v nikoletopoulou et al. nature 467 , 59-63 (2010) doi:10.1038/nature09336

V Nikoletopoulou et al. Nature 467, 59-63 (2010) doi:10.1038/nature09336 Trk-induced death without kinase activity.

Upload: megan-kerr

Post on 30-Dec-2015

17 views

Category:

Documents

1 download

Report

Download

Embed Size (px):

DESCRIPTION

Trk-induced death without kinase activity. V Nikoletopoulou et al. Nature 467 , 59-63 (2010) doi:10.1038/nature09336. - PowerPoint PPT Presentation

TRANSCRIPT

V Nikoletopoulou et al. Nature 467, 59-63 (2010) doi:10.1038/nature09336

Trk-induced death without kinase activity.

Neuropsychopharmacology (2013) 38 , 1521-1534; doi:10.1038/npp.2013.51

doi:10.1038/nature12886 Neanderthal from the Altai

Nat. Neurosci.; doi:10.1038/nn.3725 Leptin signaling in astrocytes … · 2014-06-25 · nature neuroscience correction notice Nat. Neurosci.; doi:10.1038/nn.3725 Leptin signaling

DOI: 10.1038/NGEO2405 Moist convection in hydrogen

Nature Photonics 8, 695-700 doi: 10.1038/ (2014). The

DOI: 10.1038/ncomms1280 molecular dynamics of single

GI Motility online (May 2006) | doi:10.1038/gimo48

Neuropsychopharmacology (2014) 39 , 1603-1613; doi:10.1038/npp.2014.7

doi:10.1038/nature06481 LETTERS

DOI: 10.1038/NMAT4228 - imechanicaimechanica.org/files/nmat4228-s1_0.pdf · SUPPLEMENTARY INFORMATION. DOI: 10.1038/NMAT4228. NATURE MATERIALS | . 1. 1. In Situ Atomic-Scale Observation

Nature Neuroscience: doi:10.1038/nnNtrk2 TTTTTTTAGTTTTTTTTGTTAGTTAATAAA CACATCTCAATAATCAACCACATC BS Nature Neuroscience: doi:10.1038/nn.3976 Author Andrew Gordon Created Date 2/25/2015

Published in Nature Materials (2016) doi:10.1038/nmat4569

GI Motility online (May 2006) | doi:10.1038/gimo46

DOI: 10.1038/NMAT4801 Metal-Oxide-Semiconductor

doi:10.1038/nature05202 LETTERS

Guo et al ., Nature Materials, DOI:10.1038/ nmat3234 (2012)

Nature , 2008, Doi:10.1038/nature07103

Mucosal Immunology (2013) 6 , 522-534; doi:10.1038/mi.2012.92

Nature, 2008, Doi:10.1038/nature07103 Semrah Kati 09.02.2009

DOI: 10.1038/NMAT4143 - Nature Research...in – √ ((− ((((= √ (. (). (in (() (∼ × → in ≃), ∆ = (˜)/ (˜ +) ± × ˜/ = = ˜/ =. × ×−

Vol 437 15 September 2005 doi:10.1038/nature03943 LETTERS

Nature Genetics doi:10.1038/ng · Aortic stenosis Aortic regurgitation Nature Genetics: doi:10.1038/ng.3618. Cardiomyopathy Hypertrophic card Pericardial Problem Pericarditis Pericardial

doi: 10.1038/nature09205 SupplementaryInformationfor ...projects.iq.harvard.edu/files/ped/files/nature09205-s1.pdf 2 doi: 10.1038/nature09205 SUPPLEMENTARY INFORMATION 10Asexualreproduction

Vol 453 1 May 2008 doi:10.1038/nature06733 LETTERS

Nature Biotechnology: doi:10.1038/nbt

DOI: 10.1038/NPHYS3211 Supplementary Information for

DOI: 10.1038/NMAT4204 Supplementary Information...NATURE MATERIALS | . DOI: 10.1038/NMAT4204. , , – – |

Calcium modulates force sensing by the von ... - aj-lab.gitlab.io · ARTICLE nATuRE CommunICATIons | DoI: 10.1038/ncomms1385 nATuRE CommunICATIons | 2:385 | DoI: 10.1038/ncomms1385

SCIENTIFIC REPORTS | 2 : 592 | DOI: 10.1038/srep00592

doi:10.1038/nature05150 LETTERS

GI Motility online (May 2006) | doi:10.1038/gimo12

Nature Genetics: doi:10.1038/ng - Seth Field's Lab at UCSDsethfield.ucsd.edu/Papers/Bielas..Gleeson NatureGenetics 2009 suppl... · Nature Genetics: doi:10.1038/ng.423. Supplemental

Ecosystem turnover in palaeoecological records: …€¦ · Web viewNature Publishing Group: 53–59. DOI: 10.1038/nature08227. DOI: 10.1038/nature08227. Seddon AW, Macias-Fauria

Nature Biotechnology: doi:10.1038/nbtmanalis-lab.mit.edu/publications/cermak_SI.pdf · Nature Biotechnology: doi:10.1038/nbt.3666. Supplementary Figure 13 Comparison of precision