uso de la técnica sscp para detectar mutaciones puntuales ...· los polimorfismos del adn...

Download Uso de la técnica SSCP para detectar mutaciones puntuales ...· Los polimorfismos del ADN mitocondrial

Post on 16-Oct-2018

212 views

Category:

Documents

0 download

Embed Size (px)

TRANSCRIPT

  • 349

    La tcnica SSCP para detectar mutaciones puntuales

    Rev. peru. biol. 12(3): 349- 358 (2005)

    http://sisbib.unmsm

    .edu.pe/BVRevistas/biologia/biologiaN

    EW.htm

    Rev. peru. biol. 12(3): 349- 358 (2005) Facultad de Ciencias Biolgicas UNMSM

    Presentado: 07/07/2005Aceptado: 02/02/2006

    Uso de la tcnica SSCP para detectar mutaciones puntuales del ADNmitocondrial humano

    Use of the SSCP technique to detect point mutations on human mtDNA

    Alejandro Estrada-Cuzcano, Jos Sandoval, Mara L. Guevara-Fujita y Ricardo Fujita*

    (*) Instituto de Gentica y Biologa Molecular,Facultad de Medicina Humana, Universidad de SanMartn de Porres, Alameda del Corregidor 1531, LaMolina, Lima, Per. Tel: (511) 3652300 / 365-2574anexo 152, fax: (511) 3650487.

    E-mail Ricardo Fujita: rfujita@amauta.rcp.net.pe

    ResumenEn el presente trabajo se evala la tcnica de SSCP (polimorfismo de conformacin de cadena

    individual de ADN) para detectar mutaciones puntuales, tanto por su sensibilidad en la deteccin(alrededor 80% en condiciones ideales), como por su implementacin fcil y econmica. Se utilizaroncomo controles positivos y negativos, ADN de voluntarios caracterizados previamente para las muta-ciones puntuales de 5 RFLPs mitocondriales. Para la optimizacin de la prueba fueron ensayadasconcentraciones variables del tampn TBE (1X y 0,5X) y del glicerol (10%, 5% y 0) en geles depoliacrilamida. Cuatro de los 5 RFLPs fueron detectados en las condiciones utilizadas y pueden serusados en estudios de rutina sin usar enzimas de restriccin. Adems, la tcnica SSCP permitideterminar mutaciones desconocidas en un segmento de 394 nucletidos de la regin hipervariable(HVI) del ADNmt. Diferencias en correspondencia a los distintos haplotipos fueron detectados eincluso permiti discernir grupos dentro del mismo subtipo. La secuenciacin de dos muestras delsubtipo B1 con migracin diferencial en SSCP, corrobor la existencia de siete nucletidos distintos.

    Palabras clave: SSCP, ADNmt (ADN mitocondrial), mutaciones puntuales, SNP (polimorfismo de unsolo nucletido).

    AbstractWe evaluate the use of SSCP (single strand conformational polymorphism), a relatively easy and

    inexpensive technique for the detection of point mutations with a sensibility around 80% under idealconditions. To test the technique, we used samples of volunteers whose DNA had been previouslycharacterized for the presence or absence of 5 mitochondrial RFLPs. Optimization of the tests includedvariations in TBE (1X and 0,5X) and of glycerol concentration (10%, 5% and no glycerol) in polyacrylamidegels. Four out of five RFLPs were detected under the conditions used and could be applied routinelywithout using restriction enzymes. In addition, the SSCP technique allowed detection of unknownmutations in a 394 bp nucleotide segment of the hypervariable (HVI) region of mtDNA. Differencescorresponding to different haplotypes were detected, helping to distinguish groups within the same subtype.Sequencing of two samples of subtype B1 with differential migration on SSCP gels, proved the existence inseven different nucleotides.

    Keywords: SSCP, mtDNA, point mutation, SNP.

    Introduccin

    La comparacin del genoma de dos indivi-duos del mismo sexo revelara millones demutaciones esparcidas a lo largo de todas lasregiones cromosmicas. La mayora de lasmutaciones cambian una sola base de cada5001000, frecuentemente en segmentos nocodantes y eventualmente en los codantes. Por

    esta razn la mayor parte de stas no tieneefectos fenotpicos. Sin embargo algunas pue-den provocar o estar asociadas a enfermeda-des. Cuando una mutacin puntual est en unafrecuencia mayor al 1% en la poblacin, se leconoce como SNP (single nucleotidepolymorphismpolimorfismo de un nucletido).

    Con el estudio del genoma humano se haincrementando el conocimiento del nmero degenes involucrados en diversas enfermedadeshereditarias. Actualmente se registran cercade 5700 diferentes enfermedades con com-ponente gentico (OMIM-On-Line Mendelian

    Versin Online ISSN 1727-9933

  • 350

    Estrada et al.

    Rev. peru. biol. 12(3): 349- 358 (2005)

    http

    ://sis

    bib.

    unm

    sm.ed

    u.pe

    /BV

    Revi

    stas/b

    iolo

    gia/

    biol

    ogia

    NEW

    .htm

    Inheritance in Man, 2004). Se han identifica-do mutaciones que causan o predisponen aenfermedades y su caracterizacin sirve parael diagnstico, pronstico, tratamiento y even-tualmente prevencin de la enfermedad. Al-gunos SNPs tambin son tiles como marca-dores genticos porque constituyen la muta-cin que predispone o porque estn fsicamentecerca a la mutacin causal de la enfermedad.

    En la bsqueda de mutaciones puntuales,se emplean mtodos como el secuenciamientodirecto, RFLPs (Southern, 1975), clivaje qu-mico, CCM (Cotton et al., 1988), clivaje porRNAsa (Goldrick et al., 1996) u oligonucletidosalelo especficos para hibridacin (ASO) (Nollau& Wagener, 1997), entre otros. Estos mtodospresentan diferentes rangos de sensibilidad, ade-ms de requerir reactivos y equipos sofisticados,que aumentan su complejidad y costo operati-vo. Frente a ellos, el mtodo de SSCP es fcily econmico, pues usa segmentos amplifica-dos por PCR visualizados en geles deacrilamida con adyuvantes (Orita et al., 1989).El SSCP es un mtodo capaz de identificar lavariacin de un slo nucletido en un segmen-to de ADN, tpicamente entre 150 a 200nucletidos de largo. En condiciones ideales elrango de sensibilidad del SSCP vara entre 8090% para detectar mutaciones en fragmentosmenores de 200 pares de bases (Sheffield etal., 1993). El mtodo del SSCP se basa enque bajo condiciones no desnaturalizantes unahebra individual de ADN adopta una confor-macin espacial que es especfica de la com-posicin de su secuencia nucleotdica (Fig. 1).Esta conformacin sera dependiente de la hi-bridacin entre distintas regiones de un seg-mento de ADN replegado sobre s mismo. Laconfiguracin diferente es provocada por elcambio de una sola base, entonces podra serdetectada en algunas condiciones de migracinelectrofortica en una matriz de poliacrilamida(Orita et al., 1989, Humphries et al., 1997).La tcnica es simple, verstil y econmica, peroexige la optimizacin de parmetros en la com-posicin del gel para cada fragmento a eva-luar.

    Los polimorfismos del ADN mitocondrial(ADNmt) son utilizados usualmente para el es-tudio de la diversidad del genoma humano. Estopermite la comparacin entre individuos de dife-rentes poblaciones e incluso entre individuos dedistintas pocas. El mtodo ms usado para de-terminar subtipos de ADNmt en nativos ameri-canos (amerindios) consiste en la deteccin de8 sitios polimrficos en diferentes regiones delADNmt. Siete son SNPs detectados por el m-todo llamado RFLP (polimorfismos de longitudde fragmentos de restriccin) y uno es la inser-cin/delecin de un segmento de 9 pares de ba-ses. El RFLP es un SNP que coincide en el sitiode reconocimiento de una enzima de restriccin.Su presencia o ausencia determina que la enzi-ma corte o no el segmento de ADN. Evidente-mente solo una pequea porcin de SNPs serndetectadas por la tcnica RFLPs. A partir de lacombinacin de los sitios polimrficos en cadaindividuo se confeccionan haplotipos que defini-rn tipos y subtipos de ADNmt. Los ADNmtamerindios han sido definidos en 4 tipos(haplogrupos) ms frecuentes A, B, C y D (Schurr

    Figura 1. Representacin esquemtica del fun-damento de la tcnica de SSCP durante laelectroforesis en un gel no desnaturalizante.La movilidad electrofortica de cada fragmentodepende del auto plegamiento de acuerdo a laformacin de estructuras secundarias.

    GAATCGATCCTAGGCACTTAGCTAGGATCCGT

    GAATCGATACTAGGCACTTAGCTATGATCCGT

    Muestra 1 Muestra 2

    Hebraindividual

    Hebradoble

  • 351

    La tcnica SSCP para detectar mutaciones puntuales

    Rev. peru. biol. 12(3): 349- 358 (2005)

    http://sisbib.unmsm

    .edu.pe/BVRevistas/biologia/biologiaN

    EW.htm

    Figura 2. Cinco RFLPs del ADNmt humanousados para las pruebas de SSCP. Se indica laposicin del RFLP (P) y la secuencia nucleotdicaque reconoce la enzima de restriccin, si stasecuencia es diferente la enzima no corta al ADNen esa posicin. Panel a: fragmento de 121pares de bases (bp) susceptible a la digestincon la enzima de restriccin HaeIII en la posi-cin +626 (sitio de restriccin constitutivo) y +663(sitio de restriccin polimrfico), que generanfragmentos de 66, 38 y 17 bp en muestra 3; enmuestras 1 y 2 solo se generan dos fragmentode 104 y 17 bp debido a un cambio del sitio+663. Panel b: fragmento de 183 bp suscepti-ble a la digestin con AluI en las posiciones+5042 (constitutivo) y +5176 (polimrfico), mues-tras 1, 3 y 5 presentan fragmentos de 134 y 34bp denotando el sitio AluI, muestras 2, 4 y 6

    generan fragmentos de 168 bp por ausencia delsitio AluI en +5176. Panel c: El fragmento deADN de 181 bp presenta sitio de corte para HincIIen la posicin 13259 (polimrfico)que generafragmentos de 155 y 26 bp en las muestras 1 y2, la muestra 3 no presenta este sitio de restric-cin por lo tanto el fragmento de 181 bp perma-nece intacto. Panel d: fragmento de 335 bp(muestra 1) susceptible a digestin con DdeI,presenta sitios de restriccin en las posiciones+10356 (constitutivo) y +10394 (polimrfico) quegeneran fragmentos de 175 y 38 bp en la mues-tras 2, 8 y 10; en las muestras 1, 3, 4, 5, 6, 9, y11 vara la secuencia CTGAG por CTGAA lo queelimina el sitio de restriccin generando fragmen-tos de 213 y 122 bp. Panel e: fragmento de 261bp (muestra 1) que presenta sitios de restric-cin para HaeIII en el las posiciones +16517(polimrfico) y +16456 (constitutivo), esto gene-ra fragmentos de 171, 61 y 29 bp en las mues-tras 2, 3 y 6. Las muestras 4 y 5 presentan unavariacin en la posicin +16517 que altera elsitio de restriccin generando fragmentos de90 y 171 bp. M es el marcador de tamao, Pes la ubicacin