide insights into auxin biosynthesis&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=Auxin biosynthesis inhibitors, identified by a genomics-based approach, provide insights into auxin biosynthesis&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Soeno&as_ylo=2010&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=%28Genes %26 development%5BTitle%5D%29 AND 12%5BVolume%5D AND 3703%5BPagination%5D AND Solano R%2C Stepanova A%2C Chao Q%2C Ecker JR%5BAuthor%5D&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Solano R, Stepanova A, Chao Q, Ecker JR (1998) Nuclear events in ethylene signaling: A transcriptional cascade mediated by ETHYLENE-INSENSITIVE3 and ETHYLENE-RESPONSE-FACTOR1. Genes & development 12: 3703-3714

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Solano&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=Nuclear events in ethylene signaling: A transcriptional cascade mediated by ETHYLENE-INSENSITIVE3 and ETHYLENE-RESPONSE-FACTOR1&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=Nuclear events in ethylene signaling: A transcriptional cascade mediated by ETHYLENE-INSENSITIVE3 and ETHYLENE-RESPONSE-FACTOR1&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Solano&as_ylo=1998&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=%28Arabidopsis ethylene signaling pathway%2E%5BTitle%5D%29 AND Stepanova AN%2C Alonso JM%5BAuthor%5D&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Stepanova AN, Alonso JM (2005) Arabidopsis ethylene signaling pathway. Science's STKE : Signal Transduction Knowledge Environment 2005: cm4

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Stepanova&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=Arabidopsis ethylene signaling pathway.&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=Arabidopsis ethylene signaling pathway.&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Stepanova&as_ylo=2005&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=%28Ann Appl Biol%5BTitle%5D%29 AND 110%5BVolume%5D AND 661%5BPagination%5D AND Tomlinson JA%5BAuthor%5D&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Tomlinson JA (1987) Epidemiology and control of viral diseases of vegetables. Ann Appl Biol 110: 661-681

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Tomlinson&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=Epidemiology and control of viral diseases of vegetables&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=Epidemiology and control of viral diseases of vegetables&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Tomlinson&as_ylo=1987&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=%28Virus Res%5BTitle%5D%29 AND 74%5BVolume%5D AND 157%5BPagination%5D AND Urcuqui%2DInchima S%2C Haenni AL%2C Bernardi F%5BAuthor%5D&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Urcuqui-Inchima S, Haenni AL, Bernardi F (2001) Potyvirus proteins: A wealth of functions. Virus Res 74: 157-175

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Urcuqui-Inchima&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=Potyvirus proteins: A wealth of functions&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=Potyvirus proteins: A wealth of functions&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Urcuqui-Inchima&as_ylo=2001&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=%28Phytochem%5BTitle%5D%29 AND 70%5BVolume%5D AND 1581%5BPagination%5D AND Van der Ent S%2C Van Wees SC%2C Pieterse CM%5BAuthor%5D&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Van der Ent S, Van Wees SC, Pieterse CM (2009) Jasmonate signaling in plant interactions with resistance-inducing beneficial microbes. Phytochem 70: 1581-1588

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Van&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=Jasmonate signaling in plant interactions with resistance-inducing beneficial microbes&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=Jasmonate signaling in plant interactions with resistance-inducing beneficial microbes&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Van&as_ylo=2009&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=%28Trends Plant Sci%5BTitle%5D%29 AND 11%5BVolume%5D AND 184%5BPagination%5D AND van Loon LC%2C Geraats BPJ%2C Linthorst HJM%5BAuthor%5D&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=van Loon LC, Geraats BPJ, Linthorst HJM (2006) Ethylene as a modulator of disease resistance in plants. Trends Plant Sci 11: 184-191

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=van&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=Ethylene as a modulator of disease resistance in plants&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=Ethylene as a modulator of disease resistance in plants&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=van&as_ylo=2006&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=%28Plant Physiol%5BTitle%5D%29 AND 154%5BVolume%5D AND 536%5BPagination%5D AND Verhage A%2C van Wees SCM%2C Pieterse CMJ%5BAuthor%5D&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Verhage A, van Wees SCM, Pieterse CMJ (2010) Plant immunity: It's the hormones talking, but what do they say? Plant Physiol 154: 536-540

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Verhage&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=Plant immunity: It's the hormones talking, but what do they say&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=Plant immunity: It's the hormones talking, but what do they say&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Verhage&as_ylo=2010&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=%28Mol Plant Pathol%5BTitle%5D%29 AND 3%5BVolume%5D AND 289%5BPagination%5D AND Walsh JA%2C Jenner CE%5BAuthor%5D&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Walsh JA, Jenner CE (2002) Turnip mosaic virus and the quest for durable resistance. Mol Plant Pathol 3: 289-300

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Walsh&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=Turnip mosaic virus and the quest for durable resistance&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=Turnip mosaic virus and the quest for durable resistance&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Walsh&as_ylo=2002&as_allsubj=all&hl=en&c2coff=1


for potyvirus intercellular movement is mediated by the viral protein P3N-PIPO. PLoS Patho 6Pubmed: Author and TitleCrossRef: Author and TitleGoogle Scholar: Author Only Title Only Author and Title

Wu C, Avila CA, Goggin FL (2015) The ethylene response factor PTI5 contributes to potato aphid resistance in tomato independentof ethylene signalling. J Exp Bot 66: 559-570


Yang JY, Iwasaki M, Machida C, Machida Y, Zhou X, Chua NH (2008) ßC1, the pathogenicity factor of TYLCCNV, interacts with AS1to alter leaf development and suppress selective jasmonic acid responses. Genes & Dev 22: 2564-2577


Yasaka R, Ohba K, Schwinghamer MW, Fletcher J, Ochoa-Corona FM, Thomas JE, Ho SY, Gibbs AJ, Ohshima K (2015)Phylodynamic evidence of the migration of Turnip mosaic potyvirus from Europe to Australia and New Zealand. J Gen Virol 96: 701-713


Zhang T, Luan JB, Qi JF, Huang CJ, Li M, Zhou XP, Liu SS (2012) Begomovirus-whitefly mutualism is achieved through repressionof plant defences by a virus pathogenicity factor. Mol Ecol 21: 1294-1304



http://www.ncbi.nlm.nih.gov/pubmed?term=%28Formation of complexes at plasmodesmata for potyvirus intercellular movement is mediated by the viral protein P3N%2DPIPO%2E%5BTitle%5D%29 AND Wei T%2C Zhang C%2C Hong J%2C Xiong R%2C Kasschau KD%2C Zhou X%2C Carrington JC%2C Wang A%5BAuthor%5D&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Wei T, Zhang C, Hong J, Xiong R, Kasschau KD, Zhou X, Carrington JC, Wang A (2010) Formation of complexes at plasmodesmata for potyvirus intercellular movement is mediated by the viral protein P3N-PIPO. PLoS Patho 6

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Wei&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=Formation of complexes at plasmodesmata for potyvirus intercellular movement is mediated by the viral protein P3N-PIPO.&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=Formation of complexes at plasmodesmata for potyvirus intercellular movement is mediated by the viral protein P3N-PIPO.&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Wei&as_ylo=2010&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=%28J Exp Bot%5BTitle%5D%29 AND 66%5BVolume%5D AND 559%5BPagination%5D AND Wu C%2C Avila CA%2C Goggin FL%5BAuthor%5D&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Wu C, Avila CA, Goggin FL (2015) The ethylene response factor PTI5 contributes to potato aphid resistance in tomato independent of ethylene signalling. J Exp Bot 66: 559-570

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Wu&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=The ethylene response factor PTI5 contributes to potato aphid resistance in tomato independent of ethylene signalling&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=The ethylene response factor PTI5 contributes to potato aphid resistance in tomato independent of ethylene signalling&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Wu&as_ylo=2015&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=%28C%5BTitle%5D%29 AND 1%5BVolume%5D AND the pathogenicity factor of TYLCCNV%2C interacts with AS1 to alter leaf development and suppress selective jasmonic acid responses%2E Genes %26 Dev 22%3A 2564%5BPagination%5D AND Yang JY%2C Iwasaki M%2C Machida C%2C Machida Y%2C Zhou X%2C Chua NH%5BAuthor%5D&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Yang JY, Iwasaki M, Machida C, Machida Y, Zhou X, Chua NH (2008) �C1, the pathogenicity factor of TYLCCNV, interacts with AS1 to alter leaf development and suppress selective jasmonic acid responses. Genes & Dev 22: 2564-2577

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Yang&hl=en&c2coff=1


http://scholar.google.com/scholar?as_q=&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Yang&as_ylo=2008&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=%28J Gen Virol%5BTitle%5D%29 AND 96%5BVolume%5D AND 701%5BPagination%5D AND Yasaka R%2C Ohba K%2C Schwinghamer MW%2C Fletcher J%2C Ochoa%2DCorona FM%2C Thomas JE%2C Ho SY%2C Gibbs AJ%2C Ohshima K%5BAuthor%5D&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Yasaka R, Ohba K, Schwinghamer MW, Fletcher J, Ochoa-Corona FM, Thomas JE, Ho SY, Gibbs AJ, Ohshima K (2015) Phylodynamic evidence of the migration of Turnip mosaic potyvirus from Europe to Australia and New Zealand. J Gen Virol 96: 701-713

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Yasaka&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=Phylodynamic evidence of the migration of Turnip mosaic potyvirus from Europe to Australia and New Zealand&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=Phylodynamic evidence of the migration of Turnip mosaic potyvirus from Europe to Australia and New Zealand&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Yasaka&as_ylo=2015&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=%28Mol Ecol%5BTitle%5D%29 AND 21%5BVolume%5D AND 1294%5BPagination%5D AND Zhang T%2C Luan JB%2C Qi JF%2C Huang CJ%2C Li M%2C Zhou XP%2C Liu SS%5BAuthor%5D&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Zhang T, Luan JB, Qi JF, Huang CJ, Li M, Zhou XP, Liu SS (2012) Begomovirus-whitefly mutualism is achieved through repression of plant defences by a virus pathogenicity factor. Mol Ecol 21: 1294-1304

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Zhang&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=Begomovirus-whitefly mutualism is achieved through repression of plant defences by a virus pathogenicity factor&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=Begomovirus-whitefly mutualism is achieved through repression of plant defences by a virus pathogenicity factor&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Zhang&as_ylo=2012&as_allsubj=all&hl=en&c2coff=1


1 running head: the role of ethylene in virus-vector interactions 2 · 2015-07-06 · 162 (ethylene...

Documents