university of zurich zurich open ......the cell or tissue to regulate bone resorption. an increased...

University of ZurichZurich Open Repository and Archive

Winterthurerstr. 190

CH-8057 Zurich

http://www.zora.uzh.ch

Year: 2011

Oral biofilm challenge regulates the RANKL-OPG system inperiodontal ligament and dental pulp cells

Belibasakis, G N; Meier, A; Guggenheim, B; Bostanci, N

http://www.ncbi.nlm.nih.gov/pubmed/21075196.Postprint available at:http://www.zora.uzh.ch

Posted at the Zurich Open Repository and Archive, University of Zurich.http://www.zora.uzh.ch

Originally published at:Belibasakis, G N; Meier, A; Guggenheim, B; Bostanci, N (2011). Oral biofilm challenge regulates theRANKL-OPG system in periodontal ligament and dental pulp cells. Microbial Pathogenesis, 50(1):6-11.

http://www.ncbi.nlm.nih.gov/pubmed/21075196.Postprint available at:http://www.zora.uzh.ch


Originally published at:Belibasakis, G N; Meier, A; Guggenheim, B; Bostanci, N (2011). Oral biofilm challenge regulates theRANKL-OPG system in periodontal ligament and dental pulp cells. Microbial Pathogenesis, 50(1):6-11.


Abstract

Inflammatory bone destruction triggered by oral bacteria is a hallmark of chronic and apicalperiodontitis. Receptor activator of NF-κB ligand (RANKL) activates bone resorption, whereasosteoprotegerin (OPG) blocks its action. These are members of the tumor necrosis factor ligand andreceptor families, respectively. Although individual oral pathogens are known to regulate RANKL andOPG expression in cells of relevance to the respective diseases, such as periodontal ligament (PDL) anddental pulp (DP) cells, the effect of polymicrobial oral biofilms is not known. This study aimed toinvestigate the effect of the Zürich in vitro supragingival biofilm model on RANKL and OPG geneexpression, in human PDL and DP cell cultures, by quantitative real-time polymerase chain reaction.RANKL expression was more pronouncedly up-regulated in DP than PDL cells (4-fold greater),whereas OPG was up-regulated to a similar extent. The RANKL/OPG ratio was increased only in DPcells, indicating an enhanced capacity for inducing bone resorption. The expression of pro-inflammatorycytokine interleukin-1β was also increased in DP, but not PDL cells. Collectively, the highresponsiveness of DP, but not PDL cells to the supragingival biofilm challenge could constitute aputative pathogenic mechanism for apical periodontitis, which may not crucial for chronic periodontitis.

University of ZurichZurich Open Repository and Archive

Winterthurerstr. 190

CH-8057 Zurich

http://www.zora.uzh.ch

Year: 2011


Belibasakis, G N; Meier, A; Guggenheim, B; Bostanci, N

Belibasakis, G N; Meier, A; Guggenheim, B; Bostanci, N (2011). Oral biofilm challenge regulates theRANKL-OPG system in periodontal ligament and dental pulp cells. Microbial Pathogenesis, 50(1):6-11.Postprint available at:http://www.zora.uzh.ch


Originally published at:Microbial Pathogenesis 2011, 50(1):6-11.

Belibasakis, G N; Meier, A; Guggenheim, B; Bostanci, N (2011). Oral biofilm challenge regulates theRANKL-OPG system in periodontal ligament and dental pulp cells. Microbial Pathogenesis, 50(1):6-11.Postprint available at:http://www.zora.uzh.ch


Originally published at:Microbial Pathogenesis 2011, 50(1):6-11.


Abstract

Inflammatory bone destruction triggered by oral bacteria is a hallmark of chronic and apicalperiodontitis. Receptor activator of NF-κB ligand (RANKL) activates bone resorption, whereasosteoprotegerin (OPG) blocks its action. These are members of the tumor necrosis factor ligand andreceptor families, respectively. Although individual oral pathogens are known to regulate RANKL andOPG expression in cells of relevance to the respective diseases, such as periodontal ligament (PDL) anddental pulp (DP) cells, the effect of polymicrobial oral biofilms is not known. This study aimed toinvestigate the effect of the Zürich in vitro supragingival biofilm model on RANKL and OPG geneexpression, in human PDL and DP cell cultures, by quantitative real-time polymerase chain reaction.RANKL expression was more pronouncedly up-regulated in DP than PDL cells (4-fold greater),whereas OPG was up-regulated to a similar extent. The RANKL/OPG ratio was increased only in DPcells, indicating an enhanced capacity for inducing bone resorption. The expression of pro-inflammatorycytokine interleukin-1β was also increased in DP, but not PDL cells. Collectively, the highresponsiveness of DP, but not PDL cells to the supragingival biofilm challenge could constitute aputative pathogenic mechanism for apical periodontitis, which may not crucial for chronic periodontitis.

1

1

Oral biofilm challenge regulates the RANKL-OPG system in

periodontal ligament and dental pulp cells

Georgios N. Belibasakis *, Andre Meier, Bernhard Guggenheim,

Nagihan Bostanci

Section of Oral Microbiology and General Immunology, Institute of Oral

Biology, Center for Dental Medicine, Faculty of Medicine, University of

Zürich, Switzerland

* Corresponding Author:

Dr. Georgios N. Belibasakis

Institute of Oral Biology

Center for Dental Medicine

University of Zürich

Plattenstrasse 11

8032 Zürich

Switzerland

e-mail: [email protected]

Tel: +41-44-6343329

mailto:[email protected]

2

2

Abstract

Inflammatory bone destruction triggered by oral bacteria is a hallmark of chronic and

apical periodontitis. Receptor activator of NF-?�B ligand (RANKL) activates bone

resporption, whereas osteoprotegerin (OPG) blocks its action. These are members of

the tumor necrosis factor ligand and receptor families, respectively. Although

individual oral pathogens are known to regulate RANKL and OPG expression in cells

of relevance to the respective diseases, such as periodontal ligament (PDL) and dental

pulp (DP) cells, the effect of polymicrobial oral biofilms is not known. This study

aimed to investigate the effect of the Zürich in vitro supragingival biofilm model on

RANKL and OPG gene expression, in human PDL and DP cell cultures, by

quantitative real-time polymerase chain reaction. RANKL expression was more

pronouncedly up-regulated in DP than PDL cells (4-fold greater), whereas OPG was

up-regulated to a similar extent. The RANKL/OPG ratio was increased only in DP

cells, indicating an enhanced capacity for inducing bone resorption. The expression of

pro-inflammatory cytokine interleukin-1ß� was also increased in DP, but not PDL

cells. Collectively, the high responsiveness of DP, but not PDL cells to the

supragingival biofilm challenge could constitute a putative pathogenic mechanism for

apical periodontitis, which may not crucial for chronic periodontitis.

Keywords: Oral biofilm, periodontal ligament, dental pulp, receptor activator of NF-

kß� ligand; osteoprotegerin, interleukin-1ß�

3

3

1. Introduction

Periodontal diseases are perhaps the most common chronic inflammatory diseases in

humans. Their main trait is the inflammatory destruction of the tooth-supporting

(periodontal) tissues, as a result of oral bacteria colonizing the tooth surfaces in the

form of polymicrobial biofilm communities [1]. Depending on the localization of the

biofilm in relation to the gingival margin, this can be either “supragingival” or

“subgingival”. Biofilms or their released products can cause an inflammatory

response by the periodontal tissues, aiming to eliminate this bacterial challenge [2].

However, an excessive inflammatory response would induce tissue damage, rather

than being protective [3]. Gingivitis is a clinical condition where the host

inflammatory response to the biofilm is restricted to the superficial gingival tissue.

However, when the inflammation expands into the deeper periodontal tissues, it will

develop into periodontitis, which is characterised by the destruction of the tooth-

surrounding alveolar bone and interconnecting periodontal ligament (PDL). If left

untreated, periodontitis will eventually lead to tooth loss.

Apical periodontitis results from the spread of the inflammatory material from

an infected dental pulp (DP) into the periradicular tissues. The etiological agent is

mixed bacterial species that reach the dental pulp as a result of carious lesions,

endodontic infection or trauma [4]. In the initial phase of apical periodontitis, the

inflammation is restricted to the apical PDL space without concomitant bone

resorption. However, the prolonged presence of bacterial challenge in the region

could eventually develop into chronic apical periodontitis. This condition is

associated with periapical bone resorption and potentially the formation of a cyst,

depending on the virulence of the invading bacterial species [5]. For the resolution of

this condition endodontic treatment is required.

4

4

Bone resorption in physiological and pathological conditions, such as

periodontitis, is regulated by the interplay of a system of two molecules belonging to

the tumor necrosis factor (TNF) ligand and receptor superfamilies. These are

respectively Receptor Activator of NF-?�B Ligand (RANKL) and osteoprotegerin

(OPG). RANKL is expressed as a membrane bound or secreted ligand by osteobasts,

fibroblasts and activated T- and B-cells. By activating its cognate RANK receptor on

osteoclast precursors (cells of the monocyte/macrophage lineage), it triggers their

fusion and differentiation into multi-nucleated osteoclasts, which will resorb bone [6].

RANKL can be cleaved and released from the cell surface by a metalloprotease

known as tumour necrosis factor-a converting enzyme (TACE)/ADAM17 [7]. The

soluble decoy receptor OPG acts as an inhibitor of RANKL by binding to it and thus

preventing the RANK-RANKL interaction and downstream events [8]. Changes in

the relative RANKL/OPG expression ratio are considered indicative of the capacity of

the cell or tissue to regulate bone resorption. An increased ratio can be indicative of

enhanced bone resorption in pathological inflammatory conditions, such as

periodontitis [9, 10]. The RANKL-OPG system is regulated by a number of local and

systemic factors, including the pro-inflammatory cytokine interleukin(IL)-1ß� [11].

Excessive production of IL-1ß� is considered detrimental for tissue destruction in

periodontal disease [12, 13] and apical periodontitis [5].

Both the PDL and DP contain mesenchymal cells that express RANKL and

OPG and can support osteoclastogenesis [14]. The balanced expression of these

factors is decisive for the regulation of bone resorption by DP cells [15] or PDL cells

[16]. Evidence demonstrates that RANKL is expressed in both PDL and DP tissue in

periapical lesions [17, 18] and during root resorption [19].

5

5

The current knowledge on the pathogenic mechanisms of periodontal diseases

comes mostly from studies using bacteria in planktonic state, due to the complication

and high technical demands in employing multi-species in vitro biofilm models.

Nevertheless, the use of oral biofilms rather than individual oral bacterial species

provides a more accurate view of the pathogenic events that take place in periodontal

or periapical diseases, such as bone resorption. The present study employs an in vitro

supragingival biofilm model, aiming to investigate its effects on RANKL, OPG,

TACE and IL-1ß� gene expression in human primary PDL and DP cell cultures.

2. Materials and Methods

2.1 In vitro biofilm model

The 6-species suprgagingival Zürich biofilm model [20] used in this study consisted

of Veillonella dispar ATCC 17748 (OMZ 493), Fusobacterium nucleatum KP-F8

(OMZ 598), Streptococcus oralis SK248 (OMZ 607), Actinomyces naeslundii (OMZ

745), Streptococcus mutans UAB159 (OMZ 918) and Candida albicans (OMZ 110).

Biofilms were grown in 24-well cell culture plates on sintered hydroxyapatite (HA)

discs, resembling natural tooth surfaces, and were pre-conditioned for pellicle

formation with foetal calf serum (FCS) at 1:1 dilution, for 4 h. To initiate biofilm

formation, HA discs were covered for 16.5 h with 1.6 ml of growth medium

consisting of 70% FCS (dilution 1:10), 30% FUM culture medium [21] containing

0.3% glucose, and 200 µl of a bacterial cell suspension containing equal volumes and

density from each strain. After 16.5 h of anaerobic incubation at 37°C, the inoculum

suspension was removed from the discs by 'dip-washing' using forceps, transferred

into wells with fresh medium (70% FCS dilution 1:10, and 30% FUM containing

0.15% glucose and 0.15% sucrose), and incubated for further 48 h in anaerobic

6

6

atmosphere. During this time-period, the discs were dip-washed 3x and given fresh

medium once daily. After a total 64.5 h of incubation, one biofilm-carrying HA disc

was placed per cell culture well, with the biofilm-coated surface facing towards the

cell monolayer. A plastic ring support ensured a distance of 1 mm between the

biofilm and the cell monolayer, allowing fluid flow. This form of biofilm challenge

was maintained in the cell culture for up to 24 h [22].

2.2 Cell cultures

Human PDL and DP tissue were obtained from a periodontally healthy young

individual who had their first premolar extracted in the course of orthodontic

treatment. The procedure was performed with the consent of the donor and the

approval of the Ethical Committee of the Center of Dental Medicine, University of

Zürich, abiding by the guidelines for studies with human cells of irreversibly

anonymized origin and not subject to any form of storage in a bio-bank. After

removal from the tooth, the tissues biopsies were dissected into smaller specimens

and maintained in culture. The cells were cultured in Minimum Essential Medium

(MEM) Alpha medium (Gibco), supplemented with 10 % heat-inactivated FCS

(Sigma), 50 U/ml penicillin, and 50 µ�g/ml streptomycin (Sigma). The explanted PDL

and DP cells were then passaged. Both cell types exhibited spindle-shaped fibroblast-

like morphology. Further characterisation was performed by analysing gene

expression levels of collagen type Ia�1, alkaline phosphatase and nestin in these cells

by quantitative real-time PCR. Both PDL and DP cells constitutively expressed these

markers. Collagen type Ia�1 and nestin were expressed 2.0-fold and 4.1-fold higher,

respectively, in PDL compared to DP cells. Alkaline phosphatase expression in DP

cells was only 0.2-fold higher than PDL cells (data not shown). For the experiments,

7

7

DP or PDL cells at passage 3 were seeded at concentration 20 x 103 cells/cm2 in

antibiotics-free and 5% FBS culture medium, and were allowed to attach for 24 h,

maintaining a sub-confluent status. Thereafter, the cells were co-cultured for up-to 24

h in the presence or absence of the supragingival biofilm, or the non-biofilm coated

hydroxyapatite, again in antibiotics-free and 5% FBS culture medium.

2.3 Cytotoxicity assay

The putative cytotoxic effects of the biofilm on PDL and dental pulp cell cultures

were evaluated by measurement of the extracellularly released cytosolic lactate

dehydrogenase (LDH), using the CytoTox96® Non-Radioactive Cytotoxicity Assay

(Promega). In brief, PDL or DP cell cultures were exposed to the established biofilm

for 6 h and 24 h. Cell culture supernatants were thereafter collected, and the cell

monolayer was lysed in equal volume of lysis buffer, provided in the kit. The

collected suspensions, either cell-culture supernatant or cell lysate, were centrifuged

at 1000 rpm for 5 min to pellet down any cell debris, and thereafter 50 µ�l/well of each

were transferred into an optically clear 96-well plate. Fifty µl of the reaction solution

was added to each well and incubated for 30 min in the dark. The reaction was then

stopped and the absorbance was measured at 490 nm, subtracting background values

from all samples.

2.4 RNA extraction and cDNA synthesis

Upon termination of the experiments, the culture media were discarded, and the cell

monolayers were washed twice in PBS before being lysed. The collected cell lysate

was homogenized with QIAshredder (QIAGEN), and total RNA was extracted by

using the RNeasy Mini Kit (QIAGEN), according to the manufacturer’s instructions.

8

8

The extracted RNA was finally eluted in 40 µ�l RNase free water and its concentration

was determined spectrophotometrically. One µ�g of total RNA was reverse transcribed

into single-stranded cDNA by using M-MLV Reverse Transcriptase (RNase H Minus,

Point Mutant), Oligo(dT)15 Primers, and PCR Nucleotide Mix according to the

manufacturer’s protocol (all from Promega), at 40°C for 60 min, and 70°C for 15 min.

The resulting cDNA was stored at -20°C until further use.

2.5 Quantitative real-time PCR

For RANKL, OPG, TACE and IL-1ß� gene expression analyses, quantitative real-time

PCR was performed in an ABI Prism 7000 Sequence Detection System and software

(Applied Biosystems). Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) and

RNA Polymerase II (RP2) were used as housekeeping genes of the samples. The

amplification reactions were performed with qPCR SYBR Master Mix (Applied

Biosystems). The standard PCR conditions were 10 min at 95ºC, followed 40 cycles

at 95ºC for 15 seconds, 60ºC for 1 min, and 72°C for 30 seconds. The expression

levels of RANKL, OPG, TACE and IL-1ß� transcripts in each sample were calculated

by the comparative Ct method (2-?�Ct formula) after normalization to the respective

average Ct value of the two housekeeping genes. The primer sequences were for

RANKL (NM003701) forward: GTCTGCAGCGTCGCCCTGTT and reverse:

ACCATGAGCCATCCACCATCGC, for OPG (NM002546) forward:

CGCCTCCAAGCCCCTGAGGT and reverse: CAAGGGGCGCACACGGTCTT, for

TACE (NM003183) forward: GGCGTGTCCTACTGCACAGGT and reverse:

GGGCACACAGCGGCCAGAAA, for IL-1ß� (NM000576) forward:

ACGCTCCGGGACTCACAGCA and reverse: TGAGGCCCAAGGCCACAGGT,

for collagen type Ia�1 (NM000088) forward: AAGATGGACTCAACGGTCTC and

9

9

reverse: CAGGAAGCTGAAGTCGAAAC, for alkaline phosphatase (BC136325)

forward: ATGAAGGAAAAGCCAAGCAG and reverse:

ATGGAGACATTCTCTCGTTC, for nestin: (NM006617) forward:

CCTGCAAAAGGAGAATCAAG and reverse: GTTCTCAATGTCTCTTGGTC, for

GAPDH (NM002046) forward: CAGCCTCCCGCTTCGCTCTC and reverse:

CCAGGCGCCCAATACGACCA, and for RP2 (NM000937) forward:

CCCGCTGCGCACCATCAAGA and reverse: CCCCTGCCTCGGGTCCATCA.

2.6 Statistical analysis

The Student’s t-test for unpaired values was used to compare the differences between

control and test groups, and data were considered significant at P

10

10

On the next step, the effect of biofilm challenge on RANKL gene expression by the

cells was investigated. After 3 h, RANKL expression was not affected in PDL cells,

but after 6 h this was significantly increased by 2.3-fold, compared to the control (Fig.

1A). However, in DP cells RANKL expression was already increased by 8.0-fold and

12.5-fold at 3 h and 6 h, respectively (Fig. 1B).

3.3 Effects of the biofilm on OPG gene expression

The expression of OPG in response to the biofilm was also investigated in this

experimental system. There were no changes after 3 h of challenge, but after 6 h this

was increased by 1.7-fold in PDL cells (Fig. 2A) and 1.9-fold in DP cells (Fig. 2B).

3.4 Regulation of the RANKL/OPG ratio by the biofilm

These regulations in RANKL and OPG expression resulted in changes in the relative

RANKL/OPG expression ratio, which is a measure indicative of the capacity of the

cells to induce osteoclastogenesis and bone resorption. Compared to the control, this

ratio was increased after 6 h of biofilm challenge by approximately 1.3-fold in PDL

cells (Fig. 3A) and 7.0-fold in DP cells (Fig. 3B). This indicates that the supragingival

biofilm has the capacity to regulate the RANKL-OPG system favourably for bone

resorption in DP cells, but not in PDL cells.

3.5 Effects of the biofilm on TACE gene expression

The gene expression of TACE was also investigated in response to the supragingival

biofilm challenge. The results indicate that there were no changes in TACE

expression after 3 h of challenge, but after 6 h this was increased by approximately

1.4-fold in PDL cells (Fig. 4A), and 1.6-fold in DP cells (Fig. 4B).

11

11

3.6 Effects of the biofilm on IL-1β gene expression

Finally, the gene expression of IL-1ß� was also investigated in response to the

supragingival biofilm challenge. The results indicate that there were no significant

changes in IL-1ß� expression after 3 h of challenge. After 6 h, IL-1ß� expression was

increased by approximately 1.5-fold in PDL cells (Fig. 5A), and 1.9-fold in DP pulp

cells (Fig. 5B), but only the latter proved to be statistically significant.

4. Discussion

This is the first to study to employ an in vitro biofilm to investigate the regulation of

the RANKL-OPG system. Most host-bacteria interactions models have so far

employed single bacterial species to address such questions. The obvious advantage

of the biofilm approach is that several bacterial species are represented in a

conformation that resembles their natural state, when attached on the tooth surface.

An in vitro subgingival oral biofilm model has so far been used to study apoptotic and

pro-inflammatory cytokine stimulating effects in gingival epithelial cells [22].

The present findings demonstrate that the supragingival biofilm challenge

increases both RANKL and OPG gene expressions in both PDL cells and DP cells.

None of the six bacterial species present in this in vitro biofilm have been previously

studied as for their capacity to regulate the RANKL-OPG system in host cells.

Putative periodontal pathogens, such as Aggregatibacter actinomycetemcomitans and

Porphyromonas gingivalis, have been studied individually and have been shown to

up-regulate RANKL expression in PDL cells [23, 24], but DP cells have not been

studied in this respect. In the present experimental system, although the magnitude of

OPG induction was similar between the two cell types, there were quantitative

12

12

differences in RANKL expression. In particular, the supragingival biofilm caused 4-

fold greater RANKL up-regulation in DP cells compared to PDL cells, indicating that

the former cell type is more responsive to this challenge. Such differences have been

previously considered, for instance in the case of PDL cells and gingival fibroblasts

[23, 24], and could indicative of distinct roles of the cells in the pathogenesis of

periodontitis. This may reflect the nature of the respective diseases, in which these

cells are involved. To this extent, RANKL in periapical lesions has been particularly

associated with fibroblastic cells, rather than T-cells [25], as opposed to periodontitis,

where cells of the immune system are considered a major source of RANKL [9, 26,

27]. When the relative RANKL/OPG ratio was calculated, this was significantly

increased in DP cells, compared to PDL cells, indicating a higher capacity for

inducing bone resorption by the former cells. PDL cells could be better adapted to

tackle bacterial challenges, as they are frequently exposed to their products within the

continuously colonized periodontal environment. On the contrary, DP cells are highly

protected within the specialized niche of the pulp cavity and thus less adapted to

bacterial challenges, as they are not directly exposed to them. A potential bacterial

invasion of this tissue (i.e. through a dental caries lesion) may therefore cause a more

detrimental response by DP cells.

This study has also investigated the effects of the biofilm challenge on TACE

expression. TACE is a global “sheddase”, with the capacity to enzymatically cleave

and release the ectodomain of several cell-membrane bound cytokines [28], exhibiting

high specificity for RANKL [7]. Hence, TACE can mobilize cytokines into the local

microenvironment, thus amplifying their potential inflammatory effects. In the present

experimental model, TACE expression was moderately (approximately 1.5-fold) up-

regulated in both DP and PDL cells in response to the biofilm challenge. In a previous

13

13

study, the putative periodontal pathogen P. gingivalis was shown to more strongly

induce TACE expression in a T-cell line, after 6 h of challenge [29]. However, it is

difficult at this stage to make safe interpretations on the potential of supragingival and

subgingival species for TACE induction, as there may also be differential responses

depending on cell types. In fact, T-cells are shown to be the major TACE-producing

cell population in periodontitis [30].

Interleukin-1ß� is a major pro-inflammatory cytokine with a primary role in the

pathogenesis of periodontal disease, and particularly in the induction of bone

resorption [31]. Putative periodontal pathogens have individually the capacity to

induce the production of this cytokine [32-35]. In the present study, the biofilm

challenge caused a significant up-regulation of IL-1ß� expression in DP cells, but not

in PDL cells. This may indicate that supragingival biofilms induce stronger pro-

inflammatory responses in DP than in PDL, and may therefore be more detrimental

for the development of pulpitis or periapical inflammation, rather than chronic

periodontitis. In contrast, it has recently been shown that subgingival biofilm

challenge induced IL-1ß� production in gingival epithelial cells, which may be of

direct relevance to the pathogenesis of periodontitis [22].

Collectively, the major finding of this study is the demonstration that

supragingival biofilm challenge enhances the RANKL/OPG ratio and IL-1ß�

expression in DP, but not in PDL cells. The high responsiveness of DP cells denotes

an enhanced capacity of these cells for inducing bone resorption, which could indicate

a putative pathogenic role for apical periodontitis. On the contrary, the low

responsiveness of PDL cells may reflect their potential adaptation to the bacterial

species represented in this supragingival biofilm, but also corroborates the low

virulence nature of these species for the pathogenesis of initial chronic periodontitis.

14

14

5. Acknowledgements

The authors would like to thank Mrs Verena Osterwalder and Mrs Elpida Plattner for

their excellent technical assistance. This study was supported by the authors’ Institute.

References

[1] P.D. Marsh, Dental plaque: biological significance of a biofilm and community

life-style, J Clin Periodontol 32 Suppl 6 (2005) 7-15.

[2] Z. Feng, A. Weinberg, Role of bacteria in health and disease of periodontal

tissues, Periodontol 2000 40 (2006) 50-76.

[3] H.A. Schenkein, Host responses in maintaining periodontal health and

determining periodontal disease, Periodontol 2000 40 (2006) 77-93.

[4] G. Sundqvist, Associations between microbial species in dental root canal

infections, Oral Microbiol Immunol 7 (1992) 257-262.

[5] P.N. Nair, Pathogenesis of apical periodontitis and the causes of endodontic

failures, Crit Rev Oral Biol Med 15 (2004) 348-381.

[6] D.L. Lacey, E. Timms, H.L. Tan, M.J. Kelley, C.R. Dunstan, T. Burgess, R.

Elliott, A. Colombero, G. Elliott, S. Scully, H. Hsu, J. Sullivan, N. Hawkins, E. Davy,

C. Capparelli, A. Eli, Y.X. Qian, S. Kaufman, I. Sarosi, V. Shalhoub, G. Senaldi, J.

Guo, J. Delaney, W.J. Boyle, Osteoprotegerin ligand is a cytokine that regulates

osteoclast differentiation and activation, Cell 93 (1998) 165-176.

[7] L. Lum, B.R. Wong, R. Josien, J.D. Becherer, H. Erdjument-Bromage, J.

Schlondorff, P. Tempst, Y. Choi, C.P. Blobel, Evidence for a role of a tumor necrosis

factor-alpha (TNF-alpha)-converting enzyme-like protease in shedding of TRANCE,

15

15

a TNF family member involved in osteoclastogenesis and dendritic cell survival, J

Biol Chem 274 (1999) 13613-13618.

[8] W.S. Simonet, D.L. Lacey, C.R. Dunstan, M. Kelley, M.S. Chang, R. Luthy, H.Q.

Nguyen, S. Wooden, L. Bennett, T. Boone, G. Shimamoto, M. DeRose, R. Elliott, A.

Colombero, H.L. Tan, G. Trail, J. Sullivan, E. Davy, N. Bucay, L. Renshaw-Gegg,

T.M. Hughes, D. Hill, W. Pattison, P. Campbell, S. Sander, G. Van, J. Tarpley, P.

Derby, R. Lee, W.J. Boyle, Osteoprotegerin: a novel secreted protein involved in the

regulation of bone density, Cell 89 (1997) 309-319.

[9] N. Bostanci, T. Ilgenli, G. Emingil, B. Afacan, B. Han, H. Toz, G. Atilla, F.J.

Hughes, G.N. Belibasakis, Gingival crevicular fluid levels of RANKL and OPG in

periodontal diseases: implications of their relative ratio, J Clin Periodontol 34 (2007)

370-376.

[10] N. Bostanci, T. Ilgenli, G. Emingil, B. Afacan, B. Han, H. Toz, A. Berdeli, G.

Atilla, I.J. McKay, F.J. Hughes, G.N. Belibasakis, Differential expression of receptor

activator of nuclear factor-kappaB ligand and osteoprotegerin mRNA in periodontal

diseases, J Periodontal Res 42 (2007) 287-293.

[11] U.H. Lerner, Inflammation-induced bone remodeling in periodontal disease and

the influence of post-menopausal osteoporosis, J Dent Res 85 (2006) 596-607.

[12] A.J. Delima, S. Karatzas, S. Amar, D.T. Graves, Inflammation and tissue loss

caused by periodontal pathogens is reduced by interleukin-1 antagonists, J Infect Dis

186 (2002) 511-516.

[13] D.T. Graves, D. Cochran, The contribution of interleukin-1 and tumor necrosis

factor to periodontal tissue destruction, J Periodontol 74 (2003) 391-401.

16

16

[14] M. Uchiyama, Y. Nakamichi, M. Nakamura, S. Kinugawa, H. Yamada, N.

Udagawa, H. Miyazawa, Dental pulp and periodontal ligament cells support

osteoclastic differentiation, J Dent Res 88 (2009) 609-614.

[15] C.S. Rani, M. MacDougall, Dental cells express factors that regulate bone

resorption, Mol Cell Biol Res Commun 3 (2000) 145-152.

[16] H. Kanzaki, M. Chiba, Y. Shimizu, H. Mitani, Dual regulation of osteoclast

differentiation by periodontal ligament cells through RANKL stimulation and OPG

inhibition, J Dent Res 80 (2001) 887-891.

[17] X. Zhang, B. Peng, Immunolocalization of receptor activator of NF kappa B

ligand in rat periapical lesions, J Endod 31 (2005) 574-577.

[18] R. Menezes, T.P. Garlet, A. Letra, C.M. Bramante, A.P. Campanelli, C. Figueira

Rde, M.C. Sogayar, J.M. Granjeiro, G.P. Garlet, Differential patterns of receptor

activator of nuclear factor kappa B ligand/osteoprotegerin expression in human

periapical granulomas: possible association with progressive or stable nature of the

lesions, J Endod 34 (2008) 932-938.

[19] S. Lossdorfer, W. Gotz, A. Jager, Immunohistochemical localization of receptor

activator of nuclear factor kappaB (RANK) and its ligand (RANKL) in human

deciduous teeth, Calcif Tissue Int 71 (2002) 45-52.

[20] S. Shapiro, E. Giertsen, B. Guggenheim, An in vitro oral biofilm model for

comparing the efficacy of antimicrobial mouthrinses, Caries Res 36 (2002) 93-100.

[21] R. Gmur, B. Guggenheim, Antigenic heterogeneity of Bacteroides intermedius as

recognized by monoclonal antibodies, Infect Immun 42 (1983) 459-470.

[22] B. Guggenheim, R. Gmur, J.C. Galicia, P.G. Stathopoulou, M.R. Benakanakere,

A. Meier, T. Thurnheer, D.F. Kinane, In vitro modeling of host-parasite interactions:

17

17

the 'subgingival' biofilm challenge of primary human epithelial cells, BMC Microbiol

9 (2009) 280.

[23] G.N. Belibasakis, N. Bostanci, A. Hashim, A. Johansson, J. Aduse-Opoku, M.A.

Curtis, F.J. Hughes, Regulation of RANKL and OPG gene expression in human

gingival fibroblasts and periodontal ligament cells by Porphyromonas gingivalis: a

putative role of the Arg-gingipains, Microb Pathog 43 (2007) 46-53.

[24] G.N. Belibasakis, A. Johansson, Y. Wang, C. Chen, S. Kalfas, U.H. Lerner, The

cytolethal distending toxin induces receptor activator of NF-kappaB ligand expression

in human gingival fibroblasts and periodontal ligament cells, Infect Immun 73 (2005)

342-351.

[25] N. Kawashima, N. Suzuki, G. Yang, C. Ohi, S. Okuhara, H. Nakano-Kawanishi,

H. Suda, Kinetics of RANKL, RANK and OPG expressions in experimentally

induced rat periapical lesions, Oral Surg Oral Med Oral Pathol Oral Radiol Endod 103

(2007) 707-711.

[26] D. Liu, J.K. Xu, L. Figliomeni, L. Huang, N.J. Pavlos, M. Rogers, A. Tan, P.

Price, M.H. Zheng, Expression of RANKL and OPG mRNA in periodontal disease:

possible involvement in bone destruction, Int J Mol Med 11 (2003) 17-21.

[27] T. Kawai, T. Matsuyama, Y. Hosokawa, S. Makihira, M. Seki, N.Y. Karimbux,

R.B. Goncalves, P. Valverde, S. Dibart, Y.P. Li, L.A. Miranda, C.W. Ernst, Y. Izumi,

M.A. Taubman, B and T lymphocytes are the primary sources of RANKL in the bone

resorptive lesion of periodontal disease, Am J Pathol 169 (2006) 987-998.

[28] R.A. Black, C.T. Rauch, C.J. Kozlosky, J.J. Peschon, J.L. Slack, M.F. Wolfson,

B.J. Castner, K.L. Stocking, P. Reddy, S. Srinivasan, N. Nelson, N. Boiani, K.A.

Schooley, M. Gerhart, R. Davis, J.N. Fitzner, R.S. Johnson, R.J. Paxton, C.J. March,

18

18

D.P. Cerretti, A metalloproteinase disintegrin that releases tumour-necrosis factor-

alpha from cells, Nature 385 (1997) 729-733.

[29] N. Bostanci, D. Reddi, M. Rangarajan, M.A. Curtis, G.N. Belibasakis,

Porphyromonas gingivalis stimulates TACE production by T cells, Oral Microbiol

Immunol 24 (2009) 146-151.

[30] N. Bostanci, G. Emingil, B. Afacan, B. Han, T. Ilgenli, G. Atilla, F.J. Hughes,

G.N. Belibasakis, Tumor necrosis factor-alpha-converting enzyme (TACE) levels in

periodontal diseases, J Dent Res 87 (2008) 273-277.

[31] H. Okada, S. Murakami, Cytokine expression in periodontal health and disease,

Crit Rev Oral Biol Med 9 (1998) 248-266.

[32] M. Hamedi, G.N. Belibasakis, A.T. Cruchley, M. Rangarajan, M.A. Curtis, N.

Bostanci, Porphyromonas gingivalis culture supernatants differentially regulate

interleukin-1beta and interleukin-18 in human monocytic cells, Cytokine 45 (2009)

99-104.

[33] N. Bostanci, R.P. Allaker, G.N. Belibasakis, M. Rangarajan, M.A. Curtis, F.J.

Hughes, I.J. McKay, Porphyromonas gingivalis antagonises Campylobacter rectus

induced cytokine production by human monocytes, Cytokine 39 (2007) 147-156.

[34] P. Kelk, R. Claesson, C. Chen, A. Sjostedt, A. Johansson, IL-1beta secretion

induced by Aggregatibacter (Actinobacillus) actinomycetemcomitans is mainly

caused by the leukotoxin, Int J Med Microbiol 298 (2008) 529-541.

[35] P. Kelk, R. Claesson, L. Hanstrom, U.H. Lerner, S. Kalfas, A. Johansson,

Abundant secretion of bioactive interleukin-1beta by human macrophages induced by

Actinobacillus actinomycetemcomitans leukotoxin, Infect Immun 73 (2005) 453-458.

Tables

19

19

Table 1. Cytotoxic effects of supragingival biofilm on PDL and dental pulp cells.

PDL cells Control Biofilm Ring only

6 hours 13.5 ± 0.5 14.6 ± 1.3 16.1 ± 2.7

24 hours 17.6 ± 1.3 42.6 ± 7.0 * 19.8 ± 3.0

Dental pulp cells Control Biofilm Ring only

6 hours 18.3 ± 6.5 21.5 ± 5.3 20.4 ± 4.6

24 hours 22.2 ± 2.3 41.1 ± 9.5 * 20.2 ± 1.4

PDL or DP cells were challenged with the biofilm for 6 and 24 h. Extracellularly

released LDH, representing the relative number of dead cells, is expressed as

percentage of total LDH (extracellularly released + intracellular content) in each

group. Numbers represent mean percentage values ± SD of three independent cell

cultures in each group. The “Ring only” group represents cell cultures in presence of

ring and hydroxyapatatite disc alone (without biofilm). The asterisk represents

statistically significant difference compared to the respective control group.

Figure Legends

Figure 1

Regulation of RANKL expression in PDL and DP cells. PDL cell (A) or DP cell (B)

cultures were challenged with the supragingival biofilm for 3 h and 6 h. The gene

expression levels of RANKL were measured by qPCR analysis, and normalized

against the expression levels of the GAPDH and RP2 (housekeeping genes). The

results are expressed as the 2-?�CT formula. Bars represent mean values ± SEM from

20

20

three independent cell cultures in each group. The asterisk represents statistically

significant difference compared to the respective control group.

Figure 2

Regulation of OPG expression in PDL and DP cells. PDL cell (A) or DP cell (B)


expression levels of OPG were measured by qPCR analysis, and normalized against

the expression levels of the GAPDH and RP2 (housekeeping genes). The results are

expressed as the 2-?�CT formula. Bars represent mean values ± SEM from three

independent cell cultures in each group. The asterisk represents statistically


Figure 3

Regulation of the RANKL/OPG expression ratio in PDL and DP cells. PDL cell (A)

or DP cell (B) cultures were challenged with the supragingival biofilm for 3 h and 6 h.

The relative RANKL/OPG gene expression ratio was calculated based on the RANKL

and OPG gene expression values measured by qPCR. Bars represent mean values ±

SEM from three independent cell cultures in each group. The asterisk represents

statistically significant difference compared to the respective control group.

Figure 4

Regulation of TACE expression in PDL and DP cells. PDL cell (A) or DP cell (B)


expression levels of TACE were measured by qPCR analysis, and normalized against


21

21




Figure 5

Regulation of IL-1β expression in PDL and DP cells. PDL cell (A) or DP cell (B)


expression levels of IL-1ß� were measured by qPCR analysis, and normalized against





university of zurich zurich open ......the cell or tissue to regulate bone resorption. an increased...

Documents