tspace.library.utoronto.ca · web viewa higher enzyme concentration can offset the apparent...
TRANSCRIPT
Enzymatic amplification of oligonucleotides in paper substrates
Abootaleb Sedighi and Ulrich. J. Krull*
Department of Chemical and Physical Sciences, University of Toronto Mississauga,
3359 Mississauga Road, Mississauga, Ontario, Canada, L5L 1C6
Corresponding author: [email protected]
Abstract
Several solution-based methods have recently been adapted for use in paper
substrates for enzymatic amplification to increase the number of copies of DNA
sequences. There is limited information available about the impact of a paper
matrix on DNA amplification by enzymatic processes, and about how to optimize
conditions to maximize yields. The work reported herein provides insights about
the impact of physicochemical properties of a paper matrix, using nuclease-
assisted amplification by exonuclease III and nicking endonuclease Nt.Bbv, and
a quantum dot (QD) - based Forster Resonance Energy Transfer (FRET) assay
to monitor the extent of amplification. The influence of several properties of paper
on amplification efficiency and kinetics were investigated, such as surface
adsorption of reactants, and pore size. Additional factors that impact amplification
processes such as target length and the packing density of oligonucleotide
probes on the nanoparticle surfaces were also studied. The work provides
1
guidance for development of more efficient enzymatic target-recycling DNA
amplification methods in paper substrates.
1. Introduction
Paper-based analytical devices (PAD) have recently emerged as promising
platforms for diagnostics in resource-limited settings, and nucleic acid-based
bioassays are integral to some of these systems [1–3]. The attractiveness of
paper as a substrate for bioassays includes: (1) availability of various porosities
and pore sizes, thicknesses and wicking rates at low cost [4,5], (2) cellulosic
paper is hydrophilic and has relatively weak non-specific binding [2], (3)
patterning strategies, e.g. wax printing, are facile and low cost [4,6], (4) strategies
for surface modification for biomolecule immobilization are well-established, and
(5) fluidics in paper is based on capillary action and transport of solution may
operate independently of external pumps.
Paper-based devices have attracted considerable attention for development of
low-cost assays of nucleic acids as screening technologies at point-of-care
(POC) settings [7–15]. A variety of paper devices with integrated readout
systems including colorimetric [8,9], fluorescence [10,11]. electrochemical [10,11]
and chemiluminescence [13] have been proposed for the detection of nucleic
acids. However, the detection limit achieved by these devices (pM-nM) [14] are
well above the levels encountered in biological samples (aM-fM) [16]. Therefore,
an off-chip amplification step is usually required to increase the number of target
molecules to a detectable level prior to implementation of the assay [14,15]. Such
2
an amplification step complicates a protocol and renders the bioassay less
attractive for POC diagnostics. Several reports have recently attempted to
address the issue by integrating various nucleic acid amplification techniques into
paper substrates [17,18,18–23]. These amplification methods, conducted in
paper substrates with different properties, proved to be highly efficient with limit
of detection achieving a single copy of target nucleic acid [24].
In contrast, several studies have reported contradictory results, indicating
inhibition of enzymatic amplification on different paper matrices [20,25,26]. For
instance, Rohrman et al. reported that the product yield of recombinase
polymerase amplification (RPA) was reduced when done in a Whatman
chromatography paper (CHR) in comparison with the amplification done in bulk
solution, while amplification using a glass fiber (GF) substrate produced a
quantity of product comparable to that obtained from bulk solution reactions [25].
The authors hypothesized that this disparity was due to the larger pore sizes of
GF substrates. Linnes et al. investigated different DNA amplification methods
using different substrates that included CHR, GF, nitrocellulose (NC) and
polyethersulfone (PES). They reported that polymerase chain reaction (PCR)
was completely inhibited in all substrates, while loop-mediated isothermal
amplification (LAMP) and thermophilic helicase-dependent amplification (tHDA)
was most successful in PES substrates [26]. The authors suggested that the
PES substrate has the least surface binding affinity for nucleic acids and
enzymes [26]. In contrast, a recent study by Liu et al. reported a 3-fold
enhancement of rolling circle amplification (RCA) using NC membranes in
3
comparison with the solution phase reaction [17]. This RCA experiment involved
DNA hybridization to a surface-immobilized oligonucleotide, and the
enhancement was attributed to the higher localized concentration of the
immobilized DNA strands [17]. An overview of similar reports about amplification
in paper substrates indicates a paucity of information about the impact of
chemical and physical properties of the paper matrix on the efficiency of
enzymatic DNA amplification reactions.
In this report, the work is intended to provide direction for optimal design of
oligonucleotide amplification by enzymatic target-recycling processes on/in
paper substrates by determining the potential for impact of different factors that
can influence the reactions within the matrix. It is clear that the extent of impact
for different types of enzymes may vary between different paper matrices. This
study offers some insights about general physicochemical properties of paper
substrates, such as the significance of: adsorption of enzymes/nucleic acids;
paper pore sizes; and spatial localization of reaction. The spatial location will be
referred to as the reaction “phase”, with the “solution-phase” being reaction in the
pores of the paper matrix, and “surface-phase” being reactions using reagents
that were deliberately immobilized onto the physical surfaces of the fibers of the
paper matrix. The experimental work considers the effectiveness of enzymatic
target recycling using exonuclease III and nicking endonuclease Nt.Bbv, which
have recently garnered attention as amplification methods that may be suitable
for POC settings [27]. Although, the use of these nucleases for DNA amplification
4
in paper substrates has not been reported, their simple reaction schemes
facilitate the interpretation of the results. A Forster Resonance Energy Transfer
(FRET) – based assay using semiconductor quantum dots (QDs) as the donor
served to monitor the extent of product production by the amplification process.
This fluorescence detection strategy was previously demonstrated to provide for
sensitive and specific biorecognition in paper substrates [28,29].
2. Materials and Methods
2.1. Materials
All oligonucleotides were provided by Integrated DNA Technologies (Coralville,
IA, USA), and are identified in Table 1. Exonuclease III (EXO), nicking
endonuclease Nt.BbvCI (Bbv) and 10X CutSmart buffer were from New England
Biolabs (Ipswich, MA, USA) and used without further purification. Tide
Quencher™ 3-maleimide was from AAT Bioquest, (Sunnyvale, CA, USA).
Diethylaminoethyl (DEAE)-functionalized magnetic beads (MB, 1 μm) were from
Bioclone Inc. (San Diego, CA). Green-emitting CdSe/ZnS core/shell quantum
dots (PL at 518 nm) were from Cytodiagnostics (Burlington, ON, Canada).
Hexahistidine-maleimide peptide sequences were from Canpeptide Inc.
(Montreal, QC, Canada). Illustra NAP-5 size exclusion chromatography columns
were from GE Life Sciences (Quebec, Canada). Amicon Ultra-0.5 centrifugal
filters were from Fisher Scientific (Ontario, Canada). Whatman® cellulose
chromatography papers (Grade 1, CHR-1, 200 × 200 mm), Whatman® cellulose
filter papers grade 1 (Circular, 150 mm diameter), grade 3 (Circular, 55 mm
5
diameter) and grade 5 (Circular, 55 mm diameter), Whatman® glass microfiber
Grade A (GF/A, Circular 24 mm diameter), sodium tetraborate, L-glutathione
(GSH, reduced, ≥98%), DTT, tetramethylammonium hydroxide solution (TMAH,
25% w/w in methanol), sodium (meta)periodate (NaIO4, ≥ 99%), sodium
cyanoborohydride (NaCNBH3, 95%), 1-(3-aminopropyl)imidazole (API, 98%), 4-
(2-hydroxyethyl)piperazine-1-ethanesulfonic acid (HEPES, ≥ 99.5%), albumin
from bovine serum (BSA, ≥ 98%) and Salmon Sperm DNA were from Sigma
Aldrich (Oakville, ON, Canada). All buffer solutions were prepared using a water
purification system (Milli-Q, 18 MΩ cm−1), and were autoclaved prior to use. The
buffer solutions included 100 mM tris-borate buffer (TB, pH 7.4), 50 mM borate
buffer (BB, pH 7.4), and phosphate buffer (PB, pH 7.4).
Table 1: The oligonucleotide sequences
Name Sequence
MB 5'- /SH/-CTGAGCACAGTCCTCAGCGAAA -/Cy3/-3'
TGT-1 5'- (T)5 TTTCGCTGAGGACTGTGCT (T)5 -3'TGT-2 5'-(T)6 AGCAGCTGAGGACTGTGCTCAG (T)2 -3'TGT-3 5'- (T)21 TTTCGCTGAGGACTGTGCT (T)20 -3'TGT-4 5'- (T)36 TTTCGCTGAGGACTGTGCT (T)35 -3'
(TGT – target)
2.2. Preparation of molecular beacon probes (MB)
Two molecular beacon probes were used in this study. A 22-mer oligonucleotide
that was modified with Cy3 dye at the 3’-end and a thiol group at the 5’-end, was
used to prepare the MB probes. The thiol group was first reduced via 500× DTT
in 1x PBS (10 mM phosphate, 137 mM NaCl, 2.7 mM KCl, pH 7.4) for 2 h. The
unreacted DTT was then removed by ethyl acetate extraction (4 times). To
6
prepare MB-TQ conjugates, 20 equivalents of Tide Quencher 3-maleimide was
added to MB oligonucleotides in PBS and the solution was shaken overnight. To
prepare MB-QD probes, the MB oligonucleotide was first functionalized with a
hexahistidine tag (H6) by incubating it with 5 molar equivalents of a maleimide
functionalized peptide (Maleimide-G(Aib)GHHHHHH, for 24 h. Unreacted TQ-3
and peptide was removed by running the sample through two consecutive NAP-5
desalting columns.
Immobilization of H6-oligonucleotides was performed using a solid-phase
immobilization method that we have recently developed [30]. To obtain different
packing densities of H6-MB on QD surfaces, various equivalents of
oligonucleotides to QDs (3-40 eq) were added to the positively charged magnetic
beads that were dispersed in TBS buffer (tris-borate 100 mM, NaCl 20 mM) at pH
7.4. To remove the unreacted oligonucleotides, the concentration of NaCl was
increased to 350 mM. This process removed >95% of the unreacted
oligonucleotides (See Figure S1). The DNA/QD values were determined by
independent quantification of QDs and MBs, as previously described [30].
2.3. Modification of the paper substrates
The papers were prepared using a method previously developed in our group
[8,11]. Paper substrates were patterned with wax using a Xerox ColorQube
8570DN solid ink printer. Each rectangular paper sheet was 60 mm by 26 mm in
dimension and was printed to contain an array of 8 by 4 of circular reaction zones
of 3 mm diameter (See Figure S2). Printing on smaller circular filter papers was
7
achieved after adhering the papers to regular printing paper using double-sided
tape. The wax printed papers were subsequently heated in an oven at 120 C for
2.5 min. Nitrocellulose substrates were prepared by nitrating the CHR-1 paper.
The papers were soaked in a solution (1:1 by volume) of concentrated sulfuric
acid (98%) and nitric acid (73%) for 30 min, and then neutralized using sodium
bicarbonate and rinsed extensively with deionized water.
For solution-phase amplifications, the reaction zones on the paper were used
without further chemical modifications. In contrast, the surface-phase
amplification made use of functionalized paper. The reaction zones were
modified to conjugate imidazole groups to the paper for immobilization of QD-MB
probes. Imidazole surface modification was conducted in two steps. First, the
cellulose was modified to contain aldehyde groups by two consecutive additions
of 5 μL of aqueous solutions of NaIO4 (50 mM) and LiCl (700 mM), with heating of
the paper at 50 C for 30 min, followed by rinsing with deionized water and drying
at 50 C in an oven. Next, the papers were functionalized with imidazole groups
by spotting 5 μL of a solution containing API at 200 mM and NaCNBH 3 at 300
mM, in HEPES buffer pH 8. The reactions were allowed to proceed at room
temperature for 1 h. The papers were then rinsed with borate buffer 50 mM pH
9.2 and stored in a desiccator for later use.
2.4. Bulk solution amplification
The reactions in the bulk solution were done using 1 U/μL of EXO or 0.2 U/μL of
Bbv enzymes in 50 μL of CutSmart buffer (50 mM potassium acetate, 20mM tris-
8
acetate, 10 mM magnesium acetate, 100 μg/ml BSA, pH 7.9) for 60 min at
different temperatures in the range of 23-37 C. EXO amplifications were done
using 200 nM of MB-QD (or MB-TQ) and various concentrations of TGT-1 target.
Bbv amplifications were done using 600 nM MB-QD (or MB-TQ) and various
concentrations of TGT-2 target. Photoluminescence (PL) spectra were collected
using a QuantaMaster Photon Technology International spectrofluorimeter
(London, ON, Canada).
For amplification involving MB-TQ, the fluorescence measurements were done
using an excitation wavelength of 540 nm and an emission range of 550-700 nm.
The amplification (%) from TQ-MB probes was calculated based on the
enhancement of Cy3 emission signal upon cleavage of the quencher (TQ) by the
enzyme using equation 1:
Amplification (% )MB−TQ=( ∑λ=570λ=550
PL(λ))ET−( ∑λ=570λ=550
PL(λ))N( ∑λ=570λ=550
PL( λ))N×100(1)
where the wavelength range of 550 to 570 nm corresponds to the region of
significant Cy3 PL. The subscript ET denotes a measurement made in the
presence of enzyme and target, while N denotes a measurement made in the
absence of both the enzyme and the target.
9
For amplifications involving MB-QD, the fluorescence measurements were done
using an excitation wavelength of 405 nm and an emission range of 480-640 nm.
The amplification (%) for MB-QD probes was calculated based on the
enhancement of QD emission signal over the Cy3 emission signal upon cleavage
of Cy3 by the enzyme using equation 2:
Amplification(%)MB−QD=
( ∑λ=530
λ=510
PL(λ)
∑λ=570
λ=550
PL(λ))ET−( ∑λ=530λ=510
PL ( λ )
∑λ=570
λ=550
PL ( λ ) )N( ∑λ=530
λ=510
PL ( λ )
∑λ=570
λ=550
PL ( λ ) )N×100(2)
where the wavelength range of 510 to 530 nm corresponds to the region of
significant gQD PL.
2.5. Paper-based amplification
Amplifications on paper substrates were done in solution-phase and surface-
phase formats. In the solution-phase format, 1-5 uL of amplification mixture
containing 1.6 U/μL of EXO, 1X CutSmart buffer, 200 nM of QD-MB was spotted
on each paper zone and the reaction then proceeded for 60 min. For surface-
phase amplification, MB-QDs were first immobilized on paper by adding 3 μL of
MB-QD solution (200 nM) in BB pH 9.2 to each reaction zone. The reactions
were allowed to continue until complete, which was determined to be a period of
10
30 min. The paper was then washed in borate buffer and dried in a desiccator.
Thereafter, 1-5 uL of amplification mixture containing 3 U/μL of EXO, 1X
CutSmart buffer, and various concentrations of TGT-1 oligonucleotides was
spotted on each paper zone, with reaction times of 60 min. To prevent
evaporation of the amplification solution, the paper was enclosed in a humid
chamber (See Figure S2).
The extent of amplification that occurred in the paper substrates was determined
from the PL spectra and the intensities of fluorescence from digital images. The
PL spectra were acquired using a Nikon Eclipse L150 epifluorescence
microscope (Nikon, Mississauga, ON) and the amplification was calculated using
equation (1). Digital color images from paper substrates were acquired using an
iPhone 4S (Apple, Cupertino, CA, U.S.A.). For collection of reproducible digital
images, paper substrates were illuminated at a distance of 10 cm with an
ultraviolet (UV) lamp (UVGL-58, LW/ SW, 6W The Science Company, Denver,
CO, U.S.A.) operated at the long wavelength (365 nm) setting. The digital images
were split into corresponding R-G-B color channels using ImageJ software and
the amplification was quantified by ratiometric analysis of each spot using
equation 3:
Amplification (%)=( IGI R )ET−( IGIR )N
( IGIR )N×100(3)
where IG and IR are the mean PL intensity of green channel (G) and red channel
(R) for a given spot, respectively. The subscript ET denotes a measurement
11
made in the presence of enzyme and target, while N denotes a measurement
made in the absence of both the enzyme and the target.
Kinetic assays. Kinetic experiments in solution-phase and surface-phase format
were done using 1 μL of amplification solution in reaction zone of the paper
substrates. The fluorescence spectrum of each zone was acquired using the
Nikon microscope every 5 min for 60 minutes, and signal intensity was used to
determine the extent of amplification (%). The characteristic rate constants of
amplification (k’) were obtained by fitting to a first-order kinetic model using
equation 4:
AA0
=e−k' t(4)
where A and A0 are the amplification signal at each point of time and the final
amplification signal, respectively, and t represents time in minutes.
3. Results and discussion
The mechanism of nuclease-assisted amplification is based on the target
recycling that is achieved by three sequential events, including: (1) target strand
hybridization to an oligonucleotide probe; (2) probe cleavage by a nuclease that
acts on dsDNA, resulting in development of a fluorescence response; and (3)
target strand release upon cleavage of the probe, providing for a further cycle of
binding of the target strand with oligonucleotide probe. In this work, a molecular
beacon oligonucleotide was used as the probe strand (Table 1). When hybridized
12
to the target strand TGT-1, the 3’-end of the MB was blunt, which resulted in the
cleavage of the probe by the enzyme exonuclease III (EXO). The loop region of
the MB probe contained a recognition sequence for the nicking endonuclease
Nt.Bbv (Bbv), which caused the cleavage of the probe upon binding to the target
strand TGT-2.
According to the supplier, the optimum temperature for both nucleases is 37 °C.
This work investigated the efficiency of the nucleases across a temperature
range of 23-37 °C (Figure S3). The results show ~20% and ~40% reduction in
amplification efficiencies of EXO and Bbv, respectively, at room temperature (23
°C) in comparison with the optimum temperature of 37 °C. Operation at room
temperature better fits the potential applications of paper-based amplification for
screening technologies at the POC settings, and subsequent amplification
experiments were done at room temperature.
3.1. Nanoparticles and FRET for detection
Two different designs of FRET - based assay were used to monitor the quantity
of products from the amplification reactions (Figure 1). In format 1, Cy3 and Tide
Quencher 3, attached to two ends of a MB probe (MB-TQ), were used as the
FRET pair (Figure 1(a)). The enhancement of Cy3 PL upon cleavage of the MB-
TQ probe by the enzyme was monitored as an indication of target amplification.
In format 2, QDs with green fluorescence and Cy3 were used as the FRET donor
and acceptor, respectively (Figure 1(b)). The release of Cy3 molecules from the
nanoparticle surfaces by the action of nuclease resulted in an increase in the
13
ratio of the maximum QD PL at 520 nm over the maximum Cy3 PL at 560 nm.
The amplification (%) resulting from formats 1 and 2 were calculated according to
Equations 1 & 2, respectively. Figure 2(a) shows the emission spectra and the
corresponding calibration curve obtained from EXO-assisted amplification using
MB-TQ probe at various concentrations of the target strand (TGT-1). Upon
addition of EXO, even in the absence of the target strands, there is an increase
in signal by a factor of 1.4 that is attributed to the residual exonuclease activity on
the unbound molecular beacon. A smaller residual activity was observed in Bbv-
assisted amplification, leading to a ~40% increase in signal (Figure S4). This
increase in signal in the control experiment was expected and has been
previously reported [31].
Figures 2(c) and 2(d) show the emission spectra and the corresponding
calibration curve, respectively, obtained using format 2 in which the MB-QDs
serve as the probes. It was observed that the residual exonuclease activity in the
presence of only the MB-QDs (i.e. at target concentration of 0 pM) caused about
20% enhancement in the signal associated with amplification. This result
indicated a 7-fold reduction in the residual exonuclease activity at QD surfaces
as compared to that in the bulk solution (i.e. as represented by the signal
enhancement of MB-QD and MB-TQ probes, respectively, in absence of target
strands). This lower exonuclease activity is attributed to improved limit-of-
detection (LOD) achieved using MB-QD in comparison to that using the MB-TQ
probe (4 pM vs. 45 pM, respectively).
14
Figure 1. Schematic of FRET-based monitoring of nuclease-assisted
amplification using (a) MB-TQ and (b) MB-QD probes.
The lower residual activity of EXO at a nanoparticle surface has been previously
ascribed to issues of steric hindrance, as well as the local salt concentration
being enhanced at the nanoparticle surface due to the dense packing of the
charged oligonucleotides [32,33]. Figure 3 shows the percent amplification
obtained using EXO and Bbv enzymes when the MB packing density on QDs
varied between a MB-to-QD ratio of 2.4 and 12.6. The amplification obtained
using EXO at MB-to-QD values of ≥7.4 was largely suppressed, while the
inhibition of Bbv enzyme occurred at a lower packing density (MB/QD of ≥5.5).
As an indication of local salt concentration at the NP surfaces, the Zeta potential
was determined for NPs coated at different packing densities (Figure 3). The
trend of Zeta potentials was toward more negative values with increasing packing
density. An enhancement of local ionic strength at densely packed NP surfaces
is expected, which may cause salt-induced enzyme inhibition [34]. The inhibition
of Bbv enzyme at lower packing densities compared to that of EXO may be due
15
to the larger steric hindrance encountered by the former enzyme, which is a large
protein with two subunits, each being of equal size to EXO [34,35]. Moreover,
Rush et al. reported that the activity of endonucleases were affected by steric
hindrance at highly packed NP surfaces to a larger extent than exonuclease III
[33].
Figure 2. EXO-assisted DNA amplification in the bulk phase. (a) and (b) show the
emission spectra and the corresponding calibration curves, respectively,
obtained using MB-TQ as the probe, (c) and (d) show the FRET spectra and the
corresponding calibration curves when MB-QD was used as the probe. Error
bars show the standard deviations of 3 replicates.
16
0 2 4 6 8 10 1205
101520253035404550
-32
-30
-28
-26
-24
-22
-20EXO IIINt.BbvCIZeta Potential
DNA/Nanoparticle
Am
plifi
catio
n %
Zeta
pot
entia
l (m
V)
Figure 3. Nuclease-assisted amplification at nanoparticle surfaces coated with
various packing densities of immobilized oligonucleotides. Error bars show the
standard deviations of 3 replicates.
3.2. Amplification in paper
A paper-based platform was used with reaction zones of 3 mm diameter being
confined via wax patterning of CHR-1 paper (Figure 4). The reactions in such
zones may occur in: bulk solution where excess liquid does not penetrate the
paper matrix (Setting 1 (S1) in Figure 4); in the solution-phase within the pores of
the paper matrix (S2); and on the surfaces of the fibers that confine the pores
(S3). CHR-1 substrates have a thickness of 0.18 mm and a porosity of 68% [36],
thus a paper zone contains 0.9 μL of void volume in its porous structure. When a
reaction mixture of ≤0.9 μL is spotted on the paper, the capillary action draws all
the solution into the paper matrix and the reactions occur entirely within the
paper matrix. Using larger reaction volumes results in a portion of the reaction
17
taking place in the bulk solution above the paper substrate. Reaction in the liquid
trapped in pores likely dominates within papers that offer weak surface
interactions with the enzyme/DNA, such as glass [23], CHR [25] and PES [26], or
when non-specific binding on fiber surfaces is ameliorated by implementation of
a blocking agent. The surface-phase reactions may become significant when
DNA probes are immobilized [17], or if there is high non-specific affinity for
adsorption of proteins and DNA, such as occurs when using FTA card [19] and
nitrocellulose papers [26]. Understanding the enzymatic reactions in these
different settings is significant to the design of paper-based amplification
methods.
Figure 4. Schematic showing different environmental settings for reactions in
paper substrates. S1, S2 and S3 represent the reactions in bulk phase above the
paper matrix, in the solution contained in pores, and on the surfaces of the fibers
of the paper, respectively.
18
A comparison of the extent of amplification from the various permutations is
shown in Figure 5. For reactions within pores, the reaction mixture (consisting of
QD-MB probe, the target and the enzyme) was added to unmodified CHR-1
substrates in the absence of any blocking agent. These substrates provided a
cellulosic structure with a low affinity for QDs (see Figure S5 where washing
removed QD-MBs from unmodified CHR-1), that allowed reactions to occur
primarily within the solution trapped in pores [37]. For surface reactions, the QD-
MB probes were added to imidazole-modified CHR-1 substrates prior to the
amplification step. The strong affinity of imidazole for QDs resulted in the
immobilization of QD-MBs on the cellulosic surface, forcing the reactions to occur
at a surface. Note that following the immobilization of QD-MB probes on the
imidazole-modified paper, the paper was washed to remove excess reagents and
to ensure that no free QD-MB remained for amplification by solution-phase
reaction.
To examine the potential contributions to amplification provided by reactions in
bulk solution, the reaction volumes were either 1 μL to fill all pores in a reaction
zone (similar to the 0.9 μL void volume of a reaction zone), or 5 μL (5 times
excess of the void volume, leaving substantial volume of reaction solution as a
bead above the surface of the paper). The amplification by the EXO- and Bbv
methods showed similar trends for the various permutations of reaction volume.
However, the Bbv method generally exhibited lower amplification, which was
consistent with the results obtained from reactions in bulk solution (Figure 3). An
amplification of 51% and 38% was obtained from the EXO and Bbv methods
19
using the 5 μL volumes of reaction solution, respectively, consistent with the
magnitude and the trend obtained for these enzyme reactions done in bulk
solution without any paper matrix (55% and 32% amplification, using 100 pM of
target strands (Fig 2), respectively). When the reactions were forced to occur
within the pores of the paper matrix (i.e. using 1 μL of reaction mixture and
unmodified CHR-1), the amplification was reduced to 28% and 21% for the EXO
and Bbv methods, respectively.
In comparison with the bulk solution reactions, the amplification associated with
the use of immobilized nanoparticles resulted in lower amplification that did not
vary significantly with different reaction volumes of 5 and 1 uL (~20% and 8% for
EXO and Bbv methods, respectively). The overall trend of amplification efficiency
(bulk phase > pore phase > surface phase) indicates an inhibitory effect on
amplification by confining the reactions within a paper matrix. Two primary
considerations that might explain the apparent inhibition of amplification in paper
are: (1) enzyme inactivation, and (2) reduced efficiency of target recycling.
A higher enzyme concentration can offset the apparent reduction of enzyme
activity in paper compared to bulk solution. As Figure 5(d) shows, the EXO-
assisted amplification signal within the liquids in pores reaches a plateau at an
enzyme concentration of 3.2 U/μL, which is 3-fold higher than the corresponding
value in the bulk solution.
20
Figure 5. Amplification in paper. (a) and (b) show optical images obtained from
paper-based amplification reactions on an unmodified CHR-1 paper and a CHR-
1 paper with immobilized MB-QD on the surface, respectively. N denotes the
paper spots where amplification buffer was added and ET denotes the spots
where amplification mixture (containing enzymes and target strands) were
added. (c) The histogram shows the amplification (%) obtained from images (a)
and (b). (d) shows amplification signals in bulk solution and in the liquid in pores
at different concentrations of EXO. All experiments were done using 200 nM of
QD-MB and 100 pM of target strands. Error bars show the standard deviations of
4 replicates.
21
3.3. The significance of surface chemistry
To further investigate the interactions of paper surfaces with the enzyme/DNA
and the impact of these interactions on enzymatic amplifications, a comparison
was done of the amplification obtained from different substrates including CHR-1,
GF/A, NC, DE-81. CHR-1 and GF/A are known to interact poorly with proteins
and oligonucleotides [37,38]. NC interacts strongly with proteins and weakly with
single-stranded oligonucleotides primarily by hydrophobic interactions [39]. DE-
81 is a cationic membrane that interacts strongly with oligonucleotides, as well as
with proteins containing any negatively-charged domains [40]. Some insight
about the impact of surface adsorption was derived by observing the effect of
blocking the surface with common agents such as BSA and salmon sperm DNA
(SSD). BSA is a globular protein that adsorbs to surfaces through various types
of interactions including hydrophobic, Van der Waals and ionic interactions [40],
while SSD is a DNA agent sheared to an average size of ≤2,000 bp and is
commonly used to prevent non-specific adsorption of nucleic acids. Figure 6(a)
and 6(b) show the amplification obtained from EXO and Bbv amplification
methods, respectively, using the various substrates and blocking agents. Without
a blocking agent, the relative magnitude of amplification is CHR-1>GF/A≥DE-
81>NC, which is consistent with the anticipated surface activity of the substrates.
The blocked substrates provided greater amplification, with the exception that the
Bbv method in DE-81 was more effective than GF/A. The amplification on NC
substrate was completely inhibited, while only partial inhibition was observed
22
using the DE-81 substrate. These observations are consistent with hydrophobic
interactions being more significant than electrostatic interactions.
Blocking the surfaces with BSA resulted in substantial enhancement of
amplification from all substrates for both the EXO and Bbv methods. The
effective blocking of the hydrophobic surface of NC by BSA suggests a
substantial role of hydrophobic interactions in enzyme inhibition. It is likely that
the negatively charged BSA molecules (isoelectric point of 5.4) also blocked the
cationic sites on DE-81 substrates that were responsible for the enhancement of
the amplification signal. In contrast, the SSD was only effective at blocking the
cationic sites on DE-81 substrate. On the basis of these results, it appears that
adsorption of the enzymes has a stronger inhibitory effect on the amplification
than the adsorption of oligonucleotides. Successful DNA amplification on the
substrates that are known to have a high affinity with nucleic acids such as the
FTA card and Whatman 903 paper [19,20] was consistent with the finding that
surface interactions of oligonucleotides did not significantly inhibit amplification.
23
Figure 6: Relative amplification by EXO (a) and Bbv (b) methods using different
substrates, with all reactions taking place in the liquids in pores. (c) and (d) show
the kinetic curves of amplification by the EXO method in paper substrates with
different pore sizes. The experiments were done in (c) liquids in pores, and (d) on
the imidazole-modified cellulose surface. All experiments were done using 200
nM of QD-MB and 100 pM of target strands. Error bars show the standard
deviations of 4 replicates.
3.4 The effect of pore sizes
A variety of paper substrates with different pore sizes are commercially available
and have previously been reported for DNA amplification [18,25,26,41]. It is
24
expected that the kinetics, as well as the efficiency of enzymatic reactions within
paper pores, will be affected by the size of the pores. The initial mass transfer of
reactants to the paper pores takes place via capillary action at a fast rate
(seconds). The subsequent processes that lead to the amplification (i.e. DNA
hybridization between target and probe, enzymatic cleavage of the probe and the
target release and recycling) are dependent on diffusion. Diffusion-based mass
transfer in unstirred solution is a slow process, and inter-pore transfers of
amplification components will be evenly more limited. Thus, it can be envisioned
as a first approximation that the amplification processes remain limited on
average within a single pore. This makes pore size a critical factor that affects
the extent of enzymatic amplification. The effect of the pore size on the kinetics
and efficiency of enzymatic amplification in paper substrates of similar chemical
structure was investigated. Figures 6(c) and 6(d) show the kinetic curves of
amplification reactions done in solution-phase and surface-phase for paper
substrates with pore sizes of 2.5, 6, 11, 100 μm diameter [42]. Table 1 shows the
characteristic rate constants calculated by fitting the curves to a first-order kinetic
model (see experimental section and Figures S6 and Figure S7). The rate of the
amplification for solution-phase reactions decreased proportionally with the pore
size, from 6.6 (± 0.6) × 10-2 min-1 for CHR-1 substrate (pore diameter of 100 μm)
to 4.5 (± 0.3) × 10-2 min-1 for FP-5 substrate (pore diameter of 2.5 μm). The rates
of the surface-phase amplifications exhibited an opposite trend, and increased
from 2.3 (± 0.3) × 10-2 min-1 to 6.4 (± 0.5) × 10-2 min-1 for substrates with pore
diameters of 100 μm and 2.5 μm, respectively. The latter trend is consistent with
25
the higher surface-to-volume ratio (SA/V) in smaller pores (Table 2). For
amplification where the MB-probes are immobilized on the pore surfaces, a
higher SA/V denotes a higher number of probe molecules available to the
enzyme/target strands, which is reflected in the increased rate of amplification.
An anomaly is that the FP-5 substrates (2.5 μm) reach a final amplification signal
of 26%, which is distinctly lower than the signals obtained from the other paper
substrates with larger pore sizes. This observation is consistent with our
calculation that the average target/pore ratio in 2.5 μm pores at the target
concentration of 100 pM is equal to ~0.5, and the data suggests that a significant
fraction of the pores receive no target strands. Given the large range of pore
sizes studied here, we speculate from these results that the amplification rate
and efficiency, at the range of pore diameters studied (>1 μm, commonly used
for fabrication of paper devices), are only moderately dependent on the pore
size.
Table 2: Kinetic rate constants of EXO-assisted amplifications in paper
substrates with different pore sizes.
Substrate Pore diameter (μm) a SA/V μm-1 b k’p /10-2 min-1 b k’s /10-2 min-1
CHR-1 100 0.06 c 6.6 ± 0.5c 2.3 ± 0.3FP-1 11 0.5 5.3 ± 0.2 2.9 ± 0.5FP-3 6 1 5.0 ± 0.2 3.8 ± 0.5FP-5 2.5 2.4 4.5 ± 0.3 6.4 ± 0.3
a SA/V represents the surface to volume ratios of the paper poresb k’p and k’s reperesent the characteristic rate constants obtained from curve fittings of solution-phase and surface-phase amplifications, respectively.c The errors reported are standard errors obtained from curve fitting.
26
3.5 The effect of oligonucleotide target length
Target recycling in nuclease-assisted amplification requires the target strand,
after enzymatic cleavage of a probe strand, to diffuse to the next probe and
undergo DNA hybridization. The rates of diffusion and hybridization processes
depend on the target length. Table 3 shows k’p and k’s values obtained from
amplification by the EXO method using target oligonucleotides of 30, 60 and 90-
mer length. The rate of both solution-phase and surface-phase amplifications
decreased as target length increased. However, the extent of reduction was
significantly greater for the surface-phase reactions. While k’p values decreased
by 17% and 30% when the 30-mer target was replaced with the 60-mer and 90-
mer strands, respectively, the corresponding k’s values decreased by 3-fold and
8-fold, respectively. The strong dependence of the surface-phase k’s values on
the target length suggests that diffusion across or within the boundary layer at
the pore surface plays an important role in the overall rate of amplification on
paper.
Table 3: Kinetic rate constants of amplification by the EXO method in CHR-1
paper substrates for target oligonucleotides of different lengths.
27
Target length a k’p /10-2 min-1 a k’s /10-2 min-1
30-mer b 6.6 ± 0.5c 2.3 ± 0.360-mer 5.5 ± 0.3 0.8 ± 0.190-mer 4.6 ± 0.3 0.3 ± 0.03
a k’p and k’s reperesent the characteristic rate constants obtained from curve fittings of solution-phase and surface-phase amplifications, respectively.b The errors reported are standard errors obtained from curve fitting.
4. Conclusions
This work has evaluated the significance of several factors that influence the
efficiency of nuclease-assisted DNA amplifications done in paper matrices. The
data suggests that interactions of enzymes with the paper matrix can lead to an
inhibition of the amplification in comparison to that observed to take place in bulk
solution. Thus, such interactions should be suppressed by using inert substrates
or by implementation of a protein blocking agent such as BSA. Similar levels of
sensitivity to adsorption of oligonucleotides to paper were not evident. Kinetic
studies showed that amplification rates are affected by pore size, and that
solution-phase and surface-phase amplification have opposing trends in relation
to pore size. A reduction of the amplification rate with increase in the
oligonucleotide target length was anticipated, but is significantly greater for
surface-phase as compared to the solution-phase amplifications, denoting the
significance of boundary diffusion in the amplification process. The information
reported in this work is particularly applicable to enzymatic target-recycling
amplification methods in various paper substrates, but also provides insights that
might be relevant to other enzymatic amplification methods in paper.
Acknowledgements
28
We are grateful to the Natural Sciences and Engineering Research Council of
Canada for financial support of this work (Grants STPGP 479222-15; RGPIN-
2014-04121).
References
[1] A. Nilghaz, L. Guan, W. Tan, W. Shen, Advances of paper-based
microfluidics for diagnostics - the original motivation and current status,
ACS Sensors 1 (2016) 1382-1393.
[2] A.W. Martinez, S.T. Phillips, G.M. Whitesides, E. Carrilho, Diagnostics for
the developing world: Microfluidic paper-based analytical devices, Anal.
Chem. 82 (2010) 3–10.
[3] Y. Yang, E. Noviana, M.P. Nguyen, B.J. Geiss, D.S. Dandy, C.S. Henry,
Paper-based microfluidic devices: emerging themes and applications, Anal.
Chem. 89 (2017) 71-91.
[4] E. Carrilho, A.W. Martinez, G.M. Whitesides, Understanding wax printing: a
simple micropatterning process for paper-based microfluidics, Anal. Chem.
81 (2009) 7091–7095.
[5] A.M. López-Marzo, A. Merkoçi, Paper-based sensors and assays: a
success of the engineering design and the convergence of knowledge
29
areas, Lab Chip 16 (2016) 3150-3176.
[6] A.W. Martinez, S.T. Phillips, M.J. Butte, G.M. Whitesides, Patterned paper
as a platform for inexpensive, low-volume, portable bioassays, Angew.
Chemie - Int. Ed. 46 (2007) 1318–1320.
[7] Y. Du, S. Dong, Nucleic acid biosensors: recent advances and
perspectives, Anal. Chem. 89 (2017) 189–215.
[8] M.O. Noor, U.J. Krull, Camera-based ratiometric fluorescence transduction
of nucleic acid hybridization with reagentless signal amplification on a
paper-based platform using immobilized quantum dots as donors, Anal.
Chem. 86 (2014) 10331–10339.
[9] H. Li, X. Fang, H. Cao, J. Kong, Paper-based fluorescence resonance
energy transfer assay for directly detecting nucleic acids and proteins,
Biosens. Bioelectron. 80 (2016) 79–83.
[10] S. Doughan, U. Uddayasankar, U.J. Krull, A paper-based resonance
energy transfer nucleic acid hybridization assay using upconversion
nanoparticles as donors and quantum dots as acceptors, Anal. Chim. Acta
878 (2015) 1-8.
[11] M.O. Noor, U.J. Krull, Paper-based solid-phase multiplexed nucleic acid
hybridization assay with tunable dynamic range using immobilized
quantum dots as donors in fluorescence resonance energy transfer, Anal.
Chem. 85 (2013) 7502-7511.
[12] X. Li, K. Scida, R.M. Crooks, Detection of Hepatitis B virus DNA with a
paper electrochemical sensor, Anal. Chem. 87 (2015) 9009–9015.
30
[13] F. Liu, C. Zhang, A novel paper-based microfluidic enhanced
chemiluminescence biosensor for facile, reliable and highly-sensitive gene
detection of Listeria monocytogenes, Sensors Actuators, B Chem. 209
(2015) 399–406.
[14] K. Yamada, H. Shibata, K. Suzuki, D. Citterio, Toward practical application
of paper-based microfluidics for medical diagnostics: state-of-the-art and
challenges, Lab Chip 17 (2017) 1206–1249.
[15] M. Safavieh, V. Kaul, S. Khetani, A. Singh, K. Dhingra, M.K.
Kanakasabapathy, M.S. Draz, A. Memic, D.R. Kuritzkes, H. Shafiee, Paper
microchip with a graphene-modified silver nano-composite electrode for
electrical sensing of microbial pathogens, Nanoscale 9 (2017) 1852-1861.
[16] S.O. Kelley, What are clinically relevant levels of cellular and biomolecular
analytes?, ACS Sensors 2 (2016) 193-197.
[17] M. Liu, C,Y. Hui, Q. Zhang, J. Gu, B. Kannan, S. Jahanshahi-Anbuhi,
C.D.M. Filipe, J.D. Brennan, Y. Li, Target-induced and equipment-free
DNA amplification with a simple paper device, Angew. Chemie - Int. Ed. 55
(2016) 2709–2713.
[18] J.R. Choi, J. Hu, R. Tang, Y. Gong, S. Feng, H. Ren, T. Wen, X.J. Li,
W.A.B. Wan Abas, B. Pingguan-Murphy, F. Xu, An integrated paper-based
sample-to-answer biosensor for nucleic acid testing at the point of care,
Lab Chip 16 (2016) 611–621.
[19] J.T. Connelly, J.P. Rolland, G.M. Whitesides, "Paper Machine" for
molecular diagnostics, Anal. Chem. 87 (2015) 7595–7601.
31
[20] W. Gan, B. Zhuang, P. Zhang, J. Han, C. Li, P. Liu, A filter paper-based
microdevice for low-cost, rapid, and automated DNA extraction and
amplification from diverse sample types, Lab Chip 14 (2014) 3719-3728.
[21] L. Lafleur, J.D. Bishop, E.K. Heiniger, R.P. Gallagher, M.D. Wheeler, P.C.
Kauffman, X. Zhang, E. Kline, J. Buser, S. Ramachandran, S. Byrnes, N.
Vermeulen, N. Scarr, Y. Belousov, W. Mahoney, B.J. Toley, P.D. Ladd, B.
Lutz, P. Yager, A rapid, instrument-free, sample-to-result nucleic acid
amplification test, Lab Chip 16 (2016) 3777–3787.
[22] M. Dou, D.C. Dominguez, X. Li, J. Sanchez, G. Scott, A versatile
PDMS/paper hybrid microfluidic platform for sensitive infectious disease
diagnosis, Anal. Chem. 86 (2014) 7978–7986.
[23] R. Tang, H. Yang, Y. Gong, M. You, Z. Liu, J.R. Choi, T. Wen, Z. Qu, Q.
Mei, F. Xu, A fully disposable and integrated paper-based device for
nucleic acid extraction, amplification and detection, Lab Chip 17 (2017)
1270–1279.
[24] G. Da Cunha Santos, N. Liu, M.S. Tsao, S. Kamel-Reid, K. Chin, W.R.
Geddie, Detection of EGFR and KRAS mutations in fine-needle aspirates
stored on whatman FTA cards: is this the tool for biobanking cytological
samples in the molecular era?, Cancer Cytopathol. 118 (2010) 450–456.
[25] B.A. Rohrman, R.R. Richards-Kortum, A paper and plastic device for
performing recombinase polymerase amplification of HIV DNA, Lab Chip
12 (2012) 3082-3088.
[26] J.C. Linnes, N.M. Rodriguez, L. Liu, C.M. Klapperich, Polyethersulfone
32
improves isothermal nucleic acid amplification compared to current paper-
based diagnostics, Biomed. Microdevices 18 (2016) 1–12.
[27] Y.V. Gerasimova, D.M. Kolpashchikov, Enzyme-assisted target recycling
(EATR) for nucleic acid detection, Chem Soc Rev 43 (2014) 6405–6438.
[28] M.O. Noor, D. Hrovat, M. Moazami-Goudarzi, G.S. Espie, U.J. Krull,
Ratiometric fluorescence transduction by hybridization after isothermal
amplification for determination of zeptomole quantities of oligonucleotide
biomarkers with a paper-based platform and camera-based detection,
Anal. Chim. Acta 885 (2015) 156-165.
[29] M.O. Noor, A. Shahmuradyan, U.J. Krull, Paper-based solid-phase nucleic
acid hybridization assay using immobilized quantum dots as donors in
fluorescence resonance energy transfer, Anal. Chem. 85 (2013) 1860-
1867.
[30] A. Sedighi, U.J. Krull, Rapid immobilization of oligonucleotides at high
density on semiconductor quantum dots and gold nanoparticles, Langmuir
32 (2016) 13500–13509.
[31] X. Zuo, F. Xia, Y. Xiao, K.W. Plaxco, Sensitive and selective amplified
fluorescence DNA detection based on exonuclease III-aided target
recycling, J. Am. Chem. Soc. 132 (2010) 1816–1818.
[32] D.A. Giljohann, D.S. Seferos, A.E. Prigodich, P.C. Patel, C.A. Mirkin, Gene
regulation with polyvalent siRNA-nanoparticle conjugates, J. Am. Chem.
Soc. 131 (2009) 2072–2073.
[33] A.M. Rush, M.P. Thompson, E.T. Tatro, N.C. Gianneschi, Nuclease-
33
resistant DNA via high-density packing in polymeric micellar nanoparticle
coronas, ACS Nano 7 (2013) 1379–1387.
[34] D.F. Heiter, K.D. Lunnen, G.G. Wilson, Site-specific DNA-nicking mutants
of the heterodimeric restriction endonuclease R.BbvCI, J. Mol. Biol. 348
(2005) 631–640.
[35] C.D. Mol, C.F. Kuo, M.M. Thayer, R.P. Cunningham, J.A. Tainer, Structure
and function of the multifunctional DNA-repair enzyme exonuclease III,
Nature 374 (1995) 381–386.
[36] M.N. Costa, B. Veigas, J.M. Jacob, D.S. Santos, J. Gomes, P.V. Baptista,
R. Martins, J. Inácio, E. Fortunato, A low cost, safe, disposable, rapid and
self-sustainable paper-based platform for diagnostic testing: lab-on-paper,
Nanotechnology 25 (2014) 094006.
[37] A. Yu, J. Shang, F. Cheng, B.A. Paik, J.M. Kaplan, R.B. Andrade, D.M.
Ratner, Biofunctional paper via the covalent modification of cellulose,
Langmuir 28 (2012) 11265-11273.
[38] C. Eckerskorn, W. Mewes, H. Goretzki, F. Lottspeich, A new siliconized‐
glass fiber as support for protein‐chemical analysis of electroblotted
proteins, Eur. J. Biochem. 176 (1988) 509-519.
[39] C.J. Van Oss, R.J. Good, M.K. Chaudhury, Mechanism of DNA (southern)
and protein (western) blotting on cellulose nitrate and other membranes, J.
Chromatograph. A 391 (1987) 53–65.
[40] H.T.M. Phan, S. Bartelt-Hunt, K.B. Rodenhausen, M. Schubert, J.C. Bartz,
Investigation of bovine serum albumin (BSA) attachment onto self-
34
assembled monolayers (SAMs) using combinatorial quartz crystal
microbalance with dissipation (QCM-D) and spectroscopic ellipsometry
(SE), PLoS One 10 (2015) 0141282.
[41] N.M. Rodriguez, W.S. Wong, L. Liu, R. Dewar, C.M. Klapperich, A fully
integrated paperfluidic molecular diagnostic chip for the extraction,
amplification, and detection of nucleic acids from clinical samples, Lab
Chip 16 (2016) 753–763.
[42] S.C. Fernandes, J.A. Walz, D.J. Wilson, J.C. Brooks, C.R. Mace, Beyond
wicking: expanding the role of patterned paper as the foundation for an
analytical platform, Anal. Chem. 89 (2017) 5654-5664.
35
Figure Captions:
Figure 1. Schematic of FRET-based monitoring of nuclease-assisted
amplification using (a) MB-TQ and (b) MB-QD probes.
Figure 2. EXO-assisted DNA amplification in the bulk phase. (a) and (b) show the
emission spectra and the corresponding calibration curves, respectively,
obtained using MB-TQ as the probe, (c) and (d) show the FRET spectra and the
corresponding calibration curves when MB-QD was used as the probe. Error
bars show the standard deviations of 3 replicates.
Figure 3. Nuclease-assisted amplification at nanoparticle surfaces coated with
various packing densities of immobilized oligonucleotides. Error bars show the
standard deviations of 3 replicates.
Figure 4. Schematic showing different environmental settings for reactions in
paper substrates. S1, S2 and S3 represent the reactions in bulk phase above the
paper matrix, in the solution contained in pores, and on the surfaces of the fibers
of the paper, respectively.
Figure 5. Amplification in paper. (a) and (b) show optical images obtained from
paper-based amplification reactions on an unmodified CHR-1 paper and a CHR-
1 paper with immobilized MB-QD on the surface, respectively. N denotes the
36
paper spots where amplification buffer was added and ET denotes the spots
where amplification mixture (containing enzymes and target strands) were
added. (c) The histogram shows the amplification (%) obtained from images (a)
and (b). (d) shows amplification signals in bulk solution and in the liquid in pores
at different concentrations of EXO. All experiments were done using 200 nM of
QD-MB and 100 pM of target strands. Error bars show the standard deviations of
4 replicates.
Figure 6: Relative amplification by EXO (a) and Bbv (b) methods using different
substrates, with all reactions taking place in the liquids in pores. (c) and (d) show
the kinetic curves of amplification by the EXO method in paper substrates with
different pore sizes. The experiments were done in (c) liquids in pores, and (d) on
the imidazole-modified cellulose surface. All experiments were done using 200
nM of QD-MB and 100 pM of target strands. Error bars show the standard
deviations of 4 replicates.
37