university of groningen phenylketonuria in mice and men ... · phenylketonuria in mice and men...
TRANSCRIPT
![Page 1: University of Groningen Phenylketonuria in mice and men ... · Phenylketonuria in mice and men Proefschrift ter verkrijging van de graad van doctor aan de Rijksuniversiteit Groningen](https://reader034.vdocuments.site/reader034/viewer/2022052611/5f03c1e37e708231d40a9ed0/html5/thumbnails/1.jpg)
University of Groningen
Phenylketonuria in mice and menBruinenberg, Vibeke Marijn
IMPORTANT NOTE: You are advised to consult the publisher's version (publisher's PDF) if you wish to cite fromit. Please check the document version below.
Document VersionPublisher's PDF, also known as Version of record
Publication date:2017
Link to publication in University of Groningen/UMCG research database
Citation for published version (APA):Bruinenberg, V. M. (2017). Phenylketonuria in mice and men. [Groningen]: Rijksuniversiteit Groningen.
CopyrightOther than for strictly personal use, it is not permitted to download or to forward/distribute the text or part of it without the consent of theauthor(s) and/or copyright holder(s), unless the work is under an open content license (like Creative Commons).
Take-down policyIf you believe that this document breaches copyright please contact us providing details, and we will remove access to the work immediatelyand investigate your claim.
Downloaded from the University of Groningen/UMCG research database (Pure): http://www.rug.nl/research/portal. For technical reasons thenumber of authors shown on this cover page is limited to 10 maximum.
Download date: 14-06-2020
![Page 2: University of Groningen Phenylketonuria in mice and men ... · Phenylketonuria in mice and men Proefschrift ter verkrijging van de graad van doctor aan de Rijksuniversiteit Groningen](https://reader034.vdocuments.site/reader034/viewer/2022052611/5f03c1e37e708231d40a9ed0/html5/thumbnails/2.jpg)
512536-L-bw-Bruinenberg512536-L-bw-Bruinenberg512536-L-bw-Bruinenberg512536-L-bw-BruinenbergProcessed on: 15-8-2017Processed on: 15-8-2017Processed on: 15-8-2017Processed on: 15-8-2017 PDF page: 1PDF page: 1PDF page: 1PDF page: 1
Phenylketonuria in
mice and men
Vibeke Marijn Bruinenberg
![Page 3: University of Groningen Phenylketonuria in mice and men ... · Phenylketonuria in mice and men Proefschrift ter verkrijging van de graad van doctor aan de Rijksuniversiteit Groningen](https://reader034.vdocuments.site/reader034/viewer/2022052611/5f03c1e37e708231d40a9ed0/html5/thumbnails/3.jpg)
512536-L-bw-Bruinenberg512536-L-bw-Bruinenberg512536-L-bw-Bruinenberg512536-L-bw-BruinenbergProcessed on: 15-8-2017Processed on: 15-8-2017Processed on: 15-8-2017Processed on: 15-8-2017 PDF page: 2PDF page: 2PDF page: 2PDF page: 2
The studies described in this thesis were carried out at the Groningen Institute for Evolutionary Life
Sciences (GELIFES), University of Groningen, Groningen and the at the University Medical Center
Groningen, Beatrix Children’s Hospital, Groningen, The Netherlands. This research has been supported
by a grant from Nutricia Research.
Layout: Alex Wesselink (Persoonlijk Proefschrift.nl)
Cover design: Vibeke Bruinenberg
Printed by: Ipskamp Printing (www.proefschriften.net)
ISBN: 978-94-034-0072-3
![Page 4: University of Groningen Phenylketonuria in mice and men ... · Phenylketonuria in mice and men Proefschrift ter verkrijging van de graad van doctor aan de Rijksuniversiteit Groningen](https://reader034.vdocuments.site/reader034/viewer/2022052611/5f03c1e37e708231d40a9ed0/html5/thumbnails/4.jpg)
512536-L-bw-Bruinenberg512536-L-bw-Bruinenberg512536-L-bw-Bruinenberg512536-L-bw-BruinenbergProcessed on: 15-8-2017Processed on: 15-8-2017Processed on: 15-8-2017Processed on: 15-8-2017 PDF page: 3PDF page: 3PDF page: 3PDF page: 3
Phenylketonuria in
mice and men
Proefschrift
ter verkrijging van de graad van doctor aan de
Rijksuniversiteit Groningen
op gezag van de
rector magnificus prof. dr. E. Sterken
en volgens besluit van het College voor Promoties.
De openbare verdediging zal plaatsvinden op
vrijdag 22 september 2017 om 14:30 uur
door
Vibeke Marijn Bruinenberg
geboren op 19 juni 1988
te Groningen
![Page 5: University of Groningen Phenylketonuria in mice and men ... · Phenylketonuria in mice and men Proefschrift ter verkrijging van de graad van doctor aan de Rijksuniversiteit Groningen](https://reader034.vdocuments.site/reader034/viewer/2022052611/5f03c1e37e708231d40a9ed0/html5/thumbnails/5.jpg)
512536-L-bw-Bruinenberg512536-L-bw-Bruinenberg512536-L-bw-Bruinenberg512536-L-bw-BruinenbergProcessed on: 15-8-2017Processed on: 15-8-2017Processed on: 15-8-2017Processed on: 15-8-2017 PDF page: 4PDF page: 4PDF page: 4PDF page: 4
PromotoresProf. dr. E.A. van der ZeeProf. dr. F.J. van Spronsen
Beoordelingscommissie
Prof. dr. C.O. Harding
Prof. dr. S. Spijker
Prof. dr. G.J. van Dijk
![Page 6: University of Groningen Phenylketonuria in mice and men ... · Phenylketonuria in mice and men Proefschrift ter verkrijging van de graad van doctor aan de Rijksuniversiteit Groningen](https://reader034.vdocuments.site/reader034/viewer/2022052611/5f03c1e37e708231d40a9ed0/html5/thumbnails/6.jpg)
512536-L-bw-Bruinenberg512536-L-bw-Bruinenberg512536-L-bw-Bruinenberg512536-L-bw-BruinenbergProcessed on: 15-8-2017Processed on: 15-8-2017Processed on: 15-8-2017Processed on: 15-8-2017 PDF page: 5PDF page: 5PDF page: 5PDF page: 5
![Page 7: University of Groningen Phenylketonuria in mice and men ... · Phenylketonuria in mice and men Proefschrift ter verkrijging van de graad van doctor aan de Rijksuniversiteit Groningen](https://reader034.vdocuments.site/reader034/viewer/2022052611/5f03c1e37e708231d40a9ed0/html5/thumbnails/7.jpg)
512536-L-bw-Bruinenberg512536-L-bw-Bruinenberg512536-L-bw-Bruinenberg512536-L-bw-BruinenbergProcessed on: 15-8-2017Processed on: 15-8-2017Processed on: 15-8-2017Processed on: 15-8-2017 PDF page: 6PDF page: 6PDF page: 6PDF page: 6
![Page 8: University of Groningen Phenylketonuria in mice and men ... · Phenylketonuria in mice and men Proefschrift ter verkrijging van de graad van doctor aan de Rijksuniversiteit Groningen](https://reader034.vdocuments.site/reader034/viewer/2022052611/5f03c1e37e708231d40a9ed0/html5/thumbnails/8.jpg)
512536-L-bw-Bruinenberg512536-L-bw-Bruinenberg512536-L-bw-Bruinenberg512536-L-bw-BruinenbergProcessed on: 15-8-2017Processed on: 15-8-2017Processed on: 15-8-2017Processed on: 15-8-2017 PDF page: 7PDF page: 7PDF page: 7PDF page: 7
TABLE OF CONTENTS
Chapter 1 General introduction 9
Chapter 2 The Behavioral Consequence of Phenylketonuria in Mice Depends on the Genetic Background
23
Chapter 3 The behavioral phenotype of female phenylketonuria mice differs partially from male phenylketonuria mice
45
Chapter 4 Sleep disturbances in Phenylketonuria: an explorative study in men and mice
61
Chapter 5 A novel treatment strategy for phenylketonuria: exploring the possibilities of nutrients to improve brain function
77
Chapter 6 A specific nutrient combination attenuates the reduced expression of PSD-95 in the proximal dendrites of hippocampal cell body layers in a mouse model of phenylketonuria
99
Chapter 7 Long-term treatment with a specific nutrient combination in phenylketonuria mice improves recognition memory
113
Chapter 8 Large neutral amino acid supplementation exerts its effect through three synergistic mechanisms: proof of principle in phenylketonuria mice
133
Chapter 9 Therapeutic brain modulation with targeted Large Neutral Amino Acid supplements in the Pah-enu2 phenylketonuria mouse model
159
Chapter 10 Summary and general conclusion 179
Appendix I Nederlandse samenvatting 203
Appendix II Dankwoord 213
Appendix III Curriculum Vitae 219
Appendix IV Publications 223
![Page 9: University of Groningen Phenylketonuria in mice and men ... · Phenylketonuria in mice and men Proefschrift ter verkrijging van de graad van doctor aan de Rijksuniversiteit Groningen](https://reader034.vdocuments.site/reader034/viewer/2022052611/5f03c1e37e708231d40a9ed0/html5/thumbnails/9.jpg)
512536-L-bw-Bruinenberg512536-L-bw-Bruinenberg512536-L-bw-Bruinenberg512536-L-bw-BruinenbergProcessed on: 15-8-2017Processed on: 15-8-2017Processed on: 15-8-2017Processed on: 15-8-2017 PDF page: 8PDF page: 8PDF page: 8PDF page: 8
![Page 10: University of Groningen Phenylketonuria in mice and men ... · Phenylketonuria in mice and men Proefschrift ter verkrijging van de graad van doctor aan de Rijksuniversiteit Groningen](https://reader034.vdocuments.site/reader034/viewer/2022052611/5f03c1e37e708231d40a9ed0/html5/thumbnails/10.jpg)
512536-L-bw-Bruinenberg512536-L-bw-Bruinenberg512536-L-bw-Bruinenberg512536-L-bw-BruinenbergProcessed on: 15-8-2017Processed on: 15-8-2017Processed on: 15-8-2017Processed on: 15-8-2017 PDF page: 9PDF page: 9PDF page: 9PDF page: 9
CHAPTER 1General introduction
![Page 11: University of Groningen Phenylketonuria in mice and men ... · Phenylketonuria in mice and men Proefschrift ter verkrijging van de graad van doctor aan de Rijksuniversiteit Groningen](https://reader034.vdocuments.site/reader034/viewer/2022052611/5f03c1e37e708231d40a9ed0/html5/thumbnails/11.jpg)
512536-L-bw-Bruinenberg512536-L-bw-Bruinenberg512536-L-bw-Bruinenberg512536-L-bw-BruinenbergProcessed on: 15-8-2017Processed on: 15-8-2017Processed on: 15-8-2017Processed on: 15-8-2017 PDF page: 10PDF page: 10PDF page: 10PDF page: 10
10
Chapter 1
1. PHENYLKETONURIA
The heritable metabolic disorder phenylketonuria (PKU) is caused by an inborn error in
phenylalanine (Phe) metabolism. This inborn error causes a dysfunction in the hepatic
enzyme phenylalanine hydroxylase (PAH) affecting the hydroxylation of Phe to tyrosine. As
a consequence, Phe obtained from dietary protein intake is not converted, resulting in a vast
rise of Phe in blood and brain. Furthermore, as the primary catabolic pathway of Phe relies on
functional PAH, an alternative pathway is initiated which causes an increase in metabolites
of Phe (phenylethylamine, phenylpyruvate, phenylacetate, 2-hydroxyphenylacetate, and
phenyllactate). The distinct odor of one of these metabolites (phenyllactate) in the urine of
patients was key in the first discovery of the disease in 19341. The name was later changed
to phenylketonuria considering the presence of these phenylketones in urine2. The first
descriptions of a PKU child was by a mother describing her normally developing child whom
at one point did not develop anymore (The Child Who Never Grew by Pearl Buck, 19503).
In the end, the buildup of Phe in the blood and brain affected the developing brain causing
mental disablement, problems with movement, and seizures4.
2. THE AFFECTED PHENYLKETONURIC BRAIN.
Although the conversion of Phe is disrupted in the liver, the most dramatic consequences of
raised Phe concentrations are found in the brain. Within the brain, these high concentrations
of Phe can have detrimental effects via direct and indirect mechanisms (Figure 1). The first
manner in which Phe can have an impairing effect is already with the entry of Phe in the brain
(Figure1 (1)). The LAT1 transporter responsible for this process is the predominant transport
system of large neutral amino acids (LNAA’s) over the blood-brain barrier5. As the affinity
of Phe is very high to this transporter, high concentrations of Phe can outcompete other
LNAA’s in transport, causing reduced concentrations of non-Phe LNAA’s in brain6,7(Figure 1
(2)). Among these LNAA’s are tyrosine and tryptophan, precursors of the neurotransmitters
dopamine and serotonin. Together with the poor intrinsic capacity to produce tyrosine,
this can result in reduced concentrations of these precursors in the brain. In turn, this can
result in reduced concentrations of the above mentioned neurotransmitters8 (Figure 1 (4)).
Furthermore, high levels of Phe can inhibit the enzymatic activity of tyrosine hydroxylase and
tryptophan hydroxylase, important in the conversion of these precursors to their subsequent
neurotransmitters9 (Figure 1 (3)). Not only neurotransmitter metabolism is affected by high
Phe. Increased Phe concentrations and its metabolites can increase the generation of reactive
species and inhibit antioxidant enzymes10,11 (Figure 1 (5)(6)). An imbalance between this
production and/or removal of reactive species is defined as oxidative stress that is frequently
found in PKU models and PKU patients (reviewed by Ribas12). Oxidative stress can damage
proteins, lipids, carbohydrates, and DNA. This can result in cell damage or death, f.e. in
neurons. Indeed, reduced functioning of neurons or synapses are found in PKU models and
![Page 12: University of Groningen Phenylketonuria in mice and men ... · Phenylketonuria in mice and men Proefschrift ter verkrijging van de graad van doctor aan de Rijksuniversiteit Groningen](https://reader034.vdocuments.site/reader034/viewer/2022052611/5f03c1e37e708231d40a9ed0/html5/thumbnails/12.jpg)
512536-L-bw-Bruinenberg512536-L-bw-Bruinenberg512536-L-bw-Bruinenberg512536-L-bw-BruinenbergProcessed on: 15-8-2017Processed on: 15-8-2017Processed on: 15-8-2017Processed on: 15-8-2017 PDF page: 11PDF page: 11PDF page: 11PDF page: 11
1
11
Chapter 1
post-mortem tissue of PKU patients13–22 (Figure 1 (8)). However, not only oxidative stress
can have these neurotoxic effects. In 2012, Adler-abramovich and colleagues showed that
high concentrations of Phe can result in the assembly of toxic fibrils with an amyloid-like
structure23 (Figure 1 (7)). When added to cell culture, these structures have clear neurotoxic
effects. Finally, myelin alternations are consistently reported in PKU (found in in vitro and
in vivo models, and in untreated and treated PKU patients24–32 (Figure 1 (9)). However, the
exact mechanism in which Phe affects myelin is not clear yet. A possible mechanism could
be the effect of Phe on cholesterol and protein synthesis, processes key in the production and
maintenance of myelin sheaths33–37.
The increased concentrations of Phe have an extensive effect on the brain, affecting
neurtransmitter metabolism, oxidative stress, synaptic functioning, and myelin. These are
domains that are highly interrelated and are at the basis of cognitive functioning.
Figure 1 The affected phenylketonuric brain. (1) The LAT1 transporter has a high affinity to
phenylalanine. The increased Phe concentrations compared to other non-Phe large neutral amino acids,
such as tryptophan (Tryp) and tyrosine (Tyr) outcompete these non-Phe LNAA for entry into the brain.
(2) This causes high concentrations of Phe in the brain and low concentration of other non-Phe LNAA’s,
such as Tryp and Tyr. Furthermore, the dysfunction of phenylalanine hydroxylase in the periphery causes
poor intrinsic capacity to produce Tyr. (3) High concentrations of Phe inhibit tyrosine hydroxylase and
tryptophan hydroxylase important in the conversion of Tyr to 3,4-dihydroxyphenylalanine (DOPA)
and Tryp to 5-hydrotryptophan (5-HTP) respectively. (4) Together this causes a decrease in serotonin
![Page 13: University of Groningen Phenylketonuria in mice and men ... · Phenylketonuria in mice and men Proefschrift ter verkrijging van de graad van doctor aan de Rijksuniversiteit Groningen](https://reader034.vdocuments.site/reader034/viewer/2022052611/5f03c1e37e708231d40a9ed0/html5/thumbnails/13.jpg)
512536-L-bw-Bruinenberg512536-L-bw-Bruinenberg512536-L-bw-Bruinenberg512536-L-bw-BruinenbergProcessed on: 15-8-2017Processed on: 15-8-2017Processed on: 15-8-2017Processed on: 15-8-2017 PDF page: 12PDF page: 12PDF page: 12PDF page: 12
12
Chapter 1
and dopamine. (5) High Phe concentrations can inhibit anti-oxidant enzymes and (6) increase reactive
species. The disrupted balance between production and removal of reactive species is oxidative stress.
(7) High concentrations of Phe can assembly in neurotoxic fibrils with an amyloid-like structure. (8)
Increased Phe concentrations can affect neuronal functioning trough affecting synaptic morphology,
and proteins related to synaptic functioning. (9) In PKU, alternations in myelin/ white matter integrity
are consistently found. A possible mechanism could lay in the indirect effect of Phe on cholesterol and
protein synthesis, processes important in the production and maintenance of myelin sheaths.
3. THE OUTCOME OF PHENYLKETONURIA PATIENTS.
In the 1950’s, it became clear that the treatment of PKU should focus on reducing Phe
intake38. In subsequent years, the first studies showed that low-Phe intake could reduce
Phe in blood and cerebrospinal fluid and improve behavior in PKU patients39,40. Currently,
the treatment of PKU patients still aims to reduce Phe intake that is now achieved by a
protein-restricted diet supplemented with artificial amino acids, vitamins, and minerals.
New born screening facilitates the early introduction of this diet which is prescribed as a
diet-for-life41. In early-treated patients, this diet could overcome the severe mental disabilities
experienced by untreated PKU patients. However, in recent years, it became clear that the
current treatment, the difficulties maintaining diet, and the world-wide misalignment of
Phe targets of treatment causes a suboptimal outcome42,43. Early-treated PKU patients still
experience reduced psychosocial outcome, quality of life, cognitive functioning, such as in
processing speed, attention and working memory, and more internalizing problems such as
depression and anxiety42–45. Therefore, the development of new and/or additional treatment
strategies in PKU is of great importance.
4. THESIS OUTLINE
In this current thesis we investigate two new treatment strategies in PKU, namely a specific
nutrient combination and large neutral amino acids supplementation. This research consists
of preclinical studies in the PKU mouse model. A major challenge in this preclinical research
is the translational value of the model. The translational value implies and demands a link
between the model and the modelled condition (the PKU mouse model to PKU patients).
Therefore, the first part of this thesis aims for a completer understanding of the PKU mouse
model, whereas the second and third part relate to the two new treatment strategies. As
such, the outline of this thesis is divided in three parts: I) Characterization and translational
value of the PKU mouse model, II) The effect of a specific nutrient combination in PKU and
III) Large neutral amino acids supplementation in PKU.
![Page 14: University of Groningen Phenylketonuria in mice and men ... · Phenylketonuria in mice and men Proefschrift ter verkrijging van de graad van doctor aan de Rijksuniversiteit Groningen](https://reader034.vdocuments.site/reader034/viewer/2022052611/5f03c1e37e708231d40a9ed0/html5/thumbnails/14.jpg)
512536-L-bw-Bruinenberg512536-L-bw-Bruinenberg512536-L-bw-Bruinenberg512536-L-bw-BruinenbergProcessed on: 15-8-2017Processed on: 15-8-2017Processed on: 15-8-2017Processed on: 15-8-2017 PDF page: 13PDF page: 13PDF page: 13PDF page: 13
1
13
Chapter 1
Part I: Characterization and translational value of the PKU mouse model
In PKU research, several models are used to investigate underlying mechanisms and
new treatment strategies. A model often used is the PKU mouse model. This model, first
described in 1993 by Shedlovsky and colleagues, was developed via germline mutagenesis
with N-ethyl-N-nitroso-ureum (ENU)46. This technique caused a mutation in the PAH gene
resulting in very little enzymatic activity and, consequently, increased concentrations of Phe
in blood and brain46,47. This model, Pahenu2, was developed in the BTBR genetic background.
However, outside of PKU research, this genetic background is known for their abnormalities
in behavior and brain morphology48–51. Therefore, the BTBR Pahenu2 was crossed back on
to the more commonly used C57Bl/6 background. At this moment, both backgrounds of
the mouse model are used as equals despite clear indications from other research fields
that genetic background can influence phenotypical behavior52. In chapter 2, we directly
compare the adult male wild-type (WT) and PKU individuals of both strains (BTBR and
C57Bl/6) in four PKU-related domains; activity, motor performance, anxiety-and depressive-
like behavior and learning and memory. As genotyping with specific probes and primers
confirmed that the PKU mice of both strains have an identical point mutation, this study
further investigates if the biochemical profiles of the PKU mice of both genetic backgrounds
is similar. The biochemical profiles consist of neurotransmitter concentrations in brain, and
amino acid concentration in blood and brain.
In chapter 2, we examined male mice, as preclinical research most often focusses on the
males. However, it is progressively recognized that males can respond differently than
females53–55. Therefore, chapter 3 investigates the four PKU-related domains in adult female
WT and PKU individuals of both strains.
In the previous two chapters we have tested four PKU-related domains described for PKU. A
phenotypical consequence of PKU that is not described in literature is sleep-related problems.
The lack in sleep research is somewhat surprising to us, as several modulators of sleep and
wakefulness are affected in PKU56,57 (f.e. serotonin, dopamine, norepinephrine and orexin).
For this reason, chapter 4 investigates sleep characteristics in PKU patients and sleep/wake
patterns in male and female PKU mice of both genetic backgrounds. In PKU patients and
first degree relatives, four questionnaires in an electronic survey are used. Together with ten
questions to characterize the subjects, the questionnaires are used to examine the possible
occurrence of sleep disorders, sleep quality, sleepiness during the day, and chronotype. In
PKU and WT mice, rest/wake patterns are monitored via passive infrared recorders. From
these patterns, the fragmentation score (the frequency of switching between active and non-
active behavior) and diurnality (e.g. night active animals are active in the dark phase which
gives a negative diurnality score) is calculated.
![Page 15: University of Groningen Phenylketonuria in mice and men ... · Phenylketonuria in mice and men Proefschrift ter verkrijging van de graad van doctor aan de Rijksuniversiteit Groningen](https://reader034.vdocuments.site/reader034/viewer/2022052611/5f03c1e37e708231d40a9ed0/html5/thumbnails/15.jpg)
512536-L-bw-Bruinenberg512536-L-bw-Bruinenberg512536-L-bw-Bruinenberg512536-L-bw-BruinenbergProcessed on: 15-8-2017Processed on: 15-8-2017Processed on: 15-8-2017Processed on: 15-8-2017 PDF page: 14PDF page: 14PDF page: 14PDF page: 14
14
Chapter 1
Part II: The effect of a specific nutrient combination in PKU
Current dietary treatment is often difficult to maintain by PKU patients. This can result in
reduced compliance causing Phe concentrations to rise and fluctuate58. In contrast to the
traditional focus of treatment to reduce Phe, counteracting the detrimental effects of Phe
on the brain could be of great interest to improve PKU treatment. As previously described,
several domains are affected in PKU, namely neurotransmitter metabolism, oxidative
stress, white matter integrity, and synaptic functioning. Chapter 5 reviews nutrients that
can positively affect theses domains of the brain. In this review, a combination of specific
nutrients is postulated as an additional new treatment strategy for PKU. This specific
nutrient combination (SNC) consists of uridine monophosphate (UMP), docosahexaenoic
acid (DHA), eicosapentaenoic acid (EPA), choline, phospholipids, folic acid, vitamins B12,
B6, C, and E, and selenium. The synergistic approach was originally designed to improve
the synthesis of phospholipids, a major component of (synaptic) membranes. Together
and beyond the original focus, SNC supplementation have shown positive effects on
synaptic functioning, e.g. pre- and postsynaptic proteins59–62 and neurite outgrowth61,63,
neurotransmitter release and signaling61,64, and memory performance65,66. In chapter 6, for
the first time, SNC supplementation is implemented in male and female C57Bl/6 WT and
PKU mice. In this proof-of-concept study, we examine the effect of SNC supplementation
on a post-synaptic marker, postsynaptic density protein 95, in specific subregions of the
hippocampus. In chapter 7, we continue this work in the BTBR WT and PKU mice to
investigate the behavioral outcome of this treatment. In a long-term intervention study, we
examine whether SNC supplementation can improve motor performanc, novel- and spatial
object recognition memory in high Phe and low Phe conditions.
Part III: Large neutral amino acid supplementation in PKU
As previously described, high Phe concentrations in blood can outcompete other non-
Phe LNAA’s (tyrosine, tryptophan, valine, isoleucine, leucine, methionine, histidine, and
threonine) in the transport over the blood-brain barrier. Consequently, Phe concentrations
are increased in brain, non-Phe- LNAA’s concentrations are reduced, and neurotransmitter
metabolism impaired. Restoring the balance between Phe and non-Phe LNAA’s in blood
with supplementing additional non-Phe LNAA’s could counteract these consequences.
Indeed, clinical studies support this hypothesis67–71. However, the optimal composition and
the effect on all three biochemical disturbances are still unknown. Therefore, as a start, the
acute diet regime of Pietz and colleagues (1999)67 in PKU patients was transformed to a
continuous treatment of supplementation of equal amounts of all non-Phe LNAA’s except
for threonine. In this study, described in chapter 8, we offer this LNAA’s regime for six weeks
to male and female C57Bl/6 WT and PKU mice. After six weeks, blood and brain LNAA’s
and neurotransmitter concentrations are examined to investigate the three biochemical
treatment objectives. In chapter 9, the results found in chapter 8 were used to optimize the
LNAA regimes. In this study six specific LNAA regimes were offered to C57Bl/6 PKU mice
![Page 16: University of Groningen Phenylketonuria in mice and men ... · Phenylketonuria in mice and men Proefschrift ter verkrijging van de graad van doctor aan de Rijksuniversiteit Groningen](https://reader034.vdocuments.site/reader034/viewer/2022052611/5f03c1e37e708231d40a9ed0/html5/thumbnails/16.jpg)
512536-L-bw-Bruinenberg512536-L-bw-Bruinenberg512536-L-bw-Bruinenberg512536-L-bw-BruinenbergProcessed on: 15-8-2017Processed on: 15-8-2017Processed on: 15-8-2017Processed on: 15-8-2017 PDF page: 15PDF page: 15PDF page: 15PDF page: 15
1
15
Chapter 1
and compared to a normal diet in C57Bl/6 PKU and WT mice of both sexes. Again, blood
and brain LNAA’s and neurotransmitter concentrations were examined to investigate the
three biochemical consequences.
To conclude, in Chapter 10, the results of all chapters will be summarized and discussed.
Together with additional data, suggestions are made for future research.
![Page 17: University of Groningen Phenylketonuria in mice and men ... · Phenylketonuria in mice and men Proefschrift ter verkrijging van de graad van doctor aan de Rijksuniversiteit Groningen](https://reader034.vdocuments.site/reader034/viewer/2022052611/5f03c1e37e708231d40a9ed0/html5/thumbnails/17.jpg)
512536-L-bw-Bruinenberg512536-L-bw-Bruinenberg512536-L-bw-Bruinenberg512536-L-bw-BruinenbergProcessed on: 15-8-2017Processed on: 15-8-2017Processed on: 15-8-2017Processed on: 15-8-2017 PDF page: 16PDF page: 16PDF page: 16PDF page: 16
16
Chapter 1
5. REFERENCES
1 Følling. Über Ausscheidung von
Phenylbrenztraubensäure in den Harn als
Stoffwechselanomalie in Verbindung mit
Imbezillität. Hoppe-Seylers Ztschr Physiol
Chem 1934; 227: 169–176.
2 Penrose. Inheritance of phenylpyruvic
amentia (phenylketonuria). Lancet 1935; 2:
192–194.
3 Buck P. The Child Who Never Grew. 1950.
4 Blau N, van Spronsen FJ, Levy HL.
Phenylketonuria. Lancet 2010; 376: 1417–
27.
5 Kanai Y, Segawa H, Miyamoto K i, Uchino
H, Takeda E, Endou H. Expression cloning
and characterization of a transporter for
large neutral amino acids activated by the
heavy chain of 4F2 antigen (CD98). J Biol
Chem 1998; 273: 23629–32.
6 van Spronsen FJ, Hoeksma M, Reijngoud
D-J. Brain dysfunction in phenylketonuria:
is phenylalanine toxicity the only possible
cause? J Inherit Metab Dis 2009; 32: 46–51.
7 de Groot MJ, Sijens PE, Reijngoud
D-J, Paans AM, van Spronsen FJ.
Phenylketonuria: brain phenylalanine
concentrations relate inversely to cerebral
protein synthesis. J Cereb Blood Flow
Metab 2015; 35: 200–5.
8 Hommes FA, Lee JS. The control of
5-hydroxytryptamine and dopamine
synthesis in the brain: a theoretical
approach. J Inherit Metab Dis 1990; 13:
37–57.
9 Ogawa S, Ichinose H. Effect of metals and
phenylalanine on the activity of human
tryptophan hydroxylase-2: comparison
with that on tyrosine hydroxylase activity.
Neurosci Lett 2006; 401: 261–5.
10 Mazumder MK, Paul R, Borah A.
β-phenethylamine--a phenylalanine
derivative in brain--contributes to oxidative
stress by inhibiting mitochondrial complexes
and DT-diaphorase: an in silico study. CNS
Neurosci Ther 2013; 19: 596–602.
11 Rosa AP, Jacques CED, Moraes TB,
Wannmacher CMD, Dutra A de M, Dutra-
Filho CS. Phenylpyruvic acid decreases
glucose-6-phosphate dehydrogenase activity
in rat brain. Cell Mol Neurobiol 2012; 32:
1113–8.
12 Ribas GS, Sitta A, Wajner M, Vargas CR.
Oxidative stress in phenylketonuria: what is
the evidence? Cell Mol Neurobiol 2011; 31:
653–62.
13 Christ SE, Price MH, Bodner KE, Saville C,
Moffitt AJ, Peck D. Morphometric analysis
of gray matter integrity in individuals with
early-treated phenylketonuria. Mol Genet
Metab 2016; 118: 3–8.
14 Andolina D, Conversi D, Cabib S,
Trabalza A, Ventura R, Puglisi-Allegra
S et al. 5-Hydroxytryptophan during
critical postnatal period improves
cognitive performances and promotes
dendritic spine maturation in genetic
mouse model of phenylketonuria. Int J
Neuropsychopharmacol 2011; 14: 479–89.
15 Liang L, Gu X, Lu L, Li D, Zhang X.
Phenylketonuria-related synaptic changes
in a BTBR-Pah(enu2) mouse model.
Neuroreport 2011; 22: 617–22.
16 Cordero ME, Trejo M, Colombo M, Aranda
V. Histological maturation of the neocortex
in phenylketonuric rats. Early Hum Dev
1983; 8: 157–73.
![Page 18: University of Groningen Phenylketonuria in mice and men ... · Phenylketonuria in mice and men Proefschrift ter verkrijging van de graad van doctor aan de Rijksuniversiteit Groningen](https://reader034.vdocuments.site/reader034/viewer/2022052611/5f03c1e37e708231d40a9ed0/html5/thumbnails/18.jpg)
512536-L-bw-Bruinenberg512536-L-bw-Bruinenberg512536-L-bw-Bruinenberg512536-L-bw-BruinenbergProcessed on: 15-8-2017Processed on: 15-8-2017Processed on: 15-8-2017Processed on: 15-8-2017 PDF page: 17PDF page: 17PDF page: 17PDF page: 17
1
17
Chapter 1
17 Hörster F, Schwab MA, Sauer SW, Pietz J,
Hoffmann GF, Okun JG et al. Phenylalanine
reduces synaptic density in mixed cortical
cultures from mice. Pediatr Res 2006; 59:
544–8.
18 Schlegel G, Scholz R, Ullrich K, Santer
R, Rune GM. Phenylketonuria: Direct
and indirect effects of phenylalanine. Exp
Neurol 2016; 281: 28–36.
19 Zhang Y, Zhang H, Yuan X, Gu X.
Differential effects of phenylalanine on
Rac1, Cdc42, and RhoA expression and
activity in cultured cortical neurons. Pediatr
Res 2007; 62: 8–13.
20 Imperlini E, Orrù S, Corbo C, Daniele A,
Salvatore F. Altered brain protein expression
profiles are associated with molecular
neurological dysfunction in the PKU mouse
model. J Neurochem 2014; 129: 1002–12.
21 Horling K, Schlegel G, Schulz S, Vierk R,
Ullrich K, Santer R et al. Hippocampal
synaptic connectivity in phenylketonuria.
Hum Mol Genet 2014. doi:10.1093/hmg/
ddu515.
22 Cabib S, Pascucci T, Ventura R, Romano V,
Puglisi-Allegra S. The behavioral profile of
severe mental retardation in a genetic mouse
model of phenylketonuria. Behav Genet
2003; 33: 301–10.
23 Adler-Abramovich L, Vaks L, Carny
O, Trudler D, Magno A, Caflisch A et
al. Phenylalanine assembly into toxic
fibrils suggests amyloid etiology in
phenylketonuria. Nat Chem Biol 2012; 8:
701–6.
24 ALVORD EC, STEVENSON LD, VOGEL
FS, ENGLE RL. Neuropathological findings
in phenyl-pyruvic oligophrenia (phenyl-
ketonuria). J Neuropathol Exp Neurol
1950; 9: 298–310.
25 Huttenlocher PR. The neuropathology of
phenylketonuria: human and animal studies.
Eur J Pediatr 2000; 159 Suppl: S102-6.
26 Anderson PJ, Leuzzi V. White matter
pathology in phenylketonuria. Mol Genet
Metab 2010; 99 Suppl 1: S3-9.
27 Hood A, Antenor-Dorsey JA V, Hershey
T, Rutlin J, Shimony JS, McKinstry RC et
al. White matter integrity and executive
abilities in individuals with phenylketonuria.
Mol Genet Metab 2013; 109: 125–31.
28 Anderson PJ, Wood SJ, Francis DE,
Coleman L, Warwick L, Casanelia S et al.
Neuropsychological functioning in children
with early-treated phenylketonuria: impact
of white matter abnormalities. Dev Med
Child Neurol 2004; 46: 230–8.
29 Bick U, Ullrich K, Stöber U, Möller H,
Schuierer G, Ludolph AC et al. White
matter abnormalities in patients with
treated hyperphenylalaninaemia: magnetic
resonance relaxometry and proton
spectroscopy findings. Eur J Pediatr 1993;
152: 1012–20.
30 Leuzzi V, Tosetti M, Montanaro D,
Carducci C, Artiola C, Antonozzi I et
al. The pathogenesis of the white matter
abnormalities in phenylketonuria. A
multimodal 3.0 tesla MRI and magnetic
resonance spectroscopy (1H MRS) study. J
Inherit Metab Dis 2007; 30: 209–16.
31 Mastrangelo M, Chiarotti F, Berillo L,
Caputi C, Carducci C, Di Biasi C et al. The
outcome of white matter abnormalities in
early treated phenylketonuric patients: A
retrospective longitudinal long-term study.
Mol Genet Metab 2015. doi:10.1016/j.
ymgme.2015.08.005.
32 Dyer CA, Kendler A, Philibotte T, Gardiner
P, Cruz J, Levy HL. Evidence for central
nervous system glial cell plasticity in
phenylketonuria. J Neuropathol Exp Neurol
1996; 55: 795–814.
![Page 19: University of Groningen Phenylketonuria in mice and men ... · Phenylketonuria in mice and men Proefschrift ter verkrijging van de graad van doctor aan de Rijksuniversiteit Groningen](https://reader034.vdocuments.site/reader034/viewer/2022052611/5f03c1e37e708231d40a9ed0/html5/thumbnails/19.jpg)
512536-L-bw-Bruinenberg512536-L-bw-Bruinenberg512536-L-bw-Bruinenberg512536-L-bw-BruinenbergProcessed on: 15-8-2017Processed on: 15-8-2017Processed on: 15-8-2017Processed on: 15-8-2017 PDF page: 18PDF page: 18PDF page: 18PDF page: 18
18
Chapter 1
33 Shefer S, Tint GS, Jean-Guillaume D,
Daikhin E, Kendler A, Nguyen LB et al. Is
there a relationship between 3-hydroxy-
3-methylglutaryl coenzyme a reductase
activity and forebrain pathology in the PKU
mouse? J Neurosci Res 2000; 61: 549–63.
34 Smith I, Knowles J. Behaviour in early
treated phenylketonuria: a systematic
review. Eur J Pediatr 2000; 159 Suppl: S89-
93.
35 Hoeksma M, Reijngoud D-J, Pruim J,
de Valk HW, Paans AMJ, van Spronsen
FJ. Phenylketonuria: High plasma
phenylalanine decreases cerebral protein
synthesis. Mol Genet Metab 2009; 96:
177–82.
36 Hughes J V, Johnson TC. The effects of
phenylalanine on amino acid metabolism
and protein synthesis in brain cells in vitro. J
Neurochem 1976; 26: 1105–13.
37 Binek-Singer P, Johnson TC. The effects of
chronic hyperphenylalaninaemia on mouse
brain protein synthesis can be prevented by
other amino acids. Biochem J 1982; 206:
407–14.
38 WOOLF LI, VULLIAMY DG.
Phenylketonuria with a study of the effect
upon it of glutamic acid. Arch Dis Child
1951; 26: 487–94.
39 BICKEL H, GERRARD J, HICKMANS
EM. Influence of phenylalanine intake on
phenylketonuria. Lancet (London, England)
1953; 265: 812–3.
40 BICKEL H, GERRARD J, HICKMANS
EM. The influence of phenylalanine intake
on the chemistry and behaviour of a phenyl-
ketonuric child. Acta Paediatr 1954; 43:
64–77.
41 van Spronsen FJ, van Wegberg AM, Ahring
K, Bélanger-Quintana A, Blau N, Bosch
AM et al. Key European guidelines for
the diagnosis and management of patients
with phenylketonuria. Lancet Diabetes
Endocrinol 2017. doi:10.1016/S2213-
8587(16)30320-5.
42 Moyle JJ, Fox AM, Arthur M, Bynevelt
M, Burnett JR. Meta-analysis of
neuropsychological symptoms of adolescents
and adults with PKU. Neuropsychol Rev
2007; 17: 91–101.
43 Enns GM, Koch R, Brumm V, Blakely E,
Suter R, Jurecki E. Suboptimal outcomes in
patients with PKU treated early with diet
alone: revisiting the evidence. Mol Genet
Metab; 101: 99–109.
44 Jahja R, van Spronsen FJ, de Sonneville
LMJ, van der Meere JJ, Bosch AM, Hollak
CEM et al. Social-cognitive functioning and
social skills in patients with early treated
phenylketonuria: a PKU-COBESO study. J
Inherit Metab Dis 2016; 39: 355–362.
45 Jahja R, Huijbregts SCJ, de Sonneville LMJ,
van der Meere JJ, Bosch AM, Hollak CEM
et al. Mental health and social functioning
in early treated Phenylketonuria: the PKU-
COBESO study. Mol Genet Metab 2013;
110 Suppl: S57-61.
46 Shedlovsky A, McDonald JD, Symula
D, Dove WF. Mouse models of human
phenylketonuria. Genetics 1993; 134:
1205–10.
47 van Vliet D, Bruinenberg VM, Mazzola
PN, van Faassen MHJR, de Blaauw P,
Kema IP et al. Large Neutral Amino Acid
Supplementation Exerts Its Effect through
Three Synergistic Mechanisms: Proof of
Principle in Phenylketonuria Mice. PLoS
One 2015; 10: e0143833.
![Page 20: University of Groningen Phenylketonuria in mice and men ... · Phenylketonuria in mice and men Proefschrift ter verkrijging van de graad van doctor aan de Rijksuniversiteit Groningen](https://reader034.vdocuments.site/reader034/viewer/2022052611/5f03c1e37e708231d40a9ed0/html5/thumbnails/20.jpg)
512536-L-bw-Bruinenberg512536-L-bw-Bruinenberg512536-L-bw-Bruinenberg512536-L-bw-BruinenbergProcessed on: 15-8-2017Processed on: 15-8-2017Processed on: 15-8-2017Processed on: 15-8-2017 PDF page: 19PDF page: 19PDF page: 19PDF page: 19
1
19
Chapter 1
48 Wahlsten D, Metten P, Crabbe JC. Survey of
21 inbred mouse strains in two laboratories
reveals that BTBR T/+ tf/tf has severely
reduced hippocampal commissure and
absent corpus callosum. Brain Res 2003;
971: 47–54.
49 Ding Z, Georgiev P, Thöny B.
Administration-route and gender-
independent long-term therapeutic
correction of phenylketonuria (PKU) in
a mouse model by recombinant adeno-
associated virus 8 pseudotyped vector-
mediated gene transfer. Gene Ther 2006; 13:
587–593.
50 MacPherson P, McGaffigan R, Wahlsten D,
Nguyen P V. Impaired fear memory, altered
object memory and modified hippocampal
synaptic plasticity in split-brain mice. Brain
Res 2008; 1210: 179–88.
51 Jones-Davis DM, Yang M, Rider E, Osbun
NC, da Gente GJ, Li J et al. Quantitative
trait loci for interhemispheric commissure
development and social behaviors in the
BTBR T+ tf/J mouse model of autism. PLoS
One 2013; 8: e61829.
52 Sittig LJ, Carbonetto P, Engel KA, Krauss
KS, Barrios-Camacho CM, Palmer AA.
Genetic Background Limits Generalizability
of Genotype-Phenotype Relationships.
Neuron 2016; 91: 1253–1259.
53 Miller LR, Marks C, Becker JB, Hurn PD,
Chen W-J, Woodruff T et al. Considering
sex as a biological variable in preclinical
research. FASEB J 2017; 31: 29–34.
54 Soldin OP, Mattison DR. Sex differences in
pharmacokinetics and pharmacodynamics.
Clin Pharmacokinet 2009; 48: 143–57.
55 Sandberg K, Umans JG, Georgetown
Consensus Conference Work Group the
GCCW. Recommendations concerning
the new U.S. National Institutes of Health
initiative to balance the sex of cells and
animals in preclinical research. FASEB J
2015; 29: 1646–52.
56 Holst SC, Valomon A, Landolt H-P. Sleep
Pharmacogenetics: Personalized Sleep-Wake
Therapy. Annu Rev Pharmacol Toxicol
2016; 56: 577–603.
57 Eban-Rothschild A, Rothschild G,
Giardino WJ, Jones JR, de Lecea L. VTA
dopaminergic neurons regulate ethologically
relevant sleep–wake behaviors. Nat
Neurosci 2016; 19: 1356–1366.
58 MacDonald A, Gokmen-Ozel H, van
Rijn M, Burgard P. The reality of dietary
compliance in the management of
phenylketonuria. J Inherit Metab Dis 2010;
33: 665–70.
59 Wurtman RJ, Cansev M, Sakamoto T, Ulus
IH. Administration of docosahexaenoic
acid, uridine and choline increases levels of
synaptic membranes and dendritic spines in
rodent brain. World Rev Nutr Diet 2009;
99: 71–96.
60 Cansev M, Wurtman RJ. Chronic
administration of docosahexaenoic acid or
eicosapentaenoic acid, but not arachidonic
acid, alone or in combination with uridine,
increases brain phosphatide and synaptic
protein levels in gerbils. Neuroscience 2007;
148: 421–31.
61 Cansev M, van Wijk N, Turkyilmaz
M, Orhan F, Sijben JWC, Broersen
LM. A specific multi-nutrient enriched
diet enhances hippocampal cholinergic
transmission in aged rats. Neurobiol Aging
2015; 36: 344–51.
62 Sakamoto T, Cansev M, Wurtman RJ. Oral
supplementation with docosahexaenoic acid
and uridine-5’-monophosphate increases
dendritic spine density in adult gerbil
hippocampus. Brain Res 2007; 1182: 50–9.
63 Pooler AM, Guez DH, Benedictus
R, Wurtman RJ. Uridine enhances
neurite outgrowth in nerve growth
factor-differentiated PC12 [corrected].
Neuroscience 2005; 134: 207–14.
![Page 21: University of Groningen Phenylketonuria in mice and men ... · Phenylketonuria in mice and men Proefschrift ter verkrijging van de graad van doctor aan de Rijksuniversiteit Groningen](https://reader034.vdocuments.site/reader034/viewer/2022052611/5f03c1e37e708231d40a9ed0/html5/thumbnails/21.jpg)
512536-L-bw-Bruinenberg512536-L-bw-Bruinenberg512536-L-bw-Bruinenberg512536-L-bw-BruinenbergProcessed on: 15-8-2017Processed on: 15-8-2017Processed on: 15-8-2017Processed on: 15-8-2017 PDF page: 20PDF page: 20PDF page: 20PDF page: 20
20
Chapter 1
64 Savelkoul PJM, Janickova H, Kuipers AAM,
Hageman RJJ, Kamphuis PJ, Dolezal V et
al. A specific multi-nutrient formulation
enhances M1 muscarinic acetylcholine
receptor responses in vitro. J Neurochem
2012; 120: 631–40.
65 Scheltens P, Kamphuis PJGH, Verhey
FRJ, Olde Rikkert MGM, Wurtman RJ,
Wilkinson D et al. Efficacy of a medical
food in mild Alzheimer’s disease: A
randomized, controlled trial. Alzheimers
Dement 2010; 6: 1–10.e1.
66 Scheltens P, Twisk JWR, Blesa R, Scarpini
E, von Arnim CAF, Bongers A et al. Efficacy
of Souvenaid in mild Alzheimer’s disease:
results from a randomized, controlled trial. J
Alzheimers Dis 2012; 31: 225–36.
67 Pietz J, Kreis R, Rupp A, Mayatepek
E, Rating D, Boesch C et al. Large
neutral amino acids block phenylalanine
transport into brain tissue in patients with
phenylketonuria. J Clin Invest 1999; 103:
1169–78.
68 Schindeler S, Ghosh-Jerath S, Thompson S,
Rocca A, Joy P, Kemp A et al. The effects
of large neutral amino acid supplements
in PKU: an MRS and neuropsychological
study. Mol Genet Metab 2007; 91: 48–54.
69 Koch R, Moseley KD, Yano S, Nelson
M, Moats RA. Large neutral amino acid
therapy and phenylketonuria: a promising
approach to treatment. Mol Genet Metab
2003; 79: 110–3.
70 Yano S, Moseley K, Azen C. Large neutral
amino acid supplementation increases
melatonin synthesis in phenylketonuria: a
new biomarker. J Pediatr 2013; 162: 999–
1003.
71 Kalkanoğlu HS, Ahring KK, Sertkaya D,
Møller LB, Romstad A, Mikkelsen I et
al. Behavioural effects of phenylalanine-
free amino acid tablet supplementation in
intellectually disabled adults with untreated
phenylketonuria. Acta Paediatr 2005; 94:
1218–22.
![Page 22: University of Groningen Phenylketonuria in mice and men ... · Phenylketonuria in mice and men Proefschrift ter verkrijging van de graad van doctor aan de Rijksuniversiteit Groningen](https://reader034.vdocuments.site/reader034/viewer/2022052611/5f03c1e37e708231d40a9ed0/html5/thumbnails/22.jpg)
512536-L-bw-Bruinenberg512536-L-bw-Bruinenberg512536-L-bw-Bruinenberg512536-L-bw-BruinenbergProcessed on: 15-8-2017Processed on: 15-8-2017Processed on: 15-8-2017Processed on: 15-8-2017 PDF page: 21PDF page: 21PDF page: 21PDF page: 21
1
21
Chapter 1
![Page 23: University of Groningen Phenylketonuria in mice and men ... · Phenylketonuria in mice and men Proefschrift ter verkrijging van de graad van doctor aan de Rijksuniversiteit Groningen](https://reader034.vdocuments.site/reader034/viewer/2022052611/5f03c1e37e708231d40a9ed0/html5/thumbnails/23.jpg)
512536-L-bw-Bruinenberg512536-L-bw-Bruinenberg512536-L-bw-Bruinenberg512536-L-bw-BruinenbergProcessed on: 15-8-2017Processed on: 15-8-2017Processed on: 15-8-2017Processed on: 15-8-2017 PDF page: 22PDF page: 22PDF page: 22PDF page: 22
![Page 24: University of Groningen Phenylketonuria in mice and men ... · Phenylketonuria in mice and men Proefschrift ter verkrijging van de graad van doctor aan de Rijksuniversiteit Groningen](https://reader034.vdocuments.site/reader034/viewer/2022052611/5f03c1e37e708231d40a9ed0/html5/thumbnails/24.jpg)
512536-L-bw-Bruinenberg512536-L-bw-Bruinenberg512536-L-bw-Bruinenberg512536-L-bw-BruinenbergProcessed on: 15-8-2017Processed on: 15-8-2017Processed on: 15-8-2017Processed on: 15-8-2017 PDF page: 23PDF page: 23PDF page: 23PDF page: 23
CHAPTER 2The Behavioral Consequence of Phenylketonuria
in Mice Depends on the Genetic Background
Vibeke M. Bruinenberg1, Els van der Goot1, Danique van Vliet2,
Martijn J. de Groot2, Priscila N. Mazzola1,2,
M. Rebecca Heiner-Fokkema3, Martijn van Faassen3,
Francjan J. van Spronsen2, Eddy A. van der Zee1*.
1Molecular Neurobiology, Groningen Institute for Evolutionary Life Sciences (GELIFES),
University of Groningen, Groningen, the Netherlands, 2Beatrix Children’s Hospital,
University Medical Center Groningen, Groningen, the Netherlands, 3Laboratory Medicine,
University of Groningen, University Medical Center, Groningen, the Netherlands
Front Behav Neurosci. 2016 Dec 20;10:233. doi: 10.3389/fnbeh.2016.00233.
eCollection 2016.
![Page 25: University of Groningen Phenylketonuria in mice and men ... · Phenylketonuria in mice and men Proefschrift ter verkrijging van de graad van doctor aan de Rijksuniversiteit Groningen](https://reader034.vdocuments.site/reader034/viewer/2022052611/5f03c1e37e708231d40a9ed0/html5/thumbnails/25.jpg)
512536-L-bw-Bruinenberg512536-L-bw-Bruinenberg512536-L-bw-Bruinenberg512536-L-bw-BruinenbergProcessed on: 15-8-2017Processed on: 15-8-2017Processed on: 15-8-2017Processed on: 15-8-2017 PDF page: 24PDF page: 24PDF page: 24PDF page: 24
24
Chapter 2
ABSTRACT
To unravel the role of gene mutations in the healthy and the diseased state, countless studies
have tried to link genotype with phenotype. However, over the years, it became clear that
the strain of mice can influence these results. Nevertheless, identical gene mutations in
different strains are often still considered equals. An example of this, is the research done in
phenylketonuria (PKU), an inheritable metabolic disorder. In this field, a PKU mouse model
(either on a BTBR or C57Bl/6 background) is often used to examine underlying mechanisms
of the disease and/or new treatment strategies. Both strains have a point mutation in the
gene coding for the enzyme phenylalanine hydroxylase which causes toxic concentrations of
the amino acid phenylalanine in blood and brain, as found in PKU patients. Although the
mutation is identical and therefore assumed to equally affect physiology and behavior in both
strains, no studies directly compared the two genetic backgrounds to test this assumption.
Therefore, this study compared the BTBR and C57Bl/6 wild-type and PKU mice on PKU-
relevant amino acid- and neurotransmitter levels and at a behavioral level. The behavioral
paradigms were selected from previous literature on the PKU mouse model and address four
domains, namely 1) activity levels, 2) motor performance, 3) anxiety and/or depression-
like behavior, and 4) learning and memory. The results of this study showed comparable
biochemical changes in phenylalanine and neurotransmitter concentrations. In contrast,
clear differences in behavioral outcome between the strains in all four above-mentioned
domains were found, most notably in the learning and memory domain. The outcome in
this domain seem to be primarily due to factors inherent to the genetic background of the
mouse and much less by differences in PKU-specific biochemical parameters in blood and
brain. The difference in behavioral outcome between PKU of both strains emphasizes that
the consequence of the PAH mutation is influenced by other factors than Phe levels alone.
Therefore, future research should consider these differences when choosing one of the genetic
strains to investigate the pathophysiological mechanism underlying PKU-related behavior,
especially when combined with new treatment strategies.
![Page 26: University of Groningen Phenylketonuria in mice and men ... · Phenylketonuria in mice and men Proefschrift ter verkrijging van de graad van doctor aan de Rijksuniversiteit Groningen](https://reader034.vdocuments.site/reader034/viewer/2022052611/5f03c1e37e708231d40a9ed0/html5/thumbnails/26.jpg)
512536-L-bw-Bruinenberg512536-L-bw-Bruinenberg512536-L-bw-Bruinenberg512536-L-bw-BruinenbergProcessed on: 15-8-2017Processed on: 15-8-2017Processed on: 15-8-2017Processed on: 15-8-2017 PDF page: 25PDF page: 25PDF page: 25PDF page: 25
2
25
Chapter 2
1. INTRODUCTION
Transgenic and knockout/ knock-in mice are used to investigate the consequence of genetic
mutations to understand the human biological system, especially in a diseased condition. It
is progressively acknowledged that the strain of these mice highly influences the outcome of
the gene mutation1–4. Nevertheless, identical gene mutations in different strains are often still
considered equals in various disciplines. A striking example is the mouse model used in the
field of phenylketonuria (PKU, OMIM 261600). PKU is an inheritable metabolic disorder
characterized by high concentrations of the amino acid phenylalanine (Phe) in blood and
brain caused by mutations in the gene that encodes for the enzyme Phe hydroxylase (PAH,
EC 1.14.16.1). This mutation results in a loss of catalytic activity of the enzyme and, as a
consequence, the conversion of Phe to tyrosine is disrupted. In untreated patients, these
raised concentrations of Phe are associated with symptoms such as a severe intellectual
disability, disruptions in motor performance, mood swings, anxiety, depression disorders,
and epilepsy5. The mouse model of PKU mimics the PKU patients through a chemically
induced point mutation in the gene encoding for the enzyme PAH. Originally, this point
mutation was described for the black and tan, brachyury (BTBR) mouse 6. However, the
wild-type (WT) mice of the BTBR strain were found to have difficulties with breeding and
displayed abnormalities in brain morphology and behavior, thus limiting their suitability for
preclinical research7–10. Therefore, The BTBR PKU mouse was crossed back on a C57Bl/6JRj
(referred to as B6 hereafter) background. As a result, both strains are currently used in PKU
studies, often without justification. Without fully understanding the influence of the genetic
background on behavior and physiology, notably behavioral results in these PKU studies can
be difficult to interpret.
Various studies highlight the phenotypical difference in behavior between BTBR and B6 WT,
as the BTBR is often used in autism research. For example, novelty induced activity is greater
in BTBR WT than B6 WT 11–13 but decreased in home-cage conditions11. Furthermore, motor
performance of the BTBR WT is inferior to the B6 WT on the rotarod12,14. However, mixed
results are described for the differences between the strains in anxiety-related behavior and
learning and memory. For anxiety-related behavior, no differences13, a reduction11, and an
increase of anxiety-related behavior of BTBR WT 12 compared to B6 WT are reported.
Similar contradicting results are described for learning and memory. Some articles show an
intact ability to master a short-term or long-term memory task by both backgrounds11,13.
Others report memory deficits in for instance short-term novel object memory in the
B6 WT13, reversal learning in the BTBR11, and cued and contextual fear conditioning in
BTBR9,15. The deficits found in the BTBR could be restored with an increase in training15
and cage enrichment9. These results clearly indicate differences between the BTBR and B6
WT individuals in domains important in PKU research. It highlights that the fundaments
on which the PKU genotype is induced are already different. Therefore, it is important to
![Page 27: University of Groningen Phenylketonuria in mice and men ... · Phenylketonuria in mice and men Proefschrift ter verkrijging van de graad van doctor aan de Rijksuniversiteit Groningen](https://reader034.vdocuments.site/reader034/viewer/2022052611/5f03c1e37e708231d40a9ed0/html5/thumbnails/27.jpg)
512536-L-bw-Bruinenberg512536-L-bw-Bruinenberg512536-L-bw-Bruinenberg512536-L-bw-BruinenbergProcessed on: 15-8-2017Processed on: 15-8-2017Processed on: 15-8-2017Processed on: 15-8-2017 PDF page: 26PDF page: 26PDF page: 26PDF page: 26
26
Chapter 2
characterize the different strains’ biochemical profile along with behavioral outcome in order
to highlight similarities and, most of all, differences between the strains, providing better
translational insight in the use of the PKU mouse model. For this reason, this study aims
to directly compare male BTBR and B6 mice in terms of amino acid-and neurotransmitter
levels, and behavioral and cognitive performance under identical laboratory conditions (e.g.
food regime, housing conditions, and experimental design). We particularly aimed to answer
two specific questions: 1) Do WT and PKU mice of the two strains differ from each other?
and 2) Do PKU mice differ from WT mice within a strain? To this aim, the mice were
behaviorally tested in four PKU relevant domains previously described in the literature for
at least one of the strains, namely 1) activity levels, 2) motor performance, 3) anxiety and/or
depression-like behavior, and 4) learning and memory.
2. MATERIAL AND METHODS
2.1 Animals
Heterozygous mating pairs of either BTBR or B6 mice were bred to obtain male
BTBR WT, BTBR PKU, B6 WT, and B6 PKU mice. Original breeding pairs of B6 were
obtained from the lab of Prof. Dr. Thöny, University of Zürich, Switzerland and in our
hands crossed back every fifth generation with the C57Bl/6JRj (Janvier). The breeding
pairs of the BTBR were kindly provided by Prof. Puglisi-Allegra, Sapienza University of
Rome, Italy. They obtained the original BTBR-Pahenu2/J parental pairs from Jackson
Laboratories (Bar Harbor, ME, USA)16 All individuals were weaned on postnatal day
28 and tissue obtained at weaning was used to establish genotype with quantitative
PCR (forward primer: 5’ CCGTCCTGTTGCTGGCTTAC 3’, reverse primer: 3’
CAGGTGTGTACATGGGCTTAGATC 5, WT probe: CCGAGTCZZLCALTGCA, PKU
probe: CCGAGTCZLLCACTGCA, aimed at exon 7 of the PAH gene (Eurogentec, Fremont,
USA). Mice were group housed until the start of the experiment in a cage with a paper role
and nesting material. Animals were tested around the age of 4-5 months. All mice were
housed individually in cages with a paper role and nesting material seven days before the
experiment. Mice were handled by the researcher for two minutes on the three consecutive
days before the start of the first behavioral paradigm. The reported behavioral paradigms
were obtained from two separate cohorts of 10 males for each group. In the first cohort, in
chronological order, we examined the open field (OF), long-term novel object recognition
(NOR), long-term spatial object recognition (SOR), and the forced swim test (FST). In
the second cohort, in chronological order, we examined home-cage activity, the elevated
plus maze (EPM), and the balance beam (BB). An overview of the time line is given in
figure 1A. During the experiment, animals had ad libitum access to water and normal chow
(RMH-B 2181, ABdiets, Phe: 8.7 g/kg food) and were kept on a 12/12 light/dark cycle.
All experimental measurements, except for home-cage activity, were performed between
Zeitgeber Time 1 (ZT1) and ZT6. All proceedings were carried out in accordance with the
![Page 28: University of Groningen Phenylketonuria in mice and men ... · Phenylketonuria in mice and men Proefschrift ter verkrijging van de graad van doctor aan de Rijksuniversiteit Groningen](https://reader034.vdocuments.site/reader034/viewer/2022052611/5f03c1e37e708231d40a9ed0/html5/thumbnails/28.jpg)
512536-L-bw-Bruinenberg512536-L-bw-Bruinenberg512536-L-bw-Bruinenberg512536-L-bw-BruinenbergProcessed on: 15-8-2017Processed on: 15-8-2017Processed on: 15-8-2017Processed on: 15-8-2017 PDF page: 27PDF page: 27PDF page: 27PDF page: 27
2
27
Chapter 2
recommendation of the Guide for the Care and Use of Laboratory Animals of the National
Institutes of Health (The ARRIVE Guidelines Checklist) and protocols were approved by
the Institutional Animal Care and Use Committee of the University of Groningen (Permit
No 6731A and 6731D).
Figure 1 Overview of behavioral paradigms. (A) Time line of the study. The first cohort started
with an open field (OF) and novel object recognition test (NOR), 5 days later followed by a spatial
object recognition test (SOR) and three weeks later a Forced swim test (FST). After the FST, the mice
were sacrificed. The second cohort was monitored for five days with passive infrared sensors (PIR),
subsequently 24 hours later tested in the elevated plus maze (EPM) and 24 hours later on the balance
beam (BB). (B) OF and NOR setup. The habituation phase of the NOR was used as OF. For the analysis
![Page 29: University of Groningen Phenylketonuria in mice and men ... · Phenylketonuria in mice and men Proefschrift ter verkrijging van de graad van doctor aan de Rijksuniversiteit Groningen](https://reader034.vdocuments.site/reader034/viewer/2022052611/5f03c1e37e708231d40a9ed0/html5/thumbnails/29.jpg)
512536-L-bw-Bruinenberg512536-L-bw-Bruinenberg512536-L-bw-Bruinenberg512536-L-bw-BruinenbergProcessed on: 15-8-2017Processed on: 15-8-2017Processed on: 15-8-2017Processed on: 15-8-2017 PDF page: 28PDF page: 28PDF page: 28PDF page: 28
28
Chapter 2
with ethovision, the arena was divided in three regions; 1) corner, 2) border, and 3) center. The NOR
was started 24 hours after the habituation phase, in which the animals could freely explore two identical
objects. Again 24 hours later, one object was replaced for a new object. (C) The SOR was performed in
two days. The first day the mice were exposed to four trials of six min with a two min break in between.
The first trial was a habituation phase and the second to fourth trial the mice could explore three
different objects in a specific configuration. 24 hours later, one object was moved to another position.
2.2 Amino acid and neurotransmitter analyses
Two hours after the FST, animals were anesthetized with isoflurane. When the hind paw
reflex was no longer present, blood samples were taken via heart puncture and collected
in heparin tubes (temporarily stored at 4ºC). Brains were removed from the skull and
cerebrum was immediately flash frozen. To obtain blood plasma, heparin tubes with the
blood samples were centrifuged at 1,500 rcf for ten minutes and the supernatant was taken.
Plasma and brain samples were stored at -80ºC until further processing. Amino acid and
neurotransmitter analyses were performed as described in van Vliet et al. 201517.
2.3. Open field test
Activity and anxiety-like behavior were assessed in a square OF test (50x50x35 cm) with a
white Plexiglas floor and gray Plexiglas walls with a checkerboard cue on one of the walls.
This same arena was used for the NOR and SOR. In all tests with this arena, dim lighting
was used (10 lux in the center of the arena). At the start of the trial, the animal was placed in
the middle of the OF and left to explore the arena freely for ten minutes. All trials were video
recorded and were analyzed at a later time with Ethovision v.11. In this analysis, the arena
was divided into a center zone, four border zones, and four corner zones 18. Activity was
quantified by the distance moved and anxiety-like behavior was examined by the preference
of the animal to seek out the more sheltered zones.
2.4 Novel object recognition
NOR was used to examine the ability of the mice to recall a familiar object after a delay of
24 hours. This widely used learning and memory paradigm and the SOR task (see section
2.5 below) are both based on the innate exploratory behavior of mice towards novel stimuli.
If mice successfully recall the previous event, they will increase exploration towards the
novel stimuli and in the SOR a displaced object19,20. In figure 1B is shown that the NOR
test consists of three phases; the habituation phase, the familiarization phase, and the test
phase 20. The OF test was used as the habituation phase. The familiarization phase was
performed twenty-four hours after the habituation phase. Within this phase, the mice were
allowed to freely explore two identical objects. Twenty-four Hours later, mice were exposed
to one previously encountered object and one novel object in the test phase. The objects were
randomized over the trials. All phases were ten minutes long and video recorded. The read-
out parameter of the NOR test was the time spent exploring the novel object compared to
![Page 30: University of Groningen Phenylketonuria in mice and men ... · Phenylketonuria in mice and men Proefschrift ter verkrijging van de graad van doctor aan de Rijksuniversiteit Groningen](https://reader034.vdocuments.site/reader034/viewer/2022052611/5f03c1e37e708231d40a9ed0/html5/thumbnails/30.jpg)
512536-L-bw-Bruinenberg512536-L-bw-Bruinenberg512536-L-bw-Bruinenberg512536-L-bw-BruinenbergProcessed on: 15-8-2017Processed on: 15-8-2017Processed on: 15-8-2017Processed on: 15-8-2017 PDF page: 29PDF page: 29PDF page: 29PDF page: 29
2
29
Chapter 2
the previously encountered object, expressed as the ratio of novel object exploration time to
total exploration time of both objects. The exploratory behavior was scored manually with
the program ELINE (developed in house).
2.5 Spatial object recognition
In the SOR test, mice were tested for their ability to recognize the displaced object after
twenty-four hours. Within this test, the displaced object that caused the new configuration
of objects was the novel stimulus. SOR was tested five days after the NOR test. Comparable
to the NOR test, the SOR test consisted of a habituation phase, a familiarization phase, and
a test phase (figure 1C). In the habituation phase, the mice could explore the arena without
objects, similar to the previous OF. In the familiarization phases 2-4, the mice were placed
in the same arena with three objects with different shapes and different materials (pottery,
RVS, and glass) in a specific configuration. Twenty-four hours later, in the test phase, one of
the outer objects was displaced (randomized between experimental groups). All trials were
six minutes long and video recorded for analysis at a later time point. Between habituation
phase and the familiarization phase, the mice were placed in their home cage and the arena
was cleaned with 30% ethanol. All trials were manually scored for exploratory behavior
with the program ELINE. The discrimination index for NOR was calculated by dividing
the exploration time of the novel object by the total exploration time multiplied with 100.
In contrast to NOR, in the SOR test it was not possible to keep all objects in the same
distance from the walls and from each other in both familiarization and test phases, because
the limitation of three objects in a rectangular space. Therefore, a correction was made for
possible a priori preference for location or object. This correction was done by calculating
the mean time spent on exploring each object in the three training sessions of the first day.
These cumulative exploration times were set as a percentage of the overall exploration time.
The difference between exploration time in the test trial and mean exploration time in the
three training sessions was calculated and expressed as a percentage difference. A positive
value depicts an increased preference of the individual towards the object in retrospect of
possible innate preference at for hand.
2.6 Forced swim test
The original FST21 used to test antidepressants, consists of a pre-test session of fifteen
minutes and a test session of five minutes twenty-four hours later. The now commonly used
FST to assess depressive-like behavior without intervention consists of one trial 22 and was
used in this study. Mice were placed in a 5,000 ml cylinder containing 2,000 mL of 27
C tap water for six minutes. All trials were recorded with a video camera positioned in
front of the cylinder. These videos were analyzed with ELINE and scored for the behaviors
swimming, struggling, and floating. Swimming was defined as a controlled motion in which
the animals used all four paws. Floating behavior was defined as an immobile state with only
small movements of one paw to keep balance. Finally, struggling was defined as any other
![Page 31: University of Groningen Phenylketonuria in mice and men ... · Phenylketonuria in mice and men Proefschrift ter verkrijging van de graad van doctor aan de Rijksuniversiteit Groningen](https://reader034.vdocuments.site/reader034/viewer/2022052611/5f03c1e37e708231d40a9ed0/html5/thumbnails/31.jpg)
512536-L-bw-Bruinenberg512536-L-bw-Bruinenberg512536-L-bw-Bruinenberg512536-L-bw-BruinenbergProcessed on: 15-8-2017Processed on: 15-8-2017Processed on: 15-8-2017Processed on: 15-8-2017 PDF page: 30PDF page: 30PDF page: 30PDF page: 30
30
Chapter 2
behavior to keep the head above water. This was often done with hasty movements of all
four paws towards the side of the cylinder with a vertical body position. Literature shows
that an increase in floating behavior is consistent with a more depression-like phenotype21,22.
2.7 Home-cage activity
To examine spontaneous activity in a familiar environment, individuals were monitored with
a passive infrared (PIR) detector in their home cage. After seven days of individual housing,
which included three days of handling, the animals were subjected to five consecutive days
of PIR registration starting at ZT1. Starting at midnight, four days (96 hours) were analyzed
with ACTOVIEW 23. This program calculates the average activity from the files produced by
the activity management system (CAMS) collected from the PIR.
2.6 Balance beam
The BB task was used to assess coordination and balance as previously described in Mazzola
et al. 201524. In short, animals were trained over three distances (10, 40, and 75 cm) to cross
a square wooden beam (length 1 m, width 5 mm, height 10 mm, horizontally positioned
50 cm above the underlying surface) to their home cage. This is followed by a read-out trial
of 100 cm. At the start and between trials, the animals were left in their home cage for one
minute. In this study, the performance of the animal was measured by the number of correct
steps as a percentage of the total steps necessary to cross the beam. A correct step was
defined by the full placement of the hind paw on the beam from the initiation of the step to
replacing it on the beam in a forward motion.
2.7. Elevated Plus Maze
The second measurement of anxiety-like behavior is the EPM25,26. This paradigm is also based
on the innate exploratory behavior of the mice but this exploratory drive is counteracted
by the reluctance of the mice to explore open and raised areas. The apparatus used for this
paradigm was a plus-shaped maze with two open and two closed arms connected in the
middle with an open center zone. The closed arms were surrounded by walls of 16 cm that
were open at the top. The open arms solely had a small ridge (2 mm) surrounding the arms.
The length of the arms was 29.5 cm and the center zone was 5x5 cm. The whole apparatus
was positioned 50 cm above the ground. Low lighting conditions were used (30 lux open
arms). At the start of the eight minutes trial, the animals were placed with their head in the
middle of the center zone, pointing towards an open arm. The trials were manually scored
for the following parameters: number of open arm entries and closed arm entries, and the
time spent in open arms and closed arms. The maze was divided into three zones: open arms,
closed arms and center. Entering into a new zone with four paws was seen as an entry and
time recordings were taken from this point. A percentual score for each zone was calculated
by dividing the time spent in a certain area by the total time.
![Page 32: University of Groningen Phenylketonuria in mice and men ... · Phenylketonuria in mice and men Proefschrift ter verkrijging van de graad van doctor aan de Rijksuniversiteit Groningen](https://reader034.vdocuments.site/reader034/viewer/2022052611/5f03c1e37e708231d40a9ed0/html5/thumbnails/32.jpg)
512536-L-bw-Bruinenberg512536-L-bw-Bruinenberg512536-L-bw-Bruinenberg512536-L-bw-BruinenbergProcessed on: 15-8-2017Processed on: 15-8-2017Processed on: 15-8-2017Processed on: 15-8-2017 PDF page: 31PDF page: 31PDF page: 31PDF page: 31
2
31
Chapter 2
2.8 Statistical analysis
A one-way ANOVA was used in the statistical analysis of the data. When the one-way
ANOVA resulted in a p-value ≤0.05, a Bonferroni posthoc test was performed. As the
research question in the introduction did not focus on the comparison between PKU
individuals and the opposing WT group, the statistical outcome of these comparisons (BTBR
WT vs B6 PKU and B6 WT vs BTBR PKU) will not be discussed. To further investigate
the learning and memory tasks, the discrimination index of each group was tested with
a paired Student’s t-test. A statistical significant difference was defined as p≤0.05. Values
two standard deviations outside the mean were viewed as outliers and discarded from the
analysis.
3. RESULTS
3.1 Phe measurements in blood and brain.
To examine if the identical point mutation in two different strains resulted in similar amino
acid levels under the same food regimes, amino acid measurements were performed in blood
and brain (figure 1A-B). Phe levels differed between the groups in blood (F(3,17)=106.129,
p<0.001) and brain (F(3,18)=306.510, p<0.001). In blood, BTBR PKU showed Phe
concentrations of 1270.8±82.3 µmol/L, a 6.3-fold increase compared to the BTBR WT (Phe
200.8±82.3 µmol/L, p<0.001). In B6 PKU, a Phe concentration of 1632.5±313.2 µmol/L was
observed, which was a 26.2-fold rise compared to WT littermates (Phe 62.3±7.7 µmol/L,
p<0.001). In respect to the blood Phe concentrations, brain Phe content in BTBR PKU
mice were 699.5±46.9 nmol/g wet weight and in B6 PKU 666.8±65.4 nmol/g wet weight,
resulting in respectively a 3.4-fold and 5.1-fold increase compared to WT littermates (BTBR
WT 205.6±13.3 nmol/g wet weight, B6 WT 128.5±12.8 nmol/g wet weight, p<0.001 for
both). A comparison between strains showed that B6 PKU individuals had higher levels of
Phe in blood than BTBR (p=0.036), what was also found in the brain Phe levels between WT
individuals (p=0.034). Additional amino acids measurements in blood and brain are provided
as supplementary material. In blood of the B6 strain, additional genotype differences were
found in blood valine (p=0.007), isoleucine (p=0.001) and leucine (p=0.002). In the BTBR
strain, only differences were found in tyrosine (p<0.001). The altered blood amino acid
concentrations did not translate to similar changes in brain amino acid concentration. In
brain, only tyrosine levels were reduced in B6 PKU compared to B6 WT (p=0.001).
![Page 33: University of Groningen Phenylketonuria in mice and men ... · Phenylketonuria in mice and men Proefschrift ter verkrijging van de graad van doctor aan de Rijksuniversiteit Groningen](https://reader034.vdocuments.site/reader034/viewer/2022052611/5f03c1e37e708231d40a9ed0/html5/thumbnails/33.jpg)
512536-L-bw-Bruinenberg512536-L-bw-Bruinenberg512536-L-bw-Bruinenberg512536-L-bw-BruinenbergProcessed on: 15-8-2017Processed on: 15-8-2017Processed on: 15-8-2017Processed on: 15-8-2017 PDF page: 32PDF page: 32PDF page: 32PDF page: 32
32
Chapter 2
Figure 2 Phenylalanine concentrations in blood and brain. (A) Phenylalanine concentrations in blood
(µmol/L) (n=4-6), and (B) Phenylalanine content in the brain (nmol/g) (n=5-6) of BTBR and C57Bl/6
(B6) wild-type (WT) and phenylketonuria (PKU) mice. * p≤0.05; mean±SEM
3.2 Monoaminergic neurotransmitters in brain
To further investigate the consequence on the biochemical level of the identical point
mutation in both PKU strains, monoaminergic neurotransmitters together with the
associated metabolite content were examined in the brain (Fig. 3A-C). First, in figure 3A,
the catecholamine dopamine did not significantly differ between groups (F(3,19)=1.094,
p=0.376). Second, further downstream the catecholamine pathway, norepinephrine (NE) did
show differences between the groups (figure 3B; F(3,19)=20.384, p<0.001). Norepinephrine
levels were reduced to 53% in B6 PKU compared to WT littermates (p<0.001) and a trend
towards a reduction of 63% was observed in BTBR PKU (p=0.061). B6 WT showed a higher
norepinephrine content compared to BTBR WT (p=0.002). Finally, in figure 2C, serotonin
levels showed differences between the groups (F(3,19)=14.053, p<0.001) in which BTBR PKU
showed a 57% reduction (p=0.012) and B6 PKU a 50% reduction (p<0.001). No significant
differences were observed between the WTs and PKUs of both strains (both: p=1.000).
3.3 Activity
The behavioral phenotype was examined in four domains, starting with locomotor activity that
was assessed in three experimental test conditions. First, home-cage activity measurements were
taken to assess baseline locomotor activity (figure 4A). A significant difference was observed
between the WT of both strains (F(3,33)=10.185, p<0.001, BTBR WT vs B6 WT, p<0.001)
and the PKU and WT individuals of the BTBR (p=0.017). Such a difference was not observed
in the B6 strain (p=1.000). Second, the distance moved in an open field was measured to assess
novelty-induced locomotion (figure 4B). In this novel environment, a significant difference
was found between strains (F(3,34)= 14.093, p<0.001, BTBR WT vs BTBR B6 p=0.006,
BTBR PKU vs B6 PKU, p<0.001) in which the B6 moved a greater distance. Furthermore,
in contrast to the home-cage activity measurements, no significant differences were found
![Page 34: University of Groningen Phenylketonuria in mice and men ... · Phenylketonuria in mice and men Proefschrift ter verkrijging van de graad van doctor aan de Rijksuniversiteit Groningen](https://reader034.vdocuments.site/reader034/viewer/2022052611/5f03c1e37e708231d40a9ed0/html5/thumbnails/34.jpg)
512536-L-bw-Bruinenberg512536-L-bw-Bruinenberg512536-L-bw-Bruinenberg512536-L-bw-BruinenbergProcessed on: 15-8-2017Processed on: 15-8-2017Processed on: 15-8-2017Processed on: 15-8-2017 PDF page: 33PDF page: 33PDF page: 33PDF page: 33
2
33
Chapter 2
in genotype (BTBR: p=1.000, B6: p=1.000). Finally, entries in the elevated plus maze were
used to examine novelty-induced locomotion in a different arena. The results did not show
significant differences between the groups (F(3,36)=0.916, p=0.443).
Figure 3 Neurotransmitter analyses. (A) Dopamine (B) Norepinephrine (C) Serotonin (n=6 for all
groups except for BTBR PKU n=5). * p≤0.05; mean±SEM
Figure 4 Activity. (A) Distance moved in an open field (n=9-10). (B) Home-cage activity measured by
PIR (n=9-10). * p≤0.05; mean±SEM
![Page 35: University of Groningen Phenylketonuria in mice and men ... · Phenylketonuria in mice and men Proefschrift ter verkrijging van de graad van doctor aan de Rijksuniversiteit Groningen](https://reader034.vdocuments.site/reader034/viewer/2022052611/5f03c1e37e708231d40a9ed0/html5/thumbnails/35.jpg)
512536-L-bw-Bruinenberg512536-L-bw-Bruinenberg512536-L-bw-Bruinenberg512536-L-bw-BruinenbergProcessed on: 15-8-2017Processed on: 15-8-2017Processed on: 15-8-2017Processed on: 15-8-2017 PDF page: 34PDF page: 34PDF page: 34PDF page: 34
34
Chapter 2
3.4 Motor performance
In figure 5 it is clear that the motor performance, assessed by the percentage of correct
steps in the read-out trial, differed significantly (F(3,36)=16.479, p<0.001 respectively). In
both strains, PKU individuals showed a lower percentage of correct steps compared to WT
individuals (BTBR: p=0.001, B6 p<0.001). No significant differences were observed between
strains (WTs p=1.000, PKUs p=1.000).
Figure 5 Motor performance. The number of correct steps in the probe trail is depicted as a percentage
of the total steps necessary to cross the beam (n=9-10). * p≤0.05; mean±SEM
3.5 Anxiety and depressive-like behavior
Anxiety and depressive-like behavior were examined by the use of the OF, the EPM, and the
FST (Fig.6A-D). In the OF, time spent in the corners significantly differed between groups
(F(3,34)=9.164, p<0.001). B6 PKU significantly spent more time in the corners compared
to the BTBR PKU (p<0.001). Particularly, the B6 PKU individuals spent approximately
50% of the time in the corners which was more than their WT littermates (p=0.024). In
addition, the EPM showed a difference in the percentage of time spent in the closed arms
(F(3,34)=10.302, p<0.001). This significant difference was found between the strains (WTs
p=0.001, PKU’s p=0.004) but not between the PKU and WT individuals of each strain (BTBR:
p=1.000, B6: p=1.000). Finally, the FST used to examine depressive-like behavior, showed
significant differences in the amount of time spent on floating (F(3,34)=6.155, p=0.002),
struggling (F(3,34)=11.092; p<0.001), and swimming (F(3,34)=3.634, p=0.022). Floating
and struggling differed only between B6 PKU and B6 WT but not between BTBR PKU
and BTBR WT (floating: p=0.003, p=1.000, struggling; p=0.002, p=0.140, respectively). In
swimming, only a significant reduction of swimming behavior was observed in BTBR PKU
individuals compared to BTBR WT (BTBR: p=0.047, B6 p=0.221).
![Page 36: University of Groningen Phenylketonuria in mice and men ... · Phenylketonuria in mice and men Proefschrift ter verkrijging van de graad van doctor aan de Rijksuniversiteit Groningen](https://reader034.vdocuments.site/reader034/viewer/2022052611/5f03c1e37e708231d40a9ed0/html5/thumbnails/36.jpg)
512536-L-bw-Bruinenberg512536-L-bw-Bruinenberg512536-L-bw-Bruinenberg512536-L-bw-BruinenbergProcessed on: 15-8-2017Processed on: 15-8-2017Processed on: 15-8-2017Processed on: 15-8-2017 PDF page: 35PDF page: 35PDF page: 35PDF page: 35
2
35
Chapter 2
Figure 6 Anxiety- and depressive-like behavior. (A) The time spent in the corners of the open field, the
most sheltered areas of the arena. The habituation phase of the NOR was used as open field (n=9-10).
(B) Time spent in the closed arms of the elevated plus maze (n=10). (C) Floating behavior in the forced
swim test (n=9-10) (D) Struggling behavior in the forced swim test (n=9-10). * p≤0.05; mean±SEM
3.6 Learning and memory
Learning and memory were assessed by the NOR and SOR tests (Fig7A,B). The performance
on the discrimination index of the novel object and the displaced object showed a trend
between groups (NOR: F(3,36)=2.818, p=0.053, SOR: (F(3,34)=2.775, p=0.056). To test
whether each group learned the task, a paired t-test was used to examine if either the novel
object differed from the same object or the displaced object from the non-displaced object.
In NOR, the B6 WT (t(9)=-2.265, p=0.050) and B6 PKU (t(8)=2.762, p=0.030) learned
the task. Within the BTBR WT a trend was observed (t(9)=-2.153, p=0.060). The PKU
![Page 37: University of Groningen Phenylketonuria in mice and men ... · Phenylketonuria in mice and men Proefschrift ter verkrijging van de graad van doctor aan de Rijksuniversiteit Groningen](https://reader034.vdocuments.site/reader034/viewer/2022052611/5f03c1e37e708231d40a9ed0/html5/thumbnails/37.jpg)
512536-L-bw-Bruinenberg512536-L-bw-Bruinenberg512536-L-bw-Bruinenberg512536-L-bw-BruinenbergProcessed on: 15-8-2017Processed on: 15-8-2017Processed on: 15-8-2017Processed on: 15-8-2017 PDF page: 36PDF page: 36PDF page: 36PDF page: 36
36
Chapter 2
BTBR did not learn the task (t(9)=0.986, df=9, p=0.350). In SOR, BTBR WT (t(9)=2.335,
p=0.044), B6 WT (t(8)=3.076, p=0.015), and B6 PKU (t(8)=2.762, p=0.025) learned the
task. Again, PKU BTBR mice did not learn the task (t=-0.314, df=9, p=0.761). No significant
differences were found in the exploration of the objects in the NOR test (F(3,36)=1.093,
p=0.364). In the test session of the SOR, the BTBR mice explored the objects overall more
than the B6 mice (F(3,36)=5.463, p=0.003, BTBR compared to B6 p<0.001).
Figure 7 Learning and memory. (A) Discrimination index of NOR (n=10) (B) Discrimination index of
SOR (n=8-10). * p≤0.05, ~ p=0.06; mean±SEM
4. DISCUSSION
Here, we directly compared the two strains of the PKU mouse model in behavioral domains
previously described for at least one of the two strains in literature (activity levels, motor
performance, anxiety and/or depression-like behavior, and learning and memory) and PKU-
related biochemical parameters in the same laboratory using the same experimental settings.
Distinct differences in behavioral outcome between the two strains were found in all four
above-mentioned domains, regardless of comparable biochemical changes in amino acid
and neurotransmitter content. The result of the mutation in the PAH enzyme on behavior
was most pronounced in the PKU BTBR mice, revealing changes in home-cage activity,
reduced motor performance, and learning and memory deficits. In contrast, compared to
B6 WT mice, PKU B6 mice only showed reduced motor performance and indications of
differences in anxiety-like behavior. Therefore, differences in the phenotypical outcome of
the BTBR and B6 PKU mouse model seem to be primarily due to factors inherent to the
genetic background of the mouse and much less to differences in biochemical parameters in
blood and brain that are typically described for PKU pathology.
![Page 38: University of Groningen Phenylketonuria in mice and men ... · Phenylketonuria in mice and men Proefschrift ter verkrijging van de graad van doctor aan de Rijksuniversiteit Groningen](https://reader034.vdocuments.site/reader034/viewer/2022052611/5f03c1e37e708231d40a9ed0/html5/thumbnails/38.jpg)
512536-L-bw-Bruinenberg512536-L-bw-Bruinenberg512536-L-bw-Bruinenberg512536-L-bw-BruinenbergProcessed on: 15-8-2017Processed on: 15-8-2017Processed on: 15-8-2017Processed on: 15-8-2017 PDF page: 37PDF page: 37PDF page: 37PDF page: 37
2
37
Chapter 2
4.1 Learning and memory are intact in B6 PKU
On a behavioral level, the cognitive outcome is consistently used to assess the severity of
the PKU pathology and effectiveness of (new) treatments. This study confirms the cognitive
deficits described for BTBR PKU mice in the literature. However, we show for the first time
that B6 PKU mice can master a learning and memory paradigm despite severe disruptions
in amino acid and neurotransmitter content in the brain. The differences in phenotypical
behavior could lay in a different ability to understand the cognitive demands of a learning
and memory paradigm of the genetic background. In the literature, a direct comparison
between BTBR WT and B6 WT shows mixed results. As mentioned in the introduction,
some articles show an intact ability to master a short-term or long-term memory task by
both strains11,13. In contrast, memory deficits in short-term novel object memory in the B613,
reversal learning in the BTBR11, and cued and contextual fear conditioning in BTBR9,15 have
been reported. The deficits found in BTBR could be restored with an increase in training15 and
cage enrichment9. In our study, difficulties to master the learning and memory paradigms by
BTBR WT were also found for the NOR but not for the SOR. This outcome could have been
influenced by the order of testing (the NOR always preceded the SOR), or the number of
training sessions (a single training phase in NOR, versus three training phases in SOR). Our
results together with literature suggest that BTBR WT mice have more difficulties mastering
a learning and memory paradigm compared to B6 WT mice. It is up for discussion whether
and to what degree the PKU behavioral phenotype in the BTBR PKU is a result of weakening
a poor learner, creating a deficit, or that the strong learner (B6 WT) is able to compensate.
4.2 Can PKU-related biochemical changes affect both strains differently?
Both strains showed a vast increase in Phe levels and disrupted serotonin and norepinephrine
levels in the brain (for norepinephrine a trend was observed for BTBR statistically) which
is in accordance with previous studies17,27–29. How these PKU-related changes can result
in a different functional outcome is not clear. Concerning raised Phe concentrations, in in
vitro models of PKU, increased Phe concentrations seems to affect post- and presynaptic
markers, proteins involved in cytoskeleton organization, and neuronal morphology30–35.
In vivo, although both strains show changes in different markers related to synaptic
functioning, both BTBR PKU and B6 PKU show affected synaptic plasticity and overall
neuronal functioning29,31,36,37. Differences are found between BTBR WT and B6 WT
in adult neurogenesis and neurodevelopmental markers but not in the synaptic markers
synaptophysin and postsynaptic density protein (PSD-95) that are discussed in PKU
literature38. The reduced neurogenesis together with altered neurodevelopmental markers in
BTBR WT indicates that BTBR could have a different brain development compared to B6
WT38. As changes in Phe and neurotransmitters are chronically present at a very early age,
we assume that neurodevelopment differs between BTBR PKU and B6 PKU. An indication
that this is the case is given by the work of Andolina et al. 201129. In their study they could
improve dendritic spine maturation and performance in a short-term version of the NOR and
![Page 39: University of Groningen Phenylketonuria in mice and men ... · Phenylketonuria in mice and men Proefschrift ter verkrijging van de graad van doctor aan de Rijksuniversiteit Groningen](https://reader034.vdocuments.site/reader034/viewer/2022052611/5f03c1e37e708231d40a9ed0/html5/thumbnails/39.jpg)
512536-L-bw-Bruinenberg512536-L-bw-Bruinenberg512536-L-bw-Bruinenberg512536-L-bw-BruinenbergProcessed on: 15-8-2017Processed on: 15-8-2017Processed on: 15-8-2017Processed on: 15-8-2017 PDF page: 38PDF page: 38PDF page: 38PDF page: 38
38
Chapter 2
SOR tests with a seven-day treatment (PND-14-21) with 5-hydroxytryptophan, a precursor
of serotonin29. It is not clear if B6 mice only have a different neonatal development or
that they also have different susceptibility towards neurotransmitter depletion in life. Some
indications present in literature suggest that B6 can differ from BTBR in their response to
neurotransmitter manipulations. For instance, a comparison of acute tryptophan depletion,
a method to deplete serotonin, both B6 and BTBR WT’s show a decrease in serotonin but the
tryptophan depletion only altered social interaction and social novelty behaviors in B6 and not
in BTBR39. Furthermore, administration of the serotonin agonist 3-chlorophenylpiperazine
(CCP) in WT B6 has not affected locomotor activity nor performance of the B6 in learning
and memory paradigm40. Finally, in a conditional knock-out mouse maintained on a B6
genetic background, a significant decrease in serotonin and norepinephrine concentrations
did not affect locomotor activity, motor performance and anxiety- and depression-related
behaviors 41. These examples highlight that in addition to the differences found between
BTBR WT and B6 WT in neurodevelopment, the consequence of neurotransmitter depletion
in later life (without differences in development) could be different between BTBR and B6.
Therefore, we hypothesize that the PKU-related changes in Phe and neurotransmitters affect
both strains differently during neurodevelopment and later in life resulting in a difference in
phenotypical behavior.
4.3 Considerations in testing behavior
In this study, we identified differences between PKU of the B6 background and the PKU of
the BTBR background. As all domains seem to be affected to some extent, an important
consideration is the possibility that altered behavior in one domain can influence the
outcome nonspecifically in another behavioral paradigm. For example, deficits found in
motor performance in the BB of both genetic backgrounds could influence the outcome in
the OF, EPM, SOR, NOR, and FST. However, we did not clearly find an influence of motor
performance in behavioral paradigms with a low level of required motor performance (OF,
EPM, NOR, SOR) as both strains did not reduce activity in the OF and the EPM, and
no differences were found in exploration of the objects in the NOR. Therefore, the mice
were not hampered to fulfill the key feature of the task. However, the task that required
most motor skills, i.e. the FST, could be affected by the motor problems found in PKU.
Accordingly, we observed that the PKU mice from both backgrounds showed difficulties
in maintaining a floating position and correct swimming behavior during the FST. As a
result, we believe that the changes found in the FST are primarily attributed to deficits in
motor performance. Therefore, we conclude that the FST in PKU mice is not well suited for
examining depressive-like behavior in PKU mice and conclusions in this domain should,
therefore, be drawn with caution.
![Page 40: University of Groningen Phenylketonuria in mice and men ... · Phenylketonuria in mice and men Proefschrift ter verkrijging van de graad van doctor aan de Rijksuniversiteit Groningen](https://reader034.vdocuments.site/reader034/viewer/2022052611/5f03c1e37e708231d40a9ed0/html5/thumbnails/40.jpg)
512536-L-bw-Bruinenberg512536-L-bw-Bruinenberg512536-L-bw-Bruinenberg512536-L-bw-BruinenbergProcessed on: 15-8-2017Processed on: 15-8-2017Processed on: 15-8-2017Processed on: 15-8-2017 PDF page: 39PDF page: 39PDF page: 39PDF page: 39
2
39
Chapter 2
4.4 The translational value of the PKU mouse model
The differences in behavioral outcome between PKU mice of both strains emphasizes that
the consequences of the PAH mutation are influenced by other factors than Phe levels
alone. Although the underlying mechanisms may be different, B6 PKU mice may resemble
the human situation where some specific untreated PKU patients with high blood Phe
concentrations have clearly escaped from the severe symptoms of PKU42.
To conclude, this study showed clear differences in PKU behavioral phenotype between BTBR
and B6 mice despite similar biochemical phenotype. It contributes to a better translational
insight in the use of the PKU mouse model. Future research should consider these differences
when choosing one of the genetic strains to investigate the underlying mechanisms of PKU
and/or new treatment targets. As the origin of BTBR and B6 PKU strains between labs may
differ (or the frequency of backcrossing), our results also stress the need for a better genetic
understanding of these strains used by research groups worldwide. Nevertheless, we would
like to emphasize that both PKU strains have their own translational value for studying PKU
and developing novel interventional strategies to battle the burden of the disease, as they
may represent different patient populations.
SUPPLEMENTAL DATA
Table 1. Amino acid concentrations in blood (µmol/L). Each column depicts the mean concentration of
the amino acids ± standard deviation. The greek symbols are used to highlight significant differences;
α= a difference between BTBR WT and BTBR PKU, β= a difference between B6 WT and B6 PKU, γ= a
difference between BTBR PKU and B6 PKU (n=4-6).
BTBR B6WT PKU WT PKU
Phenylalanine 200.8 ± 82.3 1270.8 ± 87.5 α 58.3 ± 2.4 1632.5 ± 313.2 β,γ
Tyrosine 65.4 ± 6.3 27.8 ± 10.9 α 53.0 ± 4.1 38.0 ± 19.8
Valine 247.8 ± 26.0 237.0 ± 30.2 181.2 ± 10.3 277.2 ± 70.2 β
Isoleucine 89.8 ± 6.8 92.5 ± 13.4 68.7 ± 11.6 104.3 ± 15.4 β
Leucine 148.6 ± 14.7 140.3 ± 21.7 117.8 ± 12.0 170.0 ± 27.5 β
Histidine 62.8 ± 7.0 65.0 ± 3.6 51.2 ± 2.4 67.7 ± 19.4
Threonine 144.2 ± 21.5 131.5 ± 7.3 116.7 ± 7.0 156.5 ± 47.1
![Page 41: University of Groningen Phenylketonuria in mice and men ... · Phenylketonuria in mice and men Proefschrift ter verkrijging van de graad van doctor aan de Rijksuniversiteit Groningen](https://reader034.vdocuments.site/reader034/viewer/2022052611/5f03c1e37e708231d40a9ed0/html5/thumbnails/41.jpg)
512536-L-bw-Bruinenberg512536-L-bw-Bruinenberg512536-L-bw-Bruinenberg512536-L-bw-BruinenbergProcessed on: 15-8-2017Processed on: 15-8-2017Processed on: 15-8-2017Processed on: 15-8-2017 PDF page: 40PDF page: 40PDF page: 40PDF page: 40
40
Chapter 2
Table 2. Amino acid concentrations in brain (nmol/g). Each column depicts the mean concentration of
the amino acids ± standard deviation. The greek symbols are used to highlight significant differences;
α= a difference between BTBR WT and BTBR PKU, β= a difference between B6 WT and B6 PKU, γ= a
difference between BTBR PKU and B6 PKU, δ= a difference between BTBR WT and B6 WT (n=5-6).
BTBR B6WT PKU WT PKU
Phenylalanine 205.6 ± 13.3 699.5 ± 46.9 β 128.5 ± 12.8 δ 666.8 ± 65.4 β
Tyrosine 125.4 ± 9.4 107.8 ± 19.7 128.0 ± 19.8 81.6 ± 1.5 β
Valine 84.4 ± 14.3 94.5 ± 21.4 93.2 ± 8.7 67.4 ± 10.5 γ
Isoleucine 53.0 ± 7.6 65.0 ± 17.7 54.0 ± 8.4 48.6 ± 5.1
Leucine 198.4 ± 19.1 224.2 ± 41.5 200.7 ± 20.5 175.8 ± 8.0
Histidine 90.4 ± 9.7 124.0 ± 10.2 86.7 ± 10.9 95.2 ± 5.3 γ
Threonine 370.2 ± 18.9 347.8 ± 32.3 347.3 ± 38.2 300.2 ± 32.2
Methionine 80.0 ± 18.1 93.8 ± 22.8 77.3 ± 10.0 62.8 ± 8.2 γ
Tryptophan 10.2 ± 4.0 12.3 ± 4.4 13.0 ± 4.1 10.2 ± 5.4
![Page 42: University of Groningen Phenylketonuria in mice and men ... · Phenylketonuria in mice and men Proefschrift ter verkrijging van de graad van doctor aan de Rijksuniversiteit Groningen](https://reader034.vdocuments.site/reader034/viewer/2022052611/5f03c1e37e708231d40a9ed0/html5/thumbnails/42.jpg)
512536-L-bw-Bruinenberg512536-L-bw-Bruinenberg512536-L-bw-Bruinenberg512536-L-bw-BruinenbergProcessed on: 15-8-2017Processed on: 15-8-2017Processed on: 15-8-2017Processed on: 15-8-2017 PDF page: 41PDF page: 41PDF page: 41PDF page: 41
2
41
Chapter 2
5. REFERENCES
1 Holmes A, Wrenn CC, Harris AP, Thayer
KE, Crawley JN. Behavioral profiles of
inbred strains on novel olfactory, spatial
and emotional tests for reference memory in
mice. Genes Brain Behav 2002; 1: 55–69.
2 Sittig LJ, Carbonetto P, Engel KA, Krauss
KS, Barrios-Camacho CM, Palmer AA.
Genetic Background Limits Generalizability
of Genotype-Phenotype Relationships.
Neuron 2016; 91: 1253–1259.
3 Alam I, McQueen AK, Acton D, Reilly
AM, Gerard-O’Riley RL, Oakes DK et al.
Phenotypic severity of autosomal dominant
osteopetrosis type II (ADO2) mice on
different genetic backgrounds recapitulates
the features of human disease. Bone 2017;
94: 34–41.
4 Doetschman T. Influence of Genetic
Background on Genetically Engineered
Mouse Phenotypes. 2009, pp 423–433.
5 Blau N, van Spronsen FJ, Levy HL.
Phenylketonuria. Lancet 2010; 376: 1417–
27.
6 Shedlovsky A, McDonald JD, Symula
D, Dove WF. Mouse models of human
phenylketonuria. Genetics 1993; 134:
1205–10.
7 Wahlsten D, Metten P, Crabbe JC. Survey of
21 inbred mouse strains in two laboratories
reveals that BTBR T/+ tf/tf has severely
reduced hippocampal commissure and
absent corpus callosum. Brain Res 2003;
971: 47–54.
8 Jones-Davis DM, Yang M, Rider E, Osbun
NC, da Gente GJ, Li J et al. Quantitative
trait loci for interhemispheric commissure
development and social behaviors in the
BTBR T+ tf/J mouse model of autism. PLoS
One 2013; 8: e61829.
9 MacPherson P, McGaffigan R, Wahlsten D,
Nguyen P V. Impaired fear memory, altered
object memory and modified hippocampal
synaptic plasticity in split-brain mice. Brain
Res 2008; 1210: 179–88.
10 Ding Z, Georgiev P, Thöny B.
Administration-route and gender-
independent long-term therapeutic
correction of phenylketonuria (PKU) in
a mouse model by recombinant adeno-
associated virus 8 pseudotyped vector-
mediated gene transfer. Gene Ther 2006; 13:
587–593.
11 Molenhuis RT, de Visser L, Bruining H,
Kas MJ. Enhancing the value of psychiatric
mouse models; differential expression of
developmental behavioral and cognitive
profiles in four inbred strains of mice. Eur
Neuropsychopharmacol 2014; 24: 945–54.
12 Moy SS, Nadler JJ, Young NB, Perez A,
Holloway LP, Barbaro RP et al. Mouse
behavioral tasks relevant to autism:
phenotypes of 10 inbred strains. Behav
Brain Res 2007; 176: 4–20.
13 Cabib S, Pascucci T, Ventura R, Romano V,
Puglisi-Allegra S. The behavioral profile of
severe mental retardation in a genetic mouse
model of phenylketonuria. Behav Genet
2003; 33: 301–10.
14 Nadler JJ, Zou F, Huang H, Moy SS,
Lauder J, Crawley JN et al. Large-scale
gene expression differences across brain
regions and inbred strains correlate with a
behavioral phenotype. Genetics 2006; 174:
1229–36.
15 Stapley NW, Guariglia SR, Chadman KK.
Cued and contextual fear conditioning in
BTBR mice is improved with training or
atomoxetine. Neurosci Lett 2013; 549:
120–4.
![Page 43: University of Groningen Phenylketonuria in mice and men ... · Phenylketonuria in mice and men Proefschrift ter verkrijging van de graad van doctor aan de Rijksuniversiteit Groningen](https://reader034.vdocuments.site/reader034/viewer/2022052611/5f03c1e37e708231d40a9ed0/html5/thumbnails/43.jpg)
512536-L-bw-Bruinenberg512536-L-bw-Bruinenberg512536-L-bw-Bruinenberg512536-L-bw-BruinenbergProcessed on: 15-8-2017Processed on: 15-8-2017Processed on: 15-8-2017Processed on: 15-8-2017 PDF page: 42PDF page: 42PDF page: 42PDF page: 42
42
Chapter 2
16 Puglisi-Allegra S, Cabib S, Pascucci T,
Ventura R, Cali F, Romano V. Dramatic
brain aminergic deficit in a genetic mouse
model of phenylketonuria. Neuroreport
2000; 11: 1361–4.
17 van Vliet D, Bruinenberg VM, Mazzola
PN, van Faassen MHJR, de Blaauw P,
Kema IP et al. Large Neutral Amino Acid
Supplementation Exerts Its Effect through
Three Synergistic Mechanisms: Proof of
Principle in Phenylketonuria Mice. PLoS
One 2015; 10: e0143833.
18 Hovens IB, Schoemaker RG, van der
Zee EA, Absalom AR, Heineman
E, van Leeuwen BL. Postoperative
cognitive dysfunction: Involvement
of neuroinflammation and neuronal
functioning. Brain Behav Immun 2014; 38:
202–10.
19 Ennaceur A, Delacour J. A new one-trial
test for neurobiological studies of memory
in rats. 1: Behavioral data. Behav Brain Res
1988; 31: 47–59.
20 Antunes M, Biala G. The novel object
recognition memory: neurobiology, test
procedure, and its modifications. Cogn
Process 2012; 13: 93–110.
21 Porsolt RD, Anton G, Blavet N, Jalfre M.
Behavioural despair in rats: a new model
sensitive to antidepressant treatments. Eur J
Pharmacol 1978; 47: 379–91.
22 Bogdanova O V, Kanekar S, D’Anci KE,
Renshaw PF. Factors influencing behavior in
the forced swim test. Physiol Behav 2013;
118: 227–39.
23 Mulder C, Van Der Zee EA, Hut RA,
Gerkema MP. Time-Place Learning and
Memory Persist in Mice Lacking Functional
Per1 and Per2 Clock Genes. J Biol Rhythms
2013; 28: 367–379.
24 Mazzola PN, Bruinenberg V, Anjema
K, van Vliet D, Dutra-Filho CS, van
Spronsen FJ et al. Voluntary Exercise
Prevents Oxidative Stress in the Brain of
Phenylketonuria Mice. JIMD Rep 2015.
doi:10.1007/8904_2015_498.
25 Calabrese EJ. An assessment of anxiolytic
drug screening tests: hormetic dose
responses predominate. Crit Rev Toxicol
2008; 38: 489–542.
26 Belzung C, Griebel G. Measuring normal
and pathological anxiety-like behaviour in
mice: a review. Behav Brain Res 2001; 125:
141–9.
27 Sawin EA, Murali SG, Ney DM. Differential
effects of low-phenylalanine protein sources
on brain neurotransmitters and behavior in
C57Bl/6-Pahenu2 mice. Mol Genet Metab
2014; 111: 452–461.
28 Pascucci T, Giacovazzo G, Andolina
D, Accoto A, Fiori E, Ventura R et
al. Behavioral and neurochemical
characterization of new mouse model of
hyperphenylalaninemia. PLoS One 2013; 8:
e84697.
29 Andolina D, Conversi D, Cabib S,
Trabalza A, Ventura R, Puglisi-Allegra
S et al. 5-Hydroxytryptophan during
critical postnatal period improves
cognitive performances and promotes
dendritic spine maturation in genetic
mouse model of phenylketonuria. Int J
Neuropsychopharmacol 2011; 14: 479–89.
30 Hörster F, Schwab MA, Sauer SW, Pietz J,
Hoffmann GF, Okun JG et al. Phenylalanine
reduces synaptic density in mixed cortical
cultures from mice. Pediatr Res 2006; 59:
544–8.
31 Horling K, Schlegel G, Schulz S, Vierk R,
Ullrich K, Santer R et al. Hippocampal
synaptic connectivity in phenylketonuria.
Hum Mol Genet 2014. doi:10.1093/hmg/
ddu515.
![Page 44: University of Groningen Phenylketonuria in mice and men ... · Phenylketonuria in mice and men Proefschrift ter verkrijging van de graad van doctor aan de Rijksuniversiteit Groningen](https://reader034.vdocuments.site/reader034/viewer/2022052611/5f03c1e37e708231d40a9ed0/html5/thumbnails/44.jpg)
512536-L-bw-Bruinenberg512536-L-bw-Bruinenberg512536-L-bw-Bruinenberg512536-L-bw-BruinenbergProcessed on: 15-8-2017Processed on: 15-8-2017Processed on: 15-8-2017Processed on: 15-8-2017 PDF page: 43PDF page: 43PDF page: 43PDF page: 43
2
43
Chapter 2
32 Zhang Y, Zhang H, Yuan X, Gu X.
Differential effects of phenylalanine on
Rac1, Cdc42, and RhoA expression and
activity in cultured cortical neurons. Pediatr
Res 2007; 62: 8–13.
33 Schlegel G, Scholz R, Ullrich K, Santer
R, Rune GM. Phenylketonuria: Direct
and indirect effects of phenylalanine. Exp
Neurol 2016; 281: 28–36.
34 Zhang H, Gu XF. A study of gene
expression profiles of cultured embryonic
rat neurons induced by phenylalanine.
Metab Brain Dis 2005; 20: 61–72.
35 Li D, Gu X, Lu L, Liang L. Effects of
phenylalanine on the survival and neurite
outgrowth of rat cortical neurons in
primary cultures: possible involvement of
brain-derived neurotrophic factor. Mol Cell
Biochem 2010; 339: 1–7.
36 Liang L, Gu X, Lu L, Li D, Zhang X.
Phenylketonuria-related synaptic changes
in a BTBR-Pah(enu2) mouse model.
Neuroreport 2011; 22: 617–22.
37 Bruinenberg VM, van Vliet D, Attali A, de
Wilde MC, Kuhn M, van Spronsen FJ et al.
A Specific Nutrient Combination Attenuates
the Reduced Expression of PSD-95 in
the Proximal Dendrites of Hippocampal
Cell Body Layers in a Mouse Model of
Phenylketonuria. Nutrients 2016; 8.
doi:10.3390/nu8040185.
38 Stephenson DT, O’Neill SM, Narayan
S, Tiwari A, Arnold E, Samaroo HD et
al. Histopathologic characterization of
the BTBR mouse model of autistic-like
behavior reveals selective changes in
neurodevelopmental proteins and adult
hippocampal neurogenesis. Mol Autism
2011; 2: 7.
39 Zhang WQ, Smolik CM, Barba-Escobedo
PA, Gamez M, Sanchez JJ, Javors MA et
al. Acute dietary tryptophan manipulation
differentially alters social behavior, brain
serotonin and plasma corticosterone in three
inbred mouse strains. Neuropharmacology
2015; 90: 1–8.
40 Vetulani J, Sansone M, Bednarczyk
B, Hano J. Different effects of
3-chlorophenylpiperazine on locomotor
activity and acquisition of conditioned
avoidance response in different strains
of mice. Naunyn Schmiedebergs Arch
Pharmacol 1982; 319: 271–4.
41 Isingrini E, Perret L, Rainer Q, Sagueby S,
Moquin L, Gratton A et al. Selective genetic
disruption of dopaminergic, serotonergic
and noradrenergic neurotransmission:
insights into motor, emotional and addictive
behaviour. J Psychiatry Neurosci 2016; 41:
169–81.
42 Ramus SJ, Forrest SM, Pitt DB, Saleeba JA,
Cotton RG. Comparison of genotype and
intellectual phenotype in untreated PKU
patients. J Med Genet 1993; 30: 401–5.
![Page 45: University of Groningen Phenylketonuria in mice and men ... · Phenylketonuria in mice and men Proefschrift ter verkrijging van de graad van doctor aan de Rijksuniversiteit Groningen](https://reader034.vdocuments.site/reader034/viewer/2022052611/5f03c1e37e708231d40a9ed0/html5/thumbnails/45.jpg)
512536-L-bw-Bruinenberg512536-L-bw-Bruinenberg512536-L-bw-Bruinenberg512536-L-bw-BruinenbergProcessed on: 15-8-2017Processed on: 15-8-2017Processed on: 15-8-2017Processed on: 15-8-2017 PDF page: 44PDF page: 44PDF page: 44PDF page: 44
![Page 46: University of Groningen Phenylketonuria in mice and men ... · Phenylketonuria in mice and men Proefschrift ter verkrijging van de graad van doctor aan de Rijksuniversiteit Groningen](https://reader034.vdocuments.site/reader034/viewer/2022052611/5f03c1e37e708231d40a9ed0/html5/thumbnails/46.jpg)
512536-L-bw-Bruinenberg512536-L-bw-Bruinenberg512536-L-bw-Bruinenberg512536-L-bw-BruinenbergProcessed on: 15-8-2017Processed on: 15-8-2017Processed on: 15-8-2017Processed on: 15-8-2017 PDF page: 45PDF page: 45PDF page: 45PDF page: 45
CHAPTER 3The behavioral phenotype of female
phenylketonuria mice differs partially from male phenylketonuria mice
Bruinenberg VM1, van der Goot E1, van Vliet D2, de Groot M2, Mazzola
PN1,2, van Spronsen FJ2, van der Zee EA1
1Molecular Neurobiology, Groningen Institute for Evolutionary Life Sciences (GELIFES),
University of Groningen, Groningen, the Netherlands, 2Beatrix Children’s Hospital,
University Medical Center Groningen, Groningen, the Netherlands.
![Page 47: University of Groningen Phenylketonuria in mice and men ... · Phenylketonuria in mice and men Proefschrift ter verkrijging van de graad van doctor aan de Rijksuniversiteit Groningen](https://reader034.vdocuments.site/reader034/viewer/2022052611/5f03c1e37e708231d40a9ed0/html5/thumbnails/47.jpg)
512536-L-bw-Bruinenberg512536-L-bw-Bruinenberg512536-L-bw-Bruinenberg512536-L-bw-BruinenbergProcessed on: 15-8-2017Processed on: 15-8-2017Processed on: 15-8-2017Processed on: 15-8-2017 PDF page: 46PDF page: 46PDF page: 46PDF page: 46
46
Chapter 3
ABSTRACT
Introduction
The use of both sexes in preclinical and clinical research is actively advocated in science.
However, the implementation of this recommendation is often lacking. In the preclinical
research of phenylketonuria (PKU) the inclusion of both sexes is limited. The heritable
metabolic disorder PKU is caused by a mutation in the gene for phenylalanine hydroxylase,
a key enzyme in the conversion of phenylalanine (Phe) to tyrosine. The consequent rise in
Phe concentrations in blood and brain has detrimental effects in the brain, for example in
neurotransmitter metabolism. Our recent study showed differences in behavioral outcome
between the two genetic backgrounds of the PKU mouse model used in preclinical research1.
As that study only included male mice, the aim of the present study was to assess the
behavioral phenotype of female PKU mice of both strains in the same behavioral paradigms;
1) activity, 2) motor performance, 3) anxiety-like behavior, and 4) learning and memory.
Materials & Methods
Female wild type (WT) and PKU mice of each strain were tested in two cohorts (BTBR
WT, BTBR PKU, B6 WT, and B6 PKU, n=10 per group/per cohort). In the first cohort, the
behavior of the mice was assessed in the open field (OF), long-term novel object recognition
(NOR), and long-term spatial object recognition (SOR). In the second cohort, the mice were
tested in home-cage activity, the elevated plus maze (EPM), and the balance beam (BB).
Results
1) For activity, a PKU phenotype was seen in the BTBR strain only in the OF (p<0.001).
A PKU phenotype was lacking in other activity measurements. 2) In motor performance,
a similar deficit was found in the BTBR and B6 strain (both p<0.001). 3) Only in the OF,
a preference for sheltered areas was found for the PKU mice of both backgrounds (BTBR:
p=0.014, B6: p=0.047). 4) Both the BTBR PKU and the B6 PKU mice did not master the
learning and memory paradigms (NOR: BTBR p=0.317, B6=0.516, SOR: BTBR p=0.565,
B6 p=0.310)
Conclusion/Discussion
In contrast to the previously described differences in behavioral phenotype of male PKU
mice of both genetic backgrounds, the PKU females of both strains showed a similar PKU
phenotype. Together these studies highlight that the outcome of the PKU pathophysiology
is influenced not only by genetic background, but also by sex. By including both males and
females in PKU research, PKU research into the underlying mechanism of brain dysfunction
and new treatment strategies will benefit the PKU population.
![Page 48: University of Groningen Phenylketonuria in mice and men ... · Phenylketonuria in mice and men Proefschrift ter verkrijging van de graad van doctor aan de Rijksuniversiteit Groningen](https://reader034.vdocuments.site/reader034/viewer/2022052611/5f03c1e37e708231d40a9ed0/html5/thumbnails/48.jpg)
512536-L-bw-Bruinenberg512536-L-bw-Bruinenberg512536-L-bw-Bruinenberg512536-L-bw-BruinenbergProcessed on: 15-8-2017Processed on: 15-8-2017Processed on: 15-8-2017Processed on: 15-8-2017 PDF page: 47PDF page: 47PDF page: 47PDF page: 47
3
47
Chapter 3
1. INTRODUCTION
Despite an equivalent number of males and females in the human population, neuroscience
and biochemical research usually neglects this ratio between the sexes. Most of the literature
focused on understanding underlying mechanisms of the healthy and the diseased state is
biased towards males2. Accordingly, the male-biased preclinical research has resulted in
skewed data that is unable to be implemented in females3. This imbalance has, for example,
resulted in reports of adverse effects in females and withdrawal of drug treatments from the
market4. To prevent these adverse effects in females and the annulment of years of research,
the use of both sexes is increasingly advocated5. However, in many research fields these
recommendations are not yet implemented, including the field of phenylketonuria (PKU).
In PKU, the first step of the catabolic pathway of phenylalanine (Phe) is disrupted. The
inborn error existing in the converting step of Phe to tyrosine causes the characterizing
increase in Phe concentrations in blood and brain. When no restrictions are made in
protein intake, patients exhibit severe mental disabilities and developmental delays6. To
understand the underlying mechanism of these detrimental effects, a PKU mouse model has
been introduced7. This PKU mouse model originated from mutagenesis in the black and tan
brachyuryblack (BTBR) mouse strain, resulting in a mouse model that had a point mutation
in the enzyme Phe hydroxylase (Pah). As a consequence, no catalytic activity of the enzyme is
present and Phe concentrations rise in blood and brain. Clear limitations of the BTBR strain
in the brain morphology and breeding capacity were the main reason to start back crossing
of the original model onto the C57Bl/6 (B6). Recent research has shown a clear difference in
the behavioral phenotype in male BTBR Pahenu2 and B6 Pahenu mice1. However, it is not clear
what the behavioral phenotype of the female mice of both strains is.
In studies concerning the PKU mouse model, limited studies investigate both sexes or
females8–13. In some of these studies sex differences are described for behavioral response,
biochemical consequence and/or treatment response. For example, while no sex differences
were found in the marble burying test, vertical activity in the open field had a clear
PKU phenotype in female B6 but not in male B69. In addition, the same study showed
sex differences in the neurotransmitters (e.g. norepinephrine, epinephrine, the metabolite
of dopamine 3,4-dihydroxyphenylacetic acid (DOPAC), and serotonin) and response to
glycomacropeptide or amino acid supplementation9. Furthermore, one of the first studies on
gene therapy has shown sex difference in dose response and duration of adeno-associated
virus-treatment in the ability to restore PAH functioning8. These studies give a first indication
that sex can influence the phenotypical outcome of PKU. However, a study examining an
array of PKU-related behavioral paradigms in female PKU mice of both genetic backgrounds
is lacking. Therefore, the aim of this study was to assess the behavioral phenotype of female
PKU mice. From our own work, it is clear that the genetic background (BTBR or B6) of
![Page 49: University of Groningen Phenylketonuria in mice and men ... · Phenylketonuria in mice and men Proefschrift ter verkrijging van de graad van doctor aan de Rijksuniversiteit Groningen](https://reader034.vdocuments.site/reader034/viewer/2022052611/5f03c1e37e708231d40a9ed0/html5/thumbnails/49.jpg)
512536-L-bw-Bruinenberg512536-L-bw-Bruinenberg512536-L-bw-Bruinenberg512536-L-bw-BruinenbergProcessed on: 15-8-2017Processed on: 15-8-2017Processed on: 15-8-2017Processed on: 15-8-2017 PDF page: 48PDF page: 48PDF page: 48PDF page: 48
48
Chapter 3
the PKU mouse model can influence the behavioral phenotype1. Therefore, female mice of
both genetic backgrounds are assed in the identical behavioral paradigms of this study1. The
behavioral paradigms can be subdivide in four behavioral domains: 1) activity, 2) motor
performance, 3) anxiety-like behavior, and 4) learning and memory.
2. MATERIAL AND METHODS
2.1 Animal and experimental design
The experimental design of this study was identical to the study described in Bruinenberg
et al. (2016)1. The fundamental steps of this design will be discussed briefly. Two cohorts of
female wild-type (WT) and PKU mice of each strain (BTBR WT, BTBR PKU, B6 WT, and
B6 PKU, n=10 per group/per cohort) were derived from heterozygous mating pairs. The
offspring was weaned at post-natal 28 and group housed until the start of the experiment at
the age of 4-5 months. The mice were subjected to a battery of behavioral paradigms. In the
first cohort, the mice were tested in the open field (OF), long-term novel object recognition
(NOR), and long-term spatial object recognition (SOR). In the second cohort, home-cage
activity, the elevated plus maze (EPM), and the balance beam (BB) were performed. Seven
days before the start of each cohort, the mice were individually housed and handled three
times in the days preceding the start of the first test. Animals were kept on a 12/12 light/
dark cycle with unlimited access to food (RMH-B 2181, AB Diets®, Phe: 8.7 g/kg) and
water. The behavioral tests were performed between zeitgeber (ZT) 1 and 6. All proceedings
were approved by the Institutional Animal Care and Use Committee of the University of
Groningen.
2.2 Behavioral paradigms of cohort 1
The first cohort was subjected to the OF, NOR, and SOR. For these tests an arena (50x50x35
cm) with grey sides and a white floor was used. On the first day, the animals were introduced
to this arena for 10 minutes to explore. This phase used as the OF test. The second day, two
identical glass objects were placed in the arena. Again, the mice could explore the apparatus
for 10 minutes. The third day, one of these objects was replaced by a novel glass object
(the replaced object was randomized over the mice). Hereafter, the mice were not tested for
five days. On day nine, the mice had four sessions of six minutes in the arena for the SOR:
(1) habituation phase, (2-4) acquisition phases wherein a specific configuration of three
different objects was presented (configuration was randomized over the mice). On day ten,
this configuration was changed. All behavioral paradigms were video recorded. In the OF
test, distance moved through the maze and time spend in certain locations of the maze (center
zone, border zone, and corner zone (Figure 3A)14) were analyzed with Ethovision v.11. The
NOR and the SOR were analyzed by hand with the program ELINE (made in house). With
this program, the percentage of time spending exploring an object can be registered. For the
NOR, the difference in time between the time exploring the novel object to familiar object
![Page 50: University of Groningen Phenylketonuria in mice and men ... · Phenylketonuria in mice and men Proefschrift ter verkrijging van de graad van doctor aan de Rijksuniversiteit Groningen](https://reader034.vdocuments.site/reader034/viewer/2022052611/5f03c1e37e708231d40a9ed0/html5/thumbnails/50.jpg)
512536-L-bw-Bruinenberg512536-L-bw-Bruinenberg512536-L-bw-Bruinenberg512536-L-bw-BruinenbergProcessed on: 15-8-2017Processed on: 15-8-2017Processed on: 15-8-2017Processed on: 15-8-2017 PDF page: 49PDF page: 49PDF page: 49PDF page: 49
3
49
Chapter 3
was divided by the total time exploring the objects. For the SOR, the exploration time of the
three habituation phases were set as zero by dividing the time exploring the located object
by the percentual exploring time of the same object in the habituation phase.
2.3 Behavioral paradigms of cohort 2
In the second cohort, the mice were subjected to three measurements, in chronological order;
home-cage activity, elevated plus maze, and balance beam. Similar to cohort 1, the mice were
individually housed seven days before the start of the experiment, including three days of
handling, in cages that where placed underneath a passive infrared detector. After these seven
days, a five-day recording period was started. In de final analysis, the 96 hours started from
midnight on the first day was used for analysis with ACTOVIEW (made in house15). After
home-cage activity measurements, the animals were subjected to an elevated plus maze. The
mice were placed in this plus-shaped maze, consisting of two open and two closed arms, for
eight minutes. With ELINE, the number of open arm entries and closed arm entries, and
the time spent in open arms and closed arms was investigated. Finally, the mice were tested
on motor performance on the balance beam. In this task, the mice were trained to cross a
one-meter long wooden beam by placing the mice further away from the safe house at the
end of the beam (10 cm, 40 cm, and 75 cm). After this training, they were able to cross the
one-meter beam in the read-out trail. The number of slips compared to the total number of
steps in this read-out trail was used as read-out parameter.
2.4 Statistical analysis
Normally distributed data, established with a Shapiro-Wilk test, was tested in a one-
Way ANOVA (owANOVO). Non-normally distributed data was analyzed with the non-
parametric Kruskal-Wallis test. As in Bruinenberg et al. 2016, the statistical analysis was
used to answer if differences were present between WT and PKU mice of each strain and
between genotype of specific strains. When the p-value of the owANOVA was ≤ 0.05, a
Bonforroni post-hoc test was used to examine the differences among these specific groups
(BTBR WT vs. BTBR PKU, B6 WT vs. B6 PKU, BTBR WT vs. B6 WT, and BTBR PKU
vs. B6 PKU). When the Kruskal-Wallis test was ≤ 0.05, a Mann-Whitney U test was used
to examine these differences. If not specified differently, the data is represented as mean ±
standard error of the mean. Tukey’s hinges are used to assess the interquartile range (Q3-
Q1). In the normally distributed data, values outside 1.5 x interquartile range were seen as
outliers and excluded from the statistical analysis.
3. RESULTS
3.1 Activity
Activity was explored in different paradigms within the battery of behavioral paradigms
(Figure 1A/B). In Figure 1A, the average daily activity under home-cage conditions is
![Page 51: University of Groningen Phenylketonuria in mice and men ... · Phenylketonuria in mice and men Proefschrift ter verkrijging van de graad van doctor aan de Rijksuniversiteit Groningen](https://reader034.vdocuments.site/reader034/viewer/2022052611/5f03c1e37e708231d40a9ed0/html5/thumbnails/51.jpg)
512536-L-bw-Bruinenberg512536-L-bw-Bruinenberg512536-L-bw-Bruinenberg512536-L-bw-BruinenbergProcessed on: 15-8-2017Processed on: 15-8-2017Processed on: 15-8-2017Processed on: 15-8-2017 PDF page: 50PDF page: 50PDF page: 50PDF page: 50
50
Chapter 3
depicted (F(3,35)=3.909, p=0.017). No significant differences were found between the PKUs
and WTs of both genetic backgrounds. However, BTBR PKU mice did show a higher activity
than the B6 PKU mice (p=0.018). In Figure 2B, the distance moved through the OF is shown.
This distance is indicative of novelty-induced activity. Here, the BTBR PKU mice covered
less distance compared to the BTBR WT mice (p<0.001), showing a PKU phenotype effect
within the BTBR strain. Furthermore, the BTBR PKU mice moved less than the B6 PKU
mice (p<0.001). No effect of the PKU phenotype was seen in the B6 strain (p=0.097), and no
differences were found between the WTs (p=0.109).
Figure 1 Activity. (A) Passive infrared registration of home-cage activity (arbitrary units) (n=9-10). (B)
The total distance moved in the open field (n=9-10). * p≤0.05; mean±SEM
3.2 Motor performance
To assess motor performance in the mice, the number of correct steps relative to the total
number of steps from the probe trail (100 cm) was calculated. In Figure 2, a clear difference
in this score was shown between PKUs and WTs in both genetic strains (BTBR PKU vs. WT
p<0.001, B6 PKU vs. WT p<0.001). No differences were observed between WTs or PKUs of
both strains (WTs p=0.286, PKUs p=0.475).
Figure 2 Motor performance. The number of correct steps in the balance beam test’s probe trail (100
cm) is expressed as a percentage of the total number of steps necessary to cross the beam (n=9-10). *
p≤0.05; mean±SEM
![Page 52: University of Groningen Phenylketonuria in mice and men ... · Phenylketonuria in mice and men Proefschrift ter verkrijging van de graad van doctor aan de Rijksuniversiteit Groningen](https://reader034.vdocuments.site/reader034/viewer/2022052611/5f03c1e37e708231d40a9ed0/html5/thumbnails/52.jpg)
512536-L-bw-Bruinenberg512536-L-bw-Bruinenberg512536-L-bw-Bruinenberg512536-L-bw-BruinenbergProcessed on: 15-8-2017Processed on: 15-8-2017Processed on: 15-8-2017Processed on: 15-8-2017 PDF page: 51PDF page: 51PDF page: 51PDF page: 51
3
51
Chapter 3
3.3 Anxiety-like behavior
Anxiety-like behavior was examined in two behavioral paradigms, namely the OF and the
EPM (Figure 3A-C). Both mazes used in these behavioral paradigms were designed to offer
the mice sheltered and open areas, i.e. the corners compared to the center in the OF (Figure
3A) and closed arms versus open arms in the EPM. The preference of the animal to seek out
these sheltered locations is thought to represent anxiety-like behavior. In the OF, the groups
differed in time spent in the corners of the arena (F(3,35)=8.511, p<0.001). Both in the
BTBR and B6 background, the PKU mice spent more time in the corners than the WT mice
(BTBR: p=0.014, B6: 0.047). No differences were found between WTs (p=0.199) and PKUs
(p=0.828). In the EPM, the PKU animals of both strains did not seek out the sheltered areas
more than the WT animals, while the B6 PKU mice did spent more time in the closed arms
compared with the BTBR PKU (p=0.003).
Figure 3 Anxiety-like behavior. (A) For Ethovion analysis, the open field was divided in three areas; 1)
corner, 2) border, and 3) center. (B) The time spent in the corners (sum of area 1) of the open field are
depicted (n=9-10). (C) Percentage of time spent in the closed arms of the elevated plus maze (n=9-10).
* p≤0.05; mean±SEM
3.4 Learning and memory
Two learning and memory paradigms were used to examine cognitive performance,
namely NOR and SOR. In both tasks, the ability to identify a novel stimulus by increasing
the exploration above change level was seen as intact ability to master the task. In the
NOR, the BTBR WT mastered the task (t(9)=2.708, p=0.024) but the BTBR PKU did not
(t(9)=1.059, p=0.317). In the B6 WT a trend was observed (t(9)=2.179, p=0.057) but this
![Page 53: University of Groningen Phenylketonuria in mice and men ... · Phenylketonuria in mice and men Proefschrift ter verkrijging van de graad van doctor aan de Rijksuniversiteit Groningen](https://reader034.vdocuments.site/reader034/viewer/2022052611/5f03c1e37e708231d40a9ed0/html5/thumbnails/53.jpg)
512536-L-bw-Bruinenberg512536-L-bw-Bruinenberg512536-L-bw-Bruinenberg512536-L-bw-BruinenbergProcessed on: 15-8-2017Processed on: 15-8-2017Processed on: 15-8-2017Processed on: 15-8-2017 PDF page: 52PDF page: 52PDF page: 52PDF page: 52
52
Chapter 3
tendency was not present in the B6 PKU (t(9)=-0.677, p=0.516). In the SOR, a distinct PKU
phenotype effect was seen in both stains wherein the WTs mastered the task (BTBR WT:
t(9)=3.016, p=0.015, B6 WT: t(9)=4.381, p=0.002) and the PKUs did not (BTBR PKU:
t(9)=0.565, p=0.586, B6 PKU: t(8)=1.084, p=0.310). Overall, trends were observed between
differences between groups (NOR: F(3.36)=2.263, p=0.098, F(3.35)=2.706, p=0.060). No
differences were found in total exploration time in both test phases of the paradigms (NOR:
F(3,36)=1.873, p=0.152, SOR: F(3,33)=2.557, p=0.072).
Figure 4 Learning and memory. (A) Discrimination index of the long-term novel object recognition
(NOR) (n=9-10). A score of zero indicates an equal amount of time spent exploring both objects (B) The
discrimination index of the long-term spatial object recognition (SOR) was corrected for any preference
in location of object at for hand (n=9-10). * p≤0.05, ~ p=0.057 above bars depict statistical analysis
concerning change level; mean±SEM
4. DISCUSSION
In this study, the behavioral phenotype of female PKU mice was assessed in the four
domains; 1) activity, 2) motor performance, 3) anxiety-like behavior, and 4) learning and
memory. In contrast to male PKU mice of both genetic backgrounds1, the effect of the PKU
phenotype of the PKU females of both strains showed a similar outcome (Figure 5). The PKU
phenotype in females was found in motor performance, anxiety-related behavior, and the
learning and memory paradigms. Therefore, this study highlights that the PKU phenotype
of the PKU mouse model is not only influenced by the genetic background1, but can also be
different between males and females. As numerous studies show that males and females can
differ in (brain) morphology, behavior, and physiology, the discussion of this study will only
concentrate on sex differences found in PKU patients. Two hypotheses related to steroid
hormones and neurotransmitter metabolism, and differences in gene expression profiles
between sexes will be considered. Before these topics are discussed, the limitations of the
study will be discussed.
![Page 54: University of Groningen Phenylketonuria in mice and men ... · Phenylketonuria in mice and men Proefschrift ter verkrijging van de graad van doctor aan de Rijksuniversiteit Groningen](https://reader034.vdocuments.site/reader034/viewer/2022052611/5f03c1e37e708231d40a9ed0/html5/thumbnails/54.jpg)
512536-L-bw-Bruinenberg512536-L-bw-Bruinenberg512536-L-bw-Bruinenberg512536-L-bw-BruinenbergProcessed on: 15-8-2017Processed on: 15-8-2017Processed on: 15-8-2017Processed on: 15-8-2017 PDF page: 53PDF page: 53PDF page: 53PDF page: 53
3
53
Chapter 3
4.1. Limitations of the study
In female mice, the fluctuating concentrations of ovarian hormones can influence behavior
in for instance learning and memory16,17. We did not monitor the cycle of the females during
the behavioral paradigms in this study. We assume that mice would be at a random point
in their cycle, as we have tested the females in small groups over a long period of time.
However, we cannot be certain of this. It would be interesting to eliminate sex hormones
to investigate the direct influence of sex hormones on the phenotypical outcome in future
research. Furthermore, including biochemical parameters such as Phe and neurotransmitter
concentration in brain, could give a better understanding of the underlying mechanism of
the gender difference in the phenotypical outcome.
4.2 Differences in the manifestation of PKU between genders.
As in preclinical research, clinical studies investigating gender differences in PKU are limited.
Some of these studies describe gender differences in the outcome parameter, others do not.
For example, no differences were found between PKU males and PKU females in IQ18 or
in gray matter volume of different brain regions19. In contrast, differences were described
in the occurrence of psychiatric disorders, visual attention, dietary control, quality of
life, personality characteristics and behavior18,20–24. The study of Stemerink et al. (2000)
showed that the association between Phe concentrations in plasma and behavioral outcome
is different between males and females (Age range: 8-20 years old)24. In PKU males, a
correlation was found between Phe concentrations measured over a two-year period prior
to evaluation and the clusters introversion and positive-task orientation. In PKU females, the
Phe concentrations of the first two years of life correlated with these clusters24. This finding
could indicate a gender difference in the response to elevated Phe concentrations24. However,
as pointed out by the authors, this result could also be influenced by differences in coping
with the disorder, e.g. differences in social stress associated to PKU or maintaining the
dietary treatment24. In the PKU mouse model, differences are found between sexes in the B6
background but not in the BTBR background. For example, in the BTBR background, both
the male and female BTBR PKU mice showed a PKU phenotype in the learning and memory
paradigms. In the B6 background, only the female PKU mouse model showed behavioral
deficit1. Taken together, our present and previous7 results suggest that (genetic) factors can
influence the phenotypical outcome of PKU.
![Page 55: University of Groningen Phenylketonuria in mice and men ... · Phenylketonuria in mice and men Proefschrift ter verkrijging van de graad van doctor aan de Rijksuniversiteit Groningen](https://reader034.vdocuments.site/reader034/viewer/2022052611/5f03c1e37e708231d40a9ed0/html5/thumbnails/55.jpg)
512536-L-bw-Bruinenberg512536-L-bw-Bruinenberg512536-L-bw-Bruinenberg512536-L-bw-BruinenbergProcessed on: 15-8-2017Processed on: 15-8-2017Processed on: 15-8-2017Processed on: 15-8-2017 PDF page: 54PDF page: 54PDF page: 54PDF page: 54
54
Chapter 3
Male Female
BTBR B6 BTBR B6
Activity
OF
Home-cage activity
Motor performance
BB
Anxiety-like behaviour
OF
EPM
Learning and memory
NOR
SOR
No significant difference
Trend
Significant difference
Figure 5 The comparison between the PKU phenotype of male and female PKU mice. In our previous
study, a PKU phenotype was observed in male BTBR mice in home-cage activity, balance beam (BB),
novel object recognition (NOR), and spatial object recognition (SOR)1. In the male B6, a PKU phenotype
was only observed in the BB and the time spent in the corners of the open field (OF). In this current
study, similar profile was seen in PKU phenotype in female BTBR and B6. Except for the distance moved
trough OF that was only significant different between BTBR WT and BTBR PKU. (EPM=elevated plus
maze)
4.2 Hypothesis 1: Sex hormones and neurotransmitter metabolism
In PKU pathophysiology, disrupted neurotransmitter metabolism plays a key role in the
development of brain dysfunction. In the PKU mouse model (B6) differences are observed
in serotonin, epinephrine, norepinephrine and a metabolite of dopamine between female
mice and male mice, regardless of genotype9. It is not clear if these differences are also
found in the BTBR PKU mouse model. Numerous studies have shown that neurotransmitter
metabolism can be directly influenced by sex hormones. For example, estrogens can affect
the neurotransmission of serotonin and dopamine by influencing concentrations, turnover,
and number and function of receptors25–27. Furthermore, exposure patterns of sex hormones
during development play a key role in the sexual dimorphic development of the brain which,
in turn, can also influence the direct effect of sex hormones later in life28,29. Therefore, the
hypothesis could be raised that different hormonal exposure in (brain) development in
male and female could predispose the sensitivity towards PKU-related changes in males
![Page 56: University of Groningen Phenylketonuria in mice and men ... · Phenylketonuria in mice and men Proefschrift ter verkrijging van de graad van doctor aan de Rijksuniversiteit Groningen](https://reader034.vdocuments.site/reader034/viewer/2022052611/5f03c1e37e708231d40a9ed0/html5/thumbnails/56.jpg)
512536-L-bw-Bruinenberg512536-L-bw-Bruinenberg512536-L-bw-Bruinenberg512536-L-bw-BruinenbergProcessed on: 15-8-2017Processed on: 15-8-2017Processed on: 15-8-2017Processed on: 15-8-2017 PDF page: 55PDF page: 55PDF page: 55PDF page: 55
3
55
Chapter 3
and females differently. However, it is clear from the data we obtained in this study and
the current literature that the gender differences are found in interaction with genetic
background, indicating that the most likely hypothesis includes genetic factors.
4.3 Hypothesis II: Sex differences in gene expression.
Despite similar genome sequences, sexual dimorphism is found in gene expression30.
Approximately 14% of the gene expression in the whole brain of mice is different between
males and females30. This estimation can differ between organs, brain regions and/or
during development30–32. Although sexual dimorphic gene expression does not equal sex
differences in protein levels33, pinpointing gene expression differences could help identify
modifying genes that reduce the impact of PKU-related biochemical changes in B6 PKU male
mice. Especially, future research could investigate the overlap between differences in gene
expression profiles between B6 and BTBR males and between B6 PKU male mice and B6
PKU female mice could narrow the number of genes of interest.
4.4 Conclusion
This study, together with our previous report1, emphasizes that the PKU phenotype is
influenced by many factors including sex and genetic background. Investigating the
underlying mechanisms in which these factors contribute to the PKU phenotype will increase
our understanding of the detrimental effect of PKU. Furthermore, by including females
within studies and as variable in statistical analysis more often, research into the underlying
mechanism and new treatment strategies could further benefit the PKU population.
![Page 57: University of Groningen Phenylketonuria in mice and men ... · Phenylketonuria in mice and men Proefschrift ter verkrijging van de graad van doctor aan de Rijksuniversiteit Groningen](https://reader034.vdocuments.site/reader034/viewer/2022052611/5f03c1e37e708231d40a9ed0/html5/thumbnails/57.jpg)
512536-L-bw-Bruinenberg512536-L-bw-Bruinenberg512536-L-bw-Bruinenberg512536-L-bw-BruinenbergProcessed on: 15-8-2017Processed on: 15-8-2017Processed on: 15-8-2017Processed on: 15-8-2017 PDF page: 56PDF page: 56PDF page: 56PDF page: 56
56
Chapter 3
5. REFERENCES
1 Bruinenberg VM, van der Goot E, van
Vliet D, de Groot MJ, Mazzola PN,
Heiner-Fokkema MR et al. The Behavioral
Consequence of Phenylketonuria in Mice
Depends on the Genetic Background. Front
Behav Neurosci 2016; 10: 233.
2 Beery AK, Zucker I. Sex bias in neuroscience
and biomedical research. Neurosci Biobehav
Rev 2011; 35: 565–72.
3 Miller LR, Marks C, Becker JB, Hurn PD,
Chen W-J, Woodruff T et al. Considering
sex as a biological variable in preclinical
research. FASEB J 2017; 31: 29–34.
4 Soldin OP, Mattison DR. Sex differences in
pharmacokinetics and pharmacodynamics.
Clin Pharmacokinet 2009; 48: 143–57.
5 Sandberg K, Umans JG, Georgetown
Consensus Conference Work Group the
GCCW. Recommendations concerning
the new U.S. National Institutes of Health
initiative to balance the sex of cells and
animals in preclinical research. FASEB J
2015; 29: 1646–52.
6 Blau N, van Spronsen FJ, Levy HL.
Phenylketonuria. Lancet 2010; 376: 1417–
27.
7 Shedlovsky A, McDonald JD, Symula
D, Dove WF. Mouse models of human
phenylketonuria. Genetics 1993; 134:
1205–10.
8 Mochizuki S, Mizukami H, Ogura T, Kure
S, Ichinohe A, Kojima K et al. Long-term
correction of hyperphenylalaninemia
by AAV-mediated gene transfer leads to
behavioral recovery in phenylketonuria
mice. Gene Ther 2004; 11: 1081–6.
9 Sawin EA, Murali SG, Ney DM. Differential
effects of low-phenylalanine protein sources
on brain neurotransmitters and behavior in
C57Bl/6-Pahenu2 mice. Mol Genet Metab
2014; 111: 452–461.
10 Zagreda L, Goodman J, Druin DP,
McDonald D, Diamond A. Cognitive
deficits in a genetic mouse model of the
most common biochemical cause of human
mental retardation. J Neurosci 1999; 19:
6175–82.
11 Mazzola PN, Bruinenberg V, Anjema
K, van Vliet D, Dutra-Filho CS, van
Spronsen FJ et al. Voluntary Exercise
Prevents Oxidative Stress in the Brain of
Phenylketonuria Mice. JIMD Rep 2015.
doi:10.1007/8904_2015_498.
12 van Vliet D, Bruinenberg VM, Mazzola
PN, van Faassen MHJR, de Blaauw P,
Kema IP et al. Large Neutral Amino Acid
Supplementation Exerts Its Effect through
Three Synergistic Mechanisms: Proof of
Principle in Phenylketonuria Mice. PLoS
One 2015; 10: e0143833.
13 van Vliet D, Bruinenberg VM, Mazzola
PN, van Faassen MH, de Blaauw P,
Pascucci T et al. Therapeutic brain
modulation with targeted large neutral
amino acid supplements in the Pah-enu2
phenylketonuria mouse model. Am J Clin
Nutr 2016; 104: 1292–1300.
14 Hovens IB, Schoemaker RG, van der
Zee EA, Absalom AR, Heineman
E, van Leeuwen BL. Postoperative
cognitive dysfunction: Involvement
of neuroinflammation and neuronal
functioning. Brain Behav Immun 2014; 38:
202–10.
15 Mulder C, Van Der Zee EA, Hut RA,
Gerkema MP. Time-Place Learning and
Memory Persist in Mice Lacking Functional
Per1 and Per2 Clock Genes. J Biol Rhythms
2013; 28: 367–379.
![Page 58: University of Groningen Phenylketonuria in mice and men ... · Phenylketonuria in mice and men Proefschrift ter verkrijging van de graad van doctor aan de Rijksuniversiteit Groningen](https://reader034.vdocuments.site/reader034/viewer/2022052611/5f03c1e37e708231d40a9ed0/html5/thumbnails/58.jpg)
512536-L-bw-Bruinenberg512536-L-bw-Bruinenberg512536-L-bw-Bruinenberg512536-L-bw-BruinenbergProcessed on: 15-8-2017Processed on: 15-8-2017Processed on: 15-8-2017Processed on: 15-8-2017 PDF page: 57PDF page: 57PDF page: 57PDF page: 57
3
57
Chapter 3
16 Sabaliauskas N, Shen H, Molla J, Gong
QH, Kuver A, Aoki C et al. Neurosteroid
effects at α4βδ GABAA receptors alter
spatial learning and synaptic plasticity in
CA1 hippocampus across the estrous cycle
of the mouse. Brain Res 2015; 1621: 170–
86.
17 Hamson DK, Roes MM, Galea LAM. Sex
Hormones and Cognition: Neuroendocrine
Influences on Memory and Learning. Compr
Physiol 2016; 6: 1295–337.
18 Pietz J, Fätkenheuer B, Burgard P,
Armbruster M, Esser G, Schmidt H.
Psychiatric disorders in adult patients with
early-treated phenylketonuria. Pediatrics
1997; 99: 345–50.
19 Christ SE, Price MH, Bodner KE, Saville C,
Moffitt AJ, Peck D. Morphometric analysis
of gray matter integrity in individuals with
early-treated phenylketonuria. Mol Genet
Metab 2016; 118: 3–8.
20 Fisch RO, Sines LK, Chang P. Personality
characteristics of nonretarded
phenylketonurics and their family members.
J Clin Psychiatry 1981; 42: 106–13.
21 Cazzorla C, Cegolon L, Burlina AP, Celato
A, Massa P, Giordano L et al. Quality
of Life (QoL) assessment in a cohort of
patients with phenylketonuria. BMC Public
Health 2014; 14: 1243.
22 Smith I, Beasley MG, Wolff OH, Ades AE.
Behavior disturbance in 8-year-old children
with early treated phenylketonuria. Report
from the MRC/DHSS Phenylketonuria
Register. J Pediatr 1988; 112: 403–8.
23 Craft S, Gourovitch ML, Dowton SB,
Swanson JM, Bonforte S. Lateralized
deficits in visual attention in males with
developmental dopamine depletion.
Neuropsychologia 1992; 30: 341–51.
24 Stemerdink BA, Kalverboer AF, van der
Meere JJ, van der Molen MW, Huisman
J, de Jong LW et al. Behaviour and school
achievement in patients with early and
continuously treated phenylketonuria. J
Inherit Metab Dis 2000; 23: 548–62.
25 Pecins-Thompson M, Brown NA, Bethea
CL. Regulation of serotonin re-uptake
transporter mRNA expression by ovarian
steroids in rhesus macaques. Brain Res Mol
Brain Res 1998; 53: 120–9.
26 Bethea CL, Phu K, Belikova Y, Bethea SC.
Localization and regulation of reproductive
steroid receptors in the raphe serotonin
system of male macaques. J Chem
Neuroanat 2015; 66–67: 19–27.
27 Fink G, Sumner BE, Rosie R, Grace O,
Quinn JP. Estrogen control of central
neurotransmission: effect on mood, mental
state, and memory. Cell Mol Neurobiol
1996; 16: 325–44.
28 Knoll J, Miklya I, Knoll B, Dalló J.
Sexual hormones terminate in the rat The
significantly enhanced catecholaminergic/
serotoninergic tone in the brain
characteristic to the post-weaning period.
Life Sci 2000; 67: 765–773.
29 Espinosa P, Silva RA, Sanguinetti NK,
Venegas FC, Riquelme R, González LF et
al. Programming of Dopaminergic Neurons
by Neonatal Sex Hormone Exposure:
Effects on Dopamine Content and Tyrosine
Hydroxylase Expression in Adult Male
Rats. Neural Plast 2016; 2016: 1–11.
30 Yang X, Schadt EE, Wang S, Wang H,
Arnold AP, Ingram-Drake L et al. Tissue-
specific expression and regulation of
sexually dimorphic genes in mice. Genome
Res 2006; 16: 995–1004.
31 Dewing P, Shi T, Horvath S, Vilain E.
Sexually dimorphic gene expression
in mouse brain precedes gonadal
differentiation. Brain Res Mol Brain Res
2003; 118: 82–90.
![Page 59: University of Groningen Phenylketonuria in mice and men ... · Phenylketonuria in mice and men Proefschrift ter verkrijging van de graad van doctor aan de Rijksuniversiteit Groningen](https://reader034.vdocuments.site/reader034/viewer/2022052611/5f03c1e37e708231d40a9ed0/html5/thumbnails/59.jpg)
512536-L-bw-Bruinenberg512536-L-bw-Bruinenberg512536-L-bw-Bruinenberg512536-L-bw-BruinenbergProcessed on: 15-8-2017Processed on: 15-8-2017Processed on: 15-8-2017Processed on: 15-8-2017 PDF page: 58PDF page: 58PDF page: 58PDF page: 58
58
Chapter 3
32 Vawter MP, Evans S, Choudary P, Tomita
H, Meador-Woodruff J, Molnar M et al.
Gender-specific gene expression in post-
mortem human brain: localization to sex
chromosomes. Neuropsychopharmacology
2004; 29: 373–84.
33 Xu J, Watkins R, Arnold AP. Sexually
dimorphic expression of the X-linked gene
Eif2s3x mRNA but not protein in mouse
brain. Gene Expr Patterns 2006; 6: 146–55.
![Page 60: University of Groningen Phenylketonuria in mice and men ... · Phenylketonuria in mice and men Proefschrift ter verkrijging van de graad van doctor aan de Rijksuniversiteit Groningen](https://reader034.vdocuments.site/reader034/viewer/2022052611/5f03c1e37e708231d40a9ed0/html5/thumbnails/60.jpg)
512536-L-bw-Bruinenberg512536-L-bw-Bruinenberg512536-L-bw-Bruinenberg512536-L-bw-BruinenbergProcessed on: 15-8-2017Processed on: 15-8-2017Processed on: 15-8-2017Processed on: 15-8-2017 PDF page: 59PDF page: 59PDF page: 59PDF page: 59
3
59
Chapter 3
![Page 61: University of Groningen Phenylketonuria in mice and men ... · Phenylketonuria in mice and men Proefschrift ter verkrijging van de graad van doctor aan de Rijksuniversiteit Groningen](https://reader034.vdocuments.site/reader034/viewer/2022052611/5f03c1e37e708231d40a9ed0/html5/thumbnails/61.jpg)
512536-L-bw-Bruinenberg512536-L-bw-Bruinenberg512536-L-bw-Bruinenberg512536-L-bw-BruinenbergProcessed on: 15-8-2017Processed on: 15-8-2017Processed on: 15-8-2017Processed on: 15-8-2017 PDF page: 60PDF page: 60PDF page: 60PDF page: 60
![Page 62: University of Groningen Phenylketonuria in mice and men ... · Phenylketonuria in mice and men Proefschrift ter verkrijging van de graad van doctor aan de Rijksuniversiteit Groningen](https://reader034.vdocuments.site/reader034/viewer/2022052611/5f03c1e37e708231d40a9ed0/html5/thumbnails/62.jpg)
512536-L-bw-Bruinenberg512536-L-bw-Bruinenberg512536-L-bw-Bruinenberg512536-L-bw-BruinenbergProcessed on: 15-8-2017Processed on: 15-8-2017Processed on: 15-8-2017Processed on: 15-8-2017 PDF page: 61PDF page: 61PDF page: 61PDF page: 61
CHAPTER 4Sleep disturbances in Phenylketonuria:an explorative study in men and mice
Vibeke M. Bruinenberg1, Marijke C.M. Gordijn2 , Anita MacDonald3,
Francjan J. van Spronsen4, Eddy A. Van der Zee1
1Molecular Neurobiology, Groningen Institute for Evolutionary Life Sciences
(GELIFES), University of Groningen, Groningen, the Netherlands, 2Chrono@work
B.V. and Chronobiology, Groningen Institute for Evolutionary Life Sciences (GELIFES),
University of Groningen, Groningen, the Netherlands, 3Birmingham Children’s Hospital,
Birmingham, United Kingdom, 4Beatrix Children’s Hospital, University Medical Center
Groningen, Groningen, the Netherlands.
Front Neurol. 2017 Apr 26;8:167. doi: 10.3389/fneur.2017.00167. eCollection 2017.
![Page 63: University of Groningen Phenylketonuria in mice and men ... · Phenylketonuria in mice and men Proefschrift ter verkrijging van de graad van doctor aan de Rijksuniversiteit Groningen](https://reader034.vdocuments.site/reader034/viewer/2022052611/5f03c1e37e708231d40a9ed0/html5/thumbnails/63.jpg)
512536-L-bw-Bruinenberg512536-L-bw-Bruinenberg512536-L-bw-Bruinenberg512536-L-bw-BruinenbergProcessed on: 15-8-2017Processed on: 15-8-2017Processed on: 15-8-2017Processed on: 15-8-2017 PDF page: 62PDF page: 62PDF page: 62PDF page: 62
62
Chapter 4
SUMMARY
Sleep problems have not been directly reported in Phenylketonuria (PKU). In PKU, the
metabolic pathway of phenylalanine is disrupted, which, among others, causes deficits
in the neurotransmitters and sleep modulators dopamine, norepinephrine and serotonin.
Understanding sleep problems in PKU patients may help explain the pathophysiology of
brain dysfunction in PKU patients. In this explorative study we investigated possible sleep
problems in adult treated PKU patients and untreated PKU mice. In the PKU patients,
sleep characteristics were compared to healthy first degree relatives by assessment of sleep
disturbances, sleep-wake patterns, and sleepiness with the help of four questionnaires:
Holland sleep disorder questionnaire, Pittsburgh sleep quality index, Epworth sleepiness
scale, and Munich Chronotype Questionnaire. The results obtained with the questionnaires
show that PKU individuals suffer more from sleep disorders, a reduced sleep quality, an
increased latency to fall asleep, and experience more sleepiness during the day. In the PKU
mice, activity patterns were recorded with passive infrared recorders. PKU mice switched
more often between active and non-active behavior and shifted a part of their resting
behavior into the active period, confirming that sleep quality is affected as a consequence
of PKU. Together, these results give the first indication that sleep problems are present in
PKU. More detailed future research will give a better understanding of these problems which
could ultimately result in the improvement of treatment strategies by including sleep quality
as an additional treatment target.
Keywords (max 6): inherited metabolic disorder; Pahenu2 mice; PKU patients; PKU mice;
neurotransmitters; sleep disorders
![Page 64: University of Groningen Phenylketonuria in mice and men ... · Phenylketonuria in mice and men Proefschrift ter verkrijging van de graad van doctor aan de Rijksuniversiteit Groningen](https://reader034.vdocuments.site/reader034/viewer/2022052611/5f03c1e37e708231d40a9ed0/html5/thumbnails/64.jpg)
512536-L-bw-Bruinenberg512536-L-bw-Bruinenberg512536-L-bw-Bruinenberg512536-L-bw-BruinenbergProcessed on: 15-8-2017Processed on: 15-8-2017Processed on: 15-8-2017Processed on: 15-8-2017 PDF page: 63PDF page: 63PDF page: 63PDF page: 63
4
63
Chapter 4
1. INTRODUCTION
In 2014, Gadoth and Oksenberg reviewed the incidence of sleep and sleep disorders in
patients with inherited metabolic disease (IMD). Although their review focused on sleep-
related breathing disorders among severely affected subjects with IMD, the general title
suggested that sleep problems could be missed or underestimated in these conditions. A
metabolic disease in which brain modulators of sleep are severely affected but attention for
sleep research is very limited is phenylketonuria (PKU). PKU is caused by an inborn error in
the metabolic pathway of phenylalanine (Phe) that disrupts the conversion of Phe to tyrosine.
As a result, Phe concentrations build up in blood and brain and the ability to intrinsically
produce the dopamine precursor tyrosine is lost. These changes do not solely affect the
metabolism of dopamine. Also, reduced concentrations of noradrenaline and serotonin are
found in PKU patients1,2 and in the PKU mouse model3. These neurotransmitters are known
to be important regulators of sleep, wakefulness, and switches between these states4,5.
Nevertheless, these abnormalities in neurotransmitter availability are not specifically linked
to possible sleep problems in PKU research. In PKU research, a few studies have indirectly
investigated sleep regulators or sleep. First, in treated and untreated PKU patients, sleep-
EEG measurements indicate differences in the number of sleep spindles despite similar REM
and non-REM distribution compared to healthy controls6. Second, in early treated PKU
infants (4-18 weeks old), EEG measurements show differences in the development of sleep
compared to healthy controls7. Finally, in the PKU mouse model high levels of orexin A
(hypocretin 1) were reported, a neuropeptide that is associated with wakefulness8,9. This
made the authors suggest hyperactivity in PKU, however, the exact consequence of these
increased levels are not clear while hyperactivity is not consistently described in PKU mice10.
Currently, PKU treatment remains suboptimal in which disturbances in executive functions,
mood, social cognition, and in internalizing problems such as depression and anxiety
are described in early-treated PKU patients11,12. As it is well established that altered sleep
negatively influences cognitive performance, most notably in the domains of executive
functioning13–15, and mood by impacting feelings of depression, anxiety and stress16,17, sleep
related issues could very well serve as an explanation of the PKU brain dysfunction despite
diet and drug treatment.
Understanding the presence and severity of sleep problems in PKU patients and its
pathophysiology could ultimately result in the improvement of treatment strategies
by including sleep quality as an additional treatment target. Therefore, the aim of this
explorative study was to investigate the presence of sleep disturbances in PKU patients with
questionnaires together with analyses of rest/wake patterns in PKU mice, indirectly reflecting
sleep characteristics which could confirm the PKU-specific nature of putative sleep issues
in PKU patients. As sleep is influenced by, among others, genetic factors18–21, first-degree
![Page 65: University of Groningen Phenylketonuria in mice and men ... · Phenylketonuria in mice and men Proefschrift ter verkrijging van de graad van doctor aan de Rijksuniversiteit Groningen](https://reader034.vdocuments.site/reader034/viewer/2022052611/5f03c1e37e708231d40a9ed0/html5/thumbnails/65.jpg)
512536-L-bw-Bruinenberg512536-L-bw-Bruinenberg512536-L-bw-Bruinenberg512536-L-bw-BruinenbergProcessed on: 15-8-2017Processed on: 15-8-2017Processed on: 15-8-2017Processed on: 15-8-2017 PDF page: 64PDF page: 64PDF page: 64PDF page: 64
64
Chapter 4
relatives (FDR) of PKU patients and wild-type (WT) littermates of each genetic strain of the
PKU mouse model were used as controls.
2. MATERIALS & METHODS
2.1. PKU patients
2.1.1. Subjects
In the summer of 2016, participants for this study were recruited by distributing a link to
an electronic survey to subjects associated with the Dutch PKU patient organization. PKU
patients and FDR, who did not do shift work in the past three months, were asked to fill
out four questionnaires with ten additional questions (date of birth, zip code, gender, height,
bodyweight, PKU or control, treatment of PKU, other health issues, smoking, and the use of
sleep promoting drugs). All participants were informed about the scientific purpose of the
study and agreed to participate. They completed the questionnaires completely anonymous.
To ensure that the questionnaires were not completed by the same individuals more than
once, the submissions were checked for uniqueness, focusing on date of birth and IP address.
In total, 47 subjects of which 25 PKU patients and 23 controls participated. The Medical
Ethics Review Committee (METC) of the University of Groningen concluded that the
Medical Research Involving Subjects Act did not apply to this study.
2.1.2. Sleep questionnaires
Four validated questionnaires were included in the survey: (1) Holland Sleep Disorders
Questionnaire (HSDQ)22; 40 items, (2) Pittsburgh Sleep Quality Index (PSQI)23; 19 items, (3)
Epworth Sleepiness Questionnaire (ESS)24; 8 items. (4) Munich Chronotype Questionnaire
(MCTQ)25; 16 items. Firstly, the HSDQ gives a general score to identify the possible
occurrence of a sleep disorder and can differentiate between six main categories of sleep
disorders (insomnia, parasomnia, circadian rhythm sleep disorders (CRSD), hypersomnia,
sleep-related movement disorders such as for instance restless legs syndrome, and sleep-
related breathing disorder)22. Secondly, for the PSQI, seven component scores can be
derived (subjective sleep quality, sleep latency, sleep duration, habitual sleep efficiency, sleep
disturbances, use of sleep medication, and daytime dysfunction) and computed to a global
score23. Thirdly, the ESS is used to examine sleepiness during the day (for instance during
reading)24. Finally, the MCTQ was used to identify chronotype (the preferred timing of
sleep) calculated by taking the mid-point of sleep on free days corrected for the sleep debt
acquired during working days26.
2.2 PKU mouse study
To investigate the rest/wake pattern in PKU mice, the home-cage activity of adult (4-7
months) WT and PKU mice of BTBR and C57Bl/6 (B6) background was monitored. Both
genetic strains of the PKU mouse model have a point mutation in the gene encoding for
![Page 66: University of Groningen Phenylketonuria in mice and men ... · Phenylketonuria in mice and men Proefschrift ter verkrijging van de graad van doctor aan de Rijksuniversiteit Groningen](https://reader034.vdocuments.site/reader034/viewer/2022052611/5f03c1e37e708231d40a9ed0/html5/thumbnails/66.jpg)
512536-L-bw-Bruinenberg512536-L-bw-Bruinenberg512536-L-bw-Bruinenberg512536-L-bw-BruinenbergProcessed on: 15-8-2017Processed on: 15-8-2017Processed on: 15-8-2017Processed on: 15-8-2017 PDF page: 65PDF page: 65PDF page: 65PDF page: 65
4
65
Chapter 4
phenylalanine hydroxylase (PAH) causing Phe to rise in blood and brain10. The PKU model
was originally described for the BTBR background but the model was latter crossed back
on to the C57Bl/6J background. Currently, both genetic strains are used in PKU research.
In-house heterozygous mating pairs were used to breed the following groups of mice:
BTBT WT, BTBR PKU, B6 WT, and B6 PKU. These mice were weaned on post-natal day
28 and genotype was established with quantitative PCR10. The experiment consisted of a
habituation phase and a data acquiring phase. After a seven-day habituation phase, the
activity of individual housed mice (cage: 33x15x14cm with nesting material and paper
role) were monitored for seven days with passive infrared detectors (PIR). During the whole
experiment, animals were on a 12/12 light/dark cycle and had ad libitum access to water and
normal chow (RMH-B 2181, ABdiets, Phe: 8.7 g/kg). Data was analyzed with ACTOVIEW
(made in-house, described in 27). This program calculated the average daily activity, diurnality
((Sum activity light phase- sum activity dark phase)/ total activity) and fragmentation28 from
the files produced by the activity management system (CAMS) collected from the PIR. All
proceedings were carried out in accordance to the Guide for the Care and Use of Laboratory
Animals of the National Institutes of Health (The ARRIVE Guidelines Checklist) approved
by the Institutional Animal Care and Use Committee of the University of Groningen.
2.3 Statistics
The statistical analysis was executed with the statistical software IBM SPSS Statistics for
Windows, Version 22.0 (Armonk, NY: IBM Corp.). Within this program the Shapiro-Wilk
was used to test normality of the data. The activity of the mice was normally distributed and
a multi-variate ANOVA was used to test the factors group and gender of overall activity,
fragmentation and diurnality. Differences in group characteristics in the patient study were
not normally distributed and therefore tested with the non-parametric Mann-Whitney U
test. The chronotype score of the MCTQ, normally distributed, was tested with a univariate
ANOVA for group. Age and gender were included as cofactors. The ordinal nature of the
HSDQ, PSQI and ESS scores, made it not possible to test confounding factors parametrically.
Therefore, gender and age were explored with generalized linear models, using an ordinal
model. Differences in the frequency of occurrence of sleep disorders was also tested with a
generalized linear model, using a binary model. Non-parametric Levene’s test was used to
test the homogeneity of the data.
3. RESULTS
3.1 PKU patients
3.1.1. Subjects
This study is a pilot study serving as a proof-of-concept for sleep-related issues due to PKU.
For this reason, individuals were included when they correctly filled out at least one of the
questionnaires. Not all questionnaires were correctly filled out by all subjects which resulted
![Page 67: University of Groningen Phenylketonuria in mice and men ... · Phenylketonuria in mice and men Proefschrift ter verkrijging van de graad van doctor aan de Rijksuniversiteit Groningen](https://reader034.vdocuments.site/reader034/viewer/2022052611/5f03c1e37e708231d40a9ed0/html5/thumbnails/67.jpg)
512536-L-bw-Bruinenberg512536-L-bw-Bruinenberg512536-L-bw-Bruinenberg512536-L-bw-BruinenbergProcessed on: 15-8-2017Processed on: 15-8-2017Processed on: 15-8-2017Processed on: 15-8-2017 PDF page: 66PDF page: 66PDF page: 66PDF page: 66
66
Chapter 4
in different group characteristics for each questionnaire (Table 1). For all questionnaires
responses, the FDR controls were significantly older than the PKU subjects (HSDQ:
p<0.05, PSQI: p<0.05, ESS: p<0.05, MCTQ: p<0.05) but no differences were found in BMI
(HSDQ: p=0.68, PSQI: p=0.92, ESS: p=0.99, MCTQ: p=0.90). Furthermore, no significant
differences were found in gender distribution of the groups (HSDQ: t(44)=-0.603, p=0.55,
PSQI: t(35)=0.172, p=0.87, ESS: t(37)=0.143, p=0.89 , MCTQ: t(39)=-0.260, p=0.80). One
FDR control was excluded because she used several sleep-promoting drugs (Trazodon and
zolpidem tartrate).
3.1.2 Frequency of sleep disorders.
The global score of the HSDQ is used to identify the presence of a sleep disorder with an
overall accuracy of 88% (κ: 0.75)22. In PKU patients, 48 % had a global score above the
cut-off of 2.02, indicative of a sleep disorder, compared to 19 % of FDR controls (Fig.
1A: b=1.367, Wald χ2(1,N=46)=3.983, p<0.05). Especially, among the six main sleep
disorder categories, PKU patients had a higher score for both insomnia and CRSD (Fig
1B: b=-1.527, Wald χ2(1,N=46)=7.626, p<0.05, Fig 1C: b=-1.593, Wald χ2(1,N=46)=8.115,
p<0.05, respectively), but not for the other four categories (parasomnia; b=-0.985, Wald
χ2(1,N=46)=2.941, p=0.086, hypersomnia; b=-0.985, Wald χ2(1,N=46)=3.287, p=0.070,
restless legs syndrome; b=-0.696, Wald χ2(1,N=46)=1.757, p=0.185 and sleep-related
breathing disorder; b=-0.693, Wald χ2(1,N=46)=1.688, p=0.194). Age and gender did not
significantly contribute to these models. These results reveal a higher frequency of sleep
disorders, more specifically insomnia and CRSD, in PKU patients.
3.1.3 Sleep quality
The global PSQI, comprised of seven sleep related components, is used to classify poor (>5)
and good sleepers (≤5). This global score was significantly higher in the PKU patients of
which more people were classified as poor sleepers (57%) compared to the FDR controls
of which 25% were classified as poor sleepers (Fig. 2A: b=-1.674, Wald χ2(1,N=37)=7.102,
p<0.05). Within the global score, two component scores differed between PKU patients
and FDR controls. The first was the component score for latency to fall asleep which was
significantly increased in PKU patients (FDR: 0.44±0.63, PKU: 1.43±0.98, b=-2.306, Wald
χ2(1,N=37)=9.733, p<0.05). The second one was the component score for subjective sleep
quality. This score was computed from the question in which subjects could indicate their
quality of sleep during the past month on a scale of very good (score 0) to very bad (score
3). This score was significantly higher in PKU patients than in the FDR controls (FDR:
0.69±0.60, PKU: 1.38±0.92, b=-1.655, Wald χ2(1,N=37)=5.516, p<0.05). Age and gender
did not significantly contribute to these models. These results suggest that sleep quality is
reduced in PKU patients compared to FDR controls.
![Page 68: University of Groningen Phenylketonuria in mice and men ... · Phenylketonuria in mice and men Proefschrift ter verkrijging van de graad van doctor aan de Rijksuniversiteit Groningen](https://reader034.vdocuments.site/reader034/viewer/2022052611/5f03c1e37e708231d40a9ed0/html5/thumbnails/68.jpg)
512536-L-bw-Bruinenberg512536-L-bw-Bruinenberg512536-L-bw-Bruinenberg512536-L-bw-BruinenbergProcessed on: 15-8-2017Processed on: 15-8-2017Processed on: 15-8-2017Processed on: 15-8-2017 PDF page: 67PDF page: 67PDF page: 67PDF page: 67
4
67
Chapter 4
Tab
le 1
. Sub
ject
cha
ract
eris
tics
. Dat
a is
pre
sent
ed a
s mea
n ±
stan
dard
dev
iati
on. A
bbre
viat
ions
: F=f
emal
e, M
=mal
e, H
SDQ
= H
olla
nd S
leep
Dis
orde
rs Q
uest
ionn
aire
,
PSQ
I=Pi
ttsb
urgh
Sle
ep Q
ualit
y In
dex,
ESS
=Epw
orth
Sle
epin
ess
Que
stio
nnai
re,
MC
TQ
=Mun
ich
Chr
onot
ype
Que
stio
nnai
re,
PKU
= ph
enyl
keto
nuri
a pa
tien
ts,
FDR
-con
trol
= fir
st d
egre
e re
lati
ves-
cont
rol
HSD
QPS
QI
ESS
MC
TQ
PKU
FDR
-con
trol
PKU
FDR
-con
trol
PKU
FDR
-con
trol
PKU
FDR
-con
trol
Num
ber
2521
2115
2217
2417
Age
29.2
± 8
.844
.2 ±
10.
130
.1 ±
9.0
46.6
± 1
029
.6 ±
9.1
45.9
± 1
0.1
29.0
± 8
.945
.9 ±
10.
1
BM
I24
.1 ±
4.3
25.0
± 5
.124
.5 ±
4.3
24.8
± 5
.624
.6 ±
4.2
24.6
± 4
.224
.4 ±
4.1
24.6
± 4
.2
Gen
der
17F/
8M
16F/
5M
15F/
6M
11F/
4M
16 F
/6 M
12 F
/ 5M
16F/
8M
12 F
/ 5M
Smok
ing
41
41
41
41
Hea
th is
sues
50
40
40
50
Slee
p-pr
omot
ing
drug
s5
05
05
05
0
KU
VA
N3
22
3
KU
VA
N+p
rote
in r
estr
icte
d4
33
3
Prot
ein
rest
rict
ed22
1617
18
![Page 69: University of Groningen Phenylketonuria in mice and men ... · Phenylketonuria in mice and men Proefschrift ter verkrijging van de graad van doctor aan de Rijksuniversiteit Groningen](https://reader034.vdocuments.site/reader034/viewer/2022052611/5f03c1e37e708231d40a9ed0/html5/thumbnails/69.jpg)
512536-L-bw-Bruinenberg512536-L-bw-Bruinenberg512536-L-bw-Bruinenberg512536-L-bw-BruinenbergProcessed on: 15-8-2017Processed on: 15-8-2017Processed on: 15-8-2017Processed on: 15-8-2017 PDF page: 68PDF page: 68PDF page: 68PDF page: 68
68
Chapter 4
3.1.4. Sleepiness during the day
In the ESS, the participant subjectively rate the chance of dozing off during eight situations
from “none” (score 0) to “high” (score 3). This score is significantly higher in PKU patients
than FDR controls (Fig 2B: (b=-1.608, Wald χ2(1,N=39)=6.597, p<0.05). A main effect of
age and gender did not contribute significantly to the model. These results suggest that PKU
patients experience more sleepiness during daytime.
3.1.5. Chronotype.
In the MCTQ, the sleep schedules of the participants on working and non-working days
were asked. From this data, we could calculate chronotype, defined as the mid-sleep on free
days corrected for the potential sleep debt acquired during the working days26. Chronotype
is dependent on age and gender26, therefore, statistical analysis included age and gender as a
cofactor. No significant differences were found between chronotype scores in PKU patients
and FDR controls or for any of the cofactors in the complete model (Group: F(1,37)=1.287,
p=0.26, Gender: F(1,37)=0.954, p=0.34, Age: F(1,37)=1.941, p=0.17).
3.2. PKU mice
3.2.1 Rest/wake patterns.
No main or interaction effects were observed for sex in all parameters, therefore, data of
males and female were grouped. The fragmentation score is indicative of the frequency that
active behavior is switched to non-active behavior and vice versa. In PKU mice, in both
strains, the fragmentation score was increased compared to WT (Fig. 3A; F(3,56)=10.803,
p<0.05, BTBR p<0.05, p<0.05). Although differences were found in overall activity between
the WT’s of each strain (BTBR WT: 3162.46±1239.24, B6 WT: 2193.69±785.91 (mean±SD)
F(3,56)=3.858, p<0.05, BTBR WT vs B6 WT p=0.019), the increase in fragmentation
score found in PKU mice did not coincide with a change in overall activity (BTBR PKU:
2655.42±605.23, B6 PKU: 2306.90±860.06, BTBR p=0.67, B6 p=1.000). However, a shift
did occur in the timing of the rest/active behavior. The negative diurnality score, reflecting
night activity in animals, became less negative in PKU mice (Fig. 3B; F(3,56)=8.235, p<0.001,
BTBR p<0.05, B6 p<0.05). These results reveal that PKU mice have increased fragmentation
and a shift in diurnality (more inactive in active phase).
![Page 70: University of Groningen Phenylketonuria in mice and men ... · Phenylketonuria in mice and men Proefschrift ter verkrijging van de graad van doctor aan de Rijksuniversiteit Groningen](https://reader034.vdocuments.site/reader034/viewer/2022052611/5f03c1e37e708231d40a9ed0/html5/thumbnails/70.jpg)
512536-L-bw-Bruinenberg512536-L-bw-Bruinenberg512536-L-bw-Bruinenberg512536-L-bw-BruinenbergProcessed on: 15-8-2017Processed on: 15-8-2017Processed on: 15-8-2017Processed on: 15-8-2017 PDF page: 69PDF page: 69PDF page: 69PDF page: 69
4
69
Chapter 4
Figure 1. HSDQ (A) Results from the global score of HSDQ indicate that 48% of the PKU patients
have a sleep disorder compared to 19% of the FDR controls. (B) PKU patients have a significant higher
insomnia score than FDR controls. Six PKU patients are above the cut-off score compared to zero FDR
controls (C). Although only two PKU patients are above the cut-off score, PKU patients have significant
higher CRSD score compared to FDR controls. Data represents individual scores with median. Dotted
line represents cut-off score between having sleep problem or not. ** p<0.01
Figure 2. PSQI and ESS. (A) The global score of the Pittsburgh Sleep Quality Index (PSQI) was
significantly higher in PKU patients compared to FDR control. The dotted line represents the cut-off
between good and poor sleepers. 57% of the PKU patients are above this cut-off and categorized as
poor sleepers. (B) Epworth Sleepiness Questionnaire (ESS). Patients experience more sleepiness during
the day than FDR controls. Data represents individual scores with median. * p<0.05, ** p<0.01
![Page 71: University of Groningen Phenylketonuria in mice and men ... · Phenylketonuria in mice and men Proefschrift ter verkrijging van de graad van doctor aan de Rijksuniversiteit Groningen](https://reader034.vdocuments.site/reader034/viewer/2022052611/5f03c1e37e708231d40a9ed0/html5/thumbnails/71.jpg)
512536-L-bw-Bruinenberg512536-L-bw-Bruinenberg512536-L-bw-Bruinenberg512536-L-bw-BruinenbergProcessed on: 15-8-2017Processed on: 15-8-2017Processed on: 15-8-2017Processed on: 15-8-2017 PDF page: 70PDF page: 70PDF page: 70PDF page: 70
70
Chapter 4
Figure 3. Characteristics of the rest/wake pattern in mice (A) In both genetic strains of the PKU mouse
model, an increase in fragmentation is seen in the PKU mice compared to WT littermates. Furthermore,
a significant difference is found between the fragmentation score of PKU mice of each strain. (B) In the
graph negative diurnality scores are observed. This indicates that we are investigating animals which
are active in the dark. PKU mice have a less distinct negative score suggesting that they shift part of
their resting behavior into the light phase. Data are depicted as mean ± standard error of the mean. *
p<0.05, ** p<0.01
4. DISCUSSION
In this explorative study, we investigated sleep characteristics in PKU patients with
questionnaires and analyzed the rest/wake patterns in PKU mice. In the PKU patients study,
we showed that PKU patients compared to FDR controls have more sleep disorders, a reduced
sleep quality, an increased latency to fall asleep, and experience more sleepiness during the
day. In the PKU mice, we found an increase in fragmentation and a shift in diurnality. The
increase in fragmentation indicated that the PKU mice switch more often between active and
non-active behavior. This score did not coincide with changes in overall activity. In addition,
PKU mice shift a part from their resting behavior into the active phase (a shift in diurnality).
Both experiments strongly support the hypothesis that sleep is affected in PKU. This seems
to be directly related to the disorders as the deficits were found in both PKU mouse strains
despite their genetic differences and cognitive sensitivity to the PKU condition10.
4.1. Study limitations
Sleep is influenced by, among others, genetic factors, age, and gender 18–21. For this reason,
this study recruited FDR of PKU patients as control group. No differences were found in
gender distributions between the groups, but differences were found in age between FDR
controls and PKU patients. Although we recognize these limitations, we believe that it does
not hamper our results obtained in the first three questionnaires (HSDQ, PSQI, ESS) for the
following reason. Literature shows either no effect or a deterioration of sleep with aging. For
![Page 72: University of Groningen Phenylketonuria in mice and men ... · Phenylketonuria in mice and men Proefschrift ter verkrijging van de graad van doctor aan de Rijksuniversiteit Groningen](https://reader034.vdocuments.site/reader034/viewer/2022052611/5f03c1e37e708231d40a9ed0/html5/thumbnails/72.jpg)
512536-L-bw-Bruinenberg512536-L-bw-Bruinenberg512536-L-bw-Bruinenberg512536-L-bw-BruinenbergProcessed on: 15-8-2017Processed on: 15-8-2017Processed on: 15-8-2017Processed on: 15-8-2017 PDF page: 71PDF page: 71PDF page: 71PDF page: 71
4
71
Chapter 4
example, the PSQI is not affected by age29. The ESS score is influenced by an age x gender
interaction, wherein females tend to have higher scores between 0-39 age group compared
to males30. Around the ages 40-49, the ESS score of males deteriorates reaching the same ESS
score as females. Therefore, the ESS score is either higher or stays constant with increasing
age30. This implies that the higher scores found in the younger PKU patients compared to
the older FDR controls are contrary to what would be expected and likely reflect a real
indication of sleep problems in PKU patients. Moreover, no significant effect of age was
found in our study.
4.2 Sleep characteristics are altered in PKU
The different measurements of sleep used in this study reveal a variety of sleep problems
and show some specifically affected characteristics of sleep. In the HSDQ, PKU patients
show a higher incidence in sleep disorders, but only in the main categories insomnia and
CRSD scores were higher in PKU patients than in FDR controls. CRSD were changed to
circadian rhythm sleep-wake disorders (CRSWD) in the third edition of the International
classification of sleep disorders31. CRSWD are sleep disorders grouped under dyssomnias, a
group of sleep disorders which show insomnia, excessive sleepiness, or difficulty initiating
or maintaining sleep31. In the current study, we found an increased score for insomnia and
an increased sleepiness during the day in the ESS in PKU patients, supporting the idea that
PKU patients experience problems specific for this cluster of sleep disorders. CRSWD are
disorders related to the timing of sleep31. Some are a consequence of external circumstances,
e.g. shift work or jet lag, others have potentially a more internal, neurological basis, e.g.
delayed sleep phase syndrome (DSPS). In DSPS, the latency to fall asleep opposed to the
desired time to fall asleep is delayed. DSPS patients experience difficulties to shift their sleep/
wake pattern to an earlier time point in response to environmental time cues, for example
traveling from Europe to Asia, and do not experience sleepiness when they are able to sleep
at their desired time, as is possible for instance during a holiday or vacation period. In this
study, we showed that PKU patients report an increased latency to fall asleep in the PSQI.
However, we did not see a difference in the midsleep on non-working days when age was
a cofactor. This could be because midsleep is strongly influenced by age and the age was
not distributed evenly over the full width of both groups26. Therefore, an important future
direction is to compare age-matched controls to PKU patients. Further research in PKU
should focus on 1) more objective measurements of sleep such as polysomnography, or sleep-
wake rhythm analysis with 2) phase shift experiments in PKU mice to identify problems in
shifting sleep/wake patterns (and neurological substrates), 3) monitoring sleepiness during
the day specifically during holidays, and 4) core body temperature and dim-light melatonin
rhythm monitoring to investigate if PKU patients experience a blunted or delayed internal
rhythm of physiological markers.
![Page 73: University of Groningen Phenylketonuria in mice and men ... · Phenylketonuria in mice and men Proefschrift ter verkrijging van de graad van doctor aan de Rijksuniversiteit Groningen](https://reader034.vdocuments.site/reader034/viewer/2022052611/5f03c1e37e708231d40a9ed0/html5/thumbnails/73.jpg)
512536-L-bw-Bruinenberg512536-L-bw-Bruinenberg512536-L-bw-Bruinenberg512536-L-bw-BruinenbergProcessed on: 15-8-2017Processed on: 15-8-2017Processed on: 15-8-2017Processed on: 15-8-2017 PDF page: 72PDF page: 72PDF page: 72PDF page: 72
72
Chapter 4
4.3 The switch between sleep and wakefulness is defective in PKU
The HSDQ identifies sleep disorders and attribute certain scores to six symptom clusters. These
clusters may be due to different sleep disorders, possibly with different pathophysiological
mechanism. For instance, the comorbidity of insomnia with other sleep disorders is very
high22. The PKU mouse study did identify a more specific aspect of sleep, namely increased
fragmentation. In general, an increased fragmentation score indicates an increase in
switching behavior. Switching between sleep and wakefulness is thought to be regulated by a
flip-flop switch that results from mutual inhibition of sleep-promoting pathways and wake-
promoting pathways32. Several cholinergic and monoaminergic projections are important
in these pathways, such as serotonin, norepinephrine, and dopamine32. As these latter
neurotransmitters are affected in PKU mice (and in untreated PKU patients), it could be that
the increased fragmentation score is a consequence of disruptions in this switch. In early-
treated patients on diet, neurotransmitter deficiencies in dopamine and serotonin are still
present2. These deficiencies could possibly affect the switch between sleep and wakefulness
and cause fragmentation of the sleep/wake rhythm in PKU patients, more difficulty falling
asleep and as a consequence daytime sleepiness.
4.4. Conclusion
This explorative study is the first to investigate sleep disturbances both in PKU patients and
PKU mice. In PKU patients, we demonstrate more sleep disorders, a reduced sleep quality,
an increased latency to fall asleep, and more sleepiness during the day. We show in PKU mice
an increased fragmentation and a shift in diurnality. These results produce the first evidence
to suggest that sleep problems occur in PKU. The resulting complaints associated with
altered sleep are comparable to the cognitive symptoms described for early and continuously
treated PKU patients. More detailed future research will give a better understanding and
further identify sleep problems in PKU which could ultimately result in the improvement of
treatment strategies by including sleep quality as an additional treatment target.
ACKNOWLEDGEMENTS
The authors would like to thank Dr. Marina C. Giménez for her help with the electronic
survey.
![Page 74: University of Groningen Phenylketonuria in mice and men ... · Phenylketonuria in mice and men Proefschrift ter verkrijging van de graad van doctor aan de Rijksuniversiteit Groningen](https://reader034.vdocuments.site/reader034/viewer/2022052611/5f03c1e37e708231d40a9ed0/html5/thumbnails/74.jpg)
512536-L-bw-Bruinenberg512536-L-bw-Bruinenberg512536-L-bw-Bruinenberg512536-L-bw-BruinenbergProcessed on: 15-8-2017Processed on: 15-8-2017Processed on: 15-8-2017Processed on: 15-8-2017 PDF page: 73PDF page: 73PDF page: 73PDF page: 73
4
73
Chapter 4
5. REFERENCES
1 McKean CM. The effects of high
phenylalanine concentrations on serotonin
and catecholamine metabolism in the
human brain. Brain Res 1972; 47: 469–76.
2 Burlina AB, Bonafé L, Ferrari V, Suppiej
A, Zacchello F, Burlina AP. Measurement
of neurotransmitter metabolites in the
cerebrospinal fluid of phenylketonuric
patients under dietary treatment. J Inherit
Metab Dis 2000; 23: 313–6.
3 van Vliet D, Bruinenberg VM, Mazzola
PN, van Faassen MH, de Blaauw P,
Pascucci T et al. Therapeutic brain
modulation with targeted large neutral
amino acid supplements in the Pah-enu2
phenylketonuria mouse model. Am J Clin
Nutr 2016; 104: 1292–1300.
4 Holst SC, Valomon A, Landolt H-P. Sleep
Pharmacogenetics: Personalized Sleep-Wake
Therapy. Annu Rev Pharmacol Toxicol
2016; 56: 577–603.
5 Eban-Rothschild A, Rothschild G,
Giardino WJ, Jones JR, de Lecea L. VTA
dopaminergic neurons regulate ethologically
relevant sleep–wake behaviors. Nat
Neurosci 2016; 19: 1356–1366.
6 Schulte FJ, Kaiser HJ, Engelbart S,
Bell EF, Castell R, Lenard HG. Sleep
patterns in hyperphenylalaninemia: a
lesson on serotonin to be learned from
phenylketonuria. Pediatr Res 1973; 7: 588–
99.
7 De Giorgis GF, Nonnis E, Crocioni
F, Gregori P, Rosini MP, Leuzzi V et
al. Evolution of daytime quiet sleep
components in early treated phenylketonuric
infants. Brain Dev; 18: 201–6.
8 Surendran S, Rady PL, Szucs S, Michals-
Matalon K, Tyring SK, Matalon R.
High level of orexin A observed in the
phenylketonuria mouse brain is due to the
abnormal expression of prepro-orexin.
Biochem Biophys Res Commun 2004; 317:
522–6.
9 Surendran S, Campbell GA, Tyring SK,
Matalon K, McDonald JD, Matalon R.
High levels of orexin A in the brain of the
mouse model for phenylketonuria: possible
role of orexin A in hyperactivity seen in
children with PKU. Neurochem Res 2003;
28: 1891–4.
10 Bruinenberg VM, van der Goot E, van
Vliet D, de Groot MJ, Mazzola PN,
Heiner-Fokkema MR et al. The Behavioral
Consequence of Phenylketonuria in Mice
Depends on the Genetic Background. Front
Behav Neurosci 2016; 10: 233.
11 Jahja R, van Spronsen FJ, de Sonneville
LMJ, van der Meere JJ, Bosch AM, Hollak
CEM et al. Social-cognitive functioning and
social skills in patients with early treated
phenylketonuria: a PKU-COBESO study. J
Inherit Metab Dis 2016; 39: 355–362.
12 Waisbren SE, Noel K, Fahrbach K, Cella C,
Frame D, Dorenbaum A et al. Phenylalanine
blood levels and clinical outcomes in
phenylketonuria: a systematic literature
review and meta-analysis. Mol Genet Metab
2007; 92: 63–70.
13 Banks S, Dinges DF. Behavioral and
physiological consequences of sleep
restriction. J Clin Sleep Med 2007; 3: 519–
28.
14 Couyoumdjian A, Sdoia S, Tempesta D,
Curcio G, Rastellini E, DE Gennaro L et al.
The effects of sleep and sleep deprivation
on task-switching performance. J Sleep Res
2010; 19: 64–70.
![Page 75: University of Groningen Phenylketonuria in mice and men ... · Phenylketonuria in mice and men Proefschrift ter verkrijging van de graad van doctor aan de Rijksuniversiteit Groningen](https://reader034.vdocuments.site/reader034/viewer/2022052611/5f03c1e37e708231d40a9ed0/html5/thumbnails/75.jpg)
512536-L-bw-Bruinenberg512536-L-bw-Bruinenberg512536-L-bw-Bruinenberg512536-L-bw-BruinenbergProcessed on: 15-8-2017Processed on: 15-8-2017Processed on: 15-8-2017Processed on: 15-8-2017 PDF page: 74PDF page: 74PDF page: 74PDF page: 74
74
Chapter 4
15 Goel N, Rao H, Durmer JS, Dinges DF.
Neurocognitive consequences of sleep
deprivation. Semin Neurol 2009; 29: 320–
39.
16 Short MA, Louca M. Sleep deprivation leads
to mood deficits in healthy adolescents.
Sleep Med 2015; 16: 987–93.
17 Meerlo P, Havekes R, Steiger A. Chronically
restricted or disrupted sleep as a causal
factor in the development of depression.
Curr Top Behav Neurosci 2015; 25: 459–
81.
18 Lind MJ, Aggen SH, Kirkpatrick RM,
Kendler KS, Amstadter AB. A Longitudinal
Twin Study of Insomnia Symptoms in
Adults. Sleep 2015; 38: 1423–30.
19 Barclay NL, Gregory AM. Quantitative
genetic research on sleep: A review of
normal sleep, sleep disturbances and
associated emotional, behavioural, and
health-related difficulties. Sleep Med Rev
2013; 17: 29–40.
20 Gottlieb DJ, O’Connor GT, Wilk JB.
Genome-wide association of sleep and
circadian phenotypes. BMC Med Genet
2007; 8: S9.
21 Paine S-J, Gander PH, Harris R, Reid P.
Who reports insomnia? Relationships with
age, sex, ethnicity, and socioeconomic
deprivation. Sleep 2004; 27: 1163–9.
22 Kerkhof GA, Geuke MEH, Brouwer A,
Rijsman RM, Schimsheimer RJ, Van Kasteel
V. Holland Sleep Disorders Questionnaire:
a new sleep disorders questionnaire based
on the International Classification of Sleep
Disorders-2. J Sleep Res 2013; 22: 104–7.
23 Buysse DJ, Reynolds CF, Monk TH, Berman
SR, Kupfer DJ. The Pittsburgh Sleep Quality
Index: a new instrument for psychiatric
practice and research. Psychiatry Res 1989;
28: 193–213.
24 Johns MW. Reliability and factor analysis
of the Epworth Sleepiness Scale. Sleep 1992;
15: 376–81.
25 Roenneberg T, Kuehnle T, Juda M,
Kantermann T, Allebrandt K, Gordijn M
et al. Epidemiology of the human circadian
clock. Sleep Med Rev 2007; 11: 429–38.
26 Roenneberg T, Kuehnle T, Pramstaller PP,
Ricken J, Havel M, Guth A et al. A marker
for the end of adolescence. Curr Biol 2004;
14: R1038–R1039.
27 Mulder C, Van Der Zee EA, Hut RA,
Gerkema MP. Time-Place Learning and
Memory Persist in Mice Lacking Functional
Per1 and Per2 Clock Genes. J Biol Rhythms
2013; 28: 367–379.
28 van Someren EJ, Hagebeuk EE, Lijzenga
C, Scheltens P, de Rooij SE, Jonker C et al.
Circadian rest-activity rhythm disturbances
in Alzheimer’s disease. Biol Psychiatry 1996;
40: 259–70.
29 Grandner MA, Kripke DF, Yoon I-Y,
Youngstedt SD. Criterion validity of the
Pittsburgh Sleep Quality Index: Investigation
in a non-clinical sample. Sleep Biol Rhythms
2006; 4: 129–139.
30 Boyes J, Drakatos P, Jarrold I, Smith J, Steier
J. The use of an online Epworth Sleepiness
Scale to assess excessive daytime sleepiness.
Sleep Breath 2016. doi:10.1007/s11325-
016-1417-x.
31 American Academy of Sleep Medicine.
International Classification of Sleep
Disorders – Third Edition (ICSD-3). 2014.
32 Saper CB, Fuller PM, Pedersen NP, Lu J,
Scammell TE. Sleep State Switching. Neuron
2010; 68: 1023–1042.
![Page 76: University of Groningen Phenylketonuria in mice and men ... · Phenylketonuria in mice and men Proefschrift ter verkrijging van de graad van doctor aan de Rijksuniversiteit Groningen](https://reader034.vdocuments.site/reader034/viewer/2022052611/5f03c1e37e708231d40a9ed0/html5/thumbnails/76.jpg)
512536-L-bw-Bruinenberg512536-L-bw-Bruinenberg512536-L-bw-Bruinenberg512536-L-bw-BruinenbergProcessed on: 15-8-2017Processed on: 15-8-2017Processed on: 15-8-2017Processed on: 15-8-2017 PDF page: 75PDF page: 75PDF page: 75PDF page: 75
4
75
Chapter 4
![Page 77: University of Groningen Phenylketonuria in mice and men ... · Phenylketonuria in mice and men Proefschrift ter verkrijging van de graad van doctor aan de Rijksuniversiteit Groningen](https://reader034.vdocuments.site/reader034/viewer/2022052611/5f03c1e37e708231d40a9ed0/html5/thumbnails/77.jpg)
512536-L-bw-Bruinenberg512536-L-bw-Bruinenberg512536-L-bw-Bruinenberg512536-L-bw-BruinenbergProcessed on: 15-8-2017Processed on: 15-8-2017Processed on: 15-8-2017Processed on: 15-8-2017 PDF page: 76PDF page: 76PDF page: 76PDF page: 76
![Page 78: University of Groningen Phenylketonuria in mice and men ... · Phenylketonuria in mice and men Proefschrift ter verkrijging van de graad van doctor aan de Rijksuniversiteit Groningen](https://reader034.vdocuments.site/reader034/viewer/2022052611/5f03c1e37e708231d40a9ed0/html5/thumbnails/78.jpg)
512536-L-bw-Bruinenberg512536-L-bw-Bruinenberg512536-L-bw-Bruinenberg512536-L-bw-BruinenbergProcessed on: 15-8-2017Processed on: 15-8-2017Processed on: 15-8-2017Processed on: 15-8-2017 PDF page: 77PDF page: 77PDF page: 77PDF page: 77
CHAPTER 5A novel treatment strategy for phenylketonuria:
exploring the possibilities of nutrients to improve brain function
Vibeke M.Bruinenberg1, Priscila N. Mazzola1,2, Danique van Vliet2,
Danielle S. Counotte3, Maryam Rakhshandehroo3, Mirjam Kuhn3,
Francjan J. van Spronsen2, Eddy A. van der Zee1
1Molecular Neurobiology, Groningen Institute for Evolutionary Life Sciences (GELIFES),
University of Groningen, Groningen, the Netherlands, 2Beatrix Children’s Hospital,
University Medical Center Groningen, Groningen, the Netherlands, 3Nutricia Research,
Nutricia Advanced Medical Nutrition, Utrecht, the Netherlands
![Page 79: University of Groningen Phenylketonuria in mice and men ... · Phenylketonuria in mice and men Proefschrift ter verkrijging van de graad van doctor aan de Rijksuniversiteit Groningen](https://reader034.vdocuments.site/reader034/viewer/2022052611/5f03c1e37e708231d40a9ed0/html5/thumbnails/79.jpg)
512536-L-bw-Bruinenberg512536-L-bw-Bruinenberg512536-L-bw-Bruinenberg512536-L-bw-BruinenbergProcessed on: 15-8-2017Processed on: 15-8-2017Processed on: 15-8-2017Processed on: 15-8-2017 PDF page: 78PDF page: 78PDF page: 78PDF page: 78
78
Chapter 5
Abbreviations
AA Arachidonic acid
BDNF Brain-derived neurotrophic factor
EPA Eicosapentaenoic acid
GABA Gamma-aminobutyric acid
HMGR 3-hydroxy-3-methylglutaryl coenzyme A reductase
LIMK1 LIM kinase 1
LNAA Large neutral amino acids
PAH Phenyalanine hydroxylase
Phe Phenylalanine
PKU Phenylketonuria
Rac 1 Ras-related C3 botulinum toxin substrate 1
ROS Reactive oxygen species
TPH-2 Tryptophan hydroxylase 2
Trp Tryptophan
Tyr Tyrosine
UMP Uridine-5’-monophosphate
![Page 80: University of Groningen Phenylketonuria in mice and men ... · Phenylketonuria in mice and men Proefschrift ter verkrijging van de graad van doctor aan de Rijksuniversiteit Groningen](https://reader034.vdocuments.site/reader034/viewer/2022052611/5f03c1e37e708231d40a9ed0/html5/thumbnails/80.jpg)
512536-L-bw-Bruinenberg512536-L-bw-Bruinenberg512536-L-bw-Bruinenberg512536-L-bw-BruinenbergProcessed on: 15-8-2017Processed on: 15-8-2017Processed on: 15-8-2017Processed on: 15-8-2017 PDF page: 79PDF page: 79PDF page: 79PDF page: 79
5
79
Chapter 5
ABSTRACT
Phenylketonuria (PKU) is an inherited metabolic disorder where disrupted conversion of
Phe into tyrosine leads to accumulation of phenylalanine (Phe) in blood and brain. Increased
Phe impairs brain functioning by negatively affecting four domains: neurotransmitter
metabolism, white matter integrity, oxidative balance, and synapse functioning. Traditionally,
PKU treatment aims to lower blood Phe concentrations, however, because treatment is often
difficult to maintain, blood Phe concentrations can rise and fluctuate in PKU patients.
Therefore, a treatment strategy focusing on relieving the Phe effects on brain functioning
by means of specific nutrients could yield new treatment possibilities. In this review, the
possibility of an additional nutritional intervention for PKU is presented through reviewing
the beneficial effects of nutritional components in the healthy or diseased brain in these four
domains. Based on the described positive effects in the non-PKU-literature, the hypothesized
alternative nutritional treatment for PKU should include omega-3 fatty acids, B-vitamins,
and antioxidants.
![Page 81: University of Groningen Phenylketonuria in mice and men ... · Phenylketonuria in mice and men Proefschrift ter verkrijging van de graad van doctor aan de Rijksuniversiteit Groningen](https://reader034.vdocuments.site/reader034/viewer/2022052611/5f03c1e37e708231d40a9ed0/html5/thumbnails/81.jpg)
512536-L-bw-Bruinenberg512536-L-bw-Bruinenberg512536-L-bw-Bruinenberg512536-L-bw-BruinenbergProcessed on: 15-8-2017Processed on: 15-8-2017Processed on: 15-8-2017Processed on: 15-8-2017 PDF page: 80PDF page: 80PDF page: 80PDF page: 80
80
Chapter 5
1. INTRODUCTION
Hippocrates stated, “Let food be thy medicine and medicine be thy food”. This statement
illustrates the age-old belief that food can be used to treat a disease. In recent years, the
concept that nutrition can be used to aid cognition and cognitive disorders, has regained
more attention1,2. The rapid increase in research and thereby knowledge has raised awareness
into the widespread possibilities of different nutritional components as a treatment strategy
for disorders affecting neurocognition.
If any disease should be addressed in which the importance of nutrition has been recognized
at an early stage, it is phenylketonuria (PKU; OMIM # 261600). This inherited metabolic
disease is caused by mutations in the gene encoding for the hepatic enzyme phenylalanine
hydroxylase (PAH) responsible for converting phenylalanine (Phe) into tyrosine (Tyr). The
loss of functionality of the enzyme results in high concentrations of Phe in blood and brain.
These increased concentrations of Phe can affect four domains of brain functioning through
1) disrupting the neurotransmitter metabolism of especially serotonin and dopamine3,
2) altering the white matter integrity4, increasing oxidative stress5, and affecting synapse
functioning6. In untreated patients, this results in mental disablement, problems with
movement, and seizures7. To minimize these consequences, current dietary treatment aims
to severely restrict Phe intake as early as possible with a protein restricted diet plus an
artificial amino acid mixture. Despite this treatment, subtle and specific deficits in cognitive
functioning, such as processing speed, attention, and working memory are found in early-
treated PKU patients8,9. The association between Phe concentrations and symptomology
in patients, treated and untreated, is well established7. Therefore, treatment strategies
in PKU traditionally have focused on lowering Phe concentrations. However, as current
dietary treatment is often difficult to maintain, Phe concentrations can rise and fluctuate
in PKU patients10. An alternative intervention strategy focusing on reducing the functional
consequences of high Phe on the four above mentioned domains by means of specific
nutrients could be of great interest.
Applying nutrients to aid brain functioning was examined, among others, by the Wurtman lab.
This resulted in a specific formulation of nutrients registered as Fortasyn ® Connect (FC)11.
FC includes the omega-3 PUFAs DHA and EPA, but also choline, UMP, phospholipids, folic
acid, vitamins B6, B12, C, E, and selenium12. These nutrients constitute the precursors and
cofactors for the formation of membranes through the biosynthetic “Kennedy pathway”13,
and dietary supplementation with these nutrients has been shown to improve brain function
(for review 12).
In this review, the affected four functional domains neurotransmitter metabolism, white
matter integrity, oxidative stress, and synaptic functioning will be discussed. Hereafter, these
![Page 82: University of Groningen Phenylketonuria in mice and men ... · Phenylketonuria in mice and men Proefschrift ter verkrijging van de graad van doctor aan de Rijksuniversiteit Groningen](https://reader034.vdocuments.site/reader034/viewer/2022052611/5f03c1e37e708231d40a9ed0/html5/thumbnails/82.jpg)
512536-L-bw-Bruinenberg512536-L-bw-Bruinenberg512536-L-bw-Bruinenberg512536-L-bw-BruinenbergProcessed on: 15-8-2017Processed on: 15-8-2017Processed on: 15-8-2017Processed on: 15-8-2017 PDF page: 81PDF page: 81PDF page: 81PDF page: 81
5
81
Chapter 5
domains will be discussed in light of possible targets of nutrients present in FC to battle
PKU-specific damage to them. Literature concerning these nutrients in PKU patients and/or
models of the disease is limited. Therefore, particularly nutrients that have beneficial effects
in the healthy or diseased brain other than PKU will also be discussed as potential candidates
to relieve cognitive deficits in PKU.
2. THE AFFECTED DOMAINS:
2.1 Neurotransmitter metabolism
The deficiency in the conversion of Phe to Tyr causes problems with neurotransmitter
metabolism via different routes. Besides the poor intrinsic synthesis of Tyr, high blood Phe
levels interfere with the brain’s availability of other large neutral amino acids (LNAAs),
including Tyr and Tryptophan (Trp), via interfering with transport over the blood-brain
barrier 14,15. In a direct matter, reduced Tyr availability in the brain leads to impaired
dopamine synthesis, as Tyr is the amino acid precursor for dopamine. Indirectly, Phe impairs
the availability of other LNAAs such as Trp, therefore diminishing the synthesis of serotonin,
which has Trp as its precursor. Moreover, high brain Phe concentrations inhibit the activity
of the enzymes Tyr- and Trp hydroxylases that are important for the rate-limiting steps in
the conversion of Tyr and Trp to dopamine and serotonin, respectively16. Indeed, lower
than normal levels of dopamine and serotonin metabolites have been observed in the CSF
of PKU patients3. In addition, reduced levels of monoamines (serotonin, dopamine and
norepinephrine) have been shown in the brain of mouse models of PKU17–21.
2.2 White matter integrity
Myelin alterations in PKU, first reported in 195022, have become a consistent feature of PKU
in vitro and in vivo models, untreated, and treated PKU patients4,23. In patients, metabolic
control expressed as plasma Phe, brain Phe, and the fluctuations in Phe during the life time
is associated with the degree of white matter abnormalities4,24–28. Nevertheless, the exact
influence of Phe on myelin is not clear yet. For instance, in cell culture, oligodendrocytes
subjected to high concentrations of Phe switch phenotype from a myelinated to a non-
myelinated form29. However, Phe and/or the metabolites of Phe (phenylpyruvate, and
phenylacetate) do not affect oligodendrocyte progenitor cell proliferation (development),
oligodendrocyte migration (function) nor induce mortality of oligodendrocytes (survival)30.
This indirect effect could be via the effect of Phe on cholesterol and protein synthesis. Both
processes are necessary for the production and maintenance of myelin sheaths. Cholesterol
synthesis is affected through the negative effect of Phe on the rate-controlling enzyme,
3-hydroxy-3-methylglutaryl coenzyme A reductase (HMGR). Both in PKU mice as well as in
Phe-exposed oligodendrocyte cultures, the activity of this enzyme is reduced 31. The negative
effect of Phe on protein synthesis is confirmed in vitro and in vivo in the PKU mouse model
and in PKU patients32–34. High concentrations of Phe, initiated by the PAH inhibitor alpha-
![Page 83: University of Groningen Phenylketonuria in mice and men ... · Phenylketonuria in mice and men Proefschrift ter verkrijging van de graad van doctor aan de Rijksuniversiteit Groningen](https://reader034.vdocuments.site/reader034/viewer/2022052611/5f03c1e37e708231d40a9ed0/html5/thumbnails/83.jpg)
512536-L-bw-Bruinenberg512536-L-bw-Bruinenberg512536-L-bw-Bruinenberg512536-L-bw-BruinenbergProcessed on: 15-8-2017Processed on: 15-8-2017Processed on: 15-8-2017Processed on: 15-8-2017 PDF page: 82PDF page: 82PDF page: 82PDF page: 82
82
Chapter 5
methylphenylalanine, are suggested to influence protein synthesis through inhibiting protein
synthesis initiation and protein elongation34,35. Taken together, the myelin deficits found in
PKU are more likely to be caused by the effect of Phe on cholesterol and protein synthesis
rather than by a direct effect of Phe on oligodendrocytes. This does not exclude other direct
effects of Phe on myelin.
2.3 Oxidative stress
Oxidative stress plays a role in the pathogenesis of several neurocognitive disorders and has
been studied in PKU (reviewed by Ribas et al.5). Oxidative stress is an imbalance between
(increased) production and/or (decreased) removal of reactive species. This imbalance can be
caused by accumulation of reactive species and/or decreased antioxidant defense. Multiple
arguments support the potential role of oxidative stress in the pathophysiology of PKU.
Firstly, the accumulation of Phe together with its metabolites can increase the generation
of reactive species mostly derived from oxygen (reactive oxygen species, ROS), that in turn
can react with biomolecules causing oxidative damage to proteins, lipids, carbohydrates,
and DNA. As a consequence, cell injury or even cell death can occur. Secondly, in general,
compared with other organs, the brain is especially susceptible to oxidative stress due to its
relatively poor antioxidant defense and its high oxygen consumption36. Thirdly, the Phe-
restricted diet may hamper the intake of antioxidants and/or their precursors in treated
patients, leading to oxidative stress by reducing antioxidant defenses5,37. Finally, metabolites
of Phe inhibit antioxidant enzymes38,39. These arguments are supported by several findings
confirming the presence of oxidative stress within PKU, shown in vitro37,40,41, in the brains of
animal models of PKU (chemically-induced hyperphenylalaninemia rat model:40–43; genetic
PKU mouse model BTBR:44,45; C57BL/6:46), and in plasma of patients47–52. Furthermore,
antioxidant defenses are lower in PKU patients by means of lower activity of antioxidant
enzymes, higher biomolecule damage and lower availability of antioxidants in blood49,50,53–55.
2.4 Synapse functioning
Together with the previously discussed myelination problems, Bauman and Kemper 56(1982)
reported morphological changes in dendritic arborizations and reduced numbers of synaptic
spines in untreated PKU patients. Likewise, in treated PKU patients, reduced synaptic or
neuronal density is suggested because of the reduced grey matter found in specific regions
of the brain57. Generally, the altered synaptic functioning in PKU is demonstrated by 1)
changes in synaptic morphology, 2) reduced expression of proteins involved in synaptic
functioning, and 3) functional outcome changes (synaptic efficacy). The first aspect is
supported with research, in vivo and in vitro, showing a decreased number of synapses,
reduced width of the synaptic cleft, reduced thickness of the post-synaptic density, altered
arborization of dendritic trees, and reduced neurite length 44,58–61. A causal role of Phe on
these structural changes was found through the effect of Phe on the pathway important
for dendritic elongation and arborization, F-actin remodeling of the cytoskeleton. High
![Page 84: University of Groningen Phenylketonuria in mice and men ... · Phenylketonuria in mice and men Proefschrift ter verkrijging van de graad van doctor aan de Rijksuniversiteit Groningen](https://reader034.vdocuments.site/reader034/viewer/2022052611/5f03c1e37e708231d40a9ed0/html5/thumbnails/84.jpg)
512536-L-bw-Bruinenberg512536-L-bw-Bruinenberg512536-L-bw-Bruinenberg512536-L-bw-BruinenbergProcessed on: 15-8-2017Processed on: 15-8-2017Processed on: 15-8-2017Processed on: 15-8-2017 PDF page: 83PDF page: 83PDF page: 83PDF page: 83
5
83
Chapter 5
concentrations of Phe in vitro affects F-actin remodeling through reducing the expression
of Cofilin, phosphorylation status of Cofilin and the activity of Ras-related C3 botulinum
toxin substrate 1 (Rac1), GTPase being important for phosphorylation of Cofilin via LIM
kinase 1 (LIMK1)61,62. The morphological changes are shown by altered expression of the
presynaptic markers synaptophysin and synaptosomal-associated protein-25, postsynaptic
markers synaptopodin and spinopodin, synaptic functioning related proteins synapsin
2 and dihydropyrimidinase-related protein 26,60,63. Taken together, these changes result in
functional outcome changes in long-term potentiation, a form of synaptic strengthening
relevant to learning and memory, and the ability for the PKU BTBR mouse to master a
learning and memory task64.
In summary, a nutritional intervention in PKU should preferably have the following features:
a) increase neurotransmitter metabolism for serotonin and dopamine, b) improve white
matter integrity, c) increase oxidative defenses, and d) improve synaptic functioning. In the
next section, nutrients affecting these four domains will be discussed.
3. NUTRIENTS AFFECTING BRAIN STRUCTURE AND FUNCTION
3.1 Can nutritional intervention improve neurotransmitter metabolism for serotonin and
dopamine?
In PKU, the precursors of the neurotransmitter pathways and enzymes of the rate-limiting
steps are affected. Although this is only a part of the synthesis pathway, all possible targets
that can positively influence synthesis will be discussed (the effect of nutrients on serotonin
is reviewed65,66). Various nutrients can intervene in the synthesis pathway and release of
neurotransmitters, for example vitamin D, vitamin B6, and omega-3 fatty acids. This is first
highlighted by in vivo experiments that revealed that vitamin D can increase the expression
of tryptophan hydroxylase 2 (TPH-2), the rate-limiting enzyme within serotonin synthesis67.
Second, the co-enzymatic form of vitamin B6, pyridoxal phosphate, is an important cofactor
in the neurotransmitter pathways of serotonin but also in others such as melatonin, dopamine,
norepinephrine, and gamma-aminobutyric acid (GABA)68. Third, serotonin release from
the pre-synapse can be inhibited by E2 series prostaglandins69. These prostaglandins are
produced from the unsaturated omega-6 fatty acid, arachidonic acid (AA), while the E3
series prostaglandins are produced from the omega-3 fatty acid eicosapentaenoic acid (EPA).
The production of these prostaglandins is affected by the competition of EPA and AA at
the cyclooxygenase pathway. A ratio in favor of EPA inhibits the production of E2 series
prostaglandins from AA70. This finding suggests that EPA supplementation, via inhibition of
E2 series prostaglandins, could promote the release of serotonin from pre-synapses. Finally,
fatty acids can affect cell membrane fluidity and consequently the receptor availability of e.g.
serotonin and dopamine71,72. In addition, DHA supplementation in rats, via micro-emulsions
with linseed oil, resulted in an increase in serotonin and dopamine concentrations in the
![Page 85: University of Groningen Phenylketonuria in mice and men ... · Phenylketonuria in mice and men Proefschrift ter verkrijging van de graad van doctor aan de Rijksuniversiteit Groningen](https://reader034.vdocuments.site/reader034/viewer/2022052611/5f03c1e37e708231d40a9ed0/html5/thumbnails/85.jpg)
512536-L-bw-Bruinenberg512536-L-bw-Bruinenberg512536-L-bw-Bruinenberg512536-L-bw-BruinenbergProcessed on: 15-8-2017Processed on: 15-8-2017Processed on: 15-8-2017Processed on: 15-8-2017 PDF page: 84PDF page: 84PDF page: 84PDF page: 84
84
Chapter 5
brain73. Omega-3 fatty acid supplementation also had a positive effect on dopamine in a rat
model of Parkinson’s disease74 and prevented dopamine-deficits induced by food allergies in
mice75. In the first study, supplementation of DHA and/or uridine-5′-monophosphate (UMP)
increased dopamine concentrations and the activity of Tyr hydroxylase, the rate-limiting
step in dopamine synthesis. Interestingly, the combination of DHA and UMP increased the
beneficial effects even more, which indicates that the combination of certain nutrients could
increase the positive effects of a single nutrient. In conclusion, nutrients, such as vitamin B6,
vitamin D, fatty acids, and UMP can mediate neurotransmitter metabolism by regulating
neurotransmitter uptake, synthesis and release. However, research with these nutrients
relating to neurotransmitter concentrations in PKU is very limited. Merely one study
examined the effect of B6 treatment on serotonin in PKU patients76. In this study, a seven
days B6 treatment in non-treated PKU patients did not significantly change blood serotonin
concentration. Although this study did not show positive results, more PKU specific studies
are needed for definite conclusions. In light of the clear beneficial effects of nutrients in
other research fields, a combination of different nutrients could yield positive effect(s) in
neurotransmitter metabolism in PKU.
3.2 Can a nutritional intervention improve white matter integrity?
In general, various nutrients are important for myelination and myelin recovery. For
example, iron, B6, and B12 deficiencies can cause problems with myelination77–79, omega-3
fatty acid supplementation supported myelination in a model of traumatic brain injury80,
vitamin D3 increased myelination in a model of nerve injury81, and in a chronic cerebral
hypoperfusion model, L-carnitine led to increased myelination82. These findings highlight
the possible positive effect of several nutrients on myelination. However, the implications
of these studies for PKU are not yet clear, as in these studies improved myelination is often
expressed by myelin sheath thickness or myelin markers82. In PKU, these parameters have
not been measured. A measure that is affected in PKU is cholesterol and protein synthesis,
which is considered essential in myelination. Therefore, selectively increasing e.g. cholesterol
biosynthesis by increasing the activity the rate-controlling enzyme, HMGR, could yield
possible treatment strategies for PKU. Possible candidates are omega-3 fatty acids as
treatment of one and two weeks in glial cells increased HMGR activity in primary glial
cell cultures83. To conclude, various nutrients are important for myelination. However, the
significance of these nutrients for this specific domain in PKU patients is not clear yet.
3.3 Can a nutritional intervention restore oxidative balance or increase oxidative defenses?
Restoring the balance between reactive species and antioxidants by supplementing with
antioxidants or their precursors could have beneficial effects for PKU patients. Several
studies examined antioxidant treatments in PKU models. Moraes and coworkers extensively
examined the positive effects of lipoic acid in PKU in in vitro and in vivo experiments40,84. They
showed in a chemically induced hyperphenylalaninemia rat model (repetitive injections of Phe
![Page 86: University of Groningen Phenylketonuria in mice and men ... · Phenylketonuria in mice and men Proefschrift ter verkrijging van de graad van doctor aan de Rijksuniversiteit Groningen](https://reader034.vdocuments.site/reader034/viewer/2022052611/5f03c1e37e708231d40a9ed0/html5/thumbnails/86.jpg)
512536-L-bw-Bruinenberg512536-L-bw-Bruinenberg512536-L-bw-Bruinenberg512536-L-bw-BruinenbergProcessed on: 15-8-2017Processed on: 15-8-2017Processed on: 15-8-2017Processed on: 15-8-2017 PDF page: 85PDF page: 85PDF page: 85PDF page: 85
5
85
Chapter 5
and alpha-methyl-Phe as PAH inhibitor) as well as in Phe-treated brain homogenates of rats,
that lipoic acid administration had a positive effect on antioxidant enzyme activity and non-
enzymatic antioxidant systems that were impaired by Phe40,84. Furthermore, in another acute
hyperphenylalaninemia model in which rodents received intracerebroventricular injections
of Phe before training in a behavioral paradigm, Phe changed the behavior and increased
oxidative stress. These effects could be counteracted by pretreatment with creatine and/or
pyruvate intraperitoneally85,86. Finally, in a rat model of maternal hyperphenylalaninemia,
vitamin C, vitamin E, as well as melatonin showed positive effects on parameters of oxidative
stress caused by Phe87,88. In PKU patients, L-carnitine and selenium had a beneficial effect on
the oxidative stress parameters89. In conclusion, increasing the availability of antioxidants
may improve patients’ oxidative defenses, thereby reducing oxidative stress.
3.4 Can a nutritional intervention improve synaptic functioning?
The use of a nutritional intervention to improve synaptic functioning is often discussed in
relation to early life interventions by either replenishing deficiencies – if these occur - or
supplementing certain nutrients during pregnancy up to early adolescence90. For instance,
supplementation of vitamin B12 during pregnancy up to three months increased brain-derived
neurotrophic factor (BDNF) gene expression and protein concentrations in the hippocampus
of male Wistar rats91. When adding omega 3-fatty acids to the same supplementation
period, the BDNF gene expression and protein concentration were significantly higher in
the hippocampus compared to the vitamin B12 supplementation group, and it increased the
BDNF concentrations also in the cortex91. Furthermore, supplementation of DHA and/or
uridine during gestation and early-life positively affected pre- and postsynaptic markers as
well as hippocampal dendritic spine density92. Nutrient supplementation studies also show
benefits later in life. This finding is illustrated by research showing that supplementation of
DHA increases dendritic spine density in the hippocampus in adult gerbils93. Supplementation
of DHA, EPA, UMP or a combination of DHA with UMP and EPA with UMP also increased
pre- and postsynaptic protein expression in adult gerbils94. On a functional level, in vitro
experiments in hippocampal primary cultures have shown that DHA supplementation could
increase synaptic activity 95. In conclusion, supplementation of especially DHA, EPA, and
UMP solely or in combination can have a positive effect on synaptic functioning.
4. REVIEWING EXISTING LITERATURE IN PKU
At the beginning of this review, four domains were introduced that are thought to contribute
to the cognitive deficits observed in PKU patients. However, these domains are not separate
entities but are highly interrelated, each contributing to the overall cognitive functioning of an
individual. Apart from oxidative stress, research specifically focused on the effect of nutrients
in PKU is very limited. Some studies examined the effects of nutrient supplementation on the
overall cognitive functioning of PKU patients96–99. Most of these studies have focused on DHA
![Page 87: University of Groningen Phenylketonuria in mice and men ... · Phenylketonuria in mice and men Proefschrift ter verkrijging van de graad van doctor aan de Rijksuniversiteit Groningen](https://reader034.vdocuments.site/reader034/viewer/2022052611/5f03c1e37e708231d40a9ed0/html5/thumbnails/87.jpg)
512536-L-bw-Bruinenberg512536-L-bw-Bruinenberg512536-L-bw-Bruinenberg512536-L-bw-BruinenbergProcessed on: 15-8-2017Processed on: 15-8-2017Processed on: 15-8-2017Processed on: 15-8-2017 PDF page: 86PDF page: 86PDF page: 86PDF page: 86
86
Chapter 5
and/or EPA supplementation and find inconclusive results. Some studies report beneficial
effects after supplementation on coordination, fine motor skills, and EEG measurements of
processing visual stimuli96–98. Others do not find beneficial effects of DHA supplementation
on cognitive processing speed and executive functioning99. Several arguments could explain
why these results are contradicting. Firstly, the duration of treatment is of great importance.
Recuperation from abnormalities as a result from omega-3 fatty acid deprivation requires
weeks to months for different cell types and organelles of the rodent brain100. The possible
transcending positive effect of these fatty acids in PKU could take even longer. Secondly, the
targeted patient group is always key in the design of the study. In healthy subjects, omega-3
fatty acid supplementation increases cognitive performance in infants but not in other age
groups101. In PKU, different patient groups can be identified, e.g. early treated, compliant,
non-compliant, and recently a new group is developing: early-treated PKU patients in late-
life. This group is new because screening and early dietary treatment of patients was initiated
approximately 40-50 years ago, depending on the country. Therefore, age-differences and
different treatment-histories in PKU patients should be taken into consideration when
designing an interventional study with a combination of specific nutrients. Finally, providing
a combination of specific nutrients or multiple nutrients in one pathway could elicit an effect
that cannot be seen when only a single nutrient is offered91,94.
5. PERSPECTIVES OF A NUTRITIONAL INTERVENTION FOR PKU
The beneficial effects of the various nutrients previously described could also be discussed
in light of the effect on neuronal membrane, one of the sites at which the four identified
domains in PKU converge. The neuronal membranes are the principal site of action for
many neuronal activities, such as synaptic functioning (including receptor and ion
channel activity), neurotransmitter release and optimal exchange of nutrients and other
molecules102,103. In addition, myelin is largely made up of lipids that can be derived from
the same precursors as those that make up the neuronal membrane. Finally, antioxidants
protect the neuronal membrane from oxidative stress, thus maintaining its integrity, stability,
and ultimately its function. Neuronal membranes are mainly composed of phospholipids,
the most abundant of which are generated primarily via the well-characterized metabolic
pathway known as the Kennedy pathway11. The rate of phospholipid synthesis through the
Kennedy pathway depends on the availability of three dietary precursors; UMP, choline and
the omega-3 polyunsaturated fatty acid DHA11. Each precursor, on its own, is rate limiting.
Furthermore, in addition to numerous other supportive roles of brain function, certain
B-vitamins, more specifically folic acid and vitamins B6 and B12, act as cofactors by directly
affecting liver metabolism of DHA and choline, thereby increasing their availability for
membrane phospholipid synthesis 12. Furthermore, vitamin C, E, and selenium play critical
roles in protecting the neuronal membrane through their antioxidant properties. Finally,
![Page 88: University of Groningen Phenylketonuria in mice and men ... · Phenylketonuria in mice and men Proefschrift ter verkrijging van de graad van doctor aan de Rijksuniversiteit Groningen](https://reader034.vdocuments.site/reader034/viewer/2022052611/5f03c1e37e708231d40a9ed0/html5/thumbnails/88.jpg)
512536-L-bw-Bruinenberg512536-L-bw-Bruinenberg512536-L-bw-Bruinenberg512536-L-bw-BruinenbergProcessed on: 15-8-2017Processed on: 15-8-2017Processed on: 15-8-2017Processed on: 15-8-2017 PDF page: 87PDF page: 87PDF page: 87PDF page: 87
5
87
Chapter 5
phospholipids exert their supportive role through increasing precursor availability, by acting
as direct precursors to choline104 and by increasing intestinal absorption of DHA and EPA105.
This particular combination of nutrients – named Fortasyn® Connect, containing DHA,
EPA, UMP, choline, folate, vitamin B12, vitamin B6, phospholipids, vitamin C, vitamin
E, and selenium has been shown to positively affect brain phospholipid synthesis11,93,106,107,
neurite outgrowth108,109, the number of dendritic spines92,93, neurotransmitter release and
signaling109,110, levels of pre- or post-synaptic protein11,93,94,109, and levels of phospholipid
also found in myelin109. Moreover, this combination of nutrients has improved white matter
integrity in an animal model of Alzheimer’s disease111. In human subjects, different measures
can be used as a proxy to study functioning of the brain, and more specifically functioning of
synapses. Clinical studies in the context of Alzheimer’s disease have shown that Fortasyn®
Connect leads to improved brain function, and more importantly improvements in memory
performance 112,113. An EEG study in humans substantiates improvements in synaptic
connectivity through demonstrated preservation of functional brain connectivity and brain
network organization114. All these studies together suggest that Fortasyn® Connect could
be of great interest to address cognitive deficits in PKU patients. Testing this combination
of nutrients in a PKU mouse model on the level of the four different domains and cognitive
performance is now warranted. The first proof-of-concept study has indicated that Fortasyn®
Connect could be beneficial for the expression of a postsynaptic marker in a specific region
in the hippocampus in the PKU mouse model 115. This indicates that Fortasyn® Connect
could be beneficial for at least of the domains, namely synaptic functioning. These results
warrant additional exploration of the effects of this specific nutrient combination on
outcome parameters in PKU.
Conflict of Interest (COI) Statement: This manuscript was written by researchers employed
by the University of Groningen and the Beatrix Children’s hospital, University Medical
Center Groningen. Both institutions received funding from Nutricia Advanced Medical
Nutrition, Utrecht, the Netherlands. Three of the co-authors are currently working at this
company (DSC, MR, and MK).
![Page 89: University of Groningen Phenylketonuria in mice and men ... · Phenylketonuria in mice and men Proefschrift ter verkrijging van de graad van doctor aan de Rijksuniversiteit Groningen](https://reader034.vdocuments.site/reader034/viewer/2022052611/5f03c1e37e708231d40a9ed0/html5/thumbnails/89.jpg)
512536-L-bw-Bruinenberg512536-L-bw-Bruinenberg512536-L-bw-Bruinenberg512536-L-bw-BruinenbergProcessed on: 15-8-2017Processed on: 15-8-2017Processed on: 15-8-2017Processed on: 15-8-2017 PDF page: 88PDF page: 88PDF page: 88PDF page: 88
88
Chapter 5
Tab
le 1
: Su
mm
ary
of s
ingl
e nu
trie
nt i
nter
vent
ions
. L
imit
ed s
tudi
es e
xam
ined
sin
gle
nutr
ient
int
erve
ntio
ns i
n PK
U (
depi
cted
in
the
first
row
). T
here
fore
, si
ngle
nutr
ient
s th
at h
ave
bene
ficia
l eff
ects
in t
he h
ealt
hy o
r di
seas
ed b
rain
oth
er t
han
PKU
are
incl
uded
in t
he t
able
(di
vide
d in
thr
ee d
omai
ns).
As
vari
ous
stud
ies
did
exam
ine
the
effe
ct o
f an
tiox
idan
ts o
n ox
idat
ive
stre
ss in
PK
U, o
ther
lite
ratu
re c
once
rnin
g an
tiox
idan
ts a
nd o
xida
tive
str
ess
are
not
incl
uded
.
Om
ega-
3fa
tty
acid
sU
MP
Iron
Vit
amin
B6
Vit
amin
B12
Vit
amin
DL
-car
niti
neA
ntio
xida
nts
PKU
rel
ated
lit
erat
ure
Did
not
si
gnifi
cant
ly
chan
ge b
lood
se
roto
nin
conc
entr
atio
n76
Ben
efici
al
effe
ct f
or
oxid
ativ
e st
ress
pa
ram
eter
s89
Ben
efici
al
effe
ct f
or
oxid
ativ
e st
ress
pa
ram
eter
s40,8
4–89
Neu
rotr
ans-
mit
ter
met
abol
ism
Show
pos
itiv
e ef
fect
s on
dop
amin
e an
d se
roto
nin71
–75
Show
s a
posi
tive
eff
ect
on d
opam
ine75
Co-
enzy
mat
ic
form
of
vita
min
B6
is
an im
port
ant
cofa
ctor
in
the
synt
hesi
s pa
thw
ay o
f se
roto
nin68
Influ
ence
s sy
nthe
sis
path
way
67
Whi
te m
atte
r in
tegr
ity
Prev
ente
d m
yelin
atio
n pr
oble
ms80
Defi
cien
cies
re
sult
in
com
plic
atio
ns77
Defi
cien
cies
re
sult
in
com
plic
atio
ns78
Defi
cien
cies
re
sult
in
com
plic
atio
ns79
Incr
ease
s m
yelin
atio
n81
Incr
ease
d m
yelin
atio
n82
Syna
ptic
fu
ncti
onin
gIn
crea
sed
BD
NF,
pr
e-an
d po
stsy
napt
ic
mar
kers
, hip
poca
mpa
l de
ndri
tic
spin
e de
nsit
y, a
nd s
ynap
tic
acti
vity
91–9
5
Incr
ease
d pr
e-an
d po
stsy
napt
ic
mar
kers
, and
hi
ppoc
ampa
l de
ndri
tic
spin
e de
nsit
y11,9
4
Incr
ease
d B
DN
F91
![Page 90: University of Groningen Phenylketonuria in mice and men ... · Phenylketonuria in mice and men Proefschrift ter verkrijging van de graad van doctor aan de Rijksuniversiteit Groningen](https://reader034.vdocuments.site/reader034/viewer/2022052611/5f03c1e37e708231d40a9ed0/html5/thumbnails/90.jpg)
512536-L-bw-Bruinenberg512536-L-bw-Bruinenberg512536-L-bw-Bruinenberg512536-L-bw-BruinenbergProcessed on: 15-8-2017Processed on: 15-8-2017Processed on: 15-8-2017Processed on: 15-8-2017 PDF page: 89PDF page: 89PDF page: 89PDF page: 89
5
89
Chapter 5
6. REFERENCES
1 Weiser MJ, Butt CM, Mohajeri MH.
Docosahexaenoic Acid and Cognition
throughout the Lifespan. Nutrients 2016; 8.
doi:10.3390/nu8020099.
2 Forbes SC, Holroyd-Leduc JM, Poulin MJ,
Hogan DB. Effect of Nutrients, Dietary
Supplements and Vitamins on Cognition:
a Systematic Review and Meta-Analysis of
Randomized Controlled Trials. Can Geriatr
J 2015; 18: 231–45.
3 Burlina AB, Bonafé L, Ferrari V, Suppiej
A, Zacchello F, Burlina AP. Measurement
of neurotransmitter metabolites in the
cerebrospinal fluid of phenylketonuric
patients under dietary treatment. J Inherit
Metab Dis 2000; 23: 313–6.
4 Anderson PJ, Leuzzi V. White matter
pathology in phenylketonuria. Mol Genet
Metab 2010; 99 Suppl 1: S3-9.
5 Ribas GS, Sitta A, Wajner M, Vargas CR.
Oxidative stress in phenylketonuria: what is
the evidence? Cell Mol Neurobiol 2011; 31:
653–62.
6 Horling K, Schlegel G, Schulz S, Vierk R,
Ullrich K, Santer R et al. Hippocampal
synaptic connectivity in phenylketonuria.
Hum Mol Genet 2014. doi:10.1093/hmg/
ddu515.
7 Waisbren SE, Noel K, Fahrbach K, Cella C,
Frame D, Dorenbaum A et al. Phenylalanine
blood levels and clinical outcomes in
phenylketonuria: a systematic literature
review and meta-analysis. Mol Genet Metab
2007; 92: 63–70.
8 Moyle JJ, Fox AM, Arthur M, Bynevelt
M, Burnett JR. Meta-analysis of
neuropsychological symptoms of adolescents
and adults with PKU. Neuropsychol Rev
2007; 17: 91–101.
9 Enns GM, Koch R, Brumm V, Blakely E,
Suter R, Jurecki E. Suboptimal outcomes in
patients with PKU treated early with diet
alone: revisiting the evidence. Mol Genet
Metab; 101: 99–109.
10 MacDonald A, Gokmen-Ozel H, van
Rijn M, Burgard P. The reality of dietary
compliance in the management of
phenylketonuria. J Inherit Metab Dis 2010;
33: 665–70.
11 Wurtman RJ, Cansev M, Sakamoto T, Ulus
IH. Administration of docosahexaenoic
acid, uridine and choline increases levels of
synaptic membranes and dendritic spines in
rodent brain. World Rev Nutr Diet 2009;
99: 71–96.
12 van Wijk N, Watkins CJ, Hageman RJJ,
Sijben JCW, Kamphuis PGHJ, Wurtman
RJ et al. Combined dietary folate, vitamin
B-12, and vitamin B-6 intake influences
plasma docosahexaenoic acid concentration
in rats. Nutr Metab (Lond) 2012; 9: 49.
13 Kennedy EP WS. The function of
cytidine coenzymes in the biosynthesis of
phospholipides. J Biol Chem 1956; 222:
193–214.
14 van Spronsen FJ, Hoeksma M, Reijngoud
D-J. Brain dysfunction in phenylketonuria:
is phenylalanine toxicity the only possible
cause? J Inherit Metab Dis 2009; 32: 46–51.
15 de Groot MJ, Sijens PE, Reijngoud
D-J, Paans AM, van Spronsen FJ.
Phenylketonuria: brain phenylalanine
concentrations relate inversely to cerebral
protein synthesis. J Cereb Blood Flow
Metab 2015; 35: 200–5.
16 Ogawa S, Ichinose H. Effect of metals and
phenylalanine on the activity of human
tryptophan hydroxylase-2: comparison
with that on tyrosine hydroxylase activity.
Neurosci Lett 2006; 401: 261–5.
![Page 91: University of Groningen Phenylketonuria in mice and men ... · Phenylketonuria in mice and men Proefschrift ter verkrijging van de graad van doctor aan de Rijksuniversiteit Groningen](https://reader034.vdocuments.site/reader034/viewer/2022052611/5f03c1e37e708231d40a9ed0/html5/thumbnails/91.jpg)
512536-L-bw-Bruinenberg512536-L-bw-Bruinenberg512536-L-bw-Bruinenberg512536-L-bw-BruinenbergProcessed on: 15-8-2017Processed on: 15-8-2017Processed on: 15-8-2017Processed on: 15-8-2017 PDF page: 90PDF page: 90PDF page: 90PDF page: 90
90
Chapter 5
17 Pascucci T, Andolina D, Mela I La,
Conversi D, Latagliata C, Ventura R et al.
5-Hydroxytryptophan rescues serotonin
response to stress in prefrontal cortex
of hyperphenylalaninaemic mice. Int J
Neuropsychopharmacol 2009; 12: 1067–79.
18 Pascucci T, Andolina D, Ventura R, Puglisi-
Allegra S, Cabib S. Reduced availability
of brain amines during critical phases of
postnatal development in a genetic mouse
model of cognitive delay. Brain Res 2008;
1217: 232–8.
19 Pascucci T, Ventura R, Puglisi-Allegra
S, Cabib S. Deficits in brain serotonin
synthesis in a genetic mouse model of
phenylketonuria. Neuroreport 2002; 13:
2561–4.
20 Puglisi-Allegra S, Cabib S, Pascucci T,
Ventura R, Cali F, Romano V. Dramatic
brain aminergic deficit in a genetic mouse
model of phenylketonuria. Neuroreport
2000; 11: 1361–4.
21 van Vliet D, Bruinenberg VM, Mazzola
PN, van Faassen MHJR, de Blaauw P,
Kema IP et al. Large Neutral Amino Acid
Supplementation Exerts Its Effect through
Three Synergistic Mechanisms: Proof of
Principle in Phenylketonuria Mice. PLoS
One 2015; 10: e0143833.
22 ALVORD EC, STEVENSON LD, VOGEL
FS, ENGLE RL. Neuropathological findings
in phenyl-pyruvic oligophrenia (phenyl-
ketonuria). J Neuropathol Exp Neurol
1950; 9: 298–310.
23 Huttenlocher PR. The neuropathology of
phenylketonuria: human and animal studies.
Eur J Pediatr 2000; 159 Suppl: S102-6.
24 Hood A, Antenor-Dorsey JA V, Hershey
T, Rutlin J, Shimony JS, McKinstry RC et
al. White matter integrity and executive
abilities in individuals with phenylketonuria.
Mol Genet Metab 2013; 109: 125–31.
25 Anderson PJ, Wood SJ, Francis DE,
Coleman L, Warwick L, Casanelia S et al.
Neuropsychological functioning in children
with early-treated phenylketonuria: impact
of white matter abnormalities. Dev Med
Child Neurol 2004; 46: 230–8.
26 Bick U, Ullrich K, Stöber U, Möller H,
Schuierer G, Ludolph AC et al. White
matter abnormalities in patients with
treated hyperphenylalaninaemia: magnetic
resonance relaxometry and proton
spectroscopy findings. Eur J Pediatr 1993;
152: 1012–20.
27 Leuzzi V, Tosetti M, Montanaro D,
Carducci C, Artiola C, Antonozzi I et
al. The pathogenesis of the white matter
abnormalities in phenylketonuria. A
multimodal 3.0 tesla MRI and magnetic
resonance spectroscopy (1H MRS) study. J
Inherit Metab Dis 2007; 30: 209–16.
28 Mastrangelo M, Chiarotti F, Berillo L,
Caputi C, Carducci C, Di Biasi C et al. The
outcome of white matter abnormalities in
early treated phenylketonuric patients: A
retrospective longitudinal long-term study.
Mol Genet Metab 2015. doi:10.1016/j.
ymgme.2015.08.005.
29 Dyer CA, Kendler A, Philibotte T, Gardiner
P, Cruz J, Levy HL. Evidence for central
nervous system glial cell plasticity in
phenylketonuria. J Neuropathol Exp Neurol
1996; 55: 795–814.
30 Schoemans R, Aigrot M-S, Wu C, Marée R,
Hong P, Belachew S et al. Oligodendrocyte
development and myelinogenesis are
not impaired by high concentrations of
phenylalanine or its metabolites. J Inherit
Metab Dis 2010; 33: 113–20.
31 Shefer S, Tint GS, Jean-Guillaume D,
Daikhin E, Kendler A, Nguyen LB et al. Is
there a relationship between 3-hydroxy-
3-methylglutaryl coenzyme a reductase
activity and forebrain pathology in the PKU
mouse? J Neurosci Res 2000; 61: 549–63.
![Page 92: University of Groningen Phenylketonuria in mice and men ... · Phenylketonuria in mice and men Proefschrift ter verkrijging van de graad van doctor aan de Rijksuniversiteit Groningen](https://reader034.vdocuments.site/reader034/viewer/2022052611/5f03c1e37e708231d40a9ed0/html5/thumbnails/92.jpg)
512536-L-bw-Bruinenberg512536-L-bw-Bruinenberg512536-L-bw-Bruinenberg512536-L-bw-BruinenbergProcessed on: 15-8-2017Processed on: 15-8-2017Processed on: 15-8-2017Processed on: 15-8-2017 PDF page: 91PDF page: 91PDF page: 91PDF page: 91
5
91
Chapter 5
32 Smith CB, Kang J. Cerebral protein
synthesis in a genetic mouse model of
phenylketonuria. Proc Natl Acad Sci U S A
2000; 97: 11014–9.
33 Hoeksma M, Reijngoud D-J, Pruim J,
de Valk HW, Paans AMJ, van Spronsen
FJ. Phenylketonuria: High plasma
phenylalanine decreases cerebral protein
synthesis. Mol Genet Metab 2009; 96:
177–82.
34 Hughes J V, Johnson TC. The effects of
phenylalanine on amino acid metabolism
and protein synthesis in brain cells in vitro. J
Neurochem 1976; 26: 1105–13.
35 Binek-Singer P, Johnson TC. The effects of
chronic hyperphenylalaninaemia on mouse
brain protein synthesis can be prevented by
other amino acids. Biochem J 1982; 206:
407–14.
36 Halliwell B GJ. Free radicals in biology and
medicine. 2007.
37 Fernandes CG, Leipnitz G, Seminotti B,
Amaral AU, Zanatta A, Vargas CR et al.
Experimental evidence that phenylalanine
provokes oxidative stress in hippocampus
and cerebral cortex of developing rats. Cell
Mol Neurobiol 2010; 30: 317–26.
38 Mazumder MK, Paul R, Borah A.
β-phenethylamine--a phenylalanine
derivative in brain--contributes to oxidative
stress by inhibiting mitochondrial complexes
and DT-diaphorase: an in silico study. CNS
Neurosci Ther 2013; 19: 596–602.
39 Rosa AP, Jacques CED, Moraes TB,
Wannmacher CMD, Dutra A de M, Dutra-
Filho CS. Phenylpyruvic acid decreases
glucose-6-phosphate dehydrogenase activity
in rat brain. Cell Mol Neurobiol 2012; 32:
1113–8.
40 Moraes TB, Zanin F, da Rosa A, de Oliveira
A, Coelho J, Petrillo F et al. Lipoic acid
prevents oxidative stress in vitro and in
vivo by an acute hyperphenylalaninemia
chemically-induced in rat brain. J Neurol Sci
2010; 292: 89–95.
41 Kienzle Hagen ME, Pederzolli CD,
Sgaravatti AM, Bridi R, Wajner M,
Wannmacher CMD et al. Experimental
hyperphenylalaninemia provokes oxidative
stress in rat brain. Biochim Biophys Acta
2002; 1586: 344–52.
42 Simon KR, Dos Santos RM, Scaini G, Leffa
DD, Damiani AP, Furlanetto CB et al. DNA
damage induced by phenylalanine and its
analogue p-chlorophenylalanine in blood
and brain of rats subjected to a model of
hyperphenylalaninemia. Biochem Cell Biol
2013; 91: 319–24.
43 Mazzola PN, Terra M, Rosa AP, Mescka CP,
Moraes TB, Piccoli B et al. Regular exercise
prevents oxidative stress in the brain of
hyperphenylalaninemic rats. Metab Brain
Dis 2011; 26: 291–7.
44 Liang L, Gu X, Lu L, Li D, Zhang X.
Phenylketonuria-related synaptic changes
in a BTBR-Pah(enu2) mouse model.
Neuroreport 2011; 22: 617–22.
45 Ercal N, Aykin-Burns N, Gurer-Orhan
H, McDonald JD. Oxidative stress in a
phenylketonuria animal model. Free Radic
Biol Med 2002; 32: 906–11.
46 Solverson P, Murali SG, Brinkman AS,
Nelson DW, Clayton MK, Yen C-LE et al.
Glycomacropeptide, a low-phenylalanine
protein isolated from cheese whey, supports
growth and attenuates metabolic stress in
the murine model of phenylketonuria. Am J
Physiol Endocrinol Metab 2012; 302: E885-
95.
![Page 93: University of Groningen Phenylketonuria in mice and men ... · Phenylketonuria in mice and men Proefschrift ter verkrijging van de graad van doctor aan de Rijksuniversiteit Groningen](https://reader034.vdocuments.site/reader034/viewer/2022052611/5f03c1e37e708231d40a9ed0/html5/thumbnails/93.jpg)
512536-L-bw-Bruinenberg512536-L-bw-Bruinenberg512536-L-bw-Bruinenberg512536-L-bw-BruinenbergProcessed on: 15-8-2017Processed on: 15-8-2017Processed on: 15-8-2017Processed on: 15-8-2017 PDF page: 92PDF page: 92PDF page: 92PDF page: 92
92
Chapter 5
47 Sitta A, Barschak AG, Deon M, Barden
AT, Biancini GB, Vargas PR et al. Effect
of short- and long-term exposition to high
phenylalanine blood levels on oxidative
damage in phenylketonuric patients. Int J
Dev Neurosci 2009; 27: 243–7.
48 Gassió R, Artuch R, Vilaseca MA, Fusté
E, Colome R, Campistol J. Cognitive
functions and the antioxidant system in
phenylketonuric patients. Neuropsychology
2008; 22: 426–31.
49 Schulpis KH, Tsakiris S, Traeger-Synodinos
J, Papassotiriou I. Low total antioxidant
status is implicated with high 8-hydroxy-
2-deoxyguanosine serum concentrations in
phenylketonuria. Clin Biochem 2005; 38:
239–42.
50 Artuch R, Colomé C, Sierra C, Brandi
N, Lambruschini N, Campistol J et al. A
longitudinal study of antioxidant status in
phenylketonuric patients. Clin Biochem
2004; 37: 198–203.
51 Sierra C, Vilaseca MA, Moyano D,
Brandi N, Campistol J, Lambruschini
N et al. Antioxidant status in
hyperphenylalaninemia. Clin Chim Acta
1998; 276: 1–9.
52 Wilke BC, Vidailhet M, Favier A, Guillemin
C, Ducros V, Arnaud J et al. Selenium,
glutathione peroxidase (GSH-Px) and lipid
peroxidation products before and after
selenium supplementation. Clin Chim Acta
1992; 207: 137–42.
53 Schulpis KH, Papastamataki M, Stamou
H, Papassotiriou I MA. The effect of diet
on total antioxidant status, ceruloplasmin,
transferrin and ferritin serum levels in
phenylketonuric children. - PubMed -
NCBI. 2010. http://www.ncbi.nlm.nih.gov/
pubmed/20491710 (accessed 3 Sep2015).
54 Colomé C, Artuch R, Vilaseca M-A,
Sierra C, Brandi N, Lambruschini N et al.
Lipophilic antioxidants in patients with
phenylketonuria. Am J Clin Nutr 2003; 77:
185–8.
55 van Bakel MM, Printzen G, Wermuth B,
Wiesmann UN. Antioxidant and thyroid
hormone status in selenium-deficient
phenylketonuric and hyperphenylalaninemic
patients. Am J Clin Nutr 2000; 72: 976–81.
56 Bauman ML, Kemper TL. Morphologic and
histoanatomic observations of the brain in
untreated human phenylketonuria. Acta
Neuropathol 1982; 58: 55–63.
57 Christ SE, Price MH, Bodner KE, Saville C,
Moffitt AJ, Peck D. Morphometric analysis
of gray matter integrity in individuals with
early-treated phenylketonuria. Mol Genet
Metab 2016; 118: 3–8.
58 Andolina D, Conversi D, Cabib S,
Trabalza A, Ventura R, Puglisi-Allegra
S et al. 5-Hydroxytryptophan during
critical postnatal period improves
cognitive performances and promotes
dendritic spine maturation in genetic
mouse model of phenylketonuria. Int J
Neuropsychopharmacol 2011; 14: 479–89.
59 Cordero ME, Trejo M, Colombo M, Aranda
V. Histological maturation of the neocortex
in phenylketonuric rats. Early Hum Dev
1983; 8: 157–73.
60 Hörster F, Schwab MA, Sauer SW, Pietz J,
Hoffmann GF, Okun JG et al. Phenylalanine
reduces synaptic density in mixed cortical
cultures from mice. Pediatr Res 2006; 59:
544–8.
61 Schlegel G, Scholz R, Ullrich K, Santer
R, Rune GM. Phenylketonuria: Direct
and indirect effects of phenylalanine. Exp
Neurol 2016; 281: 28–36.
![Page 94: University of Groningen Phenylketonuria in mice and men ... · Phenylketonuria in mice and men Proefschrift ter verkrijging van de graad van doctor aan de Rijksuniversiteit Groningen](https://reader034.vdocuments.site/reader034/viewer/2022052611/5f03c1e37e708231d40a9ed0/html5/thumbnails/94.jpg)
512536-L-bw-Bruinenberg512536-L-bw-Bruinenberg512536-L-bw-Bruinenberg512536-L-bw-BruinenbergProcessed on: 15-8-2017Processed on: 15-8-2017Processed on: 15-8-2017Processed on: 15-8-2017 PDF page: 93PDF page: 93PDF page: 93PDF page: 93
5
93
Chapter 5
62 Zhang Y, Zhang H, Yuan X, Gu X.
Differential effects of phenylalanine on
Rac1, Cdc42, and RhoA expression and
activity in cultured cortical neurons. Pediatr
Res 2007; 62: 8–13.
63 Imperlini E, Orrù S, Corbo C, Daniele A,
Salvatore F. Altered brain protein expression
profiles are associated with molecular
neurological dysfunction in the PKU mouse
model. J Neurochem 2014; 129: 1002–12.
64 Cabib S, Pascucci T, Ventura R, Romano V,
Puglisi-Allegra S. The behavioral profile of
severe mental retardation in a genetic mouse
model of phenylketonuria. Behav Genet
2003; 33: 301–10.
65 Patrick RP, Ames BN. Vitamin D and the
omega-3 fatty acids control serotonin
synthesis and action, part 2: relevance for
ADHD, bipolar disorder, schizophrenia,
and impulsive behavior. FASEB J 2015; 29:
2207–22.
66 Patrick RP, Ames BN. Vitamin D hormone
regulates serotonin synthesis. Part 1:
relevance for autism. FASEB J 2014; 28:
2398–413.
67 Kaneko I, Sabir MS, Dussik CM,
Whitfield GK, Karrys A, Hsieh J-C et
al. 1,25-Dihydroxyvitamin D regulates
expression of the tryptophan hydroxylase 2
and leptin genes: implication for behavioral
influences of vitamin D. FASEB J 2015; 29:
4023–35.
68 Shabbir F, Patel A, Mattison C, Bose S,
Krishnamohan R, Sweeney E et al. Effect
of diet on serotonergic neurotransmission
in depression. Neurochem Int 2013; 62:
324–329.
69 Schlicker E, Fink K, Göthert M. Influence of
eicosanoids on serotonin release in the rat
brain: inhibition by prostaglandins E1 and
E2. Naunyn Schmiedebergs Arch Pharmacol
1987; 335: 646–51.
70 Wada M, DeLong CJ, Hong YH, Rieke
CJ, Song I, Sidhu RS et al. Enzymes and
receptors of prostaglandin pathways
with arachidonic acid-derived versus
eicosapentaenoic acid-derived substrates and
products. J Biol Chem 2007; 282: 22254–
66.
71 Heron DS, Shinitzky M, Hershkowitz
M, Samuel D. Lipid fluidity markedly
modulates the binding of serotonin to
mouse brain membranes. Proc Natl Acad
Sci U S A 1980; 77: 7463–7.
72 Heinrichs SC. Dietary omega-3 fatty acid
supplementation for optimizing neuronal
structure and function. Mol Nutr Food Res
2010; 54: 447–56.
73 Sugasini D, Lokesh BR. Rats given linseed
oil in microemulsion forms enriches
the brain synaptic membrane with
docosahexaenoic acid and enhances the
neurotransmitter levels in the brain. Nutr
Neurosci 2015; 18: 87–96.
74 Cansev M, Ulus IH, Wang L, Maher TJ,
Wurtman RJ. Restorative effects of uridine
plus docosahexaenoic acid in a rat model of
Parkinson’s disease. Neurosci Res 2008; 62:
206–9.
75 de Theije CGM, van den Elsen LWJ,
Willemsen LEM, Milosevic V, Korte-Bouws
GAH, Lopes da Silva S et al. Dietary long
chain n-3 polyunsaturated fatty acids
prevent impaired social behaviour and
normalize brain dopamine levels in food
allergic mice. Neuropharmacology 2015;
90: 15–22.
76 Berman JL, Justice P, Hsia DY. Effect of
vitamin B 6 on blood 5-hydroxytryptamine
concentration. Ann N Y Acad Sci 1969;
166: 97–108.
77 Badaracco ME, Siri MVR, Pasquini JM.
Oligodendrogenesis: the role of iron.
Biofactors 2010; 36: 98–102.
![Page 95: University of Groningen Phenylketonuria in mice and men ... · Phenylketonuria in mice and men Proefschrift ter verkrijging van de graad van doctor aan de Rijksuniversiteit Groningen](https://reader034.vdocuments.site/reader034/viewer/2022052611/5f03c1e37e708231d40a9ed0/html5/thumbnails/95.jpg)
512536-L-bw-Bruinenberg512536-L-bw-Bruinenberg512536-L-bw-Bruinenberg512536-L-bw-BruinenbergProcessed on: 15-8-2017Processed on: 15-8-2017Processed on: 15-8-2017Processed on: 15-8-2017 PDF page: 94PDF page: 94PDF page: 94PDF page: 94
94
Chapter 5
78 Kirksey A, Morré DM, Wasynczuk AZ.
Neuronal development in vitamin B6
deficiency. Ann N Y Acad Sci 1990; 585:
202–18.
79 Agamanolis DP, Chester EM, Victor
M, Kark JA, Hines JD, Harris JW.
Neuropathology of experimental vitamin
B12 deficiency in monkeys. Neurology
1976; 26: 905–14.
80 Pu H, Guo Y, Zhang W, Huang L, Wang G,
Liou AK et al. Omega-3 polyunsaturated
fatty acid supplementation improves
neurologic recovery and attenuates white
matter injury after experimental traumatic
brain injury. J Cereb Blood Flow Metab
2013; 33: 1474–84.
81 Chabas J-F, Stephan D, Marqueste T,
Garcia S, Lavaut M-N, Nguyen C et al.
Cholecalciferol (vitamin D₃) improves
myelination and recovery after nerve injury.
PLoS One 2013; 8: e65034.
82 Ueno Y, Koike M, Shimada Y, Shimura H,
Hira K, Tanaka R et al. L-carnitine enhances
axonal plasticity and improves white-matter
lesions after chronic hypoperfusion in rat
brain. J Cereb Blood Flow Metab 2015; 35:
382–91.
83 Vignikin R, Grundt IK, Scotto J, Wolfrom
C, Raulin J, Gautier M. Effects of
polyunsaturated fatty acids on human and
rat cells. In vitro versus in vivo experiments.
In Vivo 1989; 3: 351–7.
84 Moraes TB, Jacques CED, Rosa AP,
Dalazen GR, Terra M, Coelho JG et al.
Role of catalase and superoxide dismutase
activities on oxidative stress in the brain of
a phenylketonuria animal model and the
effect of lipoic acid. Cell Mol Neurobiol
2013; 33: 253–60.
85 Berti SL, Nasi GM, Garcia C, Castro
FL de, Nunes ML, Rojas DB et al.
Pyruvate and creatine prevent oxidative
stress and behavioral alterations caused
by phenylalanine administration into
hippocampus of rats. Metab Brain Dis
2012; 27: 79–89.
86 Dos Reis EA, Rieger E, de Souza SS, Rasia-
Filho AA, Wannmacher CMD. Effects of
a co-treatment with pyruvate and creatine
on dendritic spines in rat hippocampus
and posterodorsal medial amygdala in a
phenylketonuria animal model. Metab Brain
Dis 2013; 28: 509–17.
87 Martínez-Cruz F, Osuna C, Guerrero JM.
Mitochondrial damage induced by fetal
hyperphenylalaninemia in the rat brain and
liver: its prevention by melatonin, Vitamin
E, and Vitamin C. Neurosci Lett 2006; 392:
1–4.
88 Martinez-Cruz F, Pozo D, Osuna C, Espinar
A, Marchante C, Guerrero JM. Oxidative
stress induced by phenylketonuria in the rat:
Prevention by melatonin, vitamin E, and
vitamin C. J Neurosci Res 2002; 69: 550–8.
89 Sitta a, Vanzin CS, Biancini GB, Manfredini
V, de Oliveira a B, Wayhs C a Y et al.
Evidence that L-carnitine and selenium
supplementation reduces oxidative stress
in phenylketonuric patients. Cell Mol
Neurobiol 2011; 31: 429–36.
90 Prado EL, Dewey KG. Nutrition and brain
development in early life. Nutr Rev 2014;
72: 267–84.
91 Rathod R, Khaire A, Kemse N, Kale A,
Joshi S. Maternal omega-3 fatty acid
supplementation on vitamin B12 rich
diet improves brain omega-3 fatty acids,
neurotrophins and cognition in the Wistar
rat offspring. Brain Dev 2014; 36: 853–63.
![Page 96: University of Groningen Phenylketonuria in mice and men ... · Phenylketonuria in mice and men Proefschrift ter verkrijging van de graad van doctor aan de Rijksuniversiteit Groningen](https://reader034.vdocuments.site/reader034/viewer/2022052611/5f03c1e37e708231d40a9ed0/html5/thumbnails/96.jpg)
512536-L-bw-Bruinenberg512536-L-bw-Bruinenberg512536-L-bw-Bruinenberg512536-L-bw-BruinenbergProcessed on: 15-8-2017Processed on: 15-8-2017Processed on: 15-8-2017Processed on: 15-8-2017 PDF page: 95PDF page: 95PDF page: 95PDF page: 95
5
95
Chapter 5
92 Cansev M, Marzloff G, Sakamoto T, Ulus
IH, Wurtman RJ. Giving uridine and/or
docosahexaenoic acid orally to rat dams
during gestation and nursing increases
synaptic elements in brains of weanling
pups. Dev Neurosci 2009; 31: 181–92.
93 Sakamoto T, Cansev M, Wurtman RJ. Oral
supplementation with docosahexaenoic acid
and uridine-5’-monophosphate increases
dendritic spine density in adult gerbil
hippocampus. Brain Res 2007; 1182: 50–9.
94 Cansev M, Wurtman RJ. Chronic
administration of docosahexaenoic acid or
eicosapentaenoic acid, but not arachidonic
acid, alone or in combination with uridine,
increases brain phosphatide and synaptic
protein levels in gerbils. Neuroscience 2007;
148: 421–31.
95 Cao D, Kevala K, Kim J, Moon H-S, Jun
SB, Lovinger D et al. Docosahexaenoic
acid promotes hippocampal neuronal
development and synaptic function. J
Neurochem 2009; 111: 510–21.
96 Koletzko B, Beblo S, Demmelmair H,
Hanebutt FL. Omega-3 LC-PUFA supply
and neurological outcomes in children
with phenylketonuria (PKU). J Pediatr
Gastroenterol Nutr 2009; 48 Suppl 1: S2-7.
97 Beblo S, Reinhardt H, Demmelmair H,
Muntau AC, Koletzko B. Effect of fish
oil supplementation on fatty acid status,
coordination, and fine motor skills in
children with phenylketonuria. J Pediatr
2007; 150: 479–84.
98 Agostoni C, Verduci E, Massetto N, Fiori
L, Radaelli G, Riva E et al. Long term
effects of long chain polyunsaturated fats in
hyperphenylalaninemic children. Arch Dis
Child 2003; 88: 582–3.
99 Yi SHL, Kable JA, Evatt ML, Singh RH. A
randomized, placebo-controlled, double-
blind trial of supplemental docosahexaenoic
acid on cognitive processing speed
and executive function in females of
reproductive age with phenylketonuria: A
pilot study. Prostaglandins Leukot Essent
Fatty Acids 2011; 85: 317–27.
100 Bourre JM, Durand G, Pascal G, Youyou A.
Brain cell and tissue recovery in rats made
deficient in n-3 fatty acids by alteration of
dietary fat. J Nutr 1989; 119: 15–22.
101 Jiao J, Li Q, Chu J, Zeng W, Yang M, Zhu
S. Effect of n-3 PUFA supplementation on
cognitive function throughout the life span
from infancy to old age: a systematic review
and meta-analysis of randomized controlled
trials. Am J Clin Nutr 2014; 100: 1422–36.
102 Yehuda S, Rabinovitz S, Carasso RL,
Mostofsky DI. The role of polyunsaturated
fatty acids in restoring the aging neuronal
membrane. Neurobiol Aging; 23: 843–53.
103 Vigh L, Escribá P V, Sonnleitner A,
Sonnleitner M, Piotto S, Maresca B et al.
The significance of lipid composition for
membrane activity: new concepts and ways
of assessing function. Prog Lipid Res 2005;
44: 303–44.
104 Wurtman RJ, Hirsch MJ, Growdon JH.
Lecithin consumption raises serum-free-
choline levels. Lancet (London, England)
1977; 2: 68–9.
105 O’Doherty PJ, Kakis G, Kuksis A. Role of
luminal lecithin in intestinal fat absorption.
Lipids 1973; 8: 249–55.
106 Cansev M, Watkins CJ, van der Beek
EM, Wurtman RJ. Oral uridine-5’-
monophosphate (UMP) increases brain
CDP-choline levels in gerbils. Brain Res
2005; 1058: 101–8.
![Page 97: University of Groningen Phenylketonuria in mice and men ... · Phenylketonuria in mice and men Proefschrift ter verkrijging van de graad van doctor aan de Rijksuniversiteit Groningen](https://reader034.vdocuments.site/reader034/viewer/2022052611/5f03c1e37e708231d40a9ed0/html5/thumbnails/97.jpg)
512536-L-bw-Bruinenberg512536-L-bw-Bruinenberg512536-L-bw-Bruinenberg512536-L-bw-BruinenbergProcessed on: 15-8-2017Processed on: 15-8-2017Processed on: 15-8-2017Processed on: 15-8-2017 PDF page: 96PDF page: 96PDF page: 96PDF page: 96
96
Chapter 5
107 Holguin S, Martinez J, Chow C,
Wurtman R. Dietary uridine enhances
the improvement in learning and memory
produced by administering DHA to gerbils.
FASEB J 2008; 22: 3938–46.
108 Pooler AM, Guez DH, Benedictus
R, Wurtman RJ. Uridine enhances
neurite outgrowth in nerve growth
factor-differentiated PC12 [corrected].
Neuroscience 2005; 134: 207–14.
109 Cansev M, van Wijk N, Turkyilmaz
M, Orhan F, Sijben JWC, Broersen
LM. A specific multi-nutrient enriched
diet enhances hippocampal cholinergic
transmission in aged rats. Neurobiol Aging
2015; 36: 344–51.
110 Savelkoul PJM, Janickova H, Kuipers AAM,
Hageman RJJ, Kamphuis PJ, Dolezal V et
al. A specific multi-nutrient formulation
enhances M1 muscarinic acetylcholine
receptor responses in vitro. J Neurochem
2012; 120: 631–40.
111 Zerbi V, Jansen D, Wiesmann M, Fang X,
Broersen LM, Veltien A et al. Multinutrient
diets improve cerebral perfusion and
neuroprotection in a murine model of
Alzheimer’s disease. Neurobiol Aging 2014;
35: 600–13.
112 Scheltens P, Kamphuis PJGH, Verhey
FRJ, Olde Rikkert MGM, Wurtman RJ,
Wilkinson D et al. Efficacy of a medical
food in mild Alzheimer’s disease: A
randomized, controlled trial. Alzheimers
Dement 2010; 6: 1–10.e1.
113 Scheltens P, Twisk JWR, Blesa R, Scarpini
E, von Arnim CAF, Bongers A et al. Efficacy
of Souvenaid in mild Alzheimer’s disease:
results from a randomized, controlled trial. J
Alzheimers Dis 2012; 31: 225–36.
114 e Waal H, Stam CJ, Lansbergen MM,
Wieggers RL, Kamphuis PJGH, Scheltens P
et al. The effect of souvenaid on functional
brain network organisation in patients with
mild Alzheimer’s disease: a randomised
controlled study. PLoS One 2014; 9:
e86558.
115 Bruinenberg VM, van Vliet D, Attali A, de
Wilde MC, Kuhn M, van Spronsen FJ et al.
A Specific Nutrient Combination Attenuates
the Reduced Expression of PSD-95 in
the Proximal Dendrites of Hippocampal
Cell Body Layers in a Mouse Model of
Phenylketonuria. Nutrients 2016; 8.
doi:10.3390/nu8040185.
![Page 98: University of Groningen Phenylketonuria in mice and men ... · Phenylketonuria in mice and men Proefschrift ter verkrijging van de graad van doctor aan de Rijksuniversiteit Groningen](https://reader034.vdocuments.site/reader034/viewer/2022052611/5f03c1e37e708231d40a9ed0/html5/thumbnails/98.jpg)
512536-L-bw-Bruinenberg512536-L-bw-Bruinenberg512536-L-bw-Bruinenberg512536-L-bw-BruinenbergProcessed on: 15-8-2017Processed on: 15-8-2017Processed on: 15-8-2017Processed on: 15-8-2017 PDF page: 97PDF page: 97PDF page: 97PDF page: 97
5
97
Chapter 5
![Page 99: University of Groningen Phenylketonuria in mice and men ... · Phenylketonuria in mice and men Proefschrift ter verkrijging van de graad van doctor aan de Rijksuniversiteit Groningen](https://reader034.vdocuments.site/reader034/viewer/2022052611/5f03c1e37e708231d40a9ed0/html5/thumbnails/99.jpg)
512536-L-bw-Bruinenberg512536-L-bw-Bruinenberg512536-L-bw-Bruinenberg512536-L-bw-BruinenbergProcessed on: 15-8-2017Processed on: 15-8-2017Processed on: 15-8-2017Processed on: 15-8-2017 PDF page: 98PDF page: 98PDF page: 98PDF page: 98
![Page 100: University of Groningen Phenylketonuria in mice and men ... · Phenylketonuria in mice and men Proefschrift ter verkrijging van de graad van doctor aan de Rijksuniversiteit Groningen](https://reader034.vdocuments.site/reader034/viewer/2022052611/5f03c1e37e708231d40a9ed0/html5/thumbnails/100.jpg)
512536-L-bw-Bruinenberg512536-L-bw-Bruinenberg512536-L-bw-Bruinenberg512536-L-bw-BruinenbergProcessed on: 15-8-2017Processed on: 15-8-2017Processed on: 15-8-2017Processed on: 15-8-2017 PDF page: 99PDF page: 99PDF page: 99PDF page: 99
CHAPTER 6A specific nutrient combination attenuates the reduced expression of PSD-95 in the proximal dendrites of hippocampal cell body layers in a
mouse model of phenylketonuria
Vibeke M. Bruinenberg1, Danique van Vliet2, Amos Attali3,
Martijn C. de Wilde3, Mirjam Kuhn3, Francjan J. van Spronsen2,
Eddy A. van der Zee 1,*
1Molecular Neurobiology, University of Groningen, Groningen, the Netherlands,2Division of Metabolic Diseases, Beatrix Children’s Hospital, University Medical Center
Groningen, University of Groningen, Groningen, the Netherlands3Nutricia Research, Nutricia Advanced Medical Nutrition, Utrecht, the Netherlands
*Correspondence: [email protected]; Tel.: +31-050-363-2062
![Page 101: University of Groningen Phenylketonuria in mice and men ... · Phenylketonuria in mice and men Proefschrift ter verkrijging van de graad van doctor aan de Rijksuniversiteit Groningen](https://reader034.vdocuments.site/reader034/viewer/2022052611/5f03c1e37e708231d40a9ed0/html5/thumbnails/101.jpg)
512536-L-bw-Bruinenberg512536-L-bw-Bruinenberg512536-L-bw-Bruinenberg512536-L-bw-BruinenbergProcessed on: 15-8-2017Processed on: 15-8-2017Processed on: 15-8-2017Processed on: 15-8-2017 PDF page: 100PDF page: 100PDF page: 100PDF page: 100
100
Chapter 6
ABSTRACT
The inherited metabolic disease phenylketonuria (PKU) is characterized by increased
concentrations of phenylalanine in the blood and brain, and as a consequence
neurotransmitter metabolism, white matter, and synapse functioning are affected. A specific
nutrient combination (SNC) has been shown to improve synapse formation, morphology
and function. This could become an interesting new nutritional approach for PKU. To assess
whether treatment with SNC can affect synapses, we treated PKU mice with SNC or an
isocaloric control diet for 12 weeks, starting at postnatal day 31. Immunostaining for post-
synaptic density protein 95 (PSD-95), a postsynaptic density marker, was carried out in
the hippocampus, striatum and prefrontal cortex. Compared to WT mice on normal chow
without SNC, PKU mice on the isocaloric control showed a significant reduction in PSD-95
expression in the hippocampus, specifically in the granular cell layer of the dentate gyrus,
with a similar trend seen in the CA1 and CA3 pyramidal cell layer. No differences were found
in the striatum or prefrontal cortex. PKU mice on a diet supplemented with SNC showed
improved expression of PSD-95 in the hippocampus. This study gives the first indication that
SNC supplementation has a positive effect on hippocampal synaptic deficits in PKU mice.
Keywords: Synaptic proteins; Hippocampus; PSD-95; nutrient combination;
phenylketonuria
![Page 102: University of Groningen Phenylketonuria in mice and men ... · Phenylketonuria in mice and men Proefschrift ter verkrijging van de graad van doctor aan de Rijksuniversiteit Groningen](https://reader034.vdocuments.site/reader034/viewer/2022052611/5f03c1e37e708231d40a9ed0/html5/thumbnails/102.jpg)
512536-L-bw-Bruinenberg512536-L-bw-Bruinenberg512536-L-bw-Bruinenberg512536-L-bw-BruinenbergProcessed on: 15-8-2017Processed on: 15-8-2017Processed on: 15-8-2017Processed on: 15-8-2017 PDF page: 101PDF page: 101PDF page: 101PDF page: 101
6
101
Chapter 6
1. INTRODUCTION
The primary defect in the inherited metabolic disease phenylketonuria (PKU) is the disrupted
phenylalanine (Phe) metabolism, caused by mutations in the gene encoding for the hepatic
enzyme phenylalanine hydroxylase, which normally converts Phe to tyrosine. When no
dietary Phe restriction is applied, this causes an increase in blood and brain Phe concentration
compared to healthy controls. Although many questions still remain to be answered, a clear
correlation between Phe concentration in blood and brain and the cognitive symptoms of
PKU has been shown1–3. Increased Phe concentrations disrupt neurotransmitter metabolism,
white matter integrity and affect synapse functioning in PKU patients and in models of PKU 4–11. Concerning the latter, a disruption of neuronal connectivity and synaptic morphology
became evident in Golgi analyses of both PKU patients and PKU mice, showing a decreased
number of spines, width of the synaptic cleft and thickness of the post-synaptic density,
indicative of reduced synaptic function5,6,12. These observed morphological abnormalities
are corroborated by a decrease in proteins associated with synaptic functioning 9,13,14. As
different markers of synaptic functioning have been examined in relation to PKU, the
postsynaptic marker postsynaptic density-95 (PSD-95) has not. This protein is of interest
since it is highly associated with growth and functioning of dendritic spines and modulates
long-term potentiation, a process important for learning and memory15–17).
Phe-induced neuro-morphological changes are reversible, providing a window of opportunity
for interventions even after the expression of symptoms due to high Phe exposure6,18. Our
study targets these synaptic deficits with a specific nutrient combination (SNC) monitored
via the expression of PSD-95. This SNC contains uridine monophosphate (UMP),
docosahexaenoic acid (DHA), eicosapentaenoic acid (EPA), choline, phospholipids, folic acid,
vitamins B12, B6, C, and E, and selenium. This combination provides rate-limiting nutrients
critical for the synthesis of phospholipids, a major component of (synaptic) membranes,
and has shown beneficial effects on synapse formation, morphology and function in mouse
models of Alzheimer’s disease19. Due to the multiple pathways and precursors involved in
membrane formation, intervention with single components of this SNC would, very likely,
lead to sub-optimal synthesis of phospholipids and therefore limited beneficial effects.
Indeed, limited and inconsistent evidence is available for the effect of supplementation with
single components of this SNC in PKU patients20–22. To investigate if SNC can overcome
synaptic deficits in PKU, we study here the effect of SNC on the expression of PSD-95 in the
hippocampus, striatum and prefrontal cortex in the C57BL/6 PKU mouse model.
![Page 103: University of Groningen Phenylketonuria in mice and men ... · Phenylketonuria in mice and men Proefschrift ter verkrijging van de graad van doctor aan de Rijksuniversiteit Groningen](https://reader034.vdocuments.site/reader034/viewer/2022052611/5f03c1e37e708231d40a9ed0/html5/thumbnails/103.jpg)
512536-L-bw-Bruinenberg512536-L-bw-Bruinenberg512536-L-bw-Bruinenberg512536-L-bw-BruinenbergProcessed on: 15-8-2017Processed on: 15-8-2017Processed on: 15-8-2017Processed on: 15-8-2017 PDF page: 102PDF page: 102PDF page: 102PDF page: 102
102
Chapter 6
2. MATERIALS AND METHODS
2.1 Animals and dietary intervention
In this study, 31 day-old male and female homozygous C57BL/6 Pahenu2 (PKU; gender
balanced groups, n=60) mice and their wild-type (WT; n=10) littermates were fed for 12
weeks with different diets. Mice were bred at the University of Groningen, The Netherlands.
At the start of the experiment all mice were housed singly. The genotype of the animals was
established by quantitative PCR analysis from DNA extracts from tail tissue23. PKU mice
were randomly assigned to the following groups: a high-Phe, mid-Phe, or low-Phe diet (Phe
contents of 8.8, 6.4, or 4.4 g/kg diet respectively) either with or without SNC. The Phe-
contents of 8.8 and 6.4 are in the normal range of standard chow. The 4.4 g/kg of Phe in
the food is a slight reduction compared to commercial available standard chows but still
contains the minimal nutritional requirement for laboratory animals24. The different Phe
concentrations in food resulted in the following Phe concentrations in blood: WT control;
49.6±5.9, PKU 8.8; 1841.3±305.4, PKU 6.4; 1413.8±199.8, and PKU 4.4; 1065±150.4
(mean ± standard deviation). WT control mice received a high-Phe diet without SNC. A
WT control group on this same diet with SNC was not included because potential beneficial
effects are considered irrelevant to elucidate the hypothesized mode of action of SNC in the
PKU model. All components were in accordance to the minimal nutritional requirement for
laboratory animals24. This study was approved by the ethical committee of the University of
Groningen, The Netherlands.
2.2 Tissue preparation
After 12 weeks of dietary treatment, all animals were euthanized via a single intraperitoneal
injection of pentobarbital. Blood was collected via heart punction and animals were
transcardially perfused with 4% paraformaldehyde (PFA; in 0.1 M phosphate buffer (PB);
pH7.4). Brains were post-fixed for 24 hours and subsequently rinsed with 0.01 M PB. After
exposing the brains to 30% buffered sucrose, they were snap-frozen with liquid nitrogen
and stored at -80°C.
2.3 Immunohistochemistry
Coronal brain sections (20 µm thick) were processed for immunohistochemical analysis of
the postsynaptic marker PSD-95 with a free-floating technique according to the following
steps: 1) incubation with 0.3% H2O2 for 30 minutes, 2) incubation with 1:1000 monoclonal
mouse anti-PSD-95, Millipore, MABN68, 1% normal goat serum (NGS) and 0.5% Triton-X
for 2 hours in a water bath at 37⁰C, 24 hours at room temperature and subsequent storage
for 48 hours at 4⁰C, 3) incubation with secondary antibody solution (1:500 Biotin-SP-
conjugated affiniPure Goat-anti-Mouse, Jackson, code: 115-0.65-166 Lot# 110630, 1%
NGS and 0.5% Triton-X) for 2 hours at room temperature (RT), 4) incubation with 1:400
AB complex, Vectastain PK-6100 standard in TBS for 2 hours at RT, 5) color development
![Page 104: University of Groningen Phenylketonuria in mice and men ... · Phenylketonuria in mice and men Proefschrift ter verkrijging van de graad van doctor aan de Rijksuniversiteit Groningen](https://reader034.vdocuments.site/reader034/viewer/2022052611/5f03c1e37e708231d40a9ed0/html5/thumbnails/104.jpg)
512536-L-bw-Bruinenberg512536-L-bw-Bruinenberg512536-L-bw-Bruinenberg512536-L-bw-BruinenbergProcessed on: 15-8-2017Processed on: 15-8-2017Processed on: 15-8-2017Processed on: 15-8-2017 PDF page: 103PDF page: 103PDF page: 103PDF page: 103
6
103
Chapter 6
was initiated by the introduction of 100 µl 0.1% H2O2 to the 3,3’-diaminobenzidine (DAB;
7 mg/15 mL) solution. The sections were rinsed multiple times with Tris buffered Saline
(pH 7.4) between the above described steps. The specificity of the primary antibody was
tested with omitting the primary antibody in the protocol of the staining, which resulted in
the absence of detectable immunostaining, and western blot, which showed a band at 95
kDa. The optical density (OD) of the staining was measured with a Quantimet 550 image
analysis system (Leica, Cambridge, UK) as has been used before25,26. In the hippocampus,
10 regions of interest were measured between bregma coordinates -1.34 and -1.82 mm (see
Fig 1 for delineation and abbreviations). In the striatum, the mean OD of three fixed areas
located in the caudoputamen were calculated (between bregma coordinates 1.18 and 0.14
mm). In addition, the infralimbic and prelimbic area of the prefrontal contex were measured
between the bregma coordinates 1.98 and 1.54 mm. The OD of these regions was corrected
for background staining by subtracting the OD of the corpus callosum. Both hemispheres of
three sections of each individual were measured. Due to freeze artifacts three animals were
discarded: one animal from the high-Phe without SNC group and two animals from the
low-Phe without SNC group.
2.4 Statistical analysis
The distribution of all parameters was checked with the Shapiro-Wilk normality test.
Normally distributed data were tested with a One-way ANOVA with the Bonferroni test
as post-hoc test. The Kruskal-Wallis test was used for non-parametric data with the Mann-
Whitney U test as post-hoc test. All statistical analyses were performed with the Statistical
Package for Social Sciences (SPSS) (V 16.0).
![Page 105: University of Groningen Phenylketonuria in mice and men ... · Phenylketonuria in mice and men Proefschrift ter verkrijging van de graad van doctor aan de Rijksuniversiteit Groningen](https://reader034.vdocuments.site/reader034/viewer/2022052611/5f03c1e37e708231d40a9ed0/html5/thumbnails/105.jpg)
512536-L-bw-Bruinenberg512536-L-bw-Bruinenberg512536-L-bw-Bruinenberg512536-L-bw-BruinenbergProcessed on: 15-8-2017Processed on: 15-8-2017Processed on: 15-8-2017Processed on: 15-8-2017 PDF page: 104PDF page: 104PDF page: 104PDF page: 104
104
Chapter 6
Figure 1. PSD-95 expression in the C57BL/6 PKU mouse. (A) An overview picture of the PSD-95
immunostaining. The following 10 areas of interest were measured: (B) CA3: Stratum lucidum (SL),
CA3 pyramidal cell layer (CA3 pyr) (C) DG: outer and middle molecular layer (OML/MML), the inner
molecular layer (IML), inner (DG-IB) and outer blade (DG-OB) of the dentate gyrus, hilus, (D) CA1:
Stratum oriens (SO), CA1 pyramidal cell layer (CA1 pyr) and the Stratum radiatum (SR) (E) a detailed
picture of the granular layers present in the DG. (F) a detailed picture of the CA1 pyramidal cell layer.
Arrows indicate clear staining within the granular layer. The size bar indicates 100 µm. The detail
pictures within E and F are digitally enlarged.
![Page 106: University of Groningen Phenylketonuria in mice and men ... · Phenylketonuria in mice and men Proefschrift ter verkrijging van de graad van doctor aan de Rijksuniversiteit Groningen](https://reader034.vdocuments.site/reader034/viewer/2022052611/5f03c1e37e708231d40a9ed0/html5/thumbnails/106.jpg)
512536-L-bw-Bruinenberg512536-L-bw-Bruinenberg512536-L-bw-Bruinenberg512536-L-bw-BruinenbergProcessed on: 15-8-2017Processed on: 15-8-2017Processed on: 15-8-2017Processed on: 15-8-2017 PDF page: 105PDF page: 105PDF page: 105PDF page: 105
6
105
Chapter 6
3. RESULTS
Body weight and blood Phe concentrations were measured to monitor the dietary treatment.
The absolute Phe intake, corrected for body weight, food intake, and the measured Phe in
the food, confirmed that Phe intake was significantly different between the different Phe
content groups but not between the different Phe content groups and their corresponding
SNC groups (One-way ANOVA df=6 F=64.181, post hoc Bonferroni analysis: High-Phe-
Mid-Phe; p= 0.000 High-Phe-Low-Phe; p=0.000, Mid-Phe-Low-Phe; p=0.000, High-
Phe with and without; p=0.298, Mid-Phe with and without; p=1.000, Low-Phe with and
without; p=1.000).
Furthermore, as clinically relevant, both males and females were used in this study. It is
known from the literature that hippocampal spine density is affected by the estrous cycle
and hormones associated with this cycle 27. However, we did not find significant differences
between males and females in the PSD-95 OD, and therefore pooled values from males and
females.
Non-parametric tests were used to examine the PSD-95 immunoreactivity differences. No
significant differences were found between the Phe-content groups of PKU mice for all brain
regions studied. Therefore, all PKU mice from the different Phe-groups were pooled into
two groups; those with and without SNC supplementation (final groups: WT, PKU with
and PKU without SNC). In the hippocampus, a significant difference was found within the
inner blade and outer blade of the dentate gyrus (Kruskal-Wallis: DG-IB; p=0.009, DG-
OB; p=0.008). Post hoc testing revealed that PSD-95 OD in the DG-IB and DG-OB was
significantly decreased in PKU mice fed with diets without SNC compared to WT by 54%
and 64%, respectively (Mann-Whitney U test DG-IB; p=0.005, DG-OB; p=0.005). Although
these significant differences were still present in DG-IB and DG-OB between the WT and
PKU mice fed with diets with SNC, the decrease was considerably less: 29% and 27%,
respectively (Mann-Whitney U test DG-IB; p=0.031, DG-OB; p=0.026). A clear trend was
observed in the CA1 and CA3 cell layers (Kruskal-Wallis: CA1; p=0,053, CA3; p=0,064),
where PKU mice on diets without SNC showed a reduction in PSD-95 OD of 44% in the
CA1 and 51% in the CA3 compared to WT mice. In the CA1, this difference was attenuated
for the PKU mice fed with diets with SNC, as the difference between this group and WT
mice was only 8%. In the striatum and prefrontal cortex, no significant differences were
found between the groups (Kruskal-Wallis: p=0,830, p=0.930, respectively); no PKU PSD-
95 expression deficit was present in PKU mice, and no change was induced by SNC.
![Page 107: University of Groningen Phenylketonuria in mice and men ... · Phenylketonuria in mice and men Proefschrift ter verkrijging van de graad van doctor aan de Rijksuniversiteit Groningen](https://reader034.vdocuments.site/reader034/viewer/2022052611/5f03c1e37e708231d40a9ed0/html5/thumbnails/107.jpg)
512536-L-bw-Bruinenberg512536-L-bw-Bruinenberg512536-L-bw-Bruinenberg512536-L-bw-BruinenbergProcessed on: 15-8-2017Processed on: 15-8-2017Processed on: 15-8-2017Processed on: 15-8-2017 PDF page: 106PDF page: 106PDF page: 106PDF page: 106
106
Chapter 6
4. DISCUSSION
To the best of our knowledge, this is the first report of reduced hippocampal PSD-95
expression in the PKU mouse model. The most important finding of our study is that SNC
supplementation seems to dampen PKU PSD-95 OD deficits towards WT values in specific
areas of the hippocampus. Therefore, this study indicates that SNC supplementation could
have a positive effect on synaptic functioning by lessening the reduced expression of PSD-
95 in the hippocampus of C57BL/6 PKU mice in the regions affected in PKU. This positive
effect was most clear in the dendrites of the DG granular cells at the level of the cell layer,
and to a lesser extent in CA1 pyramidal cell dendrites at the level of the cell layer.
PSD-95 is a scaffolding protein which is postsynaptically present in glutamatergic and
serotonergic synapses15,28. In general, PSD-95 is implicated in postsynaptic plasticity and
maturation of excitatory synapses via the interchange of AMPA and NMDA receptors in
the postsynaptic compartment15,29–31. The most marked reduction in PSD-95 in the PKU
hippocampus was found in the DG granular layer, and somewhat less prominent in the CA1
and CA3 regions. In all cases, the reduction was limited to the most proximal part of the
dendrites. At present, it is unclear which hippocampal input circuitry anatomically matches
best the affected terminal fields. The hippocampus receives input from various sources,
which deviate in their terminal fields. For example, part of the input from the entorhinal
cortex terminates on the proximal dendrites of DG granular cells and CA3 pyramidal cells,
and the Schaffer collaterals originating from CA3 pyramidal neurons project on the CA1
proximal dendrites32,33. A reduction of PSD-95 in PKU mice, specifically within the proximal
dendrites, could suggest weakening of synaptic connectivity in these neuronal circuits which
could negatively impact learning and memory. The supplementation with SNC attenuates
the PKU-specific reduction in hippocampal PSD-95 expression towards WT levels. Although
the effect was not statistically significant for all regions, SNC treatment seems to particularly
affect the CA1, DG-IB, and DG-OB. Apparently, certain cellular properties of these regions
are more susceptible to the effect of SNC. Alternatively, the duration of the treatment was
not sufficient to have a strong positive effect in all hippocampal regions.
The relation between PSD-95 and the glutamatergic AMPA and NMDA receptors suggests
that the PKU-specific reduction in PSD-95 could specifically affect these receptors. However,
the literature concerning this topic is somewhat contradictory. Martynyuk et al. 34 found a
significant increase in the Glu1 and Glu2/3 subunits of AMPA receptors and a total increase
in NMDA receptor densities, a suggested compensatory mechanism for the acute suppressive
effect of high Phe concentrations on glutamatergic synaptic transmission32. Despite the up-
regulation in postsynaptic glutamate receptors, Martynyuk et al. 34 also report preliminary
data indicating that the functional activity of glutamatergic synaptic transmission in the
PKU brain is still reduced. Although they do not specify to what degree, it is possible to
![Page 108: University of Groningen Phenylketonuria in mice and men ... · Phenylketonuria in mice and men Proefschrift ter verkrijging van de graad van doctor aan de Rijksuniversiteit Groningen](https://reader034.vdocuments.site/reader034/viewer/2022052611/5f03c1e37e708231d40a9ed0/html5/thumbnails/108.jpg)
512536-L-bw-Bruinenberg512536-L-bw-Bruinenberg512536-L-bw-Bruinenberg512536-L-bw-BruinenbergProcessed on: 15-8-2017Processed on: 15-8-2017Processed on: 15-8-2017Processed on: 15-8-2017 PDF page: 107PDF page: 107PDF page: 107PDF page: 107
6
107
Chapter 6
envisage that the reduction in function is associated with the reduction in PSD-95 found in
our study.
In consensus with literature, this study shows reduced levels of a protein associated with
synaptic functioning in PKU mice9,13,14. In contrast, recent literature showed an increase in
synapse number and an increase in the postsynaptic markers synaptopodin and spinophilin
in specific regions of the hippocampus (striatum radiatum CA1 and stratum lucidum CA3)
which could suggest that this results in an increase in PSD-95 in the same regions14. However,
our study did not show significant differences between PKU and WT individuals in the same
hippocampal subregions. Horling and colleagues14 found a specific upregulation of thin and
branched spines, and the postsynaptic markers associated with the cytoskeleton, suggesting
that the less mature spines are affected. These immature spines, which are not fully engaged
in synaptic activity, could contain less PSD-95 compared to the types that were not affected,
e.g. mushroom type. Hence, our data suggest that the increase in the number of spines
and postsynaptic markers found by Horling and colleagues does not come with an overall
increase in PSD-95 expression.
To conclude, this study shows that SNC supplementation could have a positive effect on
PSD-95 expression in specific hippocampal subregions affected in C57BL/6 PKU mice. The
examination of additional pre-and postsynaptic markers and functional outcomes, e.g.
executive functioning, will be key to the subsequent more extensive investigation of synaptic
dysfunction in PKU mice and the beneficial effects of SNC supplementation.
Acknowledgments: The authors thank Jan Keijser, Kunja Slopsema, and Els van der Goot for
their skillful assistance during the studies. The research leading to these results has received
funding from Nutricia Advanced Medical Nutrition.
Author contribution: All authors agreed to be listed and approved the submitted version of
the publication. VMB, DVV, AA, MCDW, MK, FJVS, and EAVZ conceived and designed
the experiments; VMB performed the experiments; VMB analyzed the data; AA, MCDW,
and MK contributed reagents/materials/analysis tools; VMB, DVV, AA, MCDW, MK, FJVS,
and EAVZ wrote the paper.
Conflict of interest: AA, MCDW, and MK are employed by Nutricia Advanced Medical
Nutrition. The content is solely the responsibility of the authors and does not necessarily
represent the official views of Nutricia Research.
![Page 109: University of Groningen Phenylketonuria in mice and men ... · Phenylketonuria in mice and men Proefschrift ter verkrijging van de graad van doctor aan de Rijksuniversiteit Groningen](https://reader034.vdocuments.site/reader034/viewer/2022052611/5f03c1e37e708231d40a9ed0/html5/thumbnails/109.jpg)
512536-L-bw-Bruinenberg512536-L-bw-Bruinenberg512536-L-bw-Bruinenberg512536-L-bw-BruinenbergProcessed on: 15-8-2017Processed on: 15-8-2017Processed on: 15-8-2017Processed on: 15-8-2017 PDF page: 108PDF page: 108PDF page: 108PDF page: 108
108
Chapter 6
Figure 2. PSD-95 expression is reduced specifically in the hippocampus of the PKU mouse
model. (A) No significant differences are found between the three groups in striatum
(Kruskal-Wallis: p=0,830) (B) No significant differences are found between the three groups
in the prefrontal cortex (Kruskal-Wallis: p=0.930) (C) Compared to WT mice on normal
chow without SNC, PKU mice on the isocaloric control showed a significant reduction in
PSD-95 expression in the hippocampus, specifically in the granular cell layer of the dentate
gyrus (Kruskal-Wallis: DG-IB p=0,009, DG-OB p=0,008), with a similar trend in the CA1
and CA3 pyramidal cell layer (Kruskal-Wallis: CA1 pyr p=0,053, CA3 pyr p=0,064). A
significant difference was found between the WT group and both PKU groups for the DG-IB
and DG-OB (WT compared to PKU without SNC: Mann-Whitney U test DG-IB; p=0.005,
DG-OB; p=0.005. WT compared to PKU with SNC: Mann-Whitney U test DG-IB; p=0.031,
DG-OB; p=0.026) (arrow bars depict SEM).
![Page 110: University of Groningen Phenylketonuria in mice and men ... · Phenylketonuria in mice and men Proefschrift ter verkrijging van de graad van doctor aan de Rijksuniversiteit Groningen](https://reader034.vdocuments.site/reader034/viewer/2022052611/5f03c1e37e708231d40a9ed0/html5/thumbnails/110.jpg)
512536-L-bw-Bruinenberg512536-L-bw-Bruinenberg512536-L-bw-Bruinenberg512536-L-bw-BruinenbergProcessed on: 15-8-2017Processed on: 15-8-2017Processed on: 15-8-2017Processed on: 15-8-2017 PDF page: 109PDF page: 109PDF page: 109PDF page: 109
6
109
Chapter 6
5. REFERENCES
1 Blau N, van Spronsen FJ, Levy HL.
Phenylketonuria. Lancet 2010; 376: 1417–
27.
2 Waisbren SE, Noel K, Fahrbach K, Cella C,
Frame D, Dorenbaum A et al. Phenylalanine
blood levels and clinical outcomes in
phenylketonuria: a systematic literature
review and meta-analysis. Mol Genet Metab
2007; 92: 63–70.
3 Jahja R, Huijbregts SCJ, de Sonneville
LMJ, van der Meere JJ, van Spronsen
FJ. Neurocognitive evidence for revision
of treatment targets and guidelines for
phenylketonuria. J Pediatr 2014; 164: 895–
899.e2.
4 Joseph B, Dyer CA. Relationship between
myelin production and dopamine synthesis
in the PKU mouse brain. J Neurochem
2003; 86: 615–26.
5 Liang L, Gu X, Lu L, Li D, Zhang X.
Phenylketonuria-related synaptic changes
in a BTBR-Pah(enu2) mouse model.
Neuroreport 2011; 22: 617–22.
6 Andolina D, Conversi D, Cabib S,
Trabalza A, Ventura R, Puglisi-Allegra
S et al. 5-Hydroxytryptophan during
critical postnatal period improves
cognitive performances and promotes
dendritic spine maturation in genetic
mouse model of phenylketonuria. Int J
Neuropsychopharmacol 2011; 14: 479–89.
7 Cordero ME, Trejo M, Colombo M, Aranda
V. Histological maturation of the neocortex
in phenylketonuric rats. Early Hum Dev
1983; 8: 157–73.
8 Loo YH, Fulton T, Miller K, Wisniewski
HM. Phenylacetate and brain dysfunction
in experimental phenylketonuria: synaptic
development. Life Sci 1980; 27: 1283–90.
9 Hörster F, Schwab MA, Sauer SW, Pietz J,
Hoffmann GF, Okun JG et al. Phenylalanine
reduces synaptic density in mixed cortical
cultures from mice. Pediatr Res 2006; 59:
544–8.
10 Adler-Abramovich L, Vaks L, Carny
O, Trudler D, Magno A, Caflisch A et
al. Phenylalanine assembly into toxic
fibrils suggests amyloid etiology in
phenylketonuria. Nat Chem Biol 2012; 8:
701–6.
11 Hood A, Antenor-Dorsey JA V, Hershey
T, Rutlin J, Shimony JS, McKinstry RC et
al. White matter integrity and executive
abilities in individuals with phenylketonuria.
Mol Genet Metab 2013; 109: 125–31.
12 Bauman ML, Kemper TL. Morphologic and
histoanatomic observations of the brain in
untreated human phenylketonuria. Acta
Neuropathol 1982; 58: 55–63.
13 Imperlini E, Orrù S, Corbo C, Daniele A,
Salvatore F. Altered brain protein expression
profiles are associated with molecular
neurological dysfunction in the PKU mouse
model. J Neurochem 2014; 129: 1002–12.
14 Horling K, Schlegel G, Schulz S, Vierk R,
Ullrich K, Santer R et al. Hippocampal
synaptic connectivity in phenylketonuria.
Hum Mol Genet 2014. doi:10.1093/hmg/
ddu515.
15 El-Husseini AE, Craven SE, Chetkovich
DM, Firestein BL, Schnell E, Aoki C et al.
Dual palmitoylation of PSD-95 mediates
its vesiculotubular sorting, postsynaptic
targeting, and ion channel clustering. J Cell
Biol 2000; 148: 159–72.
![Page 111: University of Groningen Phenylketonuria in mice and men ... · Phenylketonuria in mice and men Proefschrift ter verkrijging van de graad van doctor aan de Rijksuniversiteit Groningen](https://reader034.vdocuments.site/reader034/viewer/2022052611/5f03c1e37e708231d40a9ed0/html5/thumbnails/111.jpg)
512536-L-bw-Bruinenberg512536-L-bw-Bruinenberg512536-L-bw-Bruinenberg512536-L-bw-BruinenbergProcessed on: 15-8-2017Processed on: 15-8-2017Processed on: 15-8-2017Processed on: 15-8-2017 PDF page: 110PDF page: 110PDF page: 110PDF page: 110
110
Chapter 6
16 Nagura H, Ishikawa Y, Kobayashi K, Takao
K, Tanaka T, Nishikawa K et al. Impaired
synaptic clustering of postsynaptic density
proteins and altered signal transmission
in hippocampal neurons, and disrupted
learning behavior in PDZ1 and PDZ2 ligand
binding-deficient PSD-95 knockin mice. Mol
Brain 2012; 5: 43.
17 van der Zee EA. Synapses, spines and
kinases in mammalian learning and memory,
and the impact of aging. Neurosci Biobehav
Rev 2015; 50: 77–85.
18 Embury JE, Charron CE, Martynyuk A,
Zori AG, Liu B, Ali SF et al. PKU is a
reversible neurodegenerative process within
the nigrostriatum that begins as early as 4
weeks of age in Pah(enu2) mice. Brain Res
2007; 1127: 136–50.
19 van Wijk N, Broersen LM, de Wilde MC,
Hageman RJJ, Groenendijk M, Sijben
JWC et al. Targeting synaptic dysfunction
in Alzheimer’s disease by administering a
specific nutrient combination. J Alzheimers
Dis 2014; 38: 459–79.
20 Beblo S, Reinhardt H, Demmelmair H,
Muntau AC, Koletzko B. Effect of fish
oil supplementation on fatty acid status,
coordination, and fine motor skills in
children with phenylketonuria. J Pediatr
2007; 150: 479–84.
21 Koletzko B, Beblo S, Demmelmair H,
Hanebutt FL. Omega-3 LC-PUFA supply
and neurological outcomes in children
with phenylketonuria (PKU). J Pediatr
Gastroenterol Nutr 2009; 48 Suppl 1: S2-7.
22 Yi SHL, Kable JA, Evatt ML, Singh RH. A
randomized, placebo-controlled, double-
blind trial of supplemental docosahexaenoic
acid on cognitive processing speed
and executive function in females of
reproductive age with phenylketonuria: A
pilot study. Prostaglandins Leukot Essent
Fatty Acids 2011; 85: 317–27.
23 Mazzola PN, Bruinenberg V, Anjema
K, van Vliet D, Dutra-Filho CS, van
Spronsen FJ et al. Voluntary Exercise
Prevents Oxidative Stress in the Brain of
Phenylketonuria Mice. JIMD Rep 2015.
doi:10.1007/8904_2015_498.
24 APA National Research Council. Nutrient
Requirements of Laboratory AnimalsNo
Title. Fourth rev. The National Academies
Press: Washington DC, 1995.
25 Hovens IB, Schoemaker RG, van der
Zee EA, Absalom AR, Heineman
E, van Leeuwen BL. Postoperative
cognitive dysfunction: Involvement
of neuroinflammation and neuronal
functioning. Brain Behav Immun 2014; 38:
202–10.
26 Van der Zee EA, Keijser JN. Localization of
pre- and postsynaptic cholinergic markers
in rodent forebrain: a brief history and
comparison of rat and mouse. Behav Brain
Res 2011; 221: 356–66.
27 Shors TJ, Falduto J, Leuner B. The opposite
effects of stress on dendritic spines in
male vs. female rats are NMDA receptor-
dependent. Eur J Neurosci 2004; 19: 145–
50.
28 Allen JA, Yadav PN, Roth BL. Insights
into the regulation of 5-HT2A serotonin
receptors by scaffolding proteins and
kinases. Neuropharmacology 2008; 55:
961–8.
29 Zhang Y, Matt L, Patriarchi T, Malik ZA,
Chowdhury D, Park DK et al. Capping of
the N-terminus of PSD-95 by calmodulin
triggers its postsynaptic release. EMBO J
2014; 33: 1341–53.
30 Yudowski GA, Olsen O, Adesnik H,
Marek KW, Bredt DS. Acute inactivation
of PSD-95 destabilizes AMPA receptors at
hippocampal synapses. PLoS One 2013; 8:
e53965.
![Page 112: University of Groningen Phenylketonuria in mice and men ... · Phenylketonuria in mice and men Proefschrift ter verkrijging van de graad van doctor aan de Rijksuniversiteit Groningen](https://reader034.vdocuments.site/reader034/viewer/2022052611/5f03c1e37e708231d40a9ed0/html5/thumbnails/112.jpg)
512536-L-bw-Bruinenberg512536-L-bw-Bruinenberg512536-L-bw-Bruinenberg512536-L-bw-BruinenbergProcessed on: 15-8-2017Processed on: 15-8-2017Processed on: 15-8-2017Processed on: 15-8-2017 PDF page: 111PDF page: 111PDF page: 111PDF page: 111
6
111
Chapter 6
31 MacGillavry HD, Song Y, Raghavachari
S, Blanpied TA. Nanoscale scaffolding
domains within the postsynaptic density
concentrate synaptic AMPA receptors.
Neuron 2013; 78: 615–22.
32 Xu J-Y, Zhang J, Chen C. Long-lasting
potentiation of hippocampal synaptic
transmission by direct cortical input is
mediated via endocannabinoids. J Physiol
2012; 590: 2305–15.
33 Turner DA, Buhl EH, Hailer NP, Nitsch R.
Morphological features of the entorhinal-
hippocampal connection. Prog Neurobiol
1998; 55: 537–62.
34 Martynyuk AE, Glushakov A V, Sumners
C, Laipis PJ, Dennis DM, Seubert
CN. Impaired glutamatergic synaptic
transmission in the PKU brain. Mol Genet
Metab 2005; 86 Suppl 1: S34-42.
![Page 113: University of Groningen Phenylketonuria in mice and men ... · Phenylketonuria in mice and men Proefschrift ter verkrijging van de graad van doctor aan de Rijksuniversiteit Groningen](https://reader034.vdocuments.site/reader034/viewer/2022052611/5f03c1e37e708231d40a9ed0/html5/thumbnails/113.jpg)
512536-L-bw-Bruinenberg512536-L-bw-Bruinenberg512536-L-bw-Bruinenberg512536-L-bw-BruinenbergProcessed on: 15-8-2017Processed on: 15-8-2017Processed on: 15-8-2017Processed on: 15-8-2017 PDF page: 112PDF page: 112PDF page: 112PDF page: 112
![Page 114: University of Groningen Phenylketonuria in mice and men ... · Phenylketonuria in mice and men Proefschrift ter verkrijging van de graad van doctor aan de Rijksuniversiteit Groningen](https://reader034.vdocuments.site/reader034/viewer/2022052611/5f03c1e37e708231d40a9ed0/html5/thumbnails/114.jpg)
512536-L-bw-Bruinenberg512536-L-bw-Bruinenberg512536-L-bw-Bruinenberg512536-L-bw-BruinenbergProcessed on: 15-8-2017Processed on: 15-8-2017Processed on: 15-8-2017Processed on: 15-8-2017 PDF page: 113PDF page: 113PDF page: 113PDF page: 113
CHAPTER 7Long-term treatment with a specific nutrient
combination in phenylketonuria mice improves recognition memory
Vibeke M. Bruinenberg, Danique van Vliet2, Els van der Goot1,
Minke L. de Vries1, Danielle S. Counotte3, Mirjam Kühn3,
Francjan J. van Spronsen2, Eddy A. van der Zee1
1GELIFES, University of Groningen, Groningen, The Netherlands: 2Child Hosp, Univ
Med Cent, Groningen, The Netherlands; 3Nutricia Research, Nutricia Advanced Medical
Nutrition, Utrecht, The Netherlands
![Page 115: University of Groningen Phenylketonuria in mice and men ... · Phenylketonuria in mice and men Proefschrift ter verkrijging van de graad van doctor aan de Rijksuniversiteit Groningen](https://reader034.vdocuments.site/reader034/viewer/2022052611/5f03c1e37e708231d40a9ed0/html5/thumbnails/115.jpg)
512536-L-bw-Bruinenberg512536-L-bw-Bruinenberg512536-L-bw-Bruinenberg512536-L-bw-BruinenbergProcessed on: 15-8-2017Processed on: 15-8-2017Processed on: 15-8-2017Processed on: 15-8-2017 PDF page: 114PDF page: 114PDF page: 114PDF page: 114
114
Chapter 7
ABSTRACT
Introduction
In phenylketonuria (PKU), a gene mutation in the phenylalanine metabolic pathway causes
accumulation of phenylalanine (Phe) in blood and brain. Although early introduction of a
Phe-restricted diet can prevent severe symptoms from developing, patients who are diagnosed
and treated early still experience deficits in cognitive functioning indicating shortcomings of
current treatment. In the search for new and/or additional treatment strategies, a combination
of specific nutrient combination (SNC) was postulated to improve brain function in PKU. In
this study, we examined the effect of SNC on memory and motor function.
Material & Methods
48 homozygous wild-types (WT, +/+) and 96 PKU BTBRPah2 (-/-) male and female mice
received dietary interventions from postnatal day 31 till 10 months of age. These mice were
subdivided in the following 6 groups: high Phe diet (WT C-HP, PKU C-HP), high Phe plus
specific nutrient combination (WT SNC-HP, PKU SNC-HP), PKU low-Phe diet (PKU C-LP),
and PKU low-Phe diet plus specific nutrient combination (PKU SNC- LP). Memory and
motor function in mice was tested at 3,6, and 9 months after treatment initiation in the open
field (OF), novel object recognition test (NOR), spatial object recognition test (SOR), and
the balance beam (BB).
Results
In the NOR, we found that PKU mice despite being subjected to high Phe conditions could
master the task on all three time points when supplemented with SNC. Under low Phe
conditions, the PKU mice on control diet can master the NOR on all time points and mice
on the supplemented diet can master the task at time point 6 and 9. SNC supplementation
did not consistently influence the performance in the OF, SOR or BB.
Conclusion
This study is the first long-term intervention study in BTBR PKU mice that shows that
SNC supplementation can specifically benefit novel object recognition. Future research is
necessary to identify the mode of action of SNC supplementation.
![Page 116: University of Groningen Phenylketonuria in mice and men ... · Phenylketonuria in mice and men Proefschrift ter verkrijging van de graad van doctor aan de Rijksuniversiteit Groningen](https://reader034.vdocuments.site/reader034/viewer/2022052611/5f03c1e37e708231d40a9ed0/html5/thumbnails/116.jpg)
512536-L-bw-Bruinenberg512536-L-bw-Bruinenberg512536-L-bw-Bruinenberg512536-L-bw-BruinenbergProcessed on: 15-8-2017Processed on: 15-8-2017Processed on: 15-8-2017Processed on: 15-8-2017 PDF page: 115PDF page: 115PDF page: 115PDF page: 115
7
115
Chapter 7
1. INTRODUCTION
The detrimental effects of increased phenylalanine (Phe) concentrations on the brain are
clearly visible in the metabolic disorder, Phenylketonuria (PKU, OMIM 261600). In this
disorder, a mutation in the gene encoding for the hepatic enzyme phenylalanine hydroxylase
causes a disruption in the conversion of Phe to tyrosine. Consequently, when no restriction
is made in natural protein intake, Phe accumulates in blood and brain. Neonatal screening
facilitates early introduction of treatment preventing symptoms such as severe cognitive
disabilities and epilepsy. Nonetheless, even early-continuously-treated patients experience
deficits in cognitive functioning, in for instance processing speed, attention, working memory
and social-cognitive functioning1–3, highlighting that current treatment is not optimal.
In the search for new and/or additional treatment strategies, a combination of specific nutrients
(SNC) was postulated to relieve the functional and neurobiological effects of increased Phe4.
The specific nutrients selected were originally combined to facilitate the Kennedy pathway
as they are important precursors, cofactors and antioxidants for this pathway. This pathway
is important in phospholipid synthesis, a key feature of the neuronal membrane. Functional
neuronal membranes are important for synaptic functioning and neurotransmitter release5,6,
domains affected in PKU. Furthermore, other PKU-related problems in, for instance, white
matter integrity and oxidative stress could benefit from these nutrients as antioxidants
present in the SNC could relieve oxidative stress7–9 and the phospholipids present in the SNC
are an important part of myelin10. Therefore, the specific nutrient combination (SNC) aims
to detain the effect of Phe on neurotransmitter metabolism, white matter integrity, oxidative
stress and synaptic functioning, in the end, positively affecting functional outcome.
The period in which SNC supplementation could have an added effect on the current
recommended life-long treatment with a Phe restricted diet in PKU patients is not clear.
Although life-long treatment is recommended, at present, little is known about the progression
of the disorder under this treatment during aging as it is implemented approximately 50-
60 years ago. Therefore, the aim of this study is twofold: 1) to investigate a phe-restricted
treatment in an aging PKU mouse model, 2) to examine the effect of SNC on the behavioral
performance of PKU mice under high Phe and low Phe conditions.
2. METHODS
2.1 Animals
A breeding colony of heterozygous (+/-) mating pairs generated 48 wild-types (WT, +/+) and
96 PKU BTBRPah2 (-/-) male and female mice. Original breeding pairs were kindly provided
by prof. Puglisi-Allegra from the Sapienza, University of Roma, Rome, Italy. On postnatal
day (PND) 28 the animals were weaned and the genetic status of the animals was established
![Page 117: University of Groningen Phenylketonuria in mice and men ... · Phenylketonuria in mice and men Proefschrift ter verkrijging van de graad van doctor aan de Rijksuniversiteit Groningen](https://reader034.vdocuments.site/reader034/viewer/2022052611/5f03c1e37e708231d40a9ed0/html5/thumbnails/117.jpg)
512536-L-bw-Bruinenberg512536-L-bw-Bruinenberg512536-L-bw-Bruinenberg512536-L-bw-BruinenbergProcessed on: 15-8-2017Processed on: 15-8-2017Processed on: 15-8-2017Processed on: 15-8-2017 PDF page: 116PDF page: 116PDF page: 116PDF page: 116
116
Chapter 7
via quantitative PCR analysis on DNA extracted from ear tissue (as previously described11).
After weaning, all littermates were kept in the breeding cage (26x42x15 cm) without the
mother until PND 31. On PND 31, the animals were group housed in sex-matched pairs
of two in cages of the same dimensions (26x42x15 cm) with sawdust bedding and cage
enrichment in the form of nesting material, paper rolls, and a small wooden stick. To prevent
fighting among the males, a red transparent house was added in their cages in the adult
stage. The condition of the housing facility was kept constant at a temperature of 21±1 °C
with a 12/12 light/dark cycle. The animals received fresh food every day (between zeitgeber
time (ZT) 8-10) and had ad libitum access to water. Leftover food was collected every day
before given fresh food. Together with a thorough search of bedding after cage cleaning,
the difference with the offered food gave an estimation of weekly food intake per pair.
Furthermore, body weight of the mice was measured during these weekly cage cleaning (ZT
8-10). The dietary intervention started at PND 31 until 10 months of age. The length of the
experiment required clear humane endpoints. These were set on a decrease in body weight of
15% together with other sickness behavior e.g. inactive behavior, arched back. If one of the
pair of mice was excluded from the experiment, females were placed in pairs of three. Males
were kept solitary. All experimental procedures were approved by an independent ethics
committee for animal experimentation (6504E, Groningen, the Netherlands) and complied
with the principles of good laboratory animal care following the European Directive for the
protection of animals used for scientific purposes.
2.2. Dietary intervention
The dietary intervention started on PND 31. At this time point, pairs of mice were assigned
to one of the following six groups: WT control high Phe diet (WT C-HP), WT high Phe diet
plus SNC (WT SNC-HP), PKU high Phe diet (PKU C-HP), PKU high Phe diet plus SNC
(PKU SNC-HP), PKU low-Phe diet (PKU C-LP), and PKU low-Phe diet plus SNC (PKU
SNC-LP). The high Phe diet is a normal diet for WT animals. Each group consisted of 12
males and 12 females. As the mice were at the pre-adolescence stage at the beginning of the
experiments, the diet was based on the growth diet AIN-93G. In the adult stage (13 weeks),
the mice were switched to diets based on the maintenance diet AIN-93M manufactured by
the same supplier (Research Diet Services BV, Wijk bij Duurstede, The Netherlands). The
key characteristics of the diets were kept the same; normal diet with or without SNC had Phe
concentrations of 6.2 g/kg and tyrosine concentrations of 15 g/kg and low-Phe diet (based
on previous literature12) had Phe concentrations of 2.0 g/kg and tyrosine concentrations of
15 g/kg. The specifics of the diets are depicted in Table 1.
![Page 118: University of Groningen Phenylketonuria in mice and men ... · Phenylketonuria in mice and men Proefschrift ter verkrijging van de graad van doctor aan de Rijksuniversiteit Groningen](https://reader034.vdocuments.site/reader034/viewer/2022052611/5f03c1e37e708231d40a9ed0/html5/thumbnails/118.jpg)
512536-L-bw-Bruinenberg512536-L-bw-Bruinenberg512536-L-bw-Bruinenberg512536-L-bw-BruinenbergProcessed on: 15-8-2017Processed on: 15-8-2017Processed on: 15-8-2017Processed on: 15-8-2017 PDF page: 117PDF page: 117PDF page: 117PDF page: 117
7
117
Chapter 7
Table 1. Nutritional content of experimental diets. * The corresponding mineral and vitamin premixes
to the growth (G: AIN-93G) or maintenance (M: AIN-93M) diets were used.
g /kg diet C-HP SNC-HP C-LP SNC-HP
G M G M G M G M
Carbohydrates 666,5 718,4 638,6 690,5 670,7 722,6 642,8 694,7
Fat 50,0 50,0 50,0 50,0 50,0 50,0 50,0 50,0
Dietary fibre 50,0 50,0 50,0 50,0 50,0 50,0 50,0 50,0
Protein 186,0 134,1 186,0 134,1 181,8 129,9 181,8 129,9
Amino acids
Alanine 4,6 3,3 4,6 3,3 4,6 3,3 4,6 3,3
Arginine 6,4 4,5 6,4 4,5 6,4 4,5 6,4 4,5
Aspartic acid 12,2 8,0 12,2 8,0 12,2 8,0 12,2 8,0
Cystine 3,7 2,4 3,7 2,4 3,7 2,4 3,7 2,4
Glutamic acid 36,3 25,5 36,3 25,5 36,3 25,5 36,3 25,5
Glycine 3,2 2,3 3,2 2,3 3,2 2,3 3,2 2,3
Histidine 4,6 3,3 4,6 3,3 4,6 3,3 4,6 3,3
Isoleucine 8,2 5,9 8,2 5,9 8,2 5,9 8,2 5,9
Leucine 15,7 10,9 15,7 10,9 15,7 10,9 15,7 10,9
Lysine 16,3 9,2 16,3 9,2 16,3 9,2 16,3 9,2
Methionine 4,6 3,3 4,6 3,3 4,6 3,3 4,6 3,3
Phenylalanine 6,2 6,2 6,2 6,2 2,0 2,0 2,0 2,0
Proline 20,5 14,3 20,5 14,3 20,5 14,3 20,5 14,3
Serine 9,7 6,7 9,7 6,7 9,7 6,7 9,7 6,7
Threonine 6,7 4,7 6,7 4,7 6,7 4,7 6,7 4,7
Tryptophan 2,1 1,6 2,1 1,6 2,1 1,6 2,1 1,6
Tyrosine 15,0 15,0 15,0 15,0 15,0 15,0 15,0 15,0
Valine 10,0 7,0 10,0 7,0 10,0 7,0 10,0 7,0
Mineral premix* 35,0 35,0 35,0 35,0 35,0 35,0 35,0 35,0
Vitamin premix* 10,0 10,0 10,0 10,0 10,0 10,0 10,0 10,0
Additives 2,5 2,5 2,5 2,5 2,5 2,5 2,5 2,5
SNC 27,5 27,5 27,5 27,5
Totaal (g) 1000 1000 1000 1000 1000 1000 1000 1000
Energie (kcal/kg diet) 3859,9 3859,9 3748,4 3748,4 3859,9 3859,9 3748,4 3748,4
![Page 119: University of Groningen Phenylketonuria in mice and men ... · Phenylketonuria in mice and men Proefschrift ter verkrijging van de graad van doctor aan de Rijksuniversiteit Groningen](https://reader034.vdocuments.site/reader034/viewer/2022052611/5f03c1e37e708231d40a9ed0/html5/thumbnails/119.jpg)
512536-L-bw-Bruinenberg512536-L-bw-Bruinenberg512536-L-bw-Bruinenberg512536-L-bw-BruinenbergProcessed on: 15-8-2017Processed on: 15-8-2017Processed on: 15-8-2017Processed on: 15-8-2017 PDF page: 118PDF page: 118PDF page: 118PDF page: 118
118
Chapter 7
2.3 Behavioral paradigms
During the dietary intervention, the animals were behaviorally assessed every 12 weeks
starting at four months of age. Five days before each test session, a blood spot was taken.
Each test session consisted of an open field (OF), novel object recognition (NOR), spatial
object recognition (SOR) and a balance beam (BB). The animals were tested between ZT1-6.
All procedures and experimental setup were described in our previous study13. In short, the
habituation phase of the NOR was used as OF. On day 1 of the testing session, the animals
were placed in the middle of a square arena (50x50x35 cm) to explore the arena freely for
ten minutes. The subsequent day the animals could explore two identical objects for ten
minutes in the familiarization phase of the NOR. Again 24 hours later, one of the objects
was replaced with a novel object wherein the mouse could explore this new setting for 10
minutes. After a period of 5 days, the animals were tested in the SOR. The first day the animals
were exposed to four sessions of 6 minutes. The first session was similar to the habituation
phase of the NOR. In the second to the fourth session, the animals could freely explore
three different objects (in shape, color, and texture) in a specific configuration. Between
sessions, the animals were placed back in the home cage for 2 minutes. The second day, one
of the objects was moved to a different location. The objects, the starting condition, and the
displaced object were randomized over trails. Both the NOR and SOR were performed in
a separate room recorded with a camera (Panasonic WVCP500) connected to a computer
outside the room with Media recorder (Noldus, The Netherlands). The balance beam was
performed in the housing facility 24 hours later. During this task, the animals had to cross
a square wooden beam (length 1 m, width 5 mm, height 10 mm, horizontally positioned 50
cm above the underlying surface) over four distances (10, 40, 75, and 100 cm). The final
distance was used as read-out trail. In this trail, the number of correct steps and total steps
necessary to cross the beam were manually scored and calculated to a percentage. A step was
considered correct if the hind paw had a full placement on the beam at the initiation and end
of the forward movement.
The open field was analyzed with Ethovision v.11 (Noldus, The Netherlands). In this
analysis, the arena was divided into a center zone, four border zones, and four corner zones14.
Activity was quantified by the distance moved and anxiety-like behavior was examined by
the preference of the animal to seek out the more sheltered zones, the corners. In the NOR
and SOR, the exploration time of each object was manually scored with the program ELINE
(made in house). For the NOR, the discrimination index (DI) was calculated by the time
spent exploring the novel object minus the time exploring the same object divided by the
total exploration time of both objects15. For the SOR, the exploration time of the first three
training sessions was compared to the time exploring in the test session. The mice mastered
these learning paradigms when they explored either the novel object or the relocated object
above change level.
![Page 120: University of Groningen Phenylketonuria in mice and men ... · Phenylketonuria in mice and men Proefschrift ter verkrijging van de graad van doctor aan de Rijksuniversiteit Groningen](https://reader034.vdocuments.site/reader034/viewer/2022052611/5f03c1e37e708231d40a9ed0/html5/thumbnails/120.jpg)
512536-L-bw-Bruinenberg512536-L-bw-Bruinenberg512536-L-bw-Bruinenberg512536-L-bw-BruinenbergProcessed on: 15-8-2017Processed on: 15-8-2017Processed on: 15-8-2017Processed on: 15-8-2017 PDF page: 119PDF page: 119PDF page: 119PDF page: 119
7
119
Chapter 7
2.4 Statistics
All statistical analysis was performed with SPSS 22.0. All data were checked for normality
(Shapiro-Wilk test) and homogeneity of variance (Levene’s test). Food intake was tested
non-parametrically with a Kruskal-Wallis and post hoc analysis was done with a Mann-
Whitney U test. A fixed effects linear mixed model was used to test repeated measurements
of body weight, and the behavioral paradigms. As the groups were not fully balance between
the genotypes (WT mice are not able to receive low Phe diet), two models were tested; 1) a
factorial analysis of the factors: time, genotype, and specific nutrient combination was used
to investigate differences between WT and PKU mice on high Phe diet and the influence
of SNC supplementation within these groups, 2) a factorial analysis of the factors: time,
specific nutrient combination, and Phe condition was used to examine differences between
the four different diets in PKU mice (C-HP, SNC-HP, C-LP, and SNC-LP). For body weight,
we assume that the body weight measurements taken near each other are more related to
each other than the measurements taken with a larger time interval (for example we expect
that the body weight measurement of week 13 is more similar to week 14 than week to
41). Therefore, the repeated covariance type was set to first order autoregressive. For the
behavioral this assumption was not made, therefore a diagonal covariance type was selected.
Finally, the ability to master the task was investigated by comparing the DI to change level
(0) with a t-test. No corrections were made for multiplicity. A p-value equal to or less than
0.05 was considered significant. If not differently specified, data are expressed as mean ±
standard error of the mean.
3. RESULTS
3.1 General health, body weight, and food intake
In the course of the experiment, 21 animals were excluded from the experiment. The excluded
animals were not in a specific treatment group (Kruskal-Wallis test, groups p=0.081) and
dropout was not skewed by genotype or sex (Kruskal-Wallis test, genotype p=0.134, sex
p=0.480). The general health of the animals was, among others, monitored by body weight
and food intake. Both parameters were split for growth diet and maintenance diet, the first 9
weeks and starting from 3 months respectively. Furthermore, male and female were analyzed
separately as food intake and body weight was different between the sexes. In addition,
graphs and analysis was split for all groups on a high Phe diet (model 1) and all PKU groups
(model 2). In figure 1A-B, an increase in body weight over time is found in males and females
(Female; time p<0.001, Male; time: p<0.001). In females, the progression of the body weight
differed between WT and PKU mice (genotype x time p<0.001) and an interaction was
found between genotype and SNC supplementation (genotype x time x SNC p=0.005). In
male, similar results were found but no interaction was found with SNC supplementation
(time p<0.001, genotype x time p<0.001, genotype x time x SNC p=0.871). In figure 1C-D
![Page 121: University of Groningen Phenylketonuria in mice and men ... · Phenylketonuria in mice and men Proefschrift ter verkrijging van de graad van doctor aan de Rijksuniversiteit Groningen](https://reader034.vdocuments.site/reader034/viewer/2022052611/5f03c1e37e708231d40a9ed0/html5/thumbnails/121.jpg)
512536-L-bw-Bruinenberg512536-L-bw-Bruinenberg512536-L-bw-Bruinenberg512536-L-bw-BruinenbergProcessed on: 15-8-2017Processed on: 15-8-2017Processed on: 15-8-2017Processed on: 15-8-2017 PDF page: 120PDF page: 120PDF page: 120PDF page: 120
120
Chapter 7
the curves of all PKU groups are depicted. Again, an increase in body weight was observed
for both sexes (Female; time p<0.001, Male; time: p<0.001). In both sexes, this increase
of body weight over time was different between high Phe and low Phe conditions (Female:
Phe condition x time p=0.002, Male: Phe condition x time p=0.009). SNC supplementation
did not significantly contribute to this model. In figure 1E-F, the average daily food intake
is depicted. A mere indication of the differences in food intake can be drawn from these
data, as only group housed individuals of the same genotype were included. Nevertheless,
no differences were found in food intake between the groups in female mice (p=0.173), and
in male mice only between WT C-HP and PKU SNC-HP (p=0.036). In maintenance diet
(Figure 2A-D), the growth of the animals persisted (Fig 2A Female; time p<0.001, Fig 2B
Male; time: p<0.001, Figure 2C Female; time p<0.001, Figure 2D Male; time: p<0.001). In
male mice, the differences in the increase of body weight over time between WT and PKU on
high Phe diet were still present (genotype x time p=0.002) but in females this interaction was
no longer significant (genotype x time p=0.754). In PKU mice (figure 2C-D), similar results
were found (Female: Phe condition x time p<0.001, Male Phe condition x time p=0.002).
Daily food intake was also similar to the results found in growth diet (Male: WT C-HP and
PKU SNC-HP p=0.036).
3.2 Open field
The distance covered in the open field was used to explore differences in novelty-induced
exploration. Gender differences were observed, and therefore, male and female mice were
analyzed separately. In figure 3A trough 3D, it is evident that all groups move less through
the maze (Fig 3A Female; time p<0.001, Fig 3B Male; time: p<0.001, Figure 3C Female;
time p<0.001, Figure 3D Male; time: p<0.001). In female mice, the WT mice covered
more distance in the maze compared to PKU high Phe mice (p<0.001). In male mice, the
progression over time was different between WT and PKU high Phe mice (p=0.013) but no
main effect was found (p=0.663). The distance moved was differently influenced by SNC
supplementation in WT and PKU mice (p=0.001). In female PKU mice (Figure 3C), PKU
mice on low Phe diet covered more distance through the maze compared to PKU mice on
high Phe diet (p=0.022). Furthermore, the progression over time was different between these
groups (p=0.017). In male PKU mice (Figure 3D), the difference between high Phe and low
Phe diet was inversed. The mice in the high Phe condition moved more through the maze
compared to the low Phe condition (p=0.006). The progress over time was not different
between the conditions (p=0.254).
In addition to the distance moved through the arena, the preference of the mice to explore
more sheltered areas of the arena was investigated in the open field. This was done by
examining time spent in the corners. Over time, the time spent in the corners was not constant
(Fig 4A Female; time p<0.001, Fig 4B Male; time: p<0.001, Figure 4C Female; time p<0.001,
Figure 4D Male; time: p<0.001). In the females, the PKU high Phe mice spent less time in
![Page 122: University of Groningen Phenylketonuria in mice and men ... · Phenylketonuria in mice and men Proefschrift ter verkrijging van de graad van doctor aan de Rijksuniversiteit Groningen](https://reader034.vdocuments.site/reader034/viewer/2022052611/5f03c1e37e708231d40a9ed0/html5/thumbnails/122.jpg)
512536-L-bw-Bruinenberg512536-L-bw-Bruinenberg512536-L-bw-Bruinenberg512536-L-bw-BruinenbergProcessed on: 15-8-2017Processed on: 15-8-2017Processed on: 15-8-2017Processed on: 15-8-2017 PDF page: 121PDF page: 121PDF page: 121PDF page: 121
7
121
Chapter 7
the corners compared WT mice (Fig 4A, genotype p<0.001) in which the progress in time
was also different (p=0.040). In male mice, no difference was observed between WT and
PKU high Phe mice or the progression in time (genotype=0.906, time x genotype=0.055). In
the PKU mice, a trend was observed between low and high Phe conditions in female mice
(p=0.064) but not in male mice (p=0.586).
Figure 1 Growth diet. Results are separated for females and male (graphs A,C,E and graphs B,D,F,
respectively). In figure A and B, the bodyweight curves of the first eight weeks of treatment, starting on
postnatal day 31, are depicted for all groups on high Phe diet (WT C-HP, WT SNC-HP, PKU C-HP, PKU
SNC-HP). In figure C and D, the body weight curves for all PKU mice groups are depicted. Mean daily
food intake is depicted in graph E and F (median depicted). Graphs A-D: mean± standard error of the
mean (SEM), x-axis depict days. Graphs E-F: median.
![Page 123: University of Groningen Phenylketonuria in mice and men ... · Phenylketonuria in mice and men Proefschrift ter verkrijging van de graad van doctor aan de Rijksuniversiteit Groningen](https://reader034.vdocuments.site/reader034/viewer/2022052611/5f03c1e37e708231d40a9ed0/html5/thumbnails/123.jpg)
512536-L-bw-Bruinenberg512536-L-bw-Bruinenberg512536-L-bw-Bruinenberg512536-L-bw-BruinenbergProcessed on: 15-8-2017Processed on: 15-8-2017Processed on: 15-8-2017Processed on: 15-8-2017 PDF page: 122PDF page: 122PDF page: 122PDF page: 122
122
Chapter 7
Figure 2 Maintenance diet. Graphs are identically organized as figure 2. In graphs A-D, the bodyweight
curves of the last 28 weeks of dietary treatment are depicted, starting at week 13. In graphs E-F, mean
daily food intake is depicted. Graphs A-D: mean± SEM, x-axis depict weeks. Graphs E-F: median
![Page 124: University of Groningen Phenylketonuria in mice and men ... · Phenylketonuria in mice and men Proefschrift ter verkrijging van de graad van doctor aan de Rijksuniversiteit Groningen](https://reader034.vdocuments.site/reader034/viewer/2022052611/5f03c1e37e708231d40a9ed0/html5/thumbnails/124.jpg)
512536-L-bw-Bruinenberg512536-L-bw-Bruinenberg512536-L-bw-Bruinenberg512536-L-bw-BruinenbergProcessed on: 15-8-2017Processed on: 15-8-2017Processed on: 15-8-2017Processed on: 15-8-2017 PDF page: 123PDF page: 123PDF page: 123PDF page: 123
7
123
Chapter 7
Figure 3 Distance moved in open field. (A) Female mice on high Phe diet, (B) male mice on high Phe diet,
(C) female PKU mice, and (D) male PKU mice. (mean± SEM)
Figure 4 Time spent in corners of the maze. The time spent in the corners of the maze is thought to
represent anxiety-like behavior as the mice seek out the more sheltered areas of the arena. (A) Female
mice on high Phe diet, (B) male mice on high Phe diet, (C) female PKU mice, and (D) male PKU mice.
(mean± SEM)
![Page 125: University of Groningen Phenylketonuria in mice and men ... · Phenylketonuria in mice and men Proefschrift ter verkrijging van de graad van doctor aan de Rijksuniversiteit Groningen](https://reader034.vdocuments.site/reader034/viewer/2022052611/5f03c1e37e708231d40a9ed0/html5/thumbnails/125.jpg)
512536-L-bw-Bruinenberg512536-L-bw-Bruinenberg512536-L-bw-Bruinenberg512536-L-bw-BruinenbergProcessed on: 15-8-2017Processed on: 15-8-2017Processed on: 15-8-2017Processed on: 15-8-2017 PDF page: 124PDF page: 124PDF page: 124PDF page: 124
124
Chapter 7
3.3 Learning and memory paradigms: NOR and SOR
No differences were observed in sex, and therefore, males and females were analyzed
together. In the model, a significant difference was found between WT and PKU high Phe diet
in DI (p<0.001). SNC supplementation improved the performance of PKU mice (p<0.001)
whereas no differences were found between Phe conditions (p=0.324) or a different response
of Phe conditions to the SNC supplementation (p=0.236). Although this statistical analysis
highlight the difference between the groups, it doesn’t give insight in the ability of the mice
to master the learning and memory paradigm. To investigate this, DI was compared to
change level. From figure 5A, it is clear that the mice of the WT-groups (C-HP t(23)=3.407,
p=0.002, SNC-HP t(23)=3.715, p=0.001), PKU SNC-HP (t(20)=2.915, p=0.009), and PKU
C-LP (t(23)=3.646 p=0.001) are able to master the task after three months of treatment.
However, the PKU C-HP (t(22)=0.070 p=0.944) and PKU SNC-LP (t(23)=1.707 p=0.103)
did not. After six months of treatment (Figure 5B), all groups except for the PKU C-HP
learned the task (WT C-HP t(23)=7.789 p<0.001, WT SNC-HP t(23)=6.924 p<0.001, PKU
C-HP t(20)=0.826 p=0.418, PKU SNC-HP t(18)=3.573 p=0.002, PKU C-LP t(23)=2.137,
p=0.043, PKU SNC-LP t(22)=2.648 p=0.015). After the nine month of treatment, for a
second time, all groups mastered the NOR task, with the exception of PKU C-HP (WT
C-HP t(21)=3.482 p=0.002, WT SNC-HP t(20)=3.081 p= 0.006, PKU C-HP t(21)=1.729
p=0.098, PKU SNC-HP t(15)=6.037 p<0.001, PKU C-LP t(22)=2.230 p=0.036, PKU
SNC-LP t(20)=5.461, p<0.001). In PKU mice, the SNC supplementation did not affect the
time spent on exploring the objects ( p=0.294). PKU on high Phe diet did spent more time
exploring the objects compared to the low Phe diet groups (p=0.012). In WT mice, SNC
supplementation increased the exploration (p=0.033).
The analysis of the SOR data, did not reveal a PKU phenotype of the PKU control high Phe
group compared to the WT group (p=0.768). Upon a closer look, by comparing the DI to
change level and eliminating values two standard deviations outside the mean, similar results
were found after three months of treatment as previously described in the NOR. The mice
of the WT-groups (C-HP t(23)=2.450, p=0.022, SNC-HP t(22)=2.123, p=0.045), PKU SNC-
HP (t(19)=2.228, p=0.038), and PKU C-LP (t(23)=2.193 p=0.037) are able to master the
task after three months of treatment. The PKU C-HP (t(19)=-.069 p=0.946) and PKU SNC-
LP (t(23)=1.385 p=0.179) did not. However, the WT mice did no longer master the SOR
after six months of treatment (C-HP t(22)=2.450, p=0.074, SNC-HP t(23)=1.719, p=0.099).
![Page 126: University of Groningen Phenylketonuria in mice and men ... · Phenylketonuria in mice and men Proefschrift ter verkrijging van de graad van doctor aan de Rijksuniversiteit Groningen](https://reader034.vdocuments.site/reader034/viewer/2022052611/5f03c1e37e708231d40a9ed0/html5/thumbnails/126.jpg)
512536-L-bw-Bruinenberg512536-L-bw-Bruinenberg512536-L-bw-Bruinenberg512536-L-bw-BruinenbergProcessed on: 15-8-2017Processed on: 15-8-2017Processed on: 15-8-2017Processed on: 15-8-2017 PDF page: 125PDF page: 125PDF page: 125PDF page: 125
7
125
Chapter 7
Figure 5 Novel object recognition. Discrimination index ((exploration novel object- exploration same
object)/total exploration time) is tested against change level (0). * represent a significant difference from
change level. (mean± SEM)
3.4 Balance beam
The relative number of correct steps was used to investigate the motor performance. In both
females and males (Figure 6A-B), a clear difference was observed between WT and PKU
mice on high Phe diet (Fig 6A Female; p<0.001, Fig 4B Male; p<0.001). In female PKU mice
(Figure 6A), SNC supplementation reduced the relative number of correct steps (p=0.037).
In male PKU mice, this effect was not observed (p=0.785). When comparing low and high
Phe conditions (Figure 6C-D), only female mice performed better in the low Phe groups
(Figure 6C Female; fit of model AIC=1050.248, p<0.001, Figure 6D Male; fit of model
AIC=1217.239, p=0.863). SNC supplementation did not influence the performance of the
PKU mice groups (female: p=0.587, male: p=0.671).
![Page 127: University of Groningen Phenylketonuria in mice and men ... · Phenylketonuria in mice and men Proefschrift ter verkrijging van de graad van doctor aan de Rijksuniversiteit Groningen](https://reader034.vdocuments.site/reader034/viewer/2022052611/5f03c1e37e708231d40a9ed0/html5/thumbnails/127.jpg)
512536-L-bw-Bruinenberg512536-L-bw-Bruinenberg512536-L-bw-Bruinenberg512536-L-bw-BruinenbergProcessed on: 15-8-2017Processed on: 15-8-2017Processed on: 15-8-2017Processed on: 15-8-2017 PDF page: 126PDF page: 126PDF page: 126PDF page: 126
126
Chapter 7
Figure 6 Motor performance. The relative number of correct steps made in the probe trail (100 cm) is
depicted. (A) Female mice on high Phe diet, (B) male mice on high Phe diet, (C) female PKU mice, and
(D) male PKU mice. (mean± SEM).
4. DISCUSSION
In this study, a long-term dietary intervention with SNC supplementation, a low-Phe diet or
a combination of these diets was investigated in male and female BTBR PKU mice. These
groups of mice were compared to WT controls with or without supplementation. During
the 9 months of intervention, the animals were tested three time (after 3, 6, and 9 months
of treatment) in the open field, NOR, SOR and the balance beam. In the NOR, we found
that PKU mice despite being subjected to high Phe conditions could master the NOR at all
three time points when supplemented with SNC. Under low Phe conditions, the PKU mice
on control diet could master the NOR on all time points and mice on the supplemented
diet could master the task at time point 6 and 9. SNC supplementation did not consistently
influence the performance in the open field, SOR or the balance beam. This indicates that
SNC supplementation specifically influences the performance in the NOR.
4.1 A long-term study: Opportunities and limitations
This study was the first to investigate the long-term effect on behavior of different treatments
in the BTBR PKU mouse model. As a consequence, we were unprepared for the loss in
animals during the experiment due to early aging. This led to unbalanced groups and smaller
numbers of animals to be tested. However so, we believe that the exclusion of animals from
the experiment was not skewed towards any experimental group and that the remaining
animals were in good condition, enabling us to draw firm conclusions. Nevertheless, this
study shows that future studies should be aware of this early drop-out of BTBR mice.
![Page 128: University of Groningen Phenylketonuria in mice and men ... · Phenylketonuria in mice and men Proefschrift ter verkrijging van de graad van doctor aan de Rijksuniversiteit Groningen](https://reader034.vdocuments.site/reader034/viewer/2022052611/5f03c1e37e708231d40a9ed0/html5/thumbnails/128.jpg)
512536-L-bw-Bruinenberg512536-L-bw-Bruinenberg512536-L-bw-Bruinenberg512536-L-bw-BruinenbergProcessed on: 15-8-2017Processed on: 15-8-2017Processed on: 15-8-2017Processed on: 15-8-2017 PDF page: 127PDF page: 127PDF page: 127PDF page: 127
7
127
Chapter 7
In this study, we performed multiple rounds of behavioral testing in the same animal to
examine changes over time. In the open field, we found a reduction in locomotor activity and
an increase in time spent in the corners even in the WT mice. Although this is not described
in BTBR mice, our results are in line with other mouse studies that show reduced locomotor
activity in aging mice in the open field16,17. The preference for a certain location in the maze
is thought to depend on the properties of the maze and lighting conditions that could explain
the mixed results found for this parameter between studies16,17. In the NOR and the balance
beam, no clear differences were found over time that suggest that either the multiple testing
rounds or the aging effect of a period of 6 months does not influence the performance in
these tasks. In contrast, the SOR was affected by either one or both of these factors. At
time point 3, the WT groups showed similar abilities to master the task compared to the
NOR. However, at latter time points, the WT individuals were not able to master this task.
Although it is possible that multiple rounds of behavioral testing can influence this outcome,
impairments of spatial memory are reported in normal aging mice and BTBR mice18–21.
4.2 Timing of treatment
Early intervention in PKU patients can prevent the irreversible cognitive disabilities found
in untreated or late-diagnosed PKU patients22, suggesting a specific window of treatment.
Although guidelines are given, this window is not that exactly defined22. For example, a Phe-
restricted diet can still have positive effects in late-diagnosed PKU patients23. In our current
study, we have introduced the SNC supplementation and low-Phe conditions at PND 31. At
this time point, the maturation of the brain and the characteristic behavior in mice is thought
to represent the adolescence stage in humans24. The introduction of our treatment would,
therefore, surpass the early intervention window of PKU treatment to prevent cognitive
disabilities. Nevertheless, the PKU mice on a control low Phe diet did master the NOR
paradigm. Suggesting, at least in PKU mice, that the low Phe conditions introduced later in
life can be beneficial for object recognition memory. Furthermore, no early cognitive decline
in novel object recognition was observed under these conditions.
The timing of diet was also important in the SNC supplementation. Under high Phe conditions,
PKU mice that received SNC supplementation were able to master the NOR task at all three
time points. In contrast to the SNC supplementation in low Phe conditions, where the animals
only mastered the NOR task at time point 6 and 9. The original basis SNC supplementation
in Alzheimer’s disease was the idea that Alzheimer’s patients had a greater need for renewal
of synapses than healthy aged-matched controls25. By supplementing specific nutrients, this
nutritional need could be met and consequently improve synaptic functioning25. The positive
results of SNC in the high Phe condition and the low Phe condition on latter time points
could, therefore, be a consequence of meeting a nutritional need for the renewal of synapses.
A need that perhaps was not present at time point 3.
![Page 129: University of Groningen Phenylketonuria in mice and men ... · Phenylketonuria in mice and men Proefschrift ter verkrijging van de graad van doctor aan de Rijksuniversiteit Groningen](https://reader034.vdocuments.site/reader034/viewer/2022052611/5f03c1e37e708231d40a9ed0/html5/thumbnails/129.jpg)
512536-L-bw-Bruinenberg512536-L-bw-Bruinenberg512536-L-bw-Bruinenberg512536-L-bw-BruinenbergProcessed on: 15-8-2017Processed on: 15-8-2017Processed on: 15-8-2017Processed on: 15-8-2017 PDF page: 128PDF page: 128PDF page: 128PDF page: 128
128
Chapter 7
4.3 Specificity of SNC supplementation
Besides the beneficial effect of the SNC nutrients on the Kennedy pathway, the nutrients
(separately) of the SNC combination are likely to positively affect synaptic functioning,
neurotransmitter metabolism, white matter integrity, and oxidative stress. In this study, we
were not able to explore the underlying molecular mechanism in which SNC supplementation
exerted its positive effect in the brain. However, by comparing the different outcome
parameters, we could hypothesize certain brain regions and domains to be affected. In the
PKU mice, SNC supplementation (only in females) and low Phe conditions improved body
weight. An outcome parameter, at times, used as an indication of efficacy of treatment in
PKU mice26,27. Therefore, the improvements found in body weight could indicate efficacy of
treatment by positively effecting growth and/or metabolic stress in PKU26. Future research is
needed to establish the effects of SNC on body composition, energy balance, and the possible
difference between male and female mice in this response. In the behavioral paradigms,
SNC supplementation specifically improved the NOR. The long-term object recognition
protocol used in this study is thought to involve the hippocampal system15,28. This brain
region receives input from the perirhinal cortex, which in turn collects information from
other brain regions involved in visual, olfactory, and somatosensory perception. All these
brain regions are important in object recognition, and the consolidation, acquisition and
retrieval of the memory necessary for mastering the NOR paradigm15,29. The positive effect
of SNC supplementation on the performance in the NOR could possibly come from the
effect of SNC on synaptic plasticity within the hippocampus, important in the novel object
recognition30. Although neurotransmitter release and signaling are positively affected by
SNC supplementation10,31, it is not clear if one or more of the these domains (white matter
integrity, neurotransmitter metabolism and
4.4 CONCLUSION
This study is the first long-term intervention study in BTBR PKU mice that shows that
SNC supplementation can specifically benefit novel object recognition. Future studies are
necessary to identify the mode of action of SNC supplementation.
![Page 130: University of Groningen Phenylketonuria in mice and men ... · Phenylketonuria in mice and men Proefschrift ter verkrijging van de graad van doctor aan de Rijksuniversiteit Groningen](https://reader034.vdocuments.site/reader034/viewer/2022052611/5f03c1e37e708231d40a9ed0/html5/thumbnails/130.jpg)
512536-L-bw-Bruinenberg512536-L-bw-Bruinenberg512536-L-bw-Bruinenberg512536-L-bw-BruinenbergProcessed on: 15-8-2017Processed on: 15-8-2017Processed on: 15-8-2017Processed on: 15-8-2017 PDF page: 129PDF page: 129PDF page: 129PDF page: 129
7
129
Chapter 7
5. REFERENCES
1 Jahja R, van Spronsen FJ, de Sonneville
LMJ, van der Meere JJ, Bosch AM, Hollak
CEM et al. Social-cognitive functioning and
social skills in patients with early treated
phenylketonuria: a PKU-COBESO study. J
Inherit Metab Dis 2016; 39: 355–362.
2 Moyle JJ, Fox AM, Arthur M, Bynevelt
M, Burnett JR. Meta-analysis of
neuropsychological symptoms of adolescents
and adults with PKU. Neuropsychol Rev
2007; 17: 91–101.
3 Enns GM, Koch R, Brumm V, Blakely E,
Suter R, Jurecki E. Suboptimal outcomes in
patients with PKU treated early with diet
alone: revisiting the evidence. Mol Genet
Metab; 101: 99–109.
4 Bruinenberg VM, van Vliet D, Attali A, de
Wilde MC, Kuhn M, van Spronsen FJ et al.
A Specific Nutrient Combination Attenuates
the Reduced Expression of PSD-95 in
the Proximal Dendrites of Hippocampal
Cell Body Layers in a Mouse Model of
Phenylketonuria. Nutrients 2016; 8.
doi:10.3390/nu8040185.
5 Yehuda S, Rabinovitz S, Carasso RL,
Mostofsky DI. The role of polyunsaturated
fatty acids in restoring the aging neuronal
membrane. Neurobiol Aging; 23: 843–53.
6 Vigh L, Escribá P V, Sonnleitner A,
Sonnleitner M, Piotto S, Maresca B et al.
The significance of lipid composition for
membrane activity: new concepts and ways
of assessing function. Prog Lipid Res 2005;
44: 303–44.
7 Martínez-Cruz F, Osuna C, Guerrero JM.
Mitochondrial damage induced by fetal
hyperphenylalaninemia in the rat brain and
liver: its prevention by melatonin, Vitamin
E, and Vitamin C. Neurosci Lett 2006; 392:
1–4.
8 Martinez-Cruz F, Pozo D, Osuna C, Espinar
A, Marchante C, Guerrero JM. Oxidative
stress induced by phenylketonuria in the rat:
Prevention by melatonin, vitamin E, and
vitamin C. J Neurosci Res 2002; 69: 550–8.
9 Sitta a, Vanzin CS, Biancini GB, Manfredini
V, de Oliveira a B, Wayhs C a Y et al.
Evidence that L-carnitine and selenium
supplementation reduces oxidative stress
in phenylketonuric patients. Cell Mol
Neurobiol 2011; 31: 429–36.
10 Cansev M, van Wijk N, Turkyilmaz
M, Orhan F, Sijben JWC, Broersen
LM. A specific multi-nutrient enriched
diet enhances hippocampal cholinergic
transmission in aged rats. Neurobiol Aging
2015; 36: 344–51.
11 Mazzola PN, Bruinenberg V, Anjema
K, van Vliet D, Dutra-Filho CS, van
Spronsen FJ et al. Voluntary Exercise
Prevents Oxidative Stress in the Brain of
Phenylketonuria Mice. JIMD Rep 2015.
doi:10.1007/8904_2015_498.
12 Pascucci T, Giacovazzo G, Andolina
D, Accoto A, Fiori E, Ventura R et
al. Behavioral and neurochemical
characterization of new mouse model of
hyperphenylalaninemia. PLoS One 2013; 8:
e84697.
13 Bruinenberg VM, van der Goot E, van
Vliet D, de Groot MJ, Mazzola PN,
Heiner-Fokkema MR et al. The Behavioral
Consequence of Phenylketonuria in Mice
Depends on the Genetic Background. Front
Behav Neurosci 2016; 10: 233.
14 Hovens IB, Schoemaker RG, van der
Zee EA, Absalom AR, Heineman
E, van Leeuwen BL. Postoperative
cognitive dysfunction: Involvement
of neuroinflammation and neuronal
functioning. Brain Behav Immun 2014; 38:
202–10.
![Page 131: University of Groningen Phenylketonuria in mice and men ... · Phenylketonuria in mice and men Proefschrift ter verkrijging van de graad van doctor aan de Rijksuniversiteit Groningen](https://reader034.vdocuments.site/reader034/viewer/2022052611/5f03c1e37e708231d40a9ed0/html5/thumbnails/131.jpg)
512536-L-bw-Bruinenberg512536-L-bw-Bruinenberg512536-L-bw-Bruinenberg512536-L-bw-BruinenbergProcessed on: 15-8-2017Processed on: 15-8-2017Processed on: 15-8-2017Processed on: 15-8-2017 PDF page: 130PDF page: 130PDF page: 130PDF page: 130
130
Chapter 7
15 Antunes M, Biala G. The novel object
recognition memory: neurobiology, test
procedure, and its modifications. Cogn
Process 2012; 13: 93–110.
16 Shoji H, Takao K, Hattori S, Miyakawa
T. Age-related changes in behavior in
C57BL/6J mice from young adulthood to
middle age. Mol Brain 2016; 9: 11.
17 Brouwer-Brolsma EM, Schuurman T, de
Groot LCPMG, Feskens EJM, Lute C,
Naninck EFG et al. No role for vitamin
D or a moderate fat diet in aging induced
cognitive decline and emotional reactivity in
C57BL/6 mice. Behav Brain Res 2014; 267:
133–143.
18 Weber M, Wu T, Hanson JE, Alam NM,
Solanoy H, Ngu H et al. Cognitive Deficits,
Changes in Synaptic Function, and Brain
Pathology in a Mouse Model of Normal
Aging. eNeuro 2015; 2. doi:10.1523/
ENEURO.0047-15.2015.
19 Saroja SR, Kim E-J, Shanmugasundaram
B, Höger H, Lubec G. Hippocampal
monoamine receptor complex levels linked
to spatial memory decline in the aging
C57BL/6J. Behav Brain Res 2014; 264: 1–8.
20 MacPherson P, McGaffigan R, Wahlsten D,
Nguyen P V. Impaired fear memory, altered
object memory and modified hippocampal
synaptic plasticity in split-brain mice. Brain
Res 2008; 1210: 179–88.
21 Stapley NW, Guariglia SR, Chadman KK.
Cued and contextual fear conditioning in
BTBR mice is improved with training or
atomoxetine. Neurosci Lett 2013; 549:
120–4.
22 van Spronsen FJ, van Wegberg AM, Ahring
K, Bélanger-Quintana A, Blau N, Bosch
AM et al. Key European guidelines for
the diagnosis and management of patients
with phenylketonuria. Lancet Diabetes
Endocrinol 2017. doi:10.1016/S2213-
8587(16)30320-5.
23 Koch R, Moseley K, Ning J, Romstad A,
Guldberg P, Guttler F. Long-term beneficial
effects of the phenylalanine-restricted
diet in late-diagnosed individuals with
phenylketonuria. Mol Genet Metab 1999;
67: 148–55.
24 Semple BD, Blomgren K, Gimlin K,
Ferriero DM, Noble-Haeusslein LJ. Brain
development in rodents and humans:
Identifying benchmarks of maturation and
vulnerability to injury across species. Prog
Neurobiol 2013; 106–107: 1–16.
25 van Wijk N, Broersen LM, de Wilde MC,
Hageman RJJ, Groenendijk M, Sijben
JWC et al. Targeting synaptic dysfunction
in Alzheimer’s disease by administering a
specific nutrient combination. J Alzheimers
Dis 2014; 38: 459–79.
26 Solverson P, Murali SG, Brinkman AS,
Nelson DW, Clayton MK, Yen C-LE et al.
Glycomacropeptide, a low-phenylalanine
protein isolated from cheese whey, supports
growth and attenuates metabolic stress in
the murine model of phenylketonuria. Am J
Physiol Endocrinol Metab 2012; 302: E885-
95.
27 Ney DM, Hull AK, van Calcar SC, Liu
X, Etzel MR. Dietary glycomacropeptide
supports growth and reduces the
concentrations of phenylalanine in
plasma and brain in a murine model of
phenylketonuria. J Nutr 2008; 138: 316–22.
28 Reger ML, Hovda DA, Giza CC. Ontogeny
of Rat Recognition Memory measured
by the novel object recognition task. Dev
Psychobiol 2009; 51: 672–678.
29 Oliveira AMM, Hawk JD, Abel T, Havekes
R. Post-training reversible inactivation of
the hippocampus enhances novel object
recognition memory. Learn Mem 2010; 17:
155–160.
![Page 132: University of Groningen Phenylketonuria in mice and men ... · Phenylketonuria in mice and men Proefschrift ter verkrijging van de graad van doctor aan de Rijksuniversiteit Groningen](https://reader034.vdocuments.site/reader034/viewer/2022052611/5f03c1e37e708231d40a9ed0/html5/thumbnails/132.jpg)
512536-L-bw-Bruinenberg512536-L-bw-Bruinenberg512536-L-bw-Bruinenberg512536-L-bw-BruinenbergProcessed on: 15-8-2017Processed on: 15-8-2017Processed on: 15-8-2017Processed on: 15-8-2017 PDF page: 131PDF page: 131PDF page: 131PDF page: 131
7
131
Chapter 7
30 Sarkisyan G, Hedlund PB. The 5-HT7
receptor is involved in allocentric spatial
memory information processing. Behav
Brain Res 2009; 202: 26–31.
31 Savelkoul PJM, Janickova H, Kuipers AAM,
Hageman RJJ, Kamphuis PJ, Dolezal V et
al. A specific multi-nutrient formulation
enhances M1 muscarinic acetylcholine
receptor responses in vitro. J Neurochem
2012; 120: 631–40.
![Page 133: University of Groningen Phenylketonuria in mice and men ... · Phenylketonuria in mice and men Proefschrift ter verkrijging van de graad van doctor aan de Rijksuniversiteit Groningen](https://reader034.vdocuments.site/reader034/viewer/2022052611/5f03c1e37e708231d40a9ed0/html5/thumbnails/133.jpg)
512536-L-bw-Bruinenberg512536-L-bw-Bruinenberg512536-L-bw-Bruinenberg512536-L-bw-BruinenbergProcessed on: 15-8-2017Processed on: 15-8-2017Processed on: 15-8-2017Processed on: 15-8-2017 PDF page: 132PDF page: 132PDF page: 132PDF page: 132
![Page 134: University of Groningen Phenylketonuria in mice and men ... · Phenylketonuria in mice and men Proefschrift ter verkrijging van de graad van doctor aan de Rijksuniversiteit Groningen](https://reader034.vdocuments.site/reader034/viewer/2022052611/5f03c1e37e708231d40a9ed0/html5/thumbnails/134.jpg)
512536-L-bw-Bruinenberg512536-L-bw-Bruinenberg512536-L-bw-Bruinenberg512536-L-bw-BruinenbergProcessed on: 15-8-2017Processed on: 15-8-2017Processed on: 15-8-2017Processed on: 15-8-2017 PDF page: 133PDF page: 133PDF page: 133PDF page: 133
CHAPTER 8Large neutral amino acid supplementation exerts its effect through three synergistic mechanisms:
proof of principle in phenylketonuria mice
Danique van Vliet1,2, Vibeke M. Bruinenberg2, Priscila N. Mazzola1,2,
Martijn H.J.R. van Faassen3, Pim de Blaauw3, Ido P. Kema3, M. Rebecca
Heiner-Fokkema3, Rogier D. van Anholt4, Eddy A. van der Zee2,
Francjan J. van Spronsen1*
1University of Groningen, University Medical Center Groningen, Beatrix Children’s
Hospital, Groningen, The Netherlands. 2University of Groningen, Center of Behavior and
Neurosciences, Department of Molecular Neurobiology, Groningen, The Netherlands. 3University of Groningen, University Medical Center Groningen, Department of
Laboratory Medicine, Groningen, The Netherlands.4Independent Researcher, Deventer,
The Netherlands.
PLoS One. 2015 Dec 1;10(12):e0143833. doi: 10.1371/journal.pone.0143833.
eCollection 2015.
![Page 135: University of Groningen Phenylketonuria in mice and men ... · Phenylketonuria in mice and men Proefschrift ter verkrijging van de graad van doctor aan de Rijksuniversiteit Groningen](https://reader034.vdocuments.site/reader034/viewer/2022052611/5f03c1e37e708231d40a9ed0/html5/thumbnails/135.jpg)
512536-L-bw-Bruinenberg512536-L-bw-Bruinenberg512536-L-bw-Bruinenberg512536-L-bw-BruinenbergProcessed on: 15-8-2017Processed on: 15-8-2017Processed on: 15-8-2017Processed on: 15-8-2017 PDF page: 134PDF page: 134PDF page: 134PDF page: 134
134
Chapter 8
ABSTRACT
Background
Phenylketonuria (PKU) was the first disorder in which severe neurocognitive dysfunction
could be prevented by dietary treatment. However, despite this effect, neuropsychological
outcome in PKU still remains suboptimal and the phenylalanine-restricted diet is very
demanding. To improve neuropsychological outcome and relieve the dietary restrictions
for PKU patients, supplementation of large neutral amino acids (LNAA) is suggested as
alternative treatment strategy that might correct all brain biochemical disturbances caused
by high blood phenylalanine, and thereby improve neurocognitive functioning.
Objective
As a proof-of-principle, this study aimed to investigate all hypothesized biochemical
treatment objectives of LNAA supplementation (normalizing brain phenylalanine, non-
phenylalanine LNAA, and monoaminergic neurotransmitter concentrations) in PKU mice.
Methods: C57Bl/6 Pah-enu2 (PKU) mice and wild-type mice received a LNAA supplemented
diet, an isonitrogenic/isocaloric high-protein control diet, or normal chow. After six weeks
of dietary treatment, blood and brain amino acid and monoaminergic neurotransmitter
concentrations were assessed.
Results
In PKU mice, the investigated LNAA supplementation regimen significantly reduced blood
and brain phenylalanine concentrations by 33% and 26%, respectively, compared to normal
chow (p<0.01), while alleviating brain deficiencies of some but not all supplemented LNAA.
Moreover, LNAA supplementation in PKU mice significantly increased brain serotonin
and norepinephrine concentrations from 35% to 71% and from 57% to 86% of wild-type
concentrations (p<0.01), respectively, but not brain dopamine concentrations (p=0.307).
Conclusions
This study shows that LNAA supplementation without dietary phenylalanine restriction
in PKU mice improves brain biochemistry through all three hypothesized biochemical
mechanisms. Thereby, these data provide proof-of-concept for LNAA supplementation as
a valuable alternative dietary treatment strategy in PKU. Based on these results, LNAA
treatment should be further optimized for clinical application with regard to the composition
and dose of the LNAA supplement, taking into account all three working mechanisms of
LNAA treatment.
![Page 136: University of Groningen Phenylketonuria in mice and men ... · Phenylketonuria in mice and men Proefschrift ter verkrijging van de graad van doctor aan de Rijksuniversiteit Groningen](https://reader034.vdocuments.site/reader034/viewer/2022052611/5f03c1e37e708231d40a9ed0/html5/thumbnails/136.jpg)
512536-L-bw-Bruinenberg512536-L-bw-Bruinenberg512536-L-bw-Bruinenberg512536-L-bw-BruinenbergProcessed on: 15-8-2017Processed on: 15-8-2017Processed on: 15-8-2017Processed on: 15-8-2017 PDF page: 135PDF page: 135PDF page: 135PDF page: 135
8
135
Chapter 8
1. INTRODUCTION
Phenylketonuria (PKU; OMIM 261600) is the first disorder in which severe neurocognitive
dysfunction could be prevented by dietary treatment. It is caused by a deficient activity of
the hepatic enzyme phenylalanine hydroxylase (PAH; EC 1.14.16.1), normally converting
phenylalanine (Phe) to tyrosine. If left untreated, classical PKU symptomatology is almost
exclusively restricted to the brain, including severe neurocognitive dysfunction, seizures, and
psychiatric problems, correlating with high blood Phe concentrations1.
This selective brain vulnerability to high blood Phe concentrations is hypothesized to be
related to the transport characteristics for Phe at the blood-brain barrier (BBB)2,3. At the
BBB, the large neutral amino acid transporter 1 (LAT1) is the predominant transport system
for all large neutral amino acids (LNAA), and is saturated for >95%4. Combined with the
fact that LAT1 shows a high affinity to Phe, increased blood Phe concentrations strongly
increase brain Phe influx, outcompeting the transport of other LNAA5-8. Based on both the
increased Phe and the decreased non-Phe LNAA transport across the BBB, different brain
biochemical disturbances underlie brain dysfunction in PKU3,9. High brain Phe concentrations
have been found to be neurotoxic and to affect brain metabolism10-14, while reduced brain
availability of non-Phe LNAA has been related to impaired cerebral protein synthesis6,15.
In addition, impaired cerebral monoaminergic neurotransmitter synthesis may result from
outcompeted brain uptake of their amino acid precursors tyrosine and tryptophan16, and/or
from an inhibitory effect of high brain Phe concentrations on tyrosine hydroxylase (TH) and
tryptophan hydroxylase (TPH)17.
Thus far, blood Phe reduction has been the primary target of treatment in PKU. This can
be accomplished by a severe Phe-restricted diet and, in some patients, by pharmacological
treatment with tetrahydrobiopterin. However, early- and continuously treated PKU patients
still show impaired executive functioning and are prone to develop anxiety and depressive
symptoms18,19. Moreover, the Phe-restricted diet is socially demanding and hard to comply
with20. Therefore, an alternative pathophysiology-based treatment strategy directly targeting
the brain is required. One such possible treatment strategy includes supplementation of LNAA
(without Phe) that aims to restore the disturbed LNAA transport across the BBB without
dietary Phe restriction. Based on aforementioned hypotheses on PKU pathophysiology,
LNAA supplementation could serve to: 1) decrease brain Phe, 2) increase brain non-Phe
LNAA, and/or 3) increase brain monoaminergic neurotransmitter concentrations21.
Previous research on LNAA treatment in PKU has primarily focused on brain and blood Phe
reduction as treatment objective22-28. In addition, LNAA supplementation in PKU patients
was recently found to increase blood and urine melatonin concentrations, which might
reflect increased brain serotonin synthesis29. However, not all brain biochemical treatment
![Page 137: University of Groningen Phenylketonuria in mice and men ... · Phenylketonuria in mice and men Proefschrift ter verkrijging van de graad van doctor aan de Rijksuniversiteit Groningen](https://reader034.vdocuments.site/reader034/viewer/2022052611/5f03c1e37e708231d40a9ed0/html5/thumbnails/137.jpg)
512536-L-bw-Bruinenberg512536-L-bw-Bruinenberg512536-L-bw-Bruinenberg512536-L-bw-BruinenbergProcessed on: 15-8-2017Processed on: 15-8-2017Processed on: 15-8-2017Processed on: 15-8-2017 PDF page: 136PDF page: 136PDF page: 136PDF page: 136
136
Chapter 8
objectives have been investigated. In consequence, optimal composition and dosing of
LNAA treatment is currently unknown, limiting its clinical application. As a first step to
develop an optimal LNAA treatment regimen, the aim of the present study was to assess all
abovementioned hypothesized biochemical treatment objectives of LNAA supplementation
in a PKU mouse model.
2. MATERIAL & METHODS
2.1 Animals
To establish a new breeding colony, breeding pairs of C57Bl/6 Pah-enu2 mice had been
kindly provided by Prof. B. Thöny from the division of Clinical Chemistry and Biochemistry
of the University Children’s Hospital in Zurich in Switzerland. From heterozygous (+/-)
mating, wild-type (WT, +/+), heterozygous, and PKU (-/-) mice of both sexes were obtained.
After weaning at four weeks of age, genetic characterization was performed by quantitative
PCR analysis on DNA extracted from ear tissue. Animals were housed individually at
21±1ºC on a 12-hr light-dark cycle (7:00 am-7:00 pm), and water and AM-II food pellets
(Arie Block BV, Woerden, The Netherlands) were offered ad libitum. In total, 42 WT (21
male, 21 female) and 46 PKU (23 male, 23 female) mice were used. This study was carried
out in strict accordance with the recommendations in the Guide for the Care and Use of
Laboratory Animals of the National Institutes of Health (S1 File; ARRIVE guidelines
checklist). The protocol was approved by the Institutional Animal Care and Use Committee
of the University of Groningen (Permit Number: 6504A).
2.2 Experimental design
At postnatal day 37, animals were assigned to one of three treatment groups based on
genotype and sex, receiving either normal chow, a high-protein diet, or a LNAA supplemented
diet. Dietary treatment was continued for six weeks. During the first week of treatment,
body weight and food intake were measured daily, after which body weight and food intake
were determined at weekly intervals. Food intake was manually assessed by the difference
between food given and left on the cages’ tops using a scale. Spilled food was not measured
because it has been shown to represent less than 0.1 g/day/mouse30. After six weeks of
dietary treatment, animals were euthanized by combined heart puncture and decapitation
under inhalation-anesthetics with isoflurane 2-3 hours after the beginning of the light phase.
2.3 Experimental diets
The basal diet during the experiment was based on the composition of AIN-93M31, which
was also administered in unadjusted form to the untreated control group (normal chow).
The experimental LNAA diet was based on the LNAA regimen as used in the study by Pietz
et al.26. It was produced by adding LNAA to the basal diet at the expense of cornstarch
on a weight-for-weight basis. The added amount of LNAA was equal to the amount of
![Page 138: University of Groningen Phenylketonuria in mice and men ... · Phenylketonuria in mice and men Proefschrift ter verkrijging van de graad van doctor aan de Rijksuniversiteit Groningen](https://reader034.vdocuments.site/reader034/viewer/2022052611/5f03c1e37e708231d40a9ed0/html5/thumbnails/138.jpg)
512536-L-bw-Bruinenberg512536-L-bw-Bruinenberg512536-L-bw-Bruinenberg512536-L-bw-BruinenbergProcessed on: 15-8-2017Processed on: 15-8-2017Processed on: 15-8-2017Processed on: 15-8-2017 PDF page: 137PDF page: 137PDF page: 137PDF page: 137
8
137
Chapter 8
(natural) protein in the basal diet, in effect doubling the amount of protein/amino acids in
the LNAA supplemented diet. The LNAA added in the LNAA supplemented diet included
equal amounts of l-tyrosine, l-tryptophan, l-valine, l-isoleucine, l-leucine, l-methionine, and
l-histidine. To control for the extra amount of protein in the LNAA supplemented diet, a
high-protein control diet was included. This high-protein diet was produced by adding extra
casein to the AIN-93M diet at the expense of cornstarch on a weight-for-weight basis, and
was calculated to result in an isonitrogenic and isocaloric control diet for the experimental
LNAA diet. Diets were prepared by Research Diet Services B.V. (Wijk bij Duurstede, The
Netherlands).
2.4 Biochemical analyses
To obtain plasma and brain material for biochemical analyses, blood was collected by heart
puncture and whole brains were removed. Blood was centrifuged at 1500 g for 10 min and
plasma was collected and stored at -80 ºC until further analysis. The cerebrum was snap
frozen in liquid nitrogen and stored at -80 ºC until further preparation. Frozen cerebrum was
crushed in liquid nitrogen and divided into aliquots. Frozen brain powder for amino acid
measurements was processed to 20% (weight: volume (w:v)) homogenates in phosphate-
buffered saline (pH 7.4), and for tryptophan, indole and catecholamine measurements to
2% (w:v) homogenates in acetic acid (0.08 M). Brain homogenates were sonified on ice at
11-12 W. Next, samples were centrifuged at 800 rcf for 10 min (4 ºC), and the supernatant/
internatant was put on ice to be used for further analysis.
For brain amino acid (except for tryptophan) measurements, norleucine in sulfosalicylic
acid was added as an internal standard to the 20% brain homogenate (1:1, v:v). Samples
were vortexed and centrifuged at 20.800 rcf for 4 min. Plasma amino acid measurements
were performed according to the same method, using 50 µl plasma instead of 20% brain
homogenate. Amino acid concentrations were measured with a method based on ion
exchange chromatography with post column derivatization with Ninhydrin on a Biochrom
30+ analyser (Pharmacia Biotech, Cambridge, UK).
For tryptophan and monoaminergic neurotransmitter measurements, an anti-oxidative
solution was prepared in demineralised water (0.4 g/l ascorbic acid and 1.616 g/l
ethylenediaminetetraacetic acid). For tryptophan and indole measurements, 25 µl of the
anti-oxidative solution was added to 25 µl of the 2% brain homogenate. For catecholamine
measurements, 40 µl of the anti-oxidative solution was added to 10 µl of the 2% brain
homogenate. Plasma tryptophan measurements were performed using 25 µl plasma instead
of 2% brain homogenate. Analysis of tryptophan and monoaminergic neurotransmitter
concentrations was performed using liquid chromatography in combination with isotope
dilution mass spectrometry, essentially as described by Van de Merbel et al.32.
![Page 139: University of Groningen Phenylketonuria in mice and men ... · Phenylketonuria in mice and men Proefschrift ter verkrijging van de graad van doctor aan de Rijksuniversiteit Groningen](https://reader034.vdocuments.site/reader034/viewer/2022052611/5f03c1e37e708231d40a9ed0/html5/thumbnails/139.jpg)
512536-L-bw-Bruinenberg512536-L-bw-Bruinenberg512536-L-bw-Bruinenberg512536-L-bw-BruinenbergProcessed on: 15-8-2017Processed on: 15-8-2017Processed on: 15-8-2017Processed on: 15-8-2017 PDF page: 138PDF page: 138PDF page: 138PDF page: 138
138
Chapter 8
2.5 Statistical analyses
Statistical analyses were performed using the software IBM SPSS Statistics for Windows,
Version 22.0. (Armonk, NY: IBM Corp.). Data of the one animal that was euthanized
preterm, were excluded from analyses. All tests were performed two-sided at a significance
level of α=0.05.
Analyses on brain and blood biochemistry as well as on weekly food intake (per g body
weight) were performed by two-way ANOVA with genotype and diet as independent
variables. In case of not normally distributed data (assessed by Shapiro-Wilk test) or unequal
variances (assessed by Levene’s test), analyses were performed on log-transformed data.
If the interaction between genotype and diet and/or a main effect of diet was found to be
significant, data were further analyzed by one-way ANOVA and Tukey’s post-hoc tests for
PKU and WT mice separately.
The effect of dietary treatment on body weight was analyzed for WT and PKU male and
female mice separately by repeated-measures ANOVA with one between factor (diet, three
levels: normal chow, high-protein diet, and LNAA diet) and one within factor (time, 7 levels:
0, 1, 2, 3, 4, 5, and 6 weeks) and Tukey’s post-hoc analysis.
To investigate whether brain Phe concentrations in PKU mice were primarily determined by
blood Phe concentrations or by dietary treatment, multiple linear regression analysis was
performed with blood Phe concentrations and dietary treatment as independent variables.
Data are expressed as mean ± standard deviation (SD).
3. RESULTS
3.1 Food and LNAA intake
Amino acid contents of the different diets are presented in Table 1.
Weekly food intake (expressed as g food/g body weight/week), as shown in Fig 1, decreased
during the first weeks for all treatment groups, stabilizing in the later weeks of dietary
treatment. In both the fifth and sixth week of dietary treatment, two-way ANOVA analyses
showed a significant main effect of genotype on food intake (p<0.01). Moreover, in both
weeks, a significant main effect of dietary treatment (p<0.01), and a significant interaction
between genotype and dietary treatment on food intake was observed (p<0.01 for week 5,
p<0.05 for week 6). In PKU mice, food intake in both weeks was lower on high-protein
diet than on normal chow (p<0.05), while being even lower on LNAA supplemented diet
(p<0.01). In WT mice, food intake in both weeks did not significantly differ for any of the
dietary treatments (p=0.376 and p=0.322). Based on the weekly food intakes and amino acid
contents of the different diets, mean daily intakes of individual LNAA during the six week
![Page 140: University of Groningen Phenylketonuria in mice and men ... · Phenylketonuria in mice and men Proefschrift ter verkrijging van de graad van doctor aan de Rijksuniversiteit Groningen](https://reader034.vdocuments.site/reader034/viewer/2022052611/5f03c1e37e708231d40a9ed0/html5/thumbnails/140.jpg)
512536-L-bw-Bruinenberg512536-L-bw-Bruinenberg512536-L-bw-Bruinenberg512536-L-bw-BruinenbergProcessed on: 15-8-2017Processed on: 15-8-2017Processed on: 15-8-2017Processed on: 15-8-2017 PDF page: 139PDF page: 139PDF page: 139PDF page: 139
8
139
Chapter 8
dietary treatment were calculated for all experimental groups as shown in the Supplemental
Table 1 (S1 Table).
Table 1. Nutritional content of the experimental diets (g/kg diet).
Nutritional content* normal chow LNAA diet high-protein diet
Carbohydrates 674 550 551
Fat 41 41 41
Dietary fibre 50 50 50
Protein 124 248 248
Amino acids**
LNAA L-Phenylalanine 6.0 6.1 (0.1) 12.2 (6.2)
L-Tyrosine 4.8 20.1 (15.3) 12.1 (7.3)
L-Valine 7.4 25.0 (17.6) 15.9 (8.5)
L-Isoleucine 5.9 22.9 (17.0) 12.4 (6.4)
L-Leucine 10.9 28.0 (17.1) 23.1 (12.2)
L-Methionine 3.0 19.7 (16.7) 6.9 (3.9)
L-Histidine 3.2 19.0 (15.8) 6.8 (3.5)
L-Threonine 5.3 5.7 (0.3) 11.3 (5.9)
non-LNAA L-Aspartic acid 9.3 9.7 (0.4) 19.4 (10.1)
L-Serine 7.7 7.9 (0.2) 15.8 (8.1)
L-Glutamic acid 28.2 29.9 (1.7) 59.6 (31.4)
Glycine 2.7 2.7 (0.0) 5.2 (2.5)
L-Alanine 3.9 4.2 (0.3) 8.2 (4.3)
L-Lysine 9.1 9.9 (0.8) 19.5 (10.4)
L-Arginine 4.2 4.7 (0.5) 9.5 (5.3)
Contents are not shown for L-Tryptophan, L-Proline, and L-cyst(e)ine, as these were not measured due
to technical limitations. Differences with LNAA contents of normal chow are stated in brackets. LNAA,
large neutral amino acid.
*Mineral and vitamin premixes were also included in accordance with the composition of the AIN93M
diet30.
**Dietary contents as measured in samples of prepared food pellets.
![Page 141: University of Groningen Phenylketonuria in mice and men ... · Phenylketonuria in mice and men Proefschrift ter verkrijging van de graad van doctor aan de Rijksuniversiteit Groningen](https://reader034.vdocuments.site/reader034/viewer/2022052611/5f03c1e37e708231d40a9ed0/html5/thumbnails/141.jpg)
512536-L-bw-Bruinenberg512536-L-bw-Bruinenberg512536-L-bw-Bruinenberg512536-L-bw-BruinenbergProcessed on: 15-8-2017Processed on: 15-8-2017Processed on: 15-8-2017Processed on: 15-8-2017 PDF page: 140PDF page: 140PDF page: 140PDF page: 140
140
Chapter 8
Fig 1. Weekly food intake for WT (A) and PKU (B) mice on different diets
Numbers of mice on normal chow, LNAA supplemented diet, and high-protein diet were n=14, n=14,
and n=14 for WT mice respectively, while being n=15, n=14, and n=15 for PKU mice. Error bars
represent SEM.
3.2 Body weight and general health
At initiation of treatment, body weight of PKU mice (male 13.7 ± 3.6 g; female: 12.8 ± 2.1 g)
was lower than of WT mice (male 18.9 ± 1.5 g; female: 15.6 ± 1.8 g), but did not significantly
differ between dietary groups in PKU nor WT mice. Body weight curves during treatment
were significantly lower for WT female mice on LNAA supplemented diet compared to
either normal chow (p<0.05) or high-protein diet (p<0.01), but did not significantly differ
between dietary treatments for WT male (p=0.485) and PKU male or PKU female mice
(p=0.397 and p=0.343) (Fig 2).
During the experiment, one animal (WT female on LNAA supplemented diet) was euthanized
on the 19th day after inclusion, because of too much weight loss. Pathological examination
showed hydrocephalus, which is sometimes found in C57Bl/6 (both WT and PKU) mice.
Fig 2. Body weights during the experiment
Mean body weights for A) male and B) female WT (dashed lines) and PKU (solid lines) mice on different
diets. Numbers of mice on normal chow, LNAA supplemented diet, and high-protein diet were n=14,
n=14, and n=14 for WT mice respectively, while being n=15, n=14, and n=15 for PKU mice. Error bars
represent SEM.
![Page 142: University of Groningen Phenylketonuria in mice and men ... · Phenylketonuria in mice and men Proefschrift ter verkrijging van de graad van doctor aan de Rijksuniversiteit Groningen](https://reader034.vdocuments.site/reader034/viewer/2022052611/5f03c1e37e708231d40a9ed0/html5/thumbnails/142.jpg)
512536-L-bw-Bruinenberg512536-L-bw-Bruinenberg512536-L-bw-Bruinenberg512536-L-bw-BruinenbergProcessed on: 15-8-2017Processed on: 15-8-2017Processed on: 15-8-2017Processed on: 15-8-2017 PDF page: 141PDF page: 141PDF page: 141PDF page: 141
8
141
Chapter 8
3.3 Plasma amino acids
Plasma concentrations of individual LNAA in PKU and WT mice on control and LNAA
supplemented diets are depicted in Fig 3. Two-way ANOVA analyses showed a significant
main effect of genotype on plasma Phe, tyrosine, tryptophan (p<0.01), and threonine
concentrations (p<0.05). In PKU compared to WT mice on normal chow, plasma Phe
concentrations were increased by almost 30-fold. Plasma tyrosine, tryptophan, and
threonine concentrations in PKU mice were reduced to 55%, 77%, and 79%, respectively,
of concentrations in WT mice on normal chow. For other LNAA, no significant main effect
of genotype was observed on plasma concentrations.
A significant main effect of dietary treatment was observed on plasma concentrations of all
LNAA except for threonine (p=0.073 for threonine; p<0.05 for tyrosine; p<0.01 for all other
LNAA). Moreover, two-way ANOVA analyses showed a significant interaction between
genotype and dietary treatment on plasma Phe and methionine concentrations (p<0.01
for both). In PKU mice, plasma Phe concentrations on LNAA supplemented diet were
significantly reduced to 67% of concentrations on normal chow (p<0.01), while plasma Phe
concentrations on high-protein diet were significantly higher than on normal chow (p<0.01).
In WT mice on LNAA, plasma Phe concentrations were reduced compared to control diets
(p<0.05), but concentrations on high-protein diet did not significantly differ from those on
normal chow (p=0.929). Plasma concentrations of supplemented LNAA were higher on
LNAA supplementation compared to control diets, both in PKU and WT mice, although this
did not reach statistical significance for all LNAA.
Plasma concentrations of non-LNAA amino acids in PKU and WT mice on control and
LNAA supplemented diets are presented in Supplemental table 2 (S2 Table). In both PKU
and WT mice, plasma glycine and lysine concentrations on LNAA supplemented diet were
lower compared to control diets (p<0.05), just not reaching statistical significance for lysine
in PKU mice (p=0.051). In addition, plasma serine concentrations were lower on LNAA
supplementation compared to control diets in WT mice (p<0.05), but not in PKU mice
(p=0.407).
![Page 143: University of Groningen Phenylketonuria in mice and men ... · Phenylketonuria in mice and men Proefschrift ter verkrijging van de graad van doctor aan de Rijksuniversiteit Groningen](https://reader034.vdocuments.site/reader034/viewer/2022052611/5f03c1e37e708231d40a9ed0/html5/thumbnails/143.jpg)
512536-L-bw-Bruinenberg512536-L-bw-Bruinenberg512536-L-bw-Bruinenberg512536-L-bw-BruinenbergProcessed on: 15-8-2017Processed on: 15-8-2017Processed on: 15-8-2017Processed on: 15-8-2017 PDF page: 142PDF page: 142PDF page: 142PDF page: 142
142
Chapter 8
Fig 3. Plasma LNAA concentrations
Plasma concentrations of A) phenylalanine, B) tyrosine, C) tryptophan, D) valine, E) isoleucine, F)
leucine, G) methionine, H) histidine, and I) threonine in WT and PKU mice after six weeks of receiving
different diets. Numbers of mice on normal chow, LNAA supplemented diet, and high-protein diet were
n=14, n=12, and n=14 for WT mice respectively, while being n=14, n=12, and n=15 for PKU mice.
Untransformed data are expressed as mean ± SEM.
* p<0.05; ** p<0.01; § p<0.05 and §§ p<0.01 compared to WT mice on normal chow.
3.4 Brain amino acids
Brain concentrations of individual LNAA in PKU and WT mice on control and LNAA
supplemented diets are depicted in Fig 4. Two-way ANOVA analyses showed a significant
main effect of genotype on brain concentrations of all LNAA except for methionine (p<0.01
for all LNAA but methionine, p=0.523 for methionine). In PKU compared to WT mice on
normal chow, brain Phe concentrations were increased by 8.3-fold. Also, brain histidine
concentrations in PKU mice were elevated to 139% of WT concentrations on normal chow.
Brain concentrations of all other non-Phe LNAA but methionine were reduced in PKU
mice on normal chow, ranging from 52% of concentrations in corresponding WT mice for
tyrosine to 77% for leucine.
A significant main effect of dietary treatment was observed on brain Phe, tryptophan,
methionine, and threonine concentrations (p<0.01 for all). Moreover, two-way ANOVA
analyses showed a significant interaction between genotype and dietary treatment on brain
Phe, methionine, and histidine concentrations (p<0.01 for Phe and methionine, p<0.05 for
histidine). Brain Phe concentrations in PKU mice on LNAA supplementation were reduced to
![Page 144: University of Groningen Phenylketonuria in mice and men ... · Phenylketonuria in mice and men Proefschrift ter verkrijging van de graad van doctor aan de Rijksuniversiteit Groningen](https://reader034.vdocuments.site/reader034/viewer/2022052611/5f03c1e37e708231d40a9ed0/html5/thumbnails/144.jpg)
512536-L-bw-Bruinenberg512536-L-bw-Bruinenberg512536-L-bw-Bruinenberg512536-L-bw-BruinenbergProcessed on: 15-8-2017Processed on: 15-8-2017Processed on: 15-8-2017Processed on: 15-8-2017 PDF page: 143PDF page: 143PDF page: 143PDF page: 143
8
143
Chapter 8
74% of concentrations on normal chow (p<0.01), still being 6.1-fold higher when compared
to WT concentrations on normal chow. Brain Phe concentrations in PKU mice on high-
protein diet were higher than in PKU mice on normal chow (p<0.05). Brain tryptophan,
histidine, and methionine concentrations in PKU mice on LNAA supplementation were
significantly higher when compared to PKU mice on normal chow (p<0.05), resulting in
concentrations of 100% and 166% of WT concentrations on normal chow for tryptophan
and histidine, and an elevation by 3.6-fold for methionine. In contrast, brain threonine
concentrations in PKU mice on LNAA supplementation were lower when compared to PKU
mice on control diets (p<0.01).
In WT mice, brain Phe concentrations on LNAA supplementation tended to be lower when
compared to normal chow, although this just did not reach statistical significance (p=0.053).
Similar to PKU mice, brain methionine concentrations were higher, whereas brain threonine
concentrations were lower on LNAA supplementation as compared to control diets (p<0.01
for all).
Brain concentrations of non-LNAA amino acids in PKU and WT mice on control and LNAA
supplemented diets are presented in Supplemental Table 3 (S3 Table). In both PKU and
WT mice, brain serine and glycine concentrations on LNAA supplemented diet were lower
compared to control diets (p<0.05), although this did not reach statistical significance for
glycine in PKU mice on LNAA supplementation compared to high-protein diet (p=0.064). In
addition, in WT mice only, brain lysine concentrations were lower (p<0.01), whereas brain
taurine concentrations were higher on LNAA supplementation compared to control diets
(p<0.05).
![Page 145: University of Groningen Phenylketonuria in mice and men ... · Phenylketonuria in mice and men Proefschrift ter verkrijging van de graad van doctor aan de Rijksuniversiteit Groningen](https://reader034.vdocuments.site/reader034/viewer/2022052611/5f03c1e37e708231d40a9ed0/html5/thumbnails/145.jpg)
512536-L-bw-Bruinenberg512536-L-bw-Bruinenberg512536-L-bw-Bruinenberg512536-L-bw-BruinenbergProcessed on: 15-8-2017Processed on: 15-8-2017Processed on: 15-8-2017Processed on: 15-8-2017 PDF page: 144PDF page: 144PDF page: 144PDF page: 144
144
Chapter 8
Fig 4 Brain LNAA concentrations
Brain concentrations of A) phenylalanine, B) tyrosine, C) tryptophan, D) valine, E) isoleucine, F)
leucine, G) methionine, H) histidine, and I) threonine in WT and PKU mice after six weeks of receiving
different diets. Numbers of mice on normal chow, LNAA supplemented diet, and high-protein diet were
n=13, n=12, and n=14 for WT mice respectively, while being n=14, n=12, and n=14 for PKU mice.
Untransformed data are expressed as mean ± SEM.
* p<0.05; ** p<0.01; § p<0.05 and §§ p<0.01 compared to WT mice on normal chow.
3.5 Brain monoaminergic neurotransmitters
Brain monoaminergic neurotransmitter and associated metabolite concentrations in PKU
and WT mice are depicted in Fig 5. In the catecholamine pathway, two-way ANOVA
analyses showed significant main effects of genotype on brain dopamine and norepinephrine
concentrations (p<0.01 for both). Brain dopamine and norepinephrine concentrations in
PKU mice on normal chow were reduced to 76% and 57%, respectively, of concentrations
in WT mice on the same diet. In the serotonergic pathway, significant main effects of
genotype were observed on brain concentrations of serotonin and its associated metabolite
5-hydroxyindoleacetic acid (5-HIAA) (p<0.01 for both). Brain serotonin and 5-HIAA
concentrations in PKU mice on normal chow were decreased to 35% and 26%, respectively,
of concentrations in corresponding WT mice.
Dietary treatment had no significant effect on brain catecholamine or serotonin concentrations
in WT mice, while in PKU mice it did. A significant main effect of dietary treatment was
![Page 146: University of Groningen Phenylketonuria in mice and men ... · Phenylketonuria in mice and men Proefschrift ter verkrijging van de graad van doctor aan de Rijksuniversiteit Groningen](https://reader034.vdocuments.site/reader034/viewer/2022052611/5f03c1e37e708231d40a9ed0/html5/thumbnails/146.jpg)
512536-L-bw-Bruinenberg512536-L-bw-Bruinenberg512536-L-bw-Bruinenberg512536-L-bw-BruinenbergProcessed on: 15-8-2017Processed on: 15-8-2017Processed on: 15-8-2017Processed on: 15-8-2017 PDF page: 145PDF page: 145PDF page: 145PDF page: 145
8
145
Chapter 8
observed on brain catecholamine, serotonin, and 5-HIAA concentrations (p<0.01 for all
but dopamine, p<0.05 for dopamine). Moreover, two-way ANOVA analyses showed a
significant interaction between genotype and dietary treatment on brain norepinephrine,
serotonin, and 5-HIAA (p<0.01 for all), but not dopamine concentration (p=0.766).
In the catecholamine pathway, LNAA supplementation in PKU mice resulted in significantly
higher brain norepinephrine concentrations compared to normal chow (p<0.01), and partially
restored its deficit to an average of 86% of concentrations in WT mice on normal chow. In
contrast, brain dopamine concentrations did not significantly differ in PKU mice between the
dietary treatments (p=0.307). In WT mice, no significant differences were observed between
any of the dietary treatments for neither dopamine (p=0.104) nor norepinephrine (p=0.283).
In the serotonergic pathway, in PKU mice on LNAA supplementation, both brain serotonin
and 5-HIAA concentrations were significantly increased when compared to control diets
(p<0.01), partially restoring their concentrations to an average of 71% and 67%, respectively,
of concentrations in WT mice on normal chow. In WT mice on LNAA supplementation,
brain serotonin concentrations tended to be higher compared to normal chow (p=0.051), and
brain 5-HIAA concentrations tended to be higher compared to high-protein diet (p=0.097),
but both did not reach statistical significance.
Fig 5 Brain monoaminergic neurotransmitter concentrations
Brain concentrations of A) dopamine, B) norepinephrine, C) serotonin in WT and PKU mice after six
weeks of receiving different dietary treatments. Numbers of mice on normal chow, LNAA supplemented
diet, and high-protein diet were n=13, n=12, and n=14 for WT mice respectively, while being n=15,
n=13, and n=15 for PKU mice. Untransformed data are expressed as mean ± SEM.
**p<0.01; §§ p<0.01 compared to WT mice on normal chow.
3.6 Relation between plasma and brain Phe
To investigate whether the reduction of brain Phe concentrations on LNAA supplementation
in PKU mice was primarily related to an effect at the BBB or especially related to reduced
blood Phe concentrations, the relationship between blood and brain Phe concentrations was
assessed in PKU mice on LNAA supplementation and control diets (Fig 6). Multiple linear
regression analysis showed that brain Phe concentrations in PKU mice were significantly
![Page 147: University of Groningen Phenylketonuria in mice and men ... · Phenylketonuria in mice and men Proefschrift ter verkrijging van de graad van doctor aan de Rijksuniversiteit Groningen](https://reader034.vdocuments.site/reader034/viewer/2022052611/5f03c1e37e708231d40a9ed0/html5/thumbnails/147.jpg)
512536-L-bw-Bruinenberg512536-L-bw-Bruinenberg512536-L-bw-Bruinenberg512536-L-bw-BruinenbergProcessed on: 15-8-2017Processed on: 15-8-2017Processed on: 15-8-2017Processed on: 15-8-2017 PDF page: 146PDF page: 146PDF page: 146PDF page: 146
146
Chapter 8
predicted (adjusted R2=0.801, F=75.525, p<0.01) by both blood Phe concentrations
(B=0.127, SE B=0.026, β=0.521) and LNAA supplemented diet (B=-166.940, SE B=39.006,
β=-0.451). Brain non-Phe LNAA concentrations in PKU mice on normal chow, LNAA
supplementation, and high-protein diet did not show a clear relationship with either their
respective blood concentrations nor with blood Phe concentrations (data not shown).
Fig 6 Plasma versus brain Phe concentrations in PKU mice on different dietary treatments
Relationship between plasma Phe and brain Phe concentrations in PKU mice on normal chow (n=13),
LNAA supplemented diet (n=12), and high-protein diet (n=14).
3.7 Relation between brain monoaminergic neurotransmitters and their precursors
To investigate whether the increase of brain serotonin and norepinephrine on LNAA
supplementation in PKU mice was primarily due to (1) increased brain availability of
their precursors, or to (2) enhanced conversion of their precursors, brain monoaminergic
neurotransmitters were assessed in relation to their respective (amino acid) precursors (Fig
7).
Two-way ANOVA analyses showed a significant main effect of genotype on ratios of brain
dopamine/tyrosine, norepinephrine/dopamine, and serotonin/tryptophan (p<0.01 for all),
but not norepinephrine/tyrosine concentrations (p=0.184). Ratios of brain dopamine/
tyrosine were increased, while rations of brain norepinephrine/dopamine and serotonin/
tryptophan concentrations were reduced in PKU compared to WT mice on normal chow.
A significant main effect of dietary treatment was observed on ratios of brain norepinephrine/
dopamine concentrations only (p<0.01). In addition, two-way ANOVA analyses showed
![Page 148: University of Groningen Phenylketonuria in mice and men ... · Phenylketonuria in mice and men Proefschrift ter verkrijging van de graad van doctor aan de Rijksuniversiteit Groningen](https://reader034.vdocuments.site/reader034/viewer/2022052611/5f03c1e37e708231d40a9ed0/html5/thumbnails/148.jpg)
512536-L-bw-Bruinenberg512536-L-bw-Bruinenberg512536-L-bw-Bruinenberg512536-L-bw-BruinenbergProcessed on: 15-8-2017Processed on: 15-8-2017Processed on: 15-8-2017Processed on: 15-8-2017 PDF page: 147PDF page: 147PDF page: 147PDF page: 147
8
147
Chapter 8
a significant interaction between genotype and dietary treatment on ratios of brain
norepinephrine/dopamine and serotonin/tryptophan concentrations (p<0.01 for both).
In PKU mice on LNAA supplementation, ratios of brain norepinephrine/dopamine were
increased compared to control diets (p<0.01). Also, ratios of brain serotonin/tryptophan
concentrations in PKU mice on LNAA supplementation were higher as compared to control
diets (p<0.05).
Fig 7 Ratios of brain monoaminergic neurotransmitters to precursors
Ratios of brain A) dopamine/tyrosine, B) norepinephrine/tyrosine, C) norepinephrine/dopamine, and
D) serotonin/tryptophan concentrations in WT and PKU mice after six weeks of receiving different
dietary treatments. Numbers of mice on normal chow, LNAA supplemented diet, and high-protein diet
were n=13, n=12, and n=14 for WT mice respectively, while being n=14, n=12, and n=14 for PKU mice.
Untransformed data are expressed as mean ± SEM.
*p<0.05; **p<0.01; and § p<0.05; §§ p<0.01 compared to WT mice on normal chow.
4. DISCUSSION
This study is the first to investigate all hypothesized biochemical treatment effects of LNAA
supplementation using one LNAA supplementation regimen and a single experimental
design. Besides reducing blood Phe concentrations, the present study showed that LNAA
supplementation without dietary Phe restriction in PKU mice could directly improve brain
biochemistry through three mechanisms: 1) reducing brain Phe concentrations, 2) attenuating
the brain deficiencies of some, but not all, LNAA, and 3) increasing brain serotonin and
norepinephrine, but not dopamine concentrations. Before discussing these results in more
detail, we will first address some methodological issues.
![Page 149: University of Groningen Phenylketonuria in mice and men ... · Phenylketonuria in mice and men Proefschrift ter verkrijging van de graad van doctor aan de Rijksuniversiteit Groningen](https://reader034.vdocuments.site/reader034/viewer/2022052611/5f03c1e37e708231d40a9ed0/html5/thumbnails/149.jpg)
512536-L-bw-Bruinenberg512536-L-bw-Bruinenberg512536-L-bw-Bruinenberg512536-L-bw-BruinenbergProcessed on: 15-8-2017Processed on: 15-8-2017Processed on: 15-8-2017Processed on: 15-8-2017 PDF page: 148PDF page: 148PDF page: 148PDF page: 148
148
Chapter 8
Firstly, the present experiment was performed in Pah-enu2 (PKU) mice, a well-established
model that resembles the genetics, biochemistry and neurobiology of classical PKU in
humans. Biochemically, PKU mice show high blood and brain Phe concentrations in
combination with brain non-Phe LNAA and monoaminergic neurotransmitter deficits that
also characterize human PKU biochemistry. Km-values for LNAA transport at the BBB
have not been determined for (PKU) mice33. However, Km-values for individual LNAA as
determined in vivo in rats and in human brain capillaries showed a significant correlation34,
while being approximately 8-40 times lower for humans than for rats. This could imply
that competition between Phe and non-Phe LNAA for transport across the BBB takes place
at lower plasma concentrations in humans than in rats (and maybe mice), so that LNAA
supplementation might be even more effective in PKU patients. One of the important
advantages of this PKU mouse model over clinical studies is the possibility to measure not
only Phe (that can be determined in humans by magnetic resonance spectroscopy (MRS))
but also non-Phe LNAA and monoaminergic neurotransmitter concentrations in brain (that
at present cannot be measured by MRS).
Secondly, the LNAA supplemented diet used was based on the study by Pietz et al. (1999) that
investigated the effect of concomitant LNAA supplementation during an oral Phe challenge
on brain Phe uptake and EEG activity in PKU patients26. The LNAA supplementation
regimen used by Pietz et al. consisting of equal amounts (150 mg/kg body weight) of all non-
Phe LNAA except for threonine, in total, approximated the daily dietary protein intake for
adults. To translate this acute regimen for PKU patients to chronic treatment in PKU mice,
the total amount of added LNAA in the present study was equal to the amount of natural
protein in the basal diet. In full accordance with the study by Pietz et al., threonine was not
supplemented, even though Sanjurjo et al. (2003) have shown threonine supplementation
alone (50 mg/kg/d) reduced blood Phe concentrations by 36% in PKU patients35.
4.1 LNAA supplementation reduces blood Phe concentrations
Although LNAA supplementation is suggested to improve brain metabolism primarily by
restoring the unbalanced LNAA transport at the BBB, LNAA supplementation in PKU mice
was also found to significantly reduce blood Phe concentrations to 67% of concentrations
on normal chow. This is in accordance with previous studies on LNAA supplementation in
PKU mice showing plasma Phe reductions to 47.0-63.5% of concentrations in untreated
PKU controls23,24. LNAA supplementation has been hypothesized to exert this effect through
competition with Phe for uptake at the gut-blood barrier21, or through increased Phe
utilization due to higher net protein synthesis21. In support of this last hypothesis, food
intake of PKU mice during the final weeks of the experiment was significantly lower on
LNAA supplemented diet than on control diets, while body weight did not significantly
differ. This may suggest that LNAA supplementation indeed induced anabolism in PKU
mice, thereby demanding a lower dietary protein (and thus food) intake, and by that
![Page 150: University of Groningen Phenylketonuria in mice and men ... · Phenylketonuria in mice and men Proefschrift ter verkrijging van de graad van doctor aan de Rijksuniversiteit Groningen](https://reader034.vdocuments.site/reader034/viewer/2022052611/5f03c1e37e708231d40a9ed0/html5/thumbnails/150.jpg)
512536-L-bw-Bruinenberg512536-L-bw-Bruinenberg512536-L-bw-Bruinenberg512536-L-bw-BruinenbergProcessed on: 15-8-2017Processed on: 15-8-2017Processed on: 15-8-2017Processed on: 15-8-2017 PDF page: 149PDF page: 149PDF page: 149PDF page: 149
8
149
Chapter 8
contributing to the observed plasma Phe reduction. As expected, plasma concentrations
of supplemented LNAA in PKU mice were all increased. Surprisingly, however, plasma
tyrosine concentrations in PKU mice remained low-normal on the currently applied LNAA
supplemented diet. Even when correcting for the 20% of the supplemented tyrosine that
is assumed not to be absorbed in the gastrointestinal tract21, tyrosine intake still was 3.5
times higher in the LNAA supplemented diet compared to normal chow. Similar to plasma
tyrosine concentrations, brain tyrosine concentrations were not significantly increased on
LNAA supplemented diet either, while brain norepinephrine - the end product of tyrosine-
derived neurotransmitter metabolism - was significantly increased on LNAA supplemented
diet. Therefore, a possible explanation might be that all supplemented tyrosine was used to
partly restore the profound brain norepinephrine deficiency, and thereby did not result in
increased plasma and brain tyrosine concentrations.
4.2 LNAA supplementation reduces brain Phe concentrations, while attenuating brain
deficiencies of some but not all non-Phe LNAA
In brain, Phe concentrations on LNAA supplementation in PKU mice were significantly
reduced by 26% compared to concentrations on normal chow. This is in good agreement
with previous studies on LNAA supplementation in both PKU patients25 and mice24, showing
brain Phe reductions of 20-46%. Moreover, it may well support the finding of a clear
competitive effect on Phe transport across the BBB in PKU patients by Pietz et al. (1999)
using a comparable LNAA supplement26. As besides brain Phe, blood Phe concentrations
were also reduced in PKU mice on LNAA supplementation, the question arises whether the
reduced brain Phe concentrations might be due to the reduced plasma Phe concentrations
rather than a direct effect at the BBB level. Multiple linear regression analysis suggests,
however, that LNAA supplementation reduced brain Phe concentrations in PKU mice
through a combined effect of both plasma Phe reduction and enhanced competition at the
BBB.
This is the first time that brain non-Phe LNAA concentrations have been reported in response
to LNAA supplementation in PKU. The LNAA supplementation regimen that was used,
changed most brain non-Phe LNAA concentrations, restoring brain tryptophan in PKU mice
to WT concentrations. Brain methionine concentrations were even significantly increased by
5.5-fold in PKU mice on LNAA supplementation compared to normal chow, corresponding
with the similarly strong increases in blood. Although the cerebral and systemic effects
and possible toxicity due to these strongly elevated methionine concentrations are not
fully understood36, at least these results warrant against indiscriminate supplementation
of methionine in PKU. Also, brain histidine concentrations in PKU mice were even
further increased on LNAA supplementation. From the fact that histidinaemia, in which
brain histidine concentrations are much more increased, is not associated with any brain
dysfunction, we may conclude that this elevation of brain histidine as observed in PKU mice
![Page 151: University of Groningen Phenylketonuria in mice and men ... · Phenylketonuria in mice and men Proefschrift ter verkrijging van de graad van doctor aan de Rijksuniversiteit Groningen](https://reader034.vdocuments.site/reader034/viewer/2022052611/5f03c1e37e708231d40a9ed0/html5/thumbnails/151.jpg)
512536-L-bw-Bruinenberg512536-L-bw-Bruinenberg512536-L-bw-Bruinenberg512536-L-bw-BruinenbergProcessed on: 15-8-2017Processed on: 15-8-2017Processed on: 15-8-2017Processed on: 15-8-2017 PDF page: 150PDF page: 150PDF page: 150PDF page: 150
150
Chapter 8
probably does not have clinical significance37. On the other hand, brain concentrations of
threonine, which was not included in the LNAA supplement, were significantly reduced in
both PKU and WT mice on LNAA supplemented diet. This further supports the idea that
highly unbalanced LNAA intake may induce brain deficiencies of some LNAA.
It can be concluded from these results that LNAA supplementation in PKU mice indeed
attenuates brain Phe concentrations and attenuates brain deficiencies of (at least some) non-
Phe LNAA. At the same time, results suggest that the relationships between brain non-Phe
LNAA concentrations and their respective plasma concentrations as well as plasma Phe
concentrations are complex and differ for each non-Phe LNAA, given the amount of LNAA
supplementation used in this study. Development of the optimal LNAA supplementation
regimen that can both effectively reduce brain Phe concentrations and improve brain
concentration of all non-Phe LNAA therefore clearly deserves further research.
4.3 LNAA treatment improves brain serotonin and norepinephrine, but not dopamine,
concentrations
Besides its effect on brain LNAA concentrations, LNAA supplementation in PKU mice
significantly increased brain serotonin from 35% to 71% of concentrations in WT mice.
Also, brain norepinephrine in PKU mice on LNAA supplementation increased from 57%
to 86% of concentrations in WT mice, whereas brain dopamine concentrations remained
unchanged. Although brain monoaminergic neurotransmitter concentrations in response
to LNAA supplementation have not been reported previously, a recent study on LNAA
supplementation in PKU patients showed increased melatonin (a serotonin metabolite)
concentrations in plasma and urine, which - according to the authors- could be a possible
new marker for brain serotonin synthesis in PKU patients29. As C57Bl/6 is one of many
mouse strains being deficient in melatonin38, unfortunately, we were unable to correlate brain
serotonin and plasma melatonin concentrations. Regarding the clinical importance of brain
monoaminergic neurotransmitters in PKU, traditionally, especially brain dopamine deficiency
has been associated with cognitive and mood disturbances in PKU39,40. However, brain
norepinephrine impairments may have been underestimated, while cerebral norepinephrine
abnormalities have been associated with many (neuro)psychiatric disorders41.
Both insufficient precursor availability and impaired TH and TPH activity by inhibition
of excessive brain Phe concentrations have been hypothesized to account for the brain
monoaminergic neurotransmitter deficits in PKU. The present results suggest that the
relative contribution of each of these mechanisms may be different for the dopaminergic
and serotoninergic pathways in PKU. Regarding the brain catecholamine deficiencies, the
increased ratio of brain dopamine/tyrosine and unaffected ratio of brain norepinephrine/
tyrosine in PKU mice could be explained in two ways, each supporting one of the two
aforementioned main theories on brain monoaminergic neurotransmitter deficiencies in
![Page 152: University of Groningen Phenylketonuria in mice and men ... · Phenylketonuria in mice and men Proefschrift ter verkrijging van de graad van doctor aan de Rijksuniversiteit Groningen](https://reader034.vdocuments.site/reader034/viewer/2022052611/5f03c1e37e708231d40a9ed0/html5/thumbnails/152.jpg)
512536-L-bw-Bruinenberg512536-L-bw-Bruinenberg512536-L-bw-Bruinenberg512536-L-bw-BruinenbergProcessed on: 15-8-2017Processed on: 15-8-2017Processed on: 15-8-2017Processed on: 15-8-2017 PDF page: 151PDF page: 151PDF page: 151PDF page: 151
8
151
Chapter 8
PKU. Firstly, it may indicate that insufficient brain tyrosine availability rather than inhibition
of TH by high Phe would be responsible for the brain catecholamine deficiencies observed
in PKU. This would support the report by Fernstrom et al. (2007) concluding that increased
brain Phe is not likely to impair catecholamine synthesis in PKU, whereas low brain tyrosine
does42. In consequence, this would implicate that even higher blood tyrosine concentrations
may be needed to restore brain dopamine concentrations. Secondly, the increased ratio
of brain dopamine/tyrosine and unaffected ratio of brain norepinephrine/tyrosine in PKU
compared to WT mice on normal chow may be explained by the fact that brain dopamine
is not exclusively derived from brain tyrosine. This would support the report by Ikeda et al.
(1967) showing that TH, at least in vitro, could synthesize catecholamines also from Phe,
which is abundant in the PKU brain. This would suggest that insufficient precursor amino
acid availability in brain would not be the primary mechanism underlying reduced dopamine
concentrations, but inhibition of TH by high Phe is43. In consequence, this would imply that
further reduction of brain Phe concentrations would probably be most effective to increase
brain dopamine concentrations in PKU. Regarding the observed serotonin deficits in PKU,
the reduced ratios of brain serotonin/tryptophan in PKU mice suggest that inhibition of TPH
by high Phe does play an important role in the cerebral serotonin impairments characterizing
PKU. This is in good agreement with the in vitro observation that Phe inhibits TPH more
strongly than TH44. To further discriminate between the importance of both hypothesized
mechanisms underlying brain monoaminergic neurotransmitter impairments in PKU, future
studies need to investigate the effects of selective brain tyrosine and tryptophan increase and
selective brain Phe reduction on monoaminergic neurotransmitter concentrations in PKU
mice.
To conclude, this study was the first to investigate all hypothesized biochemical treatment
objectives of LNAA supplementation in PKU. Results in PKU mice showed that LNAA
supplementation improves brain biochemistry in PKU by three synergistic mechanisms.
Thereby, this study provides proof-of-concept for LNAA supplementation as a possible
alternative treatment strategy for PKU that improves brain biochemistry by targeting
the unbalanced LNAA transport across the BBB. Before clinical application should be
considered, however, further optimization of LNAA treatment with regard to the LNAA
being supplemented and their dose is required, taking into account all three brain biochemical
treatment objectives.
ACKNOWLEDGEMENTS
The authors express their gratitude to Mrs. H.A. Kingma, Mrs. E.Z. Jonkers, Mrs. K. Boer,
and Mrs. H. Adema for their analytical support.
![Page 153: University of Groningen Phenylketonuria in mice and men ... · Phenylketonuria in mice and men Proefschrift ter verkrijging van de graad van doctor aan de Rijksuniversiteit Groningen](https://reader034.vdocuments.site/reader034/viewer/2022052611/5f03c1e37e708231d40a9ed0/html5/thumbnails/153.jpg)
512536-L-bw-Bruinenberg512536-L-bw-Bruinenberg512536-L-bw-Bruinenberg512536-L-bw-BruinenbergProcessed on: 15-8-2017Processed on: 15-8-2017Processed on: 15-8-2017Processed on: 15-8-2017 PDF page: 152PDF page: 152PDF page: 152PDF page: 152
152
Chapter 8
REFERENCES
1 Blau N, van Spronsen FJ, Levy HL.
Phenylketonuria. Lancet 2010 Oct
23;376(9750):1417-1427.
2 Pardridge WM. Blood-brain barrier carrier-
mediated transport and brain metabolism
of amino acids. Neurochem Res 1998
May;23(5):635-644.
3 van Spronsen FJ, Hoeksma M, Reijngoud
DJ. Brain dysfunction in phenylketonuria:
is phenylalanine toxicity the only
possible cause? J Inherit Metab Dis 2009
Feb;32(1):46-51.
4 Smith QR. Transport of glutamate and
other amino acids at the blood-brain barrier.
J Nutr 2000 Apr;130(4S Suppl):1016S-22S.
5 Knudsen GM, Hasselbalch S, Toft PB,
Christensen E, Paulson OB, Lou H. Blood-
brain barrier transport of amino acids
in healthy controls and in patients with
phenylketonuria. J Inherit Metab Dis
1995;18(6):653-664.
6 de Groot MJ, Hoeksma M, Reijngoud DJ,
de Valk HW, Paans AM, Sauer PJ, et al.
Phenylketonuria: reduced tyrosine brain
influx relates to reduced cerebral protein
synthesis. Orphanet J Rare Dis 2013 Sep
4;8(1):133.
7 Shulkin BL, Betz AL, Koeppe RA, Agranoff
BW. Inhibition of neutral amino acid
transport across the human blood-brain
barrier by phenylalanine. J Neurochem
1995 Mar;64(3):1252-1257.
8 Oldendorf WH, Sisson BW, Silverstein A.
Brain uptake of selenomethionine Se 75. II.
Reduced brain uptake of selenomethionine
Se 75 in phenylketonuria. Arch Neurol 1971
Jun;24(6):524-528.
9 de Groot MJ, Hoeksma M, Blau
N, Reijngoud DJ, van Spronsen FJ.
Pathogenesis of cognitive dysfunction in
phenylketonuria: review of hypotheses. Mol
Genet Metab 2010;99 Suppl 1:S86-9.
10 de Groot MJ, Sijens PE, Reijngoud
DJ, Paans AM, van Spronsen FJ.
Phenylketonuria: brain phenylalanine
concentrations relate inversely to cerebral
protein synthesis. J Cereb Blood Flow
Metab 2014 Oct 29.
11 Glushakov AV, Glushakova O, Varshney
M, Bajpai LK, Sumners C, Laipis PJ, et
al. Long-term changes in glutamatergic
synaptic transmission in phenylketonuria.
Brain 2005 Feb;128(Pt 2):300-307.
12 Martynyuk AE, Glushakov AV, Sumners
C, Laipis PJ, Dennis DM, Seubert
CN. Impaired glutamatergic synaptic
transmission in the PKU brain. Mol Genet
Metab 2005 Dec;86 Suppl 1:S34-42.
13 Shefer S, Tint GS, Jean-Guillaume D,
Daikhin E, Kendler A, Nguyen LB, et al. Is
there a relationship between 3-hydroxy-3-
methylglutaryl coenzyme a reductase activity
and forebrain pathology in the PKU mouse?
J Neurosci Res 2000 Sep 1;61(5):549-563.
14 Horster F, Schwab MA, Sauer SW,
Pietz J, Hoffmann GF, Okun JG, et al.
Phenylalanine reduces synaptic density in
mixed cortical cultures from mice. Pediatr
Res 2006 Apr;59(4 Pt 1):544-548.
15 Smith CB, Kang J. Cerebral protein
synthesis in a genetic mouse model of
phenylketonuria. Proc Natl Acad Sci U S A
2000 Sep 26;97(20):11014-11019.
16 Hommes FA, Lee JS. The control of
5-hydroxytryptamine and dopamine
synthesis in the brain: a theoretical
approach. J Inherit Metab Dis
1990;13(1):37-57.
![Page 154: University of Groningen Phenylketonuria in mice and men ... · Phenylketonuria in mice and men Proefschrift ter verkrijging van de graad van doctor aan de Rijksuniversiteit Groningen](https://reader034.vdocuments.site/reader034/viewer/2022052611/5f03c1e37e708231d40a9ed0/html5/thumbnails/154.jpg)
512536-L-bw-Bruinenberg512536-L-bw-Bruinenberg512536-L-bw-Bruinenberg512536-L-bw-BruinenbergProcessed on: 15-8-2017Processed on: 15-8-2017Processed on: 15-8-2017Processed on: 15-8-2017 PDF page: 153PDF page: 153PDF page: 153PDF page: 153
8
153
Chapter 8
17 Pascucci T, Andolina D, Mela IL,
Conversi D, Latagliata C, Ventura R,
et al. 5-Hydroxytryptophan rescues
serotonin response to stress in prefrontal
cortex of hyperphenylalaninaemic mice.
Int J Neuropsychopharmacol 2009
Sep;12(8):1067-1079.
18 Smith I, Knowles J. Behaviour in early
treated phenylketonuria: a systematic
review. Eur J Pediatr 2000 Oct;159 Suppl
2:S89-93.
19 Jahja R, Huijbregts SC, de Sonneville
LM, van der Meere JJ, van Spronsen FJ.
Neurocognitive evidence for revision
of treatment targets and guidelines
for phenylketonuria. J Pediatr 2014
Apr;164(4):895-899.e2.
20 MacDonald A. Diet and compliance in
phenylketonuria. Eur J Pediatr 2000
Oct;159 Suppl 2:S136-41.
21 van Spronsen FJ, de Groot MJ, Hoeksma
M, Reijngoud DJ, van Rijn M. Large neutral
amino acids in the treatment of PKU: from
theory to practice. J Inherit Metab Dis 2010
Dec;33(6):671-676.
22 Matalon R, Michals-Matalon K, Bhatia
G, Burlina AB, Burlina AP, Braga C, et al.
Double blind placebo control trial of large
neutral amino acids in treatment of PKU:
effect on blood phenylalanine. J Inherit
Metab Dis 2007 Apr;30(2):153-158.
23 Matalon R, Michals-Matalon K, Bhatia
G, Grechanina E, Novikov P, McDonald
JD, et al. Large neutral amino acids in the
treatment of phenylketonuria (PKU). J
Inherit Metab Dis 2006 Dec;29(6):732-738.
24 Matalon R, Surendran S, Matalon KM,
Tyring S, Quast M, Jinga W, et al. Future
role of large neutral amino acids in
transport of phenylalanine into the brain.
Pediatrics 2003 Dec;112(6 Pt 2):1570-1574.
25 Moats RA, Moseley KD, Koch R, Nelson
M,Jr. Brain phenylalanine concentrations
in phenylketonuria: research and treatment
of adults. Pediatrics 2003 Dec;112(6 Pt
2):1575-1579.
26 Pietz J, Kreis R, Rupp A, Mayatepek
E, Rating D, Boesch C, et al. Large
neutral amino acids block phenylalanine
transport into brain tissue in patients
with phenylketonuria. J Clin Invest 1999
Apr;103(8):1169-1178.
27 Schindeler S, Ghosh-Jerath S, Thompson S,
Rocca A, Joy P, Kemp A, et al. The effects
of large neutral amino acid supplements
in PKU: an MRS and neuropsychological
study. Mol Genet Metab 2007
May;91(1):48-54.
28 Koch R, Moseley KD, Yano S, Nelson
M,Jr, Moats RA. Large neutral amino acid
therapy and phenylketonuria: a promising
approach to treatment. Mol Genet Metab
2003 Jun;79(2):110-113.
29 Yano S, Moseley K, Azen C. Large neutral
amino acid supplementation increases
melatonin synthesis in phenylketonuria:
a new biomarker. J Pediatr 2013
May;162(5):999-1003.
30 Bachmanov AA, Reed DR, Tordoff MG,
Price RA, Beauchamp GK. Nutrient
preference and diet-induced adiposity in
C57BL/6ByJ and 129P3/J mice. Physiol
Behav 2001 Mar;72(4):603-613.
31 Reeves PG, Nielsen FH, Fahey GC,Jr. AIN-
93 purified diets for laboratory rodents:
final report of the American Institute of
Nutrition ad hoc writing committee on the
reformulation of the AIN-76A rodent diet. J
Nutr 1993 Nov;123(11):1939-1951.
32 van de Merbel NC, Hendriks G, Imbos
R, Tuunainen J, Rouru J, Nikkanen H.
Quantitative determination of free and total
dopamine in human plasma by LC-MS/
MS: the importance of sample preparation.
Bioanalysis 2011 Sep;3(17):1949-1961.
![Page 155: University of Groningen Phenylketonuria in mice and men ... · Phenylketonuria in mice and men Proefschrift ter verkrijging van de graad van doctor aan de Rijksuniversiteit Groningen](https://reader034.vdocuments.site/reader034/viewer/2022052611/5f03c1e37e708231d40a9ed0/html5/thumbnails/155.jpg)
512536-L-bw-Bruinenberg512536-L-bw-Bruinenberg512536-L-bw-Bruinenberg512536-L-bw-BruinenbergProcessed on: 15-8-2017Processed on: 15-8-2017Processed on: 15-8-2017Processed on: 15-8-2017 PDF page: 154PDF page: 154PDF page: 154PDF page: 154
154
Chapter 8
33 Martynyuk AE, van Spronsen FJ, Van
der Zee EA. Animal models of brain
dysfunction in phenylketonuria. Mol Genet
Metab 2010;99 Suppl 1:S100-5.
34 Hargreaves KM, Pardridge WM. Neutral
amino acid transport at the human blood-
brain barrier. J Biol Chem 1988 Dec
25;263(36):19392-19397.
35 Sanjurjo P, Aldamiz L, Georgi G, Jelinek J,
Ruiz JI, Boehm G. Dietary threonine reduces
plasma phenylalanine levels in patients
with hyperphenylalaninemia. J Pediatr
Gastroenterol Nutr 2003 Jan;36(1):23-26.
36 de Rezende MM, D’Almeida V. Central and
systemic responses to methionine-induced
hyperhomocysteinemia in mice. PLoS One
2014 Aug 25;9(8):e105704.
37 Coulombe JT, Kammerer BL, Levy HL,
Hirsch BZ, Scriver CR. Histidinaemia. Part
III: Impact; a prospective study. J Inherit
Metab Dis 1983;6(2):58-61.
38 Roseboom PH, Namboodiri MA, Zimonjic
DB, Popescu NC, Rodriguez IR, Gastel JA,
et al. Natural melatonin ‘knockdown’ in
C57BL/6J mice: rare mechanism truncates
serotonin N-acetyltransferase. Brain Res
Mol Brain Res 1998 Dec 10;63(1):189-197.
39 Christ SE, Huijbregts SC, de Sonneville
LM, White DA. Executive function in
early-treated phenylketonuria: profile and
underlying mechanisms. Mol Genet Metab
2010;99 Suppl 1:S22-32.
40 Surtees R, Blau N. The neurochemistry
of phenylketonuria. Eur J Pediatr 2000
Oct;159 Suppl 2:S109-13.
41 Sara SJ. The locus coeruleus and
noradrenergic modulation of cognition. Nat
Rev Neurosci 2009 Mar;10(3):211-223.
42 Fernstrom JD, Fernstrom MH. Tyrosine,
phenylalanine, and catecholamine synthesis
and function in the brain. J Nutr 2007
Jun;137(6 Suppl 1):1539S-1547S; discussion
1548S.
43 Ikeda M, Levitt M, Udenfriend S.
Phenylalanine as substrate and inhibitor
of tyrosine hydroxylase. Arch Biochem
Biophys 1967 May;120(2):420-427.
44 Ogawa S, Ichinose H. Effect of metals and
phenylalanine on the activity of human
tryptophan hydroxylase-2: comparison
with that on tyrosine hydroxylase activity.
Neurosci Lett 2006 Jul 3;401(3):261-265.
![Page 156: University of Groningen Phenylketonuria in mice and men ... · Phenylketonuria in mice and men Proefschrift ter verkrijging van de graad van doctor aan de Rijksuniversiteit Groningen](https://reader034.vdocuments.site/reader034/viewer/2022052611/5f03c1e37e708231d40a9ed0/html5/thumbnails/156.jpg)
512536-L-bw-Bruinenberg512536-L-bw-Bruinenberg512536-L-bw-Bruinenberg512536-L-bw-BruinenbergProcessed on: 15-8-2017Processed on: 15-8-2017Processed on: 15-8-2017Processed on: 15-8-2017 PDF page: 155PDF page: 155PDF page: 155PDF page: 155
8
155
Chapter 8
S1 T
able
. Ave
rage
LN
AA
inta
kes
of t
he d
iffe
rent
exp
erim
enta
l gro
ups
(mg/
g bo
dy w
eigh
t/da
y)
WT
PKU
norm
al
chow
LN
AA
diet
high
-pro
tein
diet
norm
al
chow
LN
AA
diet
high
-pro
tein
diet
Phen
ylal
anin
e0.
92
±0.
090.
88±
0.07
1.81
±0.
151.
15±
0.18
0.97
±0.
122.
19±
0.13
Tyro
sine
0.74
±
0.08
2.91
±0.
241.
80±
0.15
0.92
±0.
143.
20±
0.38
2.17
±0.
13
Val
ine
1.14
±
0.12
3.62
±0.
302.
37±
0.19
1.42
±0.
223.
98±
0.47
2.85
±0.
17
Isol
euci
ne0.
91
±0.
093.
32±
0.28
1.84
±0.
151.
13±
0.18
3.65
±0.
432.
22±
0.13
Leu
cine
1.68
±
0.17
4.06
±0.
343.
44±
0.28
2.09
±0.
324.
46±
0.53
4.14
±0.
25
Met
hion
ine
0.46
±
0.05
2.85
±0.
241.
03±
0.08
0.57
±0.
093.
14±
0.37
1.24
±0.
07
His
tidi
ne0.
49
±0.
052.
75±
0.23
1.01
±0.
080.
61±
0.10
3.03
±0.
361.
22±
0.07
Thr
eoni
ne0.
82
±0.
080.
83±
0.07
1.68
±0.
141.
02±
0.16
0.91
±0.
112.
03±
0.12
LN
AA
inta
ke is
giv
en in
mg/
g bo
dy w
eigh
t/da
y, e
xpre
ssed
as
mea
n ±
SD.
Die
tary
inta
ke is
not
sho
wn
for
Try
ptop
han,
as
this
cou
ld n
ot b
e m
easu
red
in t
he f
ood
pelle
ts.
Num
bers
of
mic
e on
nor
mal
cho
w, L
NA
A s
uppl
emen
ted
diet
, and
hig
h-pr
otei
n di
et w
ere
n=13
, n=1
3, a
nd n
=14
for
WT
mic
e re
spec
tive
ly, w
hile
bei
ng
n=15
, n=1
4, a
nd n
=15
for
PKU
mic
e.
SUPPORTING INFORMATION
![Page 157: University of Groningen Phenylketonuria in mice and men ... · Phenylketonuria in mice and men Proefschrift ter verkrijging van de graad van doctor aan de Rijksuniversiteit Groningen](https://reader034.vdocuments.site/reader034/viewer/2022052611/5f03c1e37e708231d40a9ed0/html5/thumbnails/157.jpg)
512536-L-bw-Bruinenberg512536-L-bw-Bruinenberg512536-L-bw-Bruinenberg512536-L-bw-BruinenbergProcessed on: 15-8-2017Processed on: 15-8-2017Processed on: 15-8-2017Processed on: 15-8-2017 PDF page: 156PDF page: 156PDF page: 156PDF page: 156
156
Chapter 8
S2 T
able
. Pla
sma
non-
LN
AA
am
ino
acid
con
cent
rati
ons
afte
r si
x w
eeks
of
rece
ivin
g di
ffer
ent
diet
s
WT
PKU
Nor
mal
chow
LN
AA
diet
Hig
h-pr
otei
n
diet
Nor
mal
chow
LN
AA
diet
Hig
h-pr
otei
n
diet
Taur
ine
425
±16
951
3±
267
334
±16
129
4±
120 a
348
±72
#25
6±
66#
Asp
arti
c ac
id19
±7
16±
716
±8
17±
816
±9
12±
4
Seri
ne20
3±
46**
144
±36
**#
182
±39
#18
9±
5417
2±
5116
4±
46
Asp
arag
ine
71±
2061
±21
60±
1764
±31
68±
2849
±19
Glu
tam
ate
48±
3041
±39
36±
1831
±16
a32
±19
26±
10
Glu
tam
ine
585
±81
558
±75
539
±10
855
0±
157*
506
±86
422
±70
*
Prol
ine
191
±95
159
±76
232
±89
153
±67
165
±51
169
±72
Gly
cine
249
±30
**13
0±
50**
##22
2±
26##
232
±89
**14
4±
52**
#19
6±
45#
Ala
nine
749
±20
967
2±
259
636
±19
458
7±
142 a
695
±17
8##48
2±
160##
Cit
rulli
ne77
±14
86±
1976
±17
92±
17a*
*88
±15
77±
16*
Orn
ithi
ne67
±19
55±
1576
±30
72±
3369
±26
61±
16
Lysi
ne55
0±
160*
*30
0±
64**
##55
2±
140##
426
±13
0 a32
2±
7238
7±
97
Arg
inin
e11
3±
2987
±17
105
±30
77±
24aa
68±
2081
±19
Plas
ma
conc
entr
atio
ns a
re e
xpre
ssed
in µ
mol
/l (m
ean
± SD
).
Con
cent
rati
ons
in P
KU
mic
e on
nor
mal
cho
w a
re c
ompa
red
to W
T m
ice
on n
orm
al c
how
(a
<0.0
5 an
d aa
<0.0
1).
Wit
hin
the
grou
ps o
f W
T a
nd P
KU
mic
e, c
once
ntra
tion
s th
at d
iffe
r be
twee
n di
etar
y tr
eatm
ent
grou
ps a
re in
dica
ted
(*<0
.05;
**<0
.01;
#<0
.05;
and
##<
0.01
).
![Page 158: University of Groningen Phenylketonuria in mice and men ... · Phenylketonuria in mice and men Proefschrift ter verkrijging van de graad van doctor aan de Rijksuniversiteit Groningen](https://reader034.vdocuments.site/reader034/viewer/2022052611/5f03c1e37e708231d40a9ed0/html5/thumbnails/158.jpg)
512536-L-bw-Bruinenberg512536-L-bw-Bruinenberg512536-L-bw-Bruinenberg512536-L-bw-BruinenbergProcessed on: 15-8-2017Processed on: 15-8-2017Processed on: 15-8-2017Processed on: 15-8-2017 PDF page: 157PDF page: 157PDF page: 157PDF page: 157
8
157
Chapter 8
S2 T
able
. Pla
sma
non-
LN
AA
am
ino
acid
con
cent
rati
ons
afte
r si
x w
eeks
of
rece
ivin
g di
ffer
ent
diet
s
WT
PKU
Nor
mal
chow
LN
AA
diet
Hig
h-pr
otei
n
diet
Nor
mal
chow
LN
AA
diet
Hig
h-pr
otei
n
diet
Taur
ine
425
±16
951
3±
267
334
±16
129
4±
120 a
348
±72
#25
6±
66#
Asp
arti
c ac
id19
±7
16±
716
±8
17±
816
±9
12±
4
Seri
ne20
3±
46**
144
±36
**#
182
±39
#18
9±
5417
2±
5116
4±
46
Asp
arag
ine
71±
2061
±21
60±
1764
±31
68±
2849
±19
Glu
tam
ate
48±
3041
±39
36±
1831
±16
a32
±19
26±
10
Glu
tam
ine
585
±81
558
±75
539
±10
855
0±
157*
506
±86
422
±70
*
Prol
ine
191
±95
159
±76
232
±89
153
±67
165
±51
169
±72
Gly
cine
249
±30
**13
0±
50**
##22
2±
26##
232
±89
**14
4±
52**
#19
6±
45#
Ala
nine
749
±20
967
2±
259
636
±19
458
7±
142 a
695
±17
8##48
2±
160##
Cit
rulli
ne77
±14
86±
1976
±17
92±
17a*
*88
±15
77±
16*
Orn
ithi
ne67
±19
55±
1576
±30
72±
3369
±26
61±
16
Lysi
ne55
0±
160*
*30
0±
64**
##55
2±
140##
426
±13
0 a32
2±
7238
7±
97
Arg
inin
e11
3±
2987
±17
105
±30
77±
24aa
68±
2081
±19
Plas
ma
conc
entr
atio
ns a
re e
xpre
ssed
in µ
mol
/l (m
ean
± SD
).
Con
cent
rati
ons
in P
KU
mic
e on
nor
mal
cho
w a
re c
ompa
red
to W
T m
ice
on n
orm
al c
how
(a
<0.0
5 an
d aa
<0.0
1).
Wit
hin
the
grou
ps o
f W
T a
nd P
KU
mic
e, c
once
ntra
tion
s th
at d
iffe
r be
twee
n di
etar
y tr
eatm
ent
grou
ps a
re in
dica
ted
(*<0
.05;
**<0
.01;
#<0
.05;
and
##<
0.01
).
S3 T
able
. Bra
in n
on-L
NA
A a
min
o ac
id c
once
ntra
tion
s af
ter
six
wee
ks o
f re
ceiv
ing
diff
eren
t di
ets
WT
PKU
Nor
mal
chow
LN
AA
diet
Hig
h-pr
otei
n
diet
Nor
mal
chow
LN
AA
diet
Hig
h-pr
otei
n
diet
Taur
ine
9913
±70
2*10
610
±48
8*##
9839
±53
4##10
324
±10
5411
041
±83
110
933
±68
4
Asp
arti
c ac
id48
33±
402
5036
±45
049
36±
433
4471
±45
9 a45
01±
348
4556
±31
7
Seri
ne10
12±
96**
617
±10
2**##
1012
±93
##11
37±
98aa
**87
2±
174*
*##11
21±
146##
Asp
arag
ine
80±
972
±12
78±
1476
±23
72±
1474
±8
Glu
tam
ate
1033
4±
562
1015
7±
553
1033
6±
439
9624
±63
6 aa96
27±
825
9554
±67
9
Glu
tam
ine
4702
±18
8538
21±
677#
4846
±99
2#42
64±
1862
4405
±12
9336
63±
743
Prol
ine
131
±55
151
±55
131
±65
146
±88
138
±76
144
±70
Gly
cine
1496
±15
2**
1153
±14
3**##
1467
±15
7##18
17±
373 aa
*14
66±
285*
1724
±26
5
Ala
nine
874
±10
884
0±
120
816
±13
076
0±
84aa
745
±12
377
6±
95
GA
BA
3876
±49
039
41±
514
3834
±47
335
84±
514
3596
±50
337
16±
525
Lysi
ne32
8±
37**
282
±28
**##
329
±42
##30
4±
4828
9±
4930
4±
40
Arg
inin
e26
0±
6926
5±
6526
1±
8022
5±
8623
7±
9023
2±
73B
rain
con
cent
rati
ons
are
expr
esse
d in
nm
ol/g
wet
wei
ght
(mea
n ±
SD).
Con
cent
rati
ons
in P
KU
mic
e on
nor
mal
cho
w a
re c
ompa
red
to W
T m
ice
on n
orm
al c
how
(a
<0.0
5 an
d aa
<0.0
1).
Wit
hin
the
grou
ps o
f W
T a
nd P
KU
mic
e, c
once
ntra
tion
s th
at d
iffe
r be
twee
n di
etar
y tr
eatm
ent
grou
ps a
re in
dica
ted
(*<0
.05;
**<0
.01;
#<0
.05;
and
##<
0.01
).
![Page 159: University of Groningen Phenylketonuria in mice and men ... · Phenylketonuria in mice and men Proefschrift ter verkrijging van de graad van doctor aan de Rijksuniversiteit Groningen](https://reader034.vdocuments.site/reader034/viewer/2022052611/5f03c1e37e708231d40a9ed0/html5/thumbnails/159.jpg)
512536-L-bw-Bruinenberg512536-L-bw-Bruinenberg512536-L-bw-Bruinenberg512536-L-bw-BruinenbergProcessed on: 15-8-2017Processed on: 15-8-2017Processed on: 15-8-2017Processed on: 15-8-2017 PDF page: 158PDF page: 158PDF page: 158PDF page: 158
![Page 160: University of Groningen Phenylketonuria in mice and men ... · Phenylketonuria in mice and men Proefschrift ter verkrijging van de graad van doctor aan de Rijksuniversiteit Groningen](https://reader034.vdocuments.site/reader034/viewer/2022052611/5f03c1e37e708231d40a9ed0/html5/thumbnails/160.jpg)
512536-L-bw-Bruinenberg512536-L-bw-Bruinenberg512536-L-bw-Bruinenberg512536-L-bw-BruinenbergProcessed on: 15-8-2017Processed on: 15-8-2017Processed on: 15-8-2017Processed on: 15-8-2017 PDF page: 159PDF page: 159PDF page: 159PDF page: 159
CHAPTER 9Therapeutic brain modulation with targeted Large Neutral Amino Acid supplements in the Pah-enu2
phenylketonuria mouse model
D. van Vliet, V.M. Bruinenberg, P.N. Mazzola, H.J.R. van Faassen, P. de
Blaauw, T. Pascucci, S. Puglisi-Allegra, I.P. Kema, M.R. Heiner-Fokkema,
E.A. van der Zee, F.J. van Spronsen
1University of Groningen, University Medical Center Groningen, Beatrix Children’s
Hospital, Groningen, The Netherlands (DvV, PNM, FJvS). 2University of Groningen,
Groningen Institute for Evolutionary Life Sciences (GELIFES), Department of Molecular
Neurobiology, Groningen, The Netherlands (VMB, PNM, EAvdZ). 3University of
Groningen, University Medical Center Groningen, Department of Laboratory Medicine,
Groningen, The Netherlands (HJRvF, PdB, IPK, MRHF). 4Sapienza University, Fondazione
Santa Lucia, Department of Psychology and Centro “Daniel Bovet”, Rome, Italy (TP,
SPA). 5Fondazione Santa Lucia, IRCCS, Rome, Italy (TP, SPA)
Am J Clin Nutr. 2016 Nov;104(5):1292-1300. Epub 2016 Sep 21.
![Page 161: University of Groningen Phenylketonuria in mice and men ... · Phenylketonuria in mice and men Proefschrift ter verkrijging van de graad van doctor aan de Rijksuniversiteit Groningen](https://reader034.vdocuments.site/reader034/viewer/2022052611/5f03c1e37e708231d40a9ed0/html5/thumbnails/161.jpg)
512536-L-bw-Bruinenberg512536-L-bw-Bruinenberg512536-L-bw-Bruinenberg512536-L-bw-BruinenbergProcessed on: 15-8-2017Processed on: 15-8-2017Processed on: 15-8-2017Processed on: 15-8-2017 PDF page: 160PDF page: 160PDF page: 160PDF page: 160
160
Chapter 9
Sources of support: This research was funded by a research grant from the National PKU
Alliance (USA) and the University Medical Center of Groningen. Experimental diets were
provided by Nutricia Research.
Running head: Towards LNAA treatment for PKU
Keywords: phenylketonuria, inborn error of metabolism, large neutral amino acids
Abbreviations
BBB blood-brain barrier
5-HIAA 5-hydroxyindoleacetic acid
His histidine
Ile isoleucine
LAT1 large neutral amino acid transporter type 1
Leuleucine
LNAA large neutral amino acids
Met methionine
PAH phenylalanine hydroxylase
Phe phenylalanine
PKU phenylketonuria
Thr threonine
Tyr tyrosine
Trp tryptophan
Val valine
VIL valine, isoleucine, and leucine
WT wild-type
![Page 162: University of Groningen Phenylketonuria in mice and men ... · Phenylketonuria in mice and men Proefschrift ter verkrijging van de graad van doctor aan de Rijksuniversiteit Groningen](https://reader034.vdocuments.site/reader034/viewer/2022052611/5f03c1e37e708231d40a9ed0/html5/thumbnails/162.jpg)
512536-L-bw-Bruinenberg512536-L-bw-Bruinenberg512536-L-bw-Bruinenberg512536-L-bw-BruinenbergProcessed on: 15-8-2017Processed on: 15-8-2017Processed on: 15-8-2017Processed on: 15-8-2017 PDF page: 161PDF page: 161PDF page: 161PDF page: 161
9
161
Chapter 9
ABSTRACT
Background:
Phenylketonuria treatment consists mainly of a phenylalanine-restricted diet, which leads
to suboptimal neurocognitive and psychosocial outcomes. Supplementation of large neutral
amino acids (LNAAs) has been suggested as an alternative dietary treatment strategy to
optimize neurocognitive outcome in phenylketonuria and has been shown to influence 3
brain pathobiochemical mechanisms in phenylketonuria, but its optimal composition has
not been established.
Objective:
In order to provide additional pathobiochemical insight and develop optimal LNAA
treatment, several targeted LNAA supplements were investigated with respect to all 3
biochemical disturbances underlying brain dysfunction in phenylketonuria.
Design:
Pah-enu2 (PKU) mice received 1 of 5 different LNAA supplemented diets beginning at
postnatal day 45. Control groups included phenylketonuria mice receiving an isonitrogenic
and isocaloric high-protein diet or AIN-93M diet, and wild-type mice receiving the AIN-
93M diet. After 6 weeks, brain and plasma amino acid profiles and brain monoaminergic
neurotransmitter concentrations were measured.
Results:
Brain Phe concentrations were most effectively reduced by supplementation of LNAAs,
such as Leu and Ile, with a strong affinity for the LNAA transporter type 1. Brain non-
Phe LNAAs could be restored on supplementation, but unbalanced LNAA supplementation
further reduced brain concentrations of those LNAAs that were not (sufficiently) included
in the LNAA supplement. To optimally ameliorate brain monoaminergic neurotransmitter
concentrations, LNAA supplementation should include Tyr and Trp together with
those LNAAs that effectively reduce brain Phe concentrations. The requirement for Tyr
supplementation is higher than it is for Trp, and the relative effect of brain Phe reduction is
higher for serotonin than for dopamine and norepinephrine.
Conclusions:
The study shows that all 3 biochemical disturbances underlying brain dysfunction in
phenylketonuria can be targeted by specific LNAA supplements. The study thus provides
essential information for the development of optimal LNAA supplementation as an
alternative dietary treatment strategy to optimize neurocognitive outcome in patients with
phenylketonuria.
![Page 163: University of Groningen Phenylketonuria in mice and men ... · Phenylketonuria in mice and men Proefschrift ter verkrijging van de graad van doctor aan de Rijksuniversiteit Groningen](https://reader034.vdocuments.site/reader034/viewer/2022052611/5f03c1e37e708231d40a9ed0/html5/thumbnails/163.jpg)
512536-L-bw-Bruinenberg512536-L-bw-Bruinenberg512536-L-bw-Bruinenberg512536-L-bw-BruinenbergProcessed on: 15-8-2017Processed on: 15-8-2017Processed on: 15-8-2017Processed on: 15-8-2017 PDF page: 162PDF page: 162PDF page: 162PDF page: 162
162
Chapter 9
1. INTRODUCTION
Phenylketonuria (PKU; Online Mendelian Inheritance in Man no. 261600) is an inborn
error of phenylalanine (Phe) metabolism, characterized by an impaired conversion of Phe to
tyrosine (Tyr). Left untreated, high blood Phe concentrations correlate with classical PKU
symptoms, including severe neurocognitive dysfunction, seizures, and psychiatric problems.
Based on this correlation, blood Phe reduction by a Phe-restricted diet is the treatment of
choice1.
Although the symptoms of PKU are almost exclusively restricted to brain dysfunction and this
is known to correlate with blood Phe concentrations, with the current blood Phe-lowering
treatment strategies, neurocognitive and psychosocial outcomes remain suboptimal2,3 and
treatment adherence is known to decline with age4. An alternative pathophysiology-based
treatment directly targeting brain biochemistry to improve brain function of patients with
PKU is therefore highly anticipated.
In the pathophysiology of PKU, disturbed amino acid transport across the blood-brain barrier
(BBB) plays a central role, with increased brain Phe influx outcompeting the brain influx
of other large neutral amino acids (LNAAs) that share the same transport system5. Three
main hypotheses have been postulated to explain the mechanism(s) by which disturbed BBB
transport of LNAAs impairs brain function in PKU6. The first hypothesis states that brain
dysfunction is primarily the consequence of neurotoxic high brain Phe concentrations. The
second hypothesis, substantiated by impaired cerebral protein synthesis in PKU7, postulates
that insufficient availability of non-Phe LNAAs to the brain is an additional mechanism. The
third hypothesis presumes that especially impaired cerebral monoaminergic neurotransmitter
synthesis is of specific importance.
Founded on these hypotheses, dietary supplementation of LNAAs has been suggested as a
possible alternative treatment strategy for PKU that could target all the pathophysiological
mechanisms causing brain dysfunction in PKU. Previous studies have investigated various
LNAA supplements in patients with PKU and Black and Tan Brachyury (BTBR) Pah-
enu2 (PKU) mice8-23. In theory, the various LNAA supplements may have served different
biochemical pathways inside the brain, but most studies have focused primarily on the
effects on blood and brain Phe concentrations and showed inconsistent results24.
In a proof-of-principle study, we investigated all of the hypothesized biochemical treatment
objectives, and showed that LNAA supplementation 1) reduced brain Phe concentrations, 2)
attenuated the brain deficiencies of some but not all supplemented LNAAs, and 3) increased
concentrations of brain neurotransmitters in PKU mice25. LNAA supplementation could,
therefore, serve different brain biochemical treatment goals; however, thus far, insufficient
![Page 164: University of Groningen Phenylketonuria in mice and men ... · Phenylketonuria in mice and men Proefschrift ter verkrijging van de graad van doctor aan de Rijksuniversiteit Groningen](https://reader034.vdocuments.site/reader034/viewer/2022052611/5f03c1e37e708231d40a9ed0/html5/thumbnails/164.jpg)
512536-L-bw-Bruinenberg512536-L-bw-Bruinenberg512536-L-bw-Bruinenberg512536-L-bw-BruinenbergProcessed on: 15-8-2017Processed on: 15-8-2017Processed on: 15-8-2017Processed on: 15-8-2017 PDF page: 163PDF page: 163PDF page: 163PDF page: 163
9
163
Chapter 9
understanding of the effects of various LNAA supplements and optimal LNAA composition
hampers clinical application.
Our study attempted to correlate biochemical brain treatment objectives with specific
requirements for the composition of LNAA supplementation by therapeutic modulation of
blood and brain biochemistry with different LNAA supplements in BTBR Pah-enu2 PKU
mice.
2. MATERIAL AND METHODS
2.1 Animals
This study was performed in BTBR Pah-enu2 mice. The Pah-enu2 mouse is a well-
established PKU mouse model that resembles the genetics, biochemistry, and neurobiology
of PKU in humans26. As previously described, one of the important advances of this mouse
model over the human PKU model is that brain concentrations of LNAAs other than Phe
and monoaminergic neurotransmitters can be measured directly25. From heterozygous (+/-)
mating, we obtained wild-type (WT, +/+), heterozygous, and PKU (-/-) mice of both sexes.
After weaning at 4 wk of age, genetic characterization was performed by quantitative
polymerase chain reaction analysis on DNA extracted from ear tissue. Water and RMH-B
food pellets (Arie Block BV) were offered ad libitum. From the start of the experiment,
animals were individually housed and kept at 21±1ºC on a 12-h light-dark cycle (0600-
1800). In total, we used 16 WT mice (8 male, 8 female) and 112 PKU (56 male, 56 female)
mice. All procedures and treatments were carried out in strict accordance with the National
Research Council guidelines. The experimental protocol was approved by the Institutional
Animal Care and Use Committee of the University of Groningen (Permit Number: 6504D).
2.2 Experimental design
At postnatal day 45, animals were included in the experiment, and PKU mice were assigned
to 1 of 7 different dietary treatment groups. Following the order in which the animals
were born, PKU mice were successively assigned to each of the 7 experimental groups.
This procedure was carried out for male and female mice separately and avoided assigning
littermates to the same experimental group as much as possible (Supplemental Figure 1).
During the first week of dietary treatment, body weight and food intake were measured
daily. Afterward, body weight and food intake were determined weekly. Dietary treatment
was continued for 6 wk. At the end of the experiment, animals were killed by combined
heart puncture and decapitation under inhalation anesthetics with isoflurane.
2.3 Experimental diets
The basic diet was AIN-93M27, which was administered in unadjusted form to the PKU
and WT control groups. The compositions of the investigated LNAA-supplemented diets
![Page 165: University of Groningen Phenylketonuria in mice and men ... · Phenylketonuria in mice and men Proefschrift ter verkrijging van de graad van doctor aan de Rijksuniversiteit Groningen](https://reader034.vdocuments.site/reader034/viewer/2022052611/5f03c1e37e708231d40a9ed0/html5/thumbnails/165.jpg)
512536-L-bw-Bruinenberg512536-L-bw-Bruinenberg512536-L-bw-Bruinenberg512536-L-bw-BruinenbergProcessed on: 15-8-2017Processed on: 15-8-2017Processed on: 15-8-2017Processed on: 15-8-2017 PDF page: 164PDF page: 164PDF page: 164PDF page: 164
164
Chapter 9
were principally based on theoretical considerations regarding optimal regimens to achieve
each of the biochemical treatment objectives of LNAA treatment in PKU24. To reduce brain
Phe concentrations, the reported effects of Val, Ile, and Leu13,14 and that especially Leu and
Ile but not valine (Val) have relatively low Michaelis-Menten constant values for transport
across the BBB5,28 made us hypothesize that a Leu+Ile-supplemented diet may be especially
effective. To stimulate cerebral protein synthesis, however, supplementation of all LNAAs
competing with the high Phe concentrations in blood for transport across the BBB may be
required24. Moreover, to explicitly increase brain availability of amino acid precursors for
monoaminergic neurotransmitter synthesis, a Tyr+Trp supplemented diet was suggested as
being more effective. In addition, aside from theoretical considerations, a Thr-supplemented
diet was investigated because Thr supplementation was shown to be beneficial in reducing
plasma Phe concentrations in patients with PKU23.
The experimental LNAA diets were produced by adding LNAAs to the AIN-93M diet at
the expense of cornstarch on a weight-for-weight basis. The added amount of Tyr and Trp
in the Tyr+Trp-supplemented diet was calculated to be 20% and 10%, respectively, of the
amount of protein in the AIN-93M diet (124.12 g/kg diet), which corresponds to ~200 and
100 g/kg body weight in humans, if compared with a mean natural protein intake in humans
of 1 g · kg body weight-1 · d-1. Similarly, the added amount of Leu and Ile in the Leu+Ile-
supplemented diet was calculated to be 20% and 15%, respectively. The added amount of
Thr in the Thr-supplemented diet was calculated to be 5% of the amount of protein in the
AIN-93M diet. The total amount of added LNAAs in both diets containing additional non-
Phe LNAAs –with or without Thr [LNAA(+Thr) and LNAA(-Thr) diets]– was equal to the
amount of protein in the AIN-93M diet (124.12 g/kg diet). The LNAA mixtures included
equal amounts of 17.7 mg/kg [in LNAA(-Thr)] or 15.5 mg/kg diet [in LNAA(+Thr)] of
l-Tyr, l-Trp, l-Val, l-Ile, l-Leu, l-methionine (Met), and l-histidine (His) [and l-Thr in the
LNAA(+Thr) diet only]. The high-protein diet was produced by adding extra casein to the
AIN-93M diet at the expense of cornstarch on a weight-for-weight basis. The added amount
of extra casein was calculated to result in an isonitrogenic and isocaloric control diet for the
diets posing the highest amino acid loads [the LNAA(-Thr) and LNAA(+Thr) diets]. Diets
were prepared by Research Diet Services B.V. Amino acid analyses in the different diets are
presented in Supplemental Table 1.
2.4 Brain collection and biochemical analyses
To obtain brain material for biochemical analyses, whole brains were removed. Brains
were divided into cerebellum, brain stem, and cerebrum, the latter being further divided
into 2 hemispheres. The collected brain samples were individually snap frozen in liquid
nitrogen and stored at -80ºC until further preparation. One-half cerebrum and blood
samples were further processed for the analyses of brain and plasma amino acid and
monoaminergic neurotransmitter concentrations, as described previously25. Monoaminergic
![Page 166: University of Groningen Phenylketonuria in mice and men ... · Phenylketonuria in mice and men Proefschrift ter verkrijging van de graad van doctor aan de Rijksuniversiteit Groningen](https://reader034.vdocuments.site/reader034/viewer/2022052611/5f03c1e37e708231d40a9ed0/html5/thumbnails/166.jpg)
512536-L-bw-Bruinenberg512536-L-bw-Bruinenberg512536-L-bw-Bruinenberg512536-L-bw-BruinenbergProcessed on: 15-8-2017Processed on: 15-8-2017Processed on: 15-8-2017Processed on: 15-8-2017 PDF page: 165PDF page: 165PDF page: 165PDF page: 165
9
165
Chapter 9
neurotransmitters (monoamines) and associated metabolites for which concentrations in
the brains were assessed included dopamine, norepinephrine, and normetanephrine in the
catecholamine pathway, and serotonin and 5-hydroxyindoleacetic acid (5-HIAA) in the
serotonergic pathway.
2.5 Statistical analyses
Statistical analyses have been performed on the data collected on all of the animals except
for one mouse that died prematurely. Statistical analyses were performed with the use of
IBM SPSS Statistics for Windows, Version 22.0. All of the tests were performed 2-sided at a
significance level of α=0.05. Data were expressed as means ± SDs unless otherwise indicated.
Brain and plasma biochemistry was analyzed in 2 steps. If data were not normally distributed
(assessed by Shapiro-Wilk test) or in case of unequal variances (assessed by Levene’s test),
then analyses were performed on log-transformed data. First, each experimental group was
individually compared with PKU mice receiving the AIN-93M diet through use of Student’s
t tests and Bonferroni correction for multiple testing. Second, all of the experimental groups
that were significantly different from PKU mice on AIN-93M diet were compared by 1-factor
ANOVA and Tukey’s post hoc analysis.
The effect of dietary treatment on body weight was analyzed on log-transformed data by
repeated-measures ANOVA and Tukey’s post hoc analysis, with one between-subjects factor
(treatment group, 8 levels), one within-subjects factor (time, 7 levels: 0,1, 2, 3, 4, 5, and 6
wk), and sex as a covariate. Weekly food intake (per gram of body weight) was analyzed by
1-factor ANOVA with Tukey’s post hoc analysis.
To assess which parameters of brain Phe, Tyr, and Trp concentrations correlated with brain
monoaminergic neurotransmitter concentrations in PKU mice, we performed multiple
linear regression analyses using backward selection. These analyses were performed for
brain serotonin, dopamine, and norepinephrine concentrations as dependent variables, with
genotype and brain Phe, Tyr, and Trp concentrations as independent variables.
3. RESULTS
3.1 General health and dietary intake
All of the experimental diets were tolerated well by the mice. Of the 128 mice included in the
experiment, 1 PKU male mouse receiving the Leu+Ile-supplemented diet died unexpectedly
31 d after inclusion. Postmortem macroscopic pathological examination showed no
pathology. A wound in the neck of one PKU male mouse receiving the Thr-supplemented
diet was found during the final week of the experiment caused by excessive grooming. Such
excessive grooming is sometimes observed in mice, especially male BTBR (both WT and
![Page 167: University of Groningen Phenylketonuria in mice and men ... · Phenylketonuria in mice and men Proefschrift ter verkrijging van de graad van doctor aan de Rijksuniversiteit Groningen](https://reader034.vdocuments.site/reader034/viewer/2022052611/5f03c1e37e708231d40a9ed0/html5/thumbnails/167.jpg)
512536-L-bw-Bruinenberg512536-L-bw-Bruinenberg512536-L-bw-Bruinenberg512536-L-bw-BruinenbergProcessed on: 15-8-2017Processed on: 15-8-2017Processed on: 15-8-2017Processed on: 15-8-2017 PDF page: 166PDF page: 166PDF page: 166PDF page: 166
166
Chapter 9
PKU) mice. Body weight curves during 6-wk-long dietary treatment were different for male
and female mice (p<0.001), but they did not significantly differ between treatment groups
(p=0.402) (Supplemental Figure 2).
Weekly food intake (expressed as g food · g body weight-1 · wk-1) decreased after the first
week for all experimental groups, and remained relatively stable in the later treatment weeks
(data not shown). Based on the weekly food intakes and amino acid contents of the different
diets, mean daily intakes of individual LNAAs during the last week of the 6-wk dietary
treatment were calculated for all of the experimental groups and presented in Supplemental
Table 2.
3.2 Plasma LNAAs
Plasma LNAA concentrations in PKU mice receiving the AIN-93M diet and experimental
diets and in WT and PKU control animals are shown in Figure 1. In PKU mice receiving the
AIN-93M diet, plasma Phe concentrations were 490% higher than the concentrations in WT
animals receiving the AIN-93M diet (p<0.001; Figure 1A), whereas plasma concentrations
of non-Phe LNAAs were similar or lower than in WT mice (Figure 1B-I).
When assessing the LNAA-supplemented diets, plasma Phe concentrations in PKU mice
receiving LNAA(+Thr) and LNAA(-Thr) diets were 23% lower than the concentrations
observed in the AIN-93M diet (p<0.01 for both; Figure 1A). On selective supplementation
of Tyr+Trp, Leu+Ile, or Thr, however, plasma Phe concentrations did not significantly
differ from those in the AIN-93M diet, whereas with the high-protein diet, plasma Phe
concentrations were higher than they were with the AIN-93M diet (p<0.001; Figure 1A).
Plasma non-Phe LNAA concentrations were significantly higher in mice receiving diets in
which these particular non-Phe LNAAs had been supplemented than they were in PKU
mice receiving the AIN-93M diet; the exception was plasma Tyr and His concentrations
in LNAA(+Thr), which were not statistically significantly different from concentrations in
PKU mice receiving the AIN-93M diet (p=0.062 and p=0.190, respectively; Figure 1B-I). In
PKU mice receiving the high protein diet, plasma Tyr, Val, Ile, and Leu concentrations were
higher than in PKU mice receiving the AIN-93M diet (p<0.01), but these elevations were
significantly less than those observed in mice receiving the experimental diets (Figure 1B-I).
3.3 Brain LNAAs
Brain concentrations of individual LNAAs in PKU mice receiving the experimental diets and
in WT as well as in PKU control animals are shown in Figure 2. Brain Phe concentrations in
PKU mice receiving the AIN-93M diet were 310% higher than concentrations in WT mice
receiving the AIN-93M diet (p<0.001; Figure 2A). Brain His concentrations in PKU mice
receiving the AIN-93M diet were 49% higher than in WT mice receiving the AIN-93M diet
(p<0.001; Figure 2H). Brain concentrations of all other non-Phe LNAAs were lower in PKU
![Page 168: University of Groningen Phenylketonuria in mice and men ... · Phenylketonuria in mice and men Proefschrift ter verkrijging van de graad van doctor aan de Rijksuniversiteit Groningen](https://reader034.vdocuments.site/reader034/viewer/2022052611/5f03c1e37e708231d40a9ed0/html5/thumbnails/168.jpg)
512536-L-bw-Bruinenberg512536-L-bw-Bruinenberg512536-L-bw-Bruinenberg512536-L-bw-BruinenbergProcessed on: 15-8-2017Processed on: 15-8-2017Processed on: 15-8-2017Processed on: 15-8-2017 PDF page: 167PDF page: 167PDF page: 167PDF page: 167
9
167
Chapter 9
mice receiving the AIN-93M diet, ranging from 66% of concentrations in corresponding
WT mice for Tyr to 85% for Met (Figure 2B-G,I).
Figure 1. Plasma concentrations of A) phenylalanine, B) tyrosine, C) tryptophan, D) valine, E) isoleucine,
F) leucine, G) methionine, H) histidine, and I) threonine in WT and PKU mice after 6 wk of receiving
different diets. Numbers of mice are n=15 or n=16 for all treatment groups. Untransformed data are
expressed as means ± SEMs. * p<0.05; ** p<0.01; *** p<0.001 (2-sided) compared with PKU mice
receiving the AIN-93M diet unless otherwise indicated. Statistical analyses were performed in 2 steps:
1) each experimental group was individually compared with PKU mice receiving the AIN-93M diet by
using Student’s t tests and Bonferroni correction for multiple testing, and 2) all experimental groups
that were significantly different from PKU mice receiving the AIN-93M diet were compared by 1-factor
ANOVA and Tukey’s post hoc analysis. If data were not normally distributed (assessed by Shapiro-
Wilk test), or showed unequal variances (assessed by Levene’s test), analyses were performed on log-
transformed data. LNAA, large neutral amino acid; PKU, phenylketonuria; WT, wild-type
![Page 169: University of Groningen Phenylketonuria in mice and men ... · Phenylketonuria in mice and men Proefschrift ter verkrijging van de graad van doctor aan de Rijksuniversiteit Groningen](https://reader034.vdocuments.site/reader034/viewer/2022052611/5f03c1e37e708231d40a9ed0/html5/thumbnails/169.jpg)
512536-L-bw-Bruinenberg512536-L-bw-Bruinenberg512536-L-bw-Bruinenberg512536-L-bw-BruinenbergProcessed on: 15-8-2017Processed on: 15-8-2017Processed on: 15-8-2017Processed on: 15-8-2017 PDF page: 168PDF page: 168PDF page: 168PDF page: 168
168
Chapter 9
Brain Phe concentrations on LNAA(-Thr)-, LNAA(+Thr)-, and Leu+Ile-supplemented diets
were comparable, being 25-29% lower than concentrations in PKU mice receiving the AIN-
93M diet (p<0.001; Figure 2A). On selective supplementation of Tyr+Trp or Thr, however,
brain Phe concentrations in PKU mice did not differ (p=1.000 for both), whereas brain
Phe concentrations in the high-protein diet were even higher than they were in PKU mice
receiving the AIN-93M diet (p<0.05).
All brain non-Phe LNAA disturbances could be improved by either one or more of the
experimental diets. As may be observed in Figure 2B-I, almost all non-Phe LNAA
concentrations were higher if being supplemented in the diet while in general being lower
than concentrations in PKU mice receiving the AIN-93M diet if not being supplemented,
specifically for brain Met, His, and Thr concentrations. Compared with PKU mice receiving
the AIN-93M diet, the LNAA(-Thr) diet resulted in higher brain concentrations of all
supplemented non-Phe LNAAs (p<0.05 for Tyr and p<0.001 for others), except for Ile,
Leu, and Met (p=0.093; p=0.236; and p=0.115, respectively). Brain concentrations of Thr,
which was not included in the LNAA(-Thr) diet, were even lower than they were in PKU
mice receiving the AIN-93M diet (p<0.001; Figure 2I). The LNAA(+Thr) diet showed
similar results, but brain non-Phe LNAA concentrations were lower than they were in
the LNAA(-Thr) diet, and in contrast to the LNAA(-Thr) diet, brain Thr concentrations
were higher than they were in PKU mice receiving the AIN-93M diet (p<0.001). Selective
Tyr+Trp supplementation restored brain Tyr and Trp concentrations to WT levels, but
further impaired brain Thr concentrations compared with PKU mice receiving the AIN-
93M diet (p<0.001). Similarly, on selective Leu+Ile supplementation, only brain Ile and Leu
concentrations were higher than in PKU mice receiving the AIN-93M diet (p<0.05 for both).
Besides reducing brain Phe concentrations, Leu+Ile supplementation also resulted in lower
brain Met, His, and Thr –but not Tyr and Trp– concentrations than the concentrations
in PKU mice receiving the AIN-93M diet (p<0.001 for all). Selective Thr supplementation
provided higher brain Thr concentrations than those in PKU mice receiving the AIN-93M
diet (p<0.001) without affecting the brain concentrations of any other LNAAs, including
Phe. The high-protein control diet resulted in even higher brain His concentrations than
those in PKU mice receiving the AIN-93M diet (p<0.05).
3.4 Brain monoaminergic neurotransmitters
Brain monoamine and associated metabolite concentrations in PKU mice receiving
the experimental diets as well as in WT and PKU control animals are shown in Figure
3. In the catecholamine pathway, brain dopamine, norepinephrine, and normetanephrine
concentrations in PKU mice receiving the AIN-93M diet were, respectively, 85% (p<0.01),
61% (p<0.001), and 82% (p<0.05) of the concentrations in WT mice receiving the AIN-
93M diet. Tyr+Trp, LNAA(-Thr), and LNAA(+Thr) diets similarly resulted in higher brain
norepinephrine concentrations than those in PKU mice receiving the AIN-93M diet (p<0.001
![Page 170: University of Groningen Phenylketonuria in mice and men ... · Phenylketonuria in mice and men Proefschrift ter verkrijging van de graad van doctor aan de Rijksuniversiteit Groningen](https://reader034.vdocuments.site/reader034/viewer/2022052611/5f03c1e37e708231d40a9ed0/html5/thumbnails/170.jpg)
512536-L-bw-Bruinenberg512536-L-bw-Bruinenberg512536-L-bw-Bruinenberg512536-L-bw-BruinenbergProcessed on: 15-8-2017Processed on: 15-8-2017Processed on: 15-8-2017Processed on: 15-8-2017 PDF page: 169PDF page: 169PDF page: 169PDF page: 169
9
169
Chapter 9
for all), and partially restored its deficit to 79-85% of the concentrations in WT mice (Figure
3B). Brain normetanephrine concentrations were higher in these 3 LNAA-supplemented
diets than those in PKU mice receiving the AIN-93M diet (p<0.01), and they no longer
differed from WT levels (p=0.360; Figure 3C). For brain dopamine, exclusively the Tyr+Trp
diet resulted in higher concentrations than those in PKU mice receiving the AIN-93M diet
(p<0.05; Figure 3A). Selective Leu+Ile or Thr supplementation as well as the high-protein
diet did not significantly change brain dopamine or norepinephrine concentrations.
Figure 2. Brain concentrations of A) phenylalanine, B) tyrosine, C) tryptophan, D) valine, E) isoleucine,
F) leucine, G) methionine, H) histidine, and I) threonine in WT and PKU mice after 6 wk of receiving
different diets. Numbers of mice are n=15 or n=16 for all treatment groups. Untransformed data are
expressed as means ± SEMs. * p<0.05; ** p<0.01; *** p<0.001 (2-sided) compared with PKU mice
receiving the AIN-93M diet unless otherwise indicated. Statistical analyses were performed in 2 steps:
1) each experimental group was individually compared with PKU mice receiving the AIN-93M diet by
using Student’s t tests and Bonferroni correction for multiple testing, and 2) all experimental groups
that were significantly different from PKU mice receiving the AIN-93M diet were compared by 1-factor
ANOVA and Tukey’s post hoc analysis. If data were not normally distributed (assessed by Shapiro-
Wilk test), or showed unequal variances (assessed by Levene’s test), analyses were performed on log-
transformed data. LNAA, large neutral amino acid; PKU, phenylketonuria; WT, wild-type
![Page 171: University of Groningen Phenylketonuria in mice and men ... · Phenylketonuria in mice and men Proefschrift ter verkrijging van de graad van doctor aan de Rijksuniversiteit Groningen](https://reader034.vdocuments.site/reader034/viewer/2022052611/5f03c1e37e708231d40a9ed0/html5/thumbnails/171.jpg)
512536-L-bw-Bruinenberg512536-L-bw-Bruinenberg512536-L-bw-Bruinenberg512536-L-bw-BruinenbergProcessed on: 15-8-2017Processed on: 15-8-2017Processed on: 15-8-2017Processed on: 15-8-2017 PDF page: 170PDF page: 170PDF page: 170PDF page: 170
170
Chapter 9
In the serotonergic pathway, brain serotonin and 5-HIAA concentrations in PKU mice
receiving the AIN-93M diet were 46% and 27%, respectively, of concentrations in WT mice
receiving the AIN-93M diet (p<0.001 for both; Figure 3D,E). The Tyr+Trp diet resulted in
higher brain serotonin and 5-HIAA concentrations than those in PKU mice receiving the
AIN-93M diet (p<0.001 for both) and partially restored their deficiencies to, respectively,
64% and 46% of the concentrations in WT mice. In mice receiving the LNAA(-Thr) and
LNAA(+Thr) diets, brain serotonin concentrations were further restored to 83%, and brain
5-HIAA concentrations were 71% and 65%, respectively, of WT concentrations (p<0.001
for all). Selective supplementation of Leu+Ile or Thr did not demonstrate a significant effect
on either brain serotonin or 5-HIAA concentrations if compared with PKU mice receiving
the AIN-93M diet (p=0.421 for Thr diet on 5-HIAA, and p=1.000 for other), whereas brain
5-HIAA concentrations were even lower in PKU mice receiving the high-protein diet than
the AIN-93M diet (p<0.001).
Figure 3. Brain concentrations of A) dopamine, B) norepinephrine, C) normetanephrine, D) serotonin,
and E) 5-hydroxyindoleacetic acid (5-HIAA) in WT and PKU mice after 6 wk of receiving different
diets. Numbers of mice are n=15 or n=16 for all treatment groups. Untransformed data are expressed
as means ± SEMs. * p<0.05; ** p<0.01; *** p<0.001 (2-sided) compared with PKU mice receiving
the AIN-93M diet unless otherwise indicated. Statistical analyses were performed in 2 steps: 1) each
experimental group was individually compared with PKU mice receiving the AIN-93M diet by using
Student’s t tests and Bonferroni correction for multiple testing, and 2) all experimental groups that were
significantly different from PKU mice receiving the AIN-93M diet were compared by 1-factor ANOVA
and Tukey’s post hoc analysis. If data were not normally distributed (assessed by Shapiro-Wilk test),
or showed unequal variances (assessed by Levene’s test), analyses were performed on log-transformed
data. LNAA, large neutral amino acid; PKU, phenylketonuria; WT, wild-type
![Page 172: University of Groningen Phenylketonuria in mice and men ... · Phenylketonuria in mice and men Proefschrift ter verkrijging van de graad van doctor aan de Rijksuniversiteit Groningen](https://reader034.vdocuments.site/reader034/viewer/2022052611/5f03c1e37e708231d40a9ed0/html5/thumbnails/172.jpg)
512536-L-bw-Bruinenberg512536-L-bw-Bruinenberg512536-L-bw-Bruinenberg512536-L-bw-BruinenbergProcessed on: 15-8-2017Processed on: 15-8-2017Processed on: 15-8-2017Processed on: 15-8-2017 PDF page: 171PDF page: 171PDF page: 171PDF page: 171
9
171
Chapter 9
3.5 Relation between brain monoaminergic neurotransmitters and brain amino acid
biochemistry
To further investigate the correlation between brain amino acid and monoamine
concentrations and the possible mechanism(s) by which LNAA supplementation in PKU
mice restored brain monoamine concentrations, linear regression analyses were performed.
Assessing the catecholamine pathway, multivariate linear regression analyses showed
that both brain dopamine and norepinephrine concentrations could be predicted by a
combination of brain Phe and Tyr concentrations (R2=0.127, p<0.001 for dopamine;
R2=0.563, p<0.001 for norepinephrine; Figure 4A,B), showing a negative correlation with
brain Phe concentrations and a positive correlation with brain Tyr concentrations. When
considering brain Phe and Tyr concentrations, genotype no longer demonstrated a significant
correlation (p=0.780 for dopamine; p=0.704 for norepinephrine). Moreover, no interaction
was observed between brain Phe and Tyr concentrations (p=0.319 for dopamine; p=0.263
for norepinephrine). In the serotonergic pathway, brain serotonin concentrations could be
predicted by brain Phe and Trp concentrations and genotype (R2=0.753, p<0.001; Figure
4C) without significant interactions between these variables. In this model, brain serotonin
concentrations were negatively correlated with brain Phe levels and positively correlated
with brain Trp concentrations. In addition, when corrected for both brain Phe and Trp
concentrations, brain serotonin concentrations in PKU mice were 0.49 nmol/g wet weight
lower than in WT mice.
Figure 4. Predicted compared with actual brain concentrations of A) dopamine, B) norepinephrine,
and C) serotonin in WT and PKU mice after 6 wk of receiving different diets. Lines of equality x=y are
added for comparative illustration. Numbers of mice are n=16 for WT and n=110 for PKU. To assess
which parameters of brain phenylalanine (Phe), tyrosine (Tyr), and tryptophan (Trp) concentrations
were correlated with brain monoaminergic neurotransmitter concentrations in PKU mice, multiple
linear regression analyses by use of backward selection were performed. Both brain dopamine and
norepinephrine concentrations could be predicted by a combination of brain Phe (negatively correlated)
and Tyr (positively correlated) concentrations (R2=0.127, p<0.001 for dopamine; R2=0.563, p<0.001
for norepinephrine), with no significant correlation with genotype and no significant interaction
between brain Phe and Tyr. Brain serotonin concentrations could be predicted by brain Phe (negatively
correlated) and Trp (positively correlated) concentrations as well as genotype (0.49 nmol/g wet weight
lower than in WT mice, when corrected for Phe and Trp) (R2=0.753, p<0.001) without significant
interactions between these parameters. PKU, phenylketonuria; WT, wild-type .
![Page 173: University of Groningen Phenylketonuria in mice and men ... · Phenylketonuria in mice and men Proefschrift ter verkrijging van de graad van doctor aan de Rijksuniversiteit Groningen](https://reader034.vdocuments.site/reader034/viewer/2022052611/5f03c1e37e708231d40a9ed0/html5/thumbnails/173.jpg)
512536-L-bw-Bruinenberg512536-L-bw-Bruinenberg512536-L-bw-Bruinenberg512536-L-bw-BruinenbergProcessed on: 15-8-2017Processed on: 15-8-2017Processed on: 15-8-2017Processed on: 15-8-2017 PDF page: 172PDF page: 172PDF page: 172PDF page: 172
172
Chapter 9
4. DISCUSSION
Our study compared different LNAA supplements with respect to all biochemical brain and
blood treatment objectives of LNAA treatment in PKU to provide further pathobiochemical
insight and identify novel therapeutic options. After comparison of the response of (brain)
biochemical impairments in PKU to different LNAA supplements, 5 main results were
identified: 1) plasma Phe reduction could be accomplished by high-dose supplementation
of all LNAAs (either with or without Thr) but not on selective supplementation of Leu+Ile,
Tyr+Trp, or Thr; 2) brain Phe concentrations were similarly reduced on supplementation
of all LNAAs (either with or without Thr) and on selective supplementation of Leu+Ile but
not Tyr+Trp or Thr; 3) brain non-Phe LNAA concentrations could be effectively restored
on supplementation, but were more impaired if they were not included in selective LNAA
supplements; and 4) brain monoaminergic neurotransmitter concentrations improved by
increasing precursor amino acids (Tyr+Trp diet) rather than by selectively reducing brain Phe
(Leu+Ile diet); the combination of both strategies [on LNAA(+Thr) and LNAA(-Thr) diets]
was most effective, especially for the serotonergic pathway.
Thus far, plasma Phe reduction has been the primary target of all of the treatment strategies
in PKU. Although LNAA supplementation in PKU is suggested to improve brain metabolism
primarily through its effect on the transport of Phe and other LNAAs at the BBB, it also
reduces plasma Phe concentrations24. In our study, plasma Phe concentrations in PKU mice
were 23% lower with LNAA supplementation including all LNAAs (either with or without
Thr) than they were in PKU mice receiving the AIN-93M diet. This finding is in accordance
with previous results obtained in PKU mice, showing that LNAA supplementation including
(nearly) all LNAAs could reduce plasma Phe concentrations to 47-67% of untreated
PKU controls21,22,25. Regarding the underlying mechanism, plasma Phe reduction has been
assumed to be the result of supplementation of Thr in particular. In contrast to the effect of
reduced plasma Phe concentrations on Thr supplementation (50 mg · kg-1 · d-1) in patients
with PKU23, we did not observe this effect in mice. In addition, both LNAA(-Thr) and
LNAA(+Thr) diets showed comparable effects on plasma Phe concentrations. The data
presented demonstrate that our previous hypothesis that plasma Phe reduction on LNAA
treatment is the result of increased net protein synthesis rather than competition at the
gut-blood barrier24,25 is unlikely. Body weight was comparable between dietary treatment
groups, and supplementation of Tyr (in the Tyr+Trp diet) –the most limiting plasma LNAA
in PKU– did not affect plasma Phe concentrations. Alternatively, it has been suggested that
plasma Phe reduction on LNAA supplementation is caused by competition of LNAAs with
Phe for transport across the gut-blood barrier11. The Leu+Ile diet, which showed a clear
competitive effect on Phe transport across the BBB, did not result in plasma Phe reduction in
this study. Thus, high-dose supplementation of all LNAAs (either with or without Thr) can
![Page 174: University of Groningen Phenylketonuria in mice and men ... · Phenylketonuria in mice and men Proefschrift ter verkrijging van de graad van doctor aan de Rijksuniversiteit Groningen](https://reader034.vdocuments.site/reader034/viewer/2022052611/5f03c1e37e708231d40a9ed0/html5/thumbnails/174.jpg)
512536-L-bw-Bruinenberg512536-L-bw-Bruinenberg512536-L-bw-Bruinenberg512536-L-bw-BruinenbergProcessed on: 15-8-2017Processed on: 15-8-2017Processed on: 15-8-2017Processed on: 15-8-2017 PDF page: 173PDF page: 173PDF page: 173PDF page: 173
9
173
Chapter 9
effectively reduce plasma Phe concentrations in PKU, but our data do not allow for definite
conclusions regarding the underlying mechanism(s).
A second aim of LNAA supplementation in PKU is to reduce brain Phe concentrations by
increasing the competition with Phe for transport across the BBB. In our study, brain Phe
concentrations were reduced by 24-29% in all experimental diets but not in Tyr+Trp and
Thr. The findings on LNAA(-Thr) and LNAA(+Thr) are in accordance with previous studies
on LNAA supplementation that used similar regimens with equal amounts of all non-
Phe LNAAs except for Thr in PKU mice25 and patients with PKU8. The fact that selective
Leu+Ile supplementation was especially effective in reducing brain Phe concentrations in
PKU mice confirms our hypothesis based on the high affinities of Leu and Ile to the large
neutral amino acid transporter 1 (LAT1) in the rat5. Moreover, this result provides further
biochemical support for the findings on cerebrospinal fluid biochemistry as well as improved
neuropsychological functioning and electroencephalogram activity on Val, Ile, and Leu
supplementation in patient with PKU13,14,29. The fact that brain Phe reduction on Leu+Ile
was not accompanied by reduced Phe concentrations in plasma further supports the notion
that brain Phe reduction on LNAA is at least in part the result of a direct effect at the BBB
level8,25. Thus, our results indicate that supplementation of LNAAs with a strong affinity
to the LAT1 transporter, such as Leu and Ile, is especially effective in reducing brain Phe
concentrations rather than reducing plasma Phe.
A less well considered treatment objective for LNAA supplementation in PKU includes
restoring brain non-Phe LNAA concentrations. The present study confirms our previous data
that supplementation of (nearly) all LNAAs improves brain non-Phe LNAA concentrations25.
On the one hand, inclusion of any specific LNAA in the LNAA-supplemented diet almost
invariably led to increased brain concentrations of that particular LNAA compared with
concentrations in the AIN-93M diet. On the other hand, supplementation (selective) of
LNAAs with a high affinity for the LAT1 transporter further impaired brain concentrations
of unsupplemented LNAAs. Leu+Ile supplementation further reduced brain His and Met
concentrations, and brain Thr concentrations were even lower in LNAA(-Thr) than in PKU
mice receiving the AIN-93M diet. Selective supplementation of LNAAs with a lower affinity
for LAT1, such as Tyr+Trp or Thr, did not impair brain concentrations of unsupplemented
LNAAs. These findings stress the importance of well-balanced LNAA supplements and the
need to evaluate the effects on brain concentrations of all LNAAs, especially if supplements
include LNAAs that are known to have a strong affinity for LAT1.
Finally, LNAA supplementation aims to improve brain monoaminergic neurotransmitter
concentrations in PKU, which are thought to be impaired because of insufficient brain
availability of Tyr and Trp, or because of high brain Phe concentrations inhibiting the activity
of Tyr and Trp hydroxylases24. To our knowledge, our study is the first to directly compare
![Page 175: University of Groningen Phenylketonuria in mice and men ... · Phenylketonuria in mice and men Proefschrift ter verkrijging van de graad van doctor aan de Rijksuniversiteit Groningen](https://reader034.vdocuments.site/reader034/viewer/2022052611/5f03c1e37e708231d40a9ed0/html5/thumbnails/175.jpg)
512536-L-bw-Bruinenberg512536-L-bw-Bruinenberg512536-L-bw-Bruinenberg512536-L-bw-BruinenbergProcessed on: 15-8-2017Processed on: 15-8-2017Processed on: 15-8-2017Processed on: 15-8-2017 PDF page: 174PDF page: 174PDF page: 174PDF page: 174
174
Chapter 9
the effects of 1) increased brain Tyr and Trp availability, 2) reduced brain Phe concentrations,
and 3) the combination of both on brain monoamine concentrations in PKU mice. Effects
were most prominent for brain norepinephrine and serotonin rather than dopamine
concentrations, which is consistent with several studies in PKU mice and measurements in
cerebrospinal fluid of patients with PKU25, 30-32. Selective Tyr+Trp supplementation, including
24.8 and 12.4 mg/kg diets of additional Tyr and Trp, ameliorated both brain norepinephrine
and serotonin concentrations, whereas no such effects were observed for Leu+Ile. Both
LNAA(-Thr)- and LNAA(+Thr)-supplemented diets were even more effective than Tyr+Trp
in improving brain serotonin concentrations, and were similarly effective as Tyr+Trp in
improving brain norepinephrine concentrations. On the one hand, these results imply that
both insufficient brain Tyr and Trp availability and increased brain Phe concentrations
contribute to the brain monoamine impairments in PKU, but on the other hand, again imply
that the relative contribution of both mechanisms is different for the dopaminergic and
serotoninergic pathways25. Clearly, increasing cerebral Leu did decrease cerebral Phe, but
did not increase serotonin, suggesting that a decrease of cerebral Phe was not important
enough or the increase of Leu counteracted this effect. In addition, the requirement for Tyr
supplementation seems higher than it is for Trp supplementation. Taken together, brain
monoamine concentrations could be improved by increasing precursor amino acids rather
than by selectively reducing brain Phe concentrations. The combination of both strategies
through supplementation of all LNAAs was the most effective approach, especially for the
serotonergic pathway.
In conclusion, the present study compared different LNAA supplements with respect to all
brain and blood biochemical treatment objectives of LNAA treatment in PKU to provide
more pathobiochemical insight and identify novel therapeutic options. Our results show
that targeted LNAA supplements can influence specific brain biochemical features in PKU
and thereby suggest a valuable new opportunity to further elucidate the relative importance
of the different brain biochemical disturbances in PKU brain dysfunction. Our results also
provide essential knowledge for the development of the optimal LNAA treatment of patients
with PKU.
ACKNOWLEDGEMENTS
The authors express their gratitude to Mrs. H.A. Kingma, Mrs. E.Z. Jonkers, Mrs. K. Boer,
and Mrs. H. Adema for their analytical support, and to Dr. E.H. Schölvinck for English
editing of the manuscript. Also, we are grateful to Nutricia Research for providing the
experimental diets.
DvV, EAvdZ, and FJvS designed the research; DvV, VMB, and PNM conducted the animal
experiment; DvV, HJRvF, PdB, IPK, and MRHF were responsible for biochemical analyses;
![Page 176: University of Groningen Phenylketonuria in mice and men ... · Phenylketonuria in mice and men Proefschrift ter verkrijging van de graad van doctor aan de Rijksuniversiteit Groningen](https://reader034.vdocuments.site/reader034/viewer/2022052611/5f03c1e37e708231d40a9ed0/html5/thumbnails/176.jpg)
512536-L-bw-Bruinenberg512536-L-bw-Bruinenberg512536-L-bw-Bruinenberg512536-L-bw-BruinenbergProcessed on: 15-8-2017Processed on: 15-8-2017Processed on: 15-8-2017Processed on: 15-8-2017 PDF page: 175PDF page: 175PDF page: 175PDF page: 175
9
175
Chapter 9
TP and SPA provided essential material; DvV analyzed data; DvV, EAvdZ, and FJvS wrote
the paper; DvV had primary responsibility for the final content. All authors read and
approved the final manuscript.
COMPETING INTERESTS
EAvdZ has received advisory board fees from Arla Foods. FJvS has received research grants,
advisory board fees, and speaker’s honoraria from Merck Serono and Nutricia Research, has
received speaker’s honoraria from Vitaflo, and has received advisory board fees from Arla
Foods. All other authors have declared not to have conflicts of interest. All authors have read
the journal’s policy on disclosure of potential conflicts of interest.
This research was funded by a grant from the National PKU Alliance (USA). Experimental
diets were provided by Nutricia Research.
![Page 177: University of Groningen Phenylketonuria in mice and men ... · Phenylketonuria in mice and men Proefschrift ter verkrijging van de graad van doctor aan de Rijksuniversiteit Groningen](https://reader034.vdocuments.site/reader034/viewer/2022052611/5f03c1e37e708231d40a9ed0/html5/thumbnails/177.jpg)
512536-L-bw-Bruinenberg512536-L-bw-Bruinenberg512536-L-bw-Bruinenberg512536-L-bw-BruinenbergProcessed on: 15-8-2017Processed on: 15-8-2017Processed on: 15-8-2017Processed on: 15-8-2017 PDF page: 176PDF page: 176PDF page: 176PDF page: 176
176
Chapter 9
5. REFERENCES
1. Blau N, van Spronsen FJ, Levy HL.
Phenylketonuria. Lancet 2010;376:1417-27.
2. Jahja R, Huijbregts SC, de Sonneville
LM, van der Meere JJ, van Spronsen
FJ. Neurocognitive evidence for
revision of treatment targets and
guidelines for phenylketonuria. J Pediatr
2014;164:895,899.e2.
3. Smith I, Knowles J. Behaviour in early
treated phenylketonuria: a systematic review.
Eur J Pediatr 2000;159 Suppl 2:S89-93.
4. Walter JH, White FJ, Hall SK, MacDonald
A, Rylance G, Boneh A, Francis DE,
Shortland GJ, Schmidt M, Vail A. How
practical are recommendations for dietary
control in phenylketonuria? Lancet
2002;360:55-7.
5. Smith QR. Transport of glutamate and
other amino acids at the blood-brain barrier.
J Nutr 2000;130:1016S-22S.
6. van Spronsen FJ, Hoeksma M, Reijngoud
DJ. Brain dysfunction in phenylketonuria:
is phenylalanine toxicity the only possible
cause? J Inherit Metab Dis 2009;32:46-51.
7. Hoeksma M, Reijngoud DJ, Pruim J, de
Valk HW, Paans AM, van Spronsen FJ.
Phenylketonuria: High plasma phenylalanine
decreases cerebral protein synthesis. Mol
Genet Metab 2009;96:177-82.
8. Pietz J, Kreis R, Rupp A, Mayatepek E,
Rating D, Boesch C, Bremer HJ. Large
neutral amino acids block phenylalanine
transport into brain tissue in patients
with phenylketonuria. J Clin Invest
1999;103:1169-78.
9. Schindeler S, Ghosh-Jerath S, Thompson
S, Rocca A, Joy P, Kemp A, Rae C, Green
K, Wilcken B, Christodoulou J. The effects
of large neutral amino acid supplements
in PKU: an MRS and neuropsychological
study. Mol Genet Metab 2007;91:48-54.
10. Koch R, Moseley KD, Yano S, Nelson
M,Jr, Moats RA. Large neutral amino acid
therapy and phenylketonuria: a promising
approach to treatment. Mol Genet Metab
2003;79:110-3.
11. Matalon R, Michals-Matalon K, Bhatia
G, Burlina AB, Burlina AP, Braga C, Fiori
L, Giovannini M, Grechanina E, Novikov
P, et al. Double blind placebo control trial
of large neutral amino acids in treatment
of PKU: effect on blood phenylalanine. J
Inherit Metab Dis 2007;30:153-8.
12. Moats RA, Moseley KD, Koch R, Nelson
M,Jr. Brain phenylalanine concentrations in
phenylketonuria: research and treatment of
adults. Pediatrics 2003;112:1575-9.
13. Berry HK, Brunner RL, Hunt MM, White
PP. Valine, isoleucine, and leucine. A new
treatment for phenylketonuria. Am J Dis
Child 1990;144:539-43.
14. Jordan MK, Brunner RL, Hunt MM,
Berry HK. Preliminary support for the oral
administration of valine, isoleucine and
leucine for phenylketonuria. Dev Med Child
Neurol 1985;27:33-9.
15. Batshaw ML, Valle D, Bessman SP.
Unsuccessful treatment of phenylketonuria
with tyrosine. J Pediatr 1981;99:159-60.
16. Lou H. Large doses of tryptophan and
tyrosine as potential therapeutic alternative
to dietary phenylalanine restriction in
phenylketonuria. Lancet 1985;2:150-1.
17. Lou HC, Lykkelund C, Gerdes AM,
Udesen H, Bruhn P. Increased vigilance
and dopamine synthesis by large doses
of tyrosine or phenylalanine restriction
in phenylketonuria. Acta Paediatr Scand
1987;76:560-5.
![Page 178: University of Groningen Phenylketonuria in mice and men ... · Phenylketonuria in mice and men Proefschrift ter verkrijging van de graad van doctor aan de Rijksuniversiteit Groningen](https://reader034.vdocuments.site/reader034/viewer/2022052611/5f03c1e37e708231d40a9ed0/html5/thumbnails/178.jpg)
512536-L-bw-Bruinenberg512536-L-bw-Bruinenberg512536-L-bw-Bruinenberg512536-L-bw-BruinenbergProcessed on: 15-8-2017Processed on: 15-8-2017Processed on: 15-8-2017Processed on: 15-8-2017 PDF page: 177PDF page: 177PDF page: 177PDF page: 177
9
177
Chapter 9
18. Mazzocco MM, Yannicelli S, Nord AM,
van Doorninck W, Davidson-Mundt
AJ, Greene CL. Cognition and tyrosine
supplementation among school-aged
children with phenylketonuria. Am J Dis
Child 1992;146:1261-4.
19. Pietz J, Landwehr R, Kutscha A, Schmidt
H, de Sonneville L, Trefz FK. Effect of high-
dose tyrosine supplementation on brain
function in adults with phenylketonuria. J
Pediatr 1995;127:936-43.
20. Lines D, Magarey A, Raymond J,
Robertson E. Tyrosine supplementation in
phenylketonuria. J Paediatr Child Health
1997;33:177.
21. Matalon R, Surendran S, Matalon KM,
Tyring S, Quast M, Jinga W, Ezell E, Szucs
S. Future role of large neutral amino acids
in transport of phenylalanine into the brain.
Pediatrics 2003;112:1570-4.
22. Matalon R, Michals-Matalon K, Bhatia
G, Grechanina E, Novikov P, McDonald
JD, Grady J, Tyring SK, Guttler F. Large
neutral amino acids in the treatment of
phenylketonuria (PKU). J Inherit Metab Dis
2006;29:732-8.
23. Sanjurjo P, Aldamiz L, Georgi G, Jelinek J,
Ruiz JI, Boehm G. Dietary threonine reduces
plasma phenylalanine levels in patients
with hyperphenylalaninemia. J Pediatr
Gastroenterol Nutr 2003;36:23-6.
24. van Spronsen FJ, de Groot MJ, Hoeksma
M, Reijngoud DJ, van Rijn M. Large neutral
amino acids in the treatment of PKU: from
theory to practice. J Inherit Metab Dis
2010;33:671-6.
25. van Vliet D, Bruinenberg VM, Mazzola
PN, van Faassen MH, de Blaauw P, Kema
IP, Heiner-Fokkema MR, van Anholt RD,
van der Zee EA, van Spronsen FJ. Large
Neutral Amino Acid Supplementation
Exerts Its Effect through Three Synergistic
Mechanisms: Proof of Principle in
Phenylketonuria Mice. PLoS One
2015;10:e0143833.
26. Martynyuk AE, van Spronsen FJ, Van
der Zee EA. Animal models of brain
dysfunction in phenylketonuria. Mol Genet
Metab 2010;99 Suppl 1:S100-5.
27. Reeves PG, Nielsen FH, Fahey GC,Jr. AIN-
93 purified diets for laboratory rodents:
final report of the American Institute of
Nutrition ad hoc writing committee on the
reformulation of the AIN-76A rodent diet. J
Nutr 1993;123:1939-51.
28. Hargreaves KM, Pardridge WM. Neutral
amino acid transport at the human blood-
brain barrier. J Biol Chem 1988;263:19392-7.
29. Berry HK, Bofinger MK, Hunt MM,
Phillips PJ, Guilfoile MB. Reduction of
cerebrospinal fluid phenylalanine after oral
administration of valine, isoleucine, and
leucine. Pediatr Res 1982;16:751-5.
30. Harding CO, Winn SR, Gibson KM, Arning
E, Bottiglieri T, Grompe M. Pharmacologic
inhibition of L-tyrosine degradation
ameliorates cerebral dopamine deficiency
in murine phenylketonuria (PKU). J Inherit
Metab Dis 2014;
31. Pascucci T, Giacovazzo G, Andolina D,
Accoto A, Fiori E, Ventura R, Orsini
C, Conversi D, Carducci C, Leuzzi V,
et al. Behavioral and neurochemical
characterization of new mouse model
of hyperphenylalaninemia. PLoS One
2013;8:e84697.
32. Burlina AB, Bonafe L, Ferrari V, Suppiej
A, Zacchello F, Burlina AP. Measurement
of neurotransmitter metabolites in the
cerebrospinal fluid of phenylketonuric
patients under dietary treatment. J Inherit
Metab Dis 2000;23:313-6.
![Page 179: University of Groningen Phenylketonuria in mice and men ... · Phenylketonuria in mice and men Proefschrift ter verkrijging van de graad van doctor aan de Rijksuniversiteit Groningen](https://reader034.vdocuments.site/reader034/viewer/2022052611/5f03c1e37e708231d40a9ed0/html5/thumbnails/179.jpg)
512536-L-bw-Bruinenberg512536-L-bw-Bruinenberg512536-L-bw-Bruinenberg512536-L-bw-BruinenbergProcessed on: 15-8-2017Processed on: 15-8-2017Processed on: 15-8-2017Processed on: 15-8-2017 PDF page: 178PDF page: 178PDF page: 178PDF page: 178
![Page 180: University of Groningen Phenylketonuria in mice and men ... · Phenylketonuria in mice and men Proefschrift ter verkrijging van de graad van doctor aan de Rijksuniversiteit Groningen](https://reader034.vdocuments.site/reader034/viewer/2022052611/5f03c1e37e708231d40a9ed0/html5/thumbnails/180.jpg)
512536-L-bw-Bruinenberg512536-L-bw-Bruinenberg512536-L-bw-Bruinenberg512536-L-bw-BruinenbergProcessed on: 15-8-2017Processed on: 15-8-2017Processed on: 15-8-2017Processed on: 15-8-2017 PDF page: 179PDF page: 179PDF page: 179PDF page: 179
CHAPTER 10Summary and general conclusion
![Page 181: University of Groningen Phenylketonuria in mice and men ... · Phenylketonuria in mice and men Proefschrift ter verkrijging van de graad van doctor aan de Rijksuniversiteit Groningen](https://reader034.vdocuments.site/reader034/viewer/2022052611/5f03c1e37e708231d40a9ed0/html5/thumbnails/181.jpg)
512536-L-bw-Bruinenberg512536-L-bw-Bruinenberg512536-L-bw-Bruinenberg512536-L-bw-BruinenbergProcessed on: 15-8-2017Processed on: 15-8-2017Processed on: 15-8-2017Processed on: 15-8-2017 PDF page: 180PDF page: 180PDF page: 180PDF page: 180
180
Chapter 10
1. SUMMARY AND INTEGRATION OF RESULTS
The main findings of the experimental chapters of this thesis are: Chapter 2: Distinct
differences are found between the genetic background of the PKU mouse model despite similar
biochemical phenotype. Chapter 3: In contrast to the findings of chapter 2, the PKU females
of both strains show similar behavioral outcome. Chapter 4: Sleep problems are present in
PKU mice and patients. Chapter 6: A specific nutrient combination (SNC) can improve a post-
synaptic marker in specific subregions of the hippocampus. Chapter 7: SNC supplementation
improves the outcome in novel object recognition (NOR) despite high Phe concentrations in
the food. Chapter 8: Equal amounts of non-Phe large neutral amino acids (LNAA’s) (except
for Threonine) can reduce brain Phe concentrations, improve the concentrations of some of
the non-Phe LNAA’s, and improve brain levels of serotonin and norepinephrine. Chapter
9: Tailoring the LNAA composition to reduced Phe, improve brain non-Phe LNAA’s and
neurotransmitter concentration, showed that improvements of these three biochemical aims
were not always accompanied with a reduction of Phe in plasma. Overall, these experimental
chapters emphasize that increased Phe concentrations in plasma, currently the gold standard
in the clinic, is not the sole predictor of the phenotypical outcome of PKU.
Below these results will be discussed in more depth by highlighting the importance to the
PKU research field and integrating these results with findings in current literature. This is
followed by future perspectives taking the studies of this dissertation as a starting point for
future research.
The translational value of the PKU mouse model
The translational value of a model in general implies a benefit for the modeled situation.
However, the true benefit is not always exact. A benefit could be a better understanding
of the disease or developing a new treatment strategy. Yet, in the end, the model is only
beneficial when results can be extrapolated or translated to the modeled condition. One of
the models used in preclinical phenylketonuria (PKU) research, is the PKU mouse model.
PKU mice have a mutation in both copies of the phenylalanine hydroxylase (PAH) gene
(homozygous) causing a functional deficit, comparable to PKU patients. The mutation is bred
in the black and tan, brachyury (BTBR) mouse and the C57Bl/6J (B6) mouse. In chapter 2,
we show distinct differences in the behavioral outcome between these strains, most striking
in learning and memory. These differences cannot be attributed to biochemical differences
in Phe concentrations or neurotransmitter concentrations of norepinephrine and serotonin
while these show a clear PKU phenotype in both genetic backgrounds. In chapter 3, we
illustrate that the phenotypical outcome of PKU mice is not only different between genetic
background but also between males and females. It is demonstrated that B6 female mice
show deficits in learning and memory in contrast to the male counterparts. This suggests that
the consequence of the PAH mutation is influenced by the sex and genetic background of
![Page 182: University of Groningen Phenylketonuria in mice and men ... · Phenylketonuria in mice and men Proefschrift ter verkrijging van de graad van doctor aan de Rijksuniversiteit Groningen](https://reader034.vdocuments.site/reader034/viewer/2022052611/5f03c1e37e708231d40a9ed0/html5/thumbnails/182.jpg)
512536-L-bw-Bruinenberg512536-L-bw-Bruinenberg512536-L-bw-Bruinenberg512536-L-bw-BruinenbergProcessed on: 15-8-2017Processed on: 15-8-2017Processed on: 15-8-2017Processed on: 15-8-2017 PDF page: 181PDF page: 181PDF page: 181PDF page: 181
10
181
Chapter 10
mice. If the preclinical results can be extrapolated to the clinical situation, one would expect
difference in the manifestation of PKU in PKU patients.
Are there individual differences found in the manifestation of PKU in patients?
Even though reports are sparse, some studies describe PKU patients that escaped the severe
cognitive deficits despite high Phe concentrations (Table. 1). Although diagnosis and inclusion
criteria of these atypical PKU patients can differ slightly, Table 1 lists eight families that all
escaped severe cognitive deficits. This suggests a genetic influence. The predicted association
between genotype and atypical phenotype was investigated by Ramus and colleguas1,2.
They showed that PAH activity, based on genotype, could not fully explain the atypical
phenotype as untreated siblings with the same PAH genotype could show remarkable
differences in cognitive outcome2. This was also suggested by the reports described in Table
1, the third and the fourth subgroup. Here, studies where listed that showed differences
in PKU outcome among siblings. Ramus et al. further investigated other modifying genes
influencing phenotypical outcome. However, the examination of polymorphisms in tyrosine
hydroxylase or markers closely linked to the PAH gene yielded no possible candidates. As
the point mutation, and so the predicted PAH activity of the two genetic background, is
the same, the two genetic backgrounds of the PKU mouse model could help facilitate the
research in these modifying genes.
In the PKU mice studies we found that genetic background and sex of the mice could
influence the phenotypical outcome. In PKU research, studies concerning gender differences
are limited3–15. Despite these limited reports, indications of sex differences are reported.
First, in Table 1, 25 atypical female and 17 atypical male PKU are described. This skewed
distribution is in contrast to our findings in B6 PKU mice where females are thought to be
more affected in the cognitive domain than males. However, the larger number of reports
in females could be an artifact of the identification process of atypical PKU patients. The
atypical PKU patients are often identified when their siblings have typical PKU or when
children of atypical PKU patients show mental disabilities, typical PKU or PKU identified
with via newborn screening. Atypical PKU mothers will have a higher change to be
identified via this later route, as even non-PKU children can be affected in utero by the high
concentrations of Phe of the mother (maternal PKU). This differs from atypical PKU fathers,
where healthy children can be born when the child has a healthy mother. Second, in Table 1 a
separation was made between genders of the affected siblings of atypical PKU patients. Eight
reports discussed affected sisters, in the face of four brothers. However, this distribution is
not statistically different (c2(1,N=13)=1.17,p=0.281). The outcome could be influenced by
the selecting parameter, IQ, as other behavioral disturbances could be present in atypical
1All statistical analysis was performed in IBM SPSS Statistics for Windows, Version 22.0 (Armonk, NY:
IBM Corp.)
![Page 183: University of Groningen Phenylketonuria in mice and men ... · Phenylketonuria in mice and men Proefschrift ter verkrijging van de graad van doctor aan de Rijksuniversiteit Groningen](https://reader034.vdocuments.site/reader034/viewer/2022052611/5f03c1e37e708231d40a9ed0/html5/thumbnails/183.jpg)
512536-L-bw-Bruinenberg512536-L-bw-Bruinenberg512536-L-bw-Bruinenberg512536-L-bw-BruinenbergProcessed on: 15-8-2017Processed on: 15-8-2017Processed on: 15-8-2017Processed on: 15-8-2017 PDF page: 182PDF page: 182PDF page: 182PDF page: 182
182
Chapter 10
PKU patients despite normal IQ (Hsia et al. 1970). Finally, indeed, in studies concerning
treated PKU patients, sex differences are observed in the pathophysiology of PKU such
as differences in the occurrence of psychiatric disorders, visual attention, dietary control,
quality of life, and personality10,11,13,15–17. Together, these studies highlight that genetic factors
and sex can influence the outcome of PKU.
1.1.2 Considerations of the PKU mouse model
The PKU mouse model has clear similarities with the modeled situation; 1) PKU mice have
a point mutation in the PAH gene, 2) the mutation causes Phe concentration to rise in blood
and brain, 3) biochemical consequences in amino acids and neurotransmitter concentration
are similar to PKU patients, 4) cognitive deficits are found in BTBR PKU mice, 5) B6 PKU
mice might resemble atypical PKU patients in the cognitive domain, and 6) problems in sleep
are found in PKU mice and patients (Chapter 4). Utilizing the model to its full potential is
not only identifying the strengths, but also considering the limitations. First, the original
PKU mouse model was described in the black and tan, brachyury (BTBR) strain18. This
strain of mice are commonly used in N-nitrosoN-ethylurea (ENU) genetic screens because
of the relative high forward mutation rates after a single dose of the mutagen in these mice
compared to, for example, the B6 mouse18,19. Yet, the BTBR wild-type (WT) mice show
abnormalities in brain morphology and behavior20–25. Therefore, the BTBR PKU mouse
model was crossed back on the B6 background. The question that arises is: Why are both
genetic backgrounds still used in preclinical PKU research as these abnormalities are known
in the BTRB background? Without underestimating the influence of these abnormalities on
the PKU phenotype in BTBR, only BTBR PKU mice consistently mimics the typical PKU
patients in behavioral outcome. Therefore, when behavioral outcome is included in the
outcome parameters, the BTBR background of the PKU mouse model is preferred. Secondly,
there are limitations in the behaviors mice can express and, therefore, model. For instance, in
early-treated PKU patients deficits are still found in working memory, executive functioning
and personality26,27. Although specific behavioral paradigms are designed to investigate
these cognitive functions, they are often dependent on the definition used and measure only
certain components of the behavior. Finally, newborn screening makes it possible to identify
PKU patients’ early-in-life and start Phe-restricted as soon as possible. One could question,
what “type” of PKU patient the PKU mouse model is a model for in the future. When this
is the early-treated PKU patient, practical problems could appear as intervening in the first
21-28 days of the pups is very difficult.
To conclude, the PKU mouse models the PKU patients adequately. If the use of either one
is a conscious decision, the BTBR PKU and the B6 PKU mice have their translational value
for studying PKU.
![Page 184: University of Groningen Phenylketonuria in mice and men ... · Phenylketonuria in mice and men Proefschrift ter verkrijging van de graad van doctor aan de Rijksuniversiteit Groningen](https://reader034.vdocuments.site/reader034/viewer/2022052611/5f03c1e37e708231d40a9ed0/html5/thumbnails/184.jpg)
512536-L-bw-Bruinenberg512536-L-bw-Bruinenberg512536-L-bw-Bruinenberg512536-L-bw-BruinenbergProcessed on: 15-8-2017Processed on: 15-8-2017Processed on: 15-8-2017Processed on: 15-8-2017 PDF page: 183PDF page: 183PDF page: 183PDF page: 183
10
183
Chapter 10
Table 1 Case reports of atypical PKU patients. Reports were included when the gender of the PKU
patients and PKU siblings were stated. First two columns show author and date. The third column
depict the males (M) and females (F) with normal or borderline intelligence (IQ>70). When more than 1
individual is depicted in this column, the patients were siblings. The categorization of the fourth column
is described at the bottom of the table. The dotted line distinguishes between four subgroups. The first
group consist of single cases atypical PKU patients without siblings (with PKU) or siblings are not
reported. The second subgroup, consists of atypical PKU patients related to each other without (more)
siblings or typical PKU siblings. The third subgroup, consist of atypical PKU patients with a typical PKU
brother. The final subgroup, consist of atypical PKU patients with a typical PKU sister.
Authors Date Siblings Other SiblingsAllen 1961 1M A
Coates 1957 1M A
Dyken and Culley (Case 4) 1969 1M A
Frankenburg (Case B) 1968 1F A
Hsia (Yannet) 1957 1M A
Perry 1966 1F A
Fisch 1966 1F A
Leonard 1959 1F B
Partington 1962 1F B
Woolf (Case 1-2) 1961 2F A
Colombo 1971 1M; 1F B
Dyken and Culley (Case 1-3) 1969 2M; 1F B
Frankenburg (Case C) 1968 2M; 1F B
Hsia 1968 2F B
Koch 2000 2M B
Perry 1973 1M;3F B
Zinger 1963 2F B
Blainey 1956 1F C
Kasim 2001 1F C
Perry (Case 1-2) 1970 1M C
Stevenson 1967 2F C
Brugger 1942 1M D
Coffelt 1964 1F D
Hsia 1957 1F D
Hsia (Yannet) 1957 1F D
Jervis 1954 1M D
Knox 1960 1M D
Mabry 1963 1F D
Tapia 1961 1M D
Total 17M;25F
A not certain or not reported
B no siblings (with PKU)
C typical PKU brother
D typical PKU sister
![Page 185: University of Groningen Phenylketonuria in mice and men ... · Phenylketonuria in mice and men Proefschrift ter verkrijging van de graad van doctor aan de Rijksuniversiteit Groningen](https://reader034.vdocuments.site/reader034/viewer/2022052611/5f03c1e37e708231d40a9ed0/html5/thumbnails/185.jpg)
512536-L-bw-Bruinenberg512536-L-bw-Bruinenberg512536-L-bw-Bruinenberg512536-L-bw-BruinenbergProcessed on: 15-8-2017Processed on: 15-8-2017Processed on: 15-8-2017Processed on: 15-8-2017 PDF page: 184PDF page: 184PDF page: 184PDF page: 184
184
Chapter 10
New treatment strategies in PKU
1.2.1 Specific nutrient combination
A specific nutrient combination (SNC) comprised of uridine monophosphate (UMP),
docosahexaenoic acid (DHA), eicosapentaenoic acid (EPA), choline, phospholipids, folic
acid, vitamins B12, B6, C, and E, and selenium was investigated for the first time as new
(additional) treatment strategy for PKU. In the first proof-of-concept study, described in
chapter 6, male and female B6 WT and PKU mice were offered a diet supplemented with
SNC for post-natal day (PND) 31 up to PND 115. After this period, a positive effect of
SNC supplementation was found in the post-synaptic marker, postsynaptic density protein
95 (PSD-95), in specific sub-regions of the hippocampus. As this protein is associated with
growth and functioning of dendritic spines28,29, the SNC supplementation is hypothesized to
restore the affected synaptic function in PKU mice. The possible improvement in synaptic
functioning could implicate an improvement in functional outcome. Therefore, in chapter
7, we investigated the behavioral outcome of SNC supplementation in the BTBR WT and
PKU mice (male and female). In this long-term intervention study, we show that SNC
supplementation can improve novel object recognition memory in high Phe and low Phe
conditions. These two studies show that a nutrient combination that specifically targets
consequences of Phe in the brain can improve functional outcome despite the high Phe
concentrations in blood and brain and possibly other PKU-related biochemical disturbances.
This is a novel view on treatment in PKU. Current treatment and research into new
treatment strategies focusses on the biochemical outcome of the treatment, for example
reducing Phe concentrations. Therefore, these two chapters highlight that (new) treatment
strategies, perhaps, do not need to be exclusively confined to the original idea of reducing
Phe concentrations. Identifying the mode of action of the SNC could help pinpoint the
critical (biochemical) parameter(s) or brain networks involved in the functional outcome
of PKU. One treatment that also moves beyond the idea of reducing Phe concentrations, is
LNAA treatment.
1.2.2. LNAA
The concept of treating PKU with LNAA supplementation is not a new approach to PKU30–
38. However, despite this research, the optimal composition of the LNAA treatment is not
yet identified. In addition, the integration of mulptiple biochemical treatment objectives is
lacking (for example (1) reducing brain Phe concentrations, (2) improve protein synthesis
by restoring brain non-Phe LNAA concentrations, and (3) improve monoaminergic
neurotransmitter synthesis by increasing amino acid precursors)38. In chapter 8, LNAA
treatment of equal amounts of the LNAA’s tyrosine, tryptophan, valine, isoleucine, leucine,
methionine, and histidine (based on Pietz et al. 1999) was added to the diet of B6 WT
and PKU mice (both sexes). This study showed that such a regime can reduce brain Phe
concentrations, improve the concentrations of some of the non-Phe LNAA’s, and improve
brain levels of serotonin and norepinephrine. In chapter 9, the composition of the LNAA
![Page 186: University of Groningen Phenylketonuria in mice and men ... · Phenylketonuria in mice and men Proefschrift ter verkrijging van de graad van doctor aan de Rijksuniversiteit Groningen](https://reader034.vdocuments.site/reader034/viewer/2022052611/5f03c1e37e708231d40a9ed0/html5/thumbnails/186.jpg)
512536-L-bw-Bruinenberg512536-L-bw-Bruinenberg512536-L-bw-Bruinenberg512536-L-bw-BruinenbergProcessed on: 15-8-2017Processed on: 15-8-2017Processed on: 15-8-2017Processed on: 15-8-2017 PDF page: 185PDF page: 185PDF page: 185PDF page: 185
10
185
Chapter 10
regime was refined and tailored to the three biochemical aims. This resulted in five specific
LNAA regimes that were offered to B6 PKU (both sexes) mice for six weeks and compared
to a normal diet in WT and PKU mice and a high-protein control diet in PKU mice. The
outcome for the three biochemical aims were: First, brain Phe concentrations could be
reduced by LNAA treatment with or without threonine and with supplementation of solely
leucine and isoleucine. Secondly, non-Phe LNAA concentrations could be restored if they
were added to the supplementation. When they were not added to the regime, they were
more impaired. Finally, monoaminergic neurotransmitter concentrations were improved
when the precursors (tyrosine+ tryptophan) were added and with both LNAA treatments
(with or without threonine). The improvements found for all three biochemical aims was
not always accompanied with reduced Phe concentrations in plasma. Again, these studies
highlight that the blood Phe concentrations alone, as currently used clinically, is not always
indicative of the detrimental effects in the brain. Therefore, it is of importance to evaluate
the consequence for all three biochemical aims, in future LNAA studies but also other PKU
research. Although we recognize that investigating all three biochemical aims in PKU patient
can be challenging. For example, non-invasive methods of measuring neurotransmitter
concentrations repeatedly in the brain are currently not at hand. Finally, for the LNAA
studies, we can conclude that the balance between all components of the LNAA’s is of great
importance.
2. FUTURE PERSPECTIVES
2.1. Future perspective I: the PKU mouse model
2.1.1. Can a physiological challenge influence the BTBR and B6 differently?
In Chapter 2, we show that male B6 mice are able to master the learning and memory
paradigms despite similar biochemical changes in blood and brain. Therefore, we hypothesize
in the discussion of that chapter that the biochemical changes could affect the B6 PKU
differently than BTBR PKU during the neurodevelopment and adult life. In the discussion of
this chapter, we make the assumption that the PKU-related biochemical differences are not
influenced by the physiological challenge of the forced swim test two hours before sacrifice.
However, it is possible that the physiological challenge (e.g. the massive release of stress
hormones) elicits or masks changes of the naïve state that, in the end, could mask possible
differences between the genetic strains. To explore this hypothesis, home-cage controls
(age-matched, sex-matched, and housed under the same conditions) were compared to the
tested BTBR WT, BTBR PKU, B6 WT, and B6 PKU of Chapter 2. Statistical analysis with
multivariate ANOVA (factors; genetic background (BTBR/B6), state (naïve/tested), and
genotype (WT/PKU)), was performed on amino acid concentrations in blood and brain and
neurotransmitter concentrations in brain (Figure 1-3).
![Page 187: University of Groningen Phenylketonuria in mice and men ... · Phenylketonuria in mice and men Proefschrift ter verkrijging van de graad van doctor aan de Rijksuniversiteit Groningen](https://reader034.vdocuments.site/reader034/viewer/2022052611/5f03c1e37e708231d40a9ed0/html5/thumbnails/187.jpg)
512536-L-bw-Bruinenberg512536-L-bw-Bruinenberg512536-L-bw-Bruinenberg512536-L-bw-BruinenbergProcessed on: 15-8-2017Processed on: 15-8-2017Processed on: 15-8-2017Processed on: 15-8-2017 PDF page: 186PDF page: 186PDF page: 186PDF page: 186
186
Chapter 10
Figure 1 Amino acids in plasma of both genetic backgrounds. Except for Phenylalanine (Phe:
F(1,45)=1.038 p=0.315), in interaction effect between genotype was found for all LNAA’s (Tyrosine:
F(1,45)=4.542 p<0.05, Valine: F(1,45)=10.814 p<0.05, Leucine: F(1,45)=10.304 p<0.05, Histidine:
F(1,45)=4.360 p<0.05, Threonine: F(1,45)=11.369 p<0.05, and Isoleucine: F(1,45)=8.861 p<0.05).
Furthermore, an interaction effect of genetic background and genotype was observed for all LNAA’s
(Phe: F(1,45)=29.256 p<0.05, Tyrosine: F(1,45)=12.044 p<0.05,Valine: F(45,1)=10.221 p<0.05,
Leucine: F(1,45)=9.005 p<0.05, Histidine: F(1,45)=8.952 p<0.05, Threonine: F(1,45)=11.657 p<0.05,
Isoleucine: F(1,45)=7.059 p<0.05). WT= wild type, PKU= phenylketonuria, (N)= naïve mice, (T)= tested
mice (Chapter 2).
![Page 188: University of Groningen Phenylketonuria in mice and men ... · Phenylketonuria in mice and men Proefschrift ter verkrijging van de graad van doctor aan de Rijksuniversiteit Groningen](https://reader034.vdocuments.site/reader034/viewer/2022052611/5f03c1e37e708231d40a9ed0/html5/thumbnails/188.jpg)
512536-L-bw-Bruinenberg512536-L-bw-Bruinenberg512536-L-bw-Bruinenberg512536-L-bw-BruinenbergProcessed on: 15-8-2017Processed on: 15-8-2017Processed on: 15-8-2017Processed on: 15-8-2017 PDF page: 187PDF page: 187PDF page: 187PDF page: 187
10
187
Chapter 10
For amino acids in the blood, a significant interaction effect was found between genotype
and state for all LNAA depicted in Figure 1, except for Phe. This indicates that the response
to a physiological challenge is different between WT’s and PKU’s but not between the genetic
backgrounds. Genetic background did interact with genotype for all LNAA depicted in
Figure 1. From the graphs it is evident that the WTs of each genetic background differ from
each other. The results found in blood amino acids could not be directly extrapolated to
brain amino acids (Figure 2). Only, Phe concentrations were affected by an interaction of
genotype and state and background and state. The tested B6 PKU mice showed lower Phe
concentrations than the naïve B6 PKU, a response to the challenge that is not observed in the
WT’s or the BTBR PKU. As in the plasma, genetic background and genotype did interact,
except for tryptophan and threonine. However, in the brain the concentration of these
amino acids were found to differ between the PKU’s of each strain. Overall, BTBR PKU and
B6 PKU seem to respond similar to physiological challenge in amino acid concentrations in
blood and brain. From the graphs, only the response of histidine in the brain stands out. The
BTBR PKU and B6 PKU seem to be affected in opposite direction, however, only a trend was
observed (p=0.058).
For the neurotransmitters, a clear PKU phenotype is found for dopamine, norepinephrine,
serotonin and the turn-over of serotonin (Figure 3A-C) independently of genetic background.
Overall, the genetic backgrounds differed in norepinephrine and the turn-over of serotonin.
Furthermore, only the turn-over of serotonin was affect by the physiological challenge wherein
a trend was observed in a difference between WTs and PKUs. These results suggest that
there are no major differences in neurotransmitter concentrations between BTBR PKU and
B6 PKU. Therefore, these results raise the hypothesis that neurotransmitter concentrations
alone are not likely to explain the difference found in behavioral outcome. Interestingly,
although it is a trend, it seems that PKU individuals of both genetic backgrounds cannot
increase the turn-over of serotonin after a physiological challenge, a response that is also
observed in WT littermates.
Together, this data suggest that the response in amino acids and neurotransmitters to a
physiological challenge is not different for the genetic backgrounds despite clear difference
between WT and PKU.
![Page 189: University of Groningen Phenylketonuria in mice and men ... · Phenylketonuria in mice and men Proefschrift ter verkrijging van de graad van doctor aan de Rijksuniversiteit Groningen](https://reader034.vdocuments.site/reader034/viewer/2022052611/5f03c1e37e708231d40a9ed0/html5/thumbnails/189.jpg)
512536-L-bw-Bruinenberg512536-L-bw-Bruinenberg512536-L-bw-Bruinenberg512536-L-bw-BruinenbergProcessed on: 15-8-2017Processed on: 15-8-2017Processed on: 15-8-2017Processed on: 15-8-2017 PDF page: 188PDF page: 188PDF page: 188PDF page: 188
188
Chapter 10
Figure 2 Amino acids in brain of both genetic backgrounds. Phe concentrations are affected by an
interaction of genotype and state (F(1,45)=4.461, p<0.05) and background and state (F(1,45)=4.694,
p<0.05). Genetic background and genotype interacted, except for Tryptophan and Threonine (Phe:
F(1,45)=7.573 p<0.05, Tyrosine: F(1,45)=5.281 p<0.05, Tryptophan: F(1,45)= 1.242 p= 0.272, Valine:
F(1,45)=8.357 p<0.05, Isoleucine: F(1,45)=5.460 p<0.05, Leucine: F(1,45)=6.349 p<0.05, Methionine;
F(1,45)=6.789 p<0.05, Histidine: F(1,45)=6.863 p<0.05, Threonine: F(1,45)=3.798 p=0.059). A main
effect of the physiological challenge was found for Histidine and Methionine (F(1,45)=4.934 p<0.05,
F(1,45)=4.387, p<0.05, respectively). In Histidine, a trend was observed in the interaction of genotype
and state (F(1,45)=3.831, p=0.058). WT= wild type, PKU= phenylketonuria, (N)= naïve mice, (T)=
tested mice (Chapter 2).
2.1.2. Identifying the difference between BTBR and B6
From Chapter 2 it is clear that genetic factors influence the PKU phenotype. To identify
candidate genes, different genetic screening tools can be used such as RNA-seq. This approach
would allow us to identify candidate genes that are upregulated, for example following a
learning event. Likewise, it would help elucidate gene clusters that are distinctively expressed
by the different genetic strains or sexes. Another possibility is to investigate m-RNA profiles
during neurodevelopment. The previous found similarities in PKU phenotype of both
genetics background in amino acids and neurotransmitters (paragraph 2.1.1) withholds
the hypothesis that the PKU mutation in different genetic backgrounds differently affects
these PKU induced changes, presumably during the neurodevelopment and adult life.
![Page 190: University of Groningen Phenylketonuria in mice and men ... · Phenylketonuria in mice and men Proefschrift ter verkrijging van de graad van doctor aan de Rijksuniversiteit Groningen](https://reader034.vdocuments.site/reader034/viewer/2022052611/5f03c1e37e708231d40a9ed0/html5/thumbnails/190.jpg)
512536-L-bw-Bruinenberg512536-L-bw-Bruinenberg512536-L-bw-Bruinenberg512536-L-bw-BruinenbergProcessed on: 15-8-2017Processed on: 15-8-2017Processed on: 15-8-2017Processed on: 15-8-2017 PDF page: 189PDF page: 189PDF page: 189PDF page: 189
10
189
Chapter 10
Research showed that a seven-day treatment in BTBR PKU pups (post-natal day 14-21) with
5-hydroxytryptophan, a precursor of serotonin, can improve dendritic spine maturation and
performance in a short-term version of the NOR and SOR tests39. Investigating differences
between genetic backgrounds around this time window, could help identifying the processes
protecting the PKU mutant mice with a B6 background.
Figure 3 Neurotransmitters in blood of both genetic backgrounds. (A) PKU phenotype was observed
for dopamine (F(1,45)=5.698 p<0.05), norepinephrine (F(1,45)=111.428 p<0.05), Serotonin
(F(1,45)=136.201 p<0.05) and turn-over of serotonin (5-HIAA/Serotonin F(1,45)=58.272, p<0.05).
Independently of the physiological challenge, differences are found between BTBR and B6 in
norepinephrine (F(1,45)=45.142 p<0.05) and the turn-over of serotonin (F(1,45)=11.251 p<0.05).
The turn-over of serotonin seems to be affected by the physiological challenge (F(1,45) 6.302 p<0.05)
wherein a trend was observed in a difference between WT and PKU’s (F(1,45)=3.166, p=0.083). WT=
wild type, PKU= phenylketonuria, (N)= naïve mice, (T)= tested mice (Chapter 2)
2.2. Future perspective II: Sleep research in PKU
In Chapter 4, we show that PKU patients have more sleep disorders, reduced sleep quality,
increased latency to fall asleep, and experience more sleepiness during the day compared to
first degree relatives. In the PKU mice, we found an increase in fragmentation, more switches
between active and non-active behavior, and a shift in diurnality, shifting a part from their
resting behavior into the active phase. Both experiments strongly support the hypothesis that
![Page 191: University of Groningen Phenylketonuria in mice and men ... · Phenylketonuria in mice and men Proefschrift ter verkrijging van de graad van doctor aan de Rijksuniversiteit Groningen](https://reader034.vdocuments.site/reader034/viewer/2022052611/5f03c1e37e708231d40a9ed0/html5/thumbnails/191.jpg)
512536-L-bw-Bruinenberg512536-L-bw-Bruinenberg512536-L-bw-Bruinenberg512536-L-bw-BruinenbergProcessed on: 15-8-2017Processed on: 15-8-2017Processed on: 15-8-2017Processed on: 15-8-2017 PDF page: 190PDF page: 190PDF page: 190PDF page: 190
190
Chapter 10
sleep is affected in PKU, a starting point for sleep research in PKU. An important new avenue
as sleep problems can negatively affect cognitive functioning, e.g. executive functioning40,41
and mood, e.g. feelings of depression, anxiety and stress42,43. These are disturbances similar
to the described disturbances in early-and continuous treated PKU patients (e.g. in executive
functioning, mood, social cognition, and in internalizing problems such as depression and
anxiety26,27).
2.2.1. Improving the electronic survey.
The proof-of-concept study in chapter 4 examined a small number of PKU patients and
first-degree relatives (FDR) controls. In retrospect, small adjustments could yield more
information in future cohorts. First, the distribution in age was different between PKU
patients and FDR controls. In the study, the recruitment of healthy sibling of PKU patients
was more difficult than expected at forehand. Besides investigating more time in this
recruitment, an age-matched control group from the general population could be included
to examine the differences between PKU patients and a healthy population. Second, the
recruitment of subjects was done via a specific call concerning a sleep questionnaire via
Dutch PKU society on a non-committal basis. This could have resulted in a responder bias
as people of the Dutch PKU society are probably a subclass of PKU patients. Dispersing
the questionnaire via health care professionals could possibly give a better representation
of the PKU community. Third, in the questionnaire one question was added concerning the
treatment of the PKU patients. However, it is not clear how well the patients were controlled.
Including a question about recent Phe concentrations or involving the treating health care
professionals, could possibly associate the Phe concentration or type of treatment with the
sleep disturbances. Finally, the leading treatment for PKU patients is a Phe restricted diet
supplemented with artificial amino acids, vitamins, and minerals. The timing of the artificial
mix could influence the timing of sleep. Evaluation of this timing should be included in the
future survey. Together, these adjustments would give more insights in the relation between
sleep and PKU.
2.2.2. Moving beyond the proof-of-concept study
The proof-of-concept study indicated that the timing of sleep and switching from active
to non-active behavior could be affected in PKU. Corroboration of these findings should
be done in future studies. Timing of sleep is influenced by sleep regulatory processes and
circadian rhythm44. The sleep regulatory processes could be influenced by neurotransmitter
disturbances in PKU. Improving these neurotransmitter concentrations by either Phe-
restriction or LNAA supplementation could identify if this processes are at hand. To
investigate if PKU influences the circadian rhythm, PKU mice could be exposed to continuous
lighting regimes (constant light or dark) to identify disruptions in the internal free-running
rhythm of the animal or phase-shift experiments to identify problems in shifting sleep/wake
patterns. The use of PKU mice could help identify the neurobiological substrates. In PKU
![Page 192: University of Groningen Phenylketonuria in mice and men ... · Phenylketonuria in mice and men Proefschrift ter verkrijging van de graad van doctor aan de Rijksuniversiteit Groningen](https://reader034.vdocuments.site/reader034/viewer/2022052611/5f03c1e37e708231d40a9ed0/html5/thumbnails/192.jpg)
512536-L-bw-Bruinenberg512536-L-bw-Bruinenberg512536-L-bw-Bruinenberg512536-L-bw-BruinenbergProcessed on: 15-8-2017Processed on: 15-8-2017Processed on: 15-8-2017Processed on: 15-8-2017 PDF page: 191PDF page: 191PDF page: 191PDF page: 191
10
191
Chapter 10
patients, core body temperature and dim-light melatonin rhythm could be monitored to
investigate if PKU patients experience a blunted or delayed internal rhythm of physiological
markers. These experiments would give the first indications concerning the underlying
mechanism of sleep problems in PKU.
2.2.3. Possible treatment strategy: Exercise
A possible treatment strategy to improve the altered sleep/wake pattern is exercise. This
treatment strategy is, for instance, investigated in aged individuals where disturbed temporal
regulation of rest/wake cycle, as found in PKU mice, is part of the altered rest/wake pattern.
Voluntary exercise in these mice improved parameters associated with a strengthened rest/
wake pattern45. On the basis of these findings, the hypothesis is that providing a running
wheel to PKU mice would strengthen their rest/wake patterns. Although the study was
not designed to examine the effect of exercise on rest/wake patterns, the study of Mazzola
and colleagues (2015) did offer running wheels to female WT and PKU B6 mice (4 mo)6.
Reanalysis of the data showed reduced fragmentation and a shift in diurnality in PKU mice
(Figure 4A,B one-tailed t-test: fragmentation t(17)=1.951 p<0.05, diurnality t(17)=2.071
p<0.05). The affected rest/wake pattern in these PKU mice suggest that voluntary exercise
does not improve the circadian rhythm. However, as previously pointed out, this study was
not designed to examine rest/wake patterns. The type of running wheel (with bars) could
have affected the outcome as motor deficits could cause the PKU mice to have difficulties to
run for long consecutive periods. A closed running wheel and passive infrared registration
of all activity could reveal other results. Therefore, this data does not allow for definite
conclusions, but is nevertheless in support of the data presented in chapter 4.
Figure 4 Fragmentation and diurnality score of exercising PKU mice. WT mice (n=9) and PKU mice
(n=10) had excess to a running wheel for 53 days. Fragmentation score and diurnality was calculated
over data collected from this period. In both scores, the WT and PKU mice differed from each other
(one-tailed t-test: fragmentation t(17)=1.951 p<0.05, Diurnality t(17)=2.071 p<0.05).
![Page 193: University of Groningen Phenylketonuria in mice and men ... · Phenylketonuria in mice and men Proefschrift ter verkrijging van de graad van doctor aan de Rijksuniversiteit Groningen](https://reader034.vdocuments.site/reader034/viewer/2022052611/5f03c1e37e708231d40a9ed0/html5/thumbnails/193.jpg)
512536-L-bw-Bruinenberg512536-L-bw-Bruinenberg512536-L-bw-Bruinenberg512536-L-bw-BruinenbergProcessed on: 15-8-2017Processed on: 15-8-2017Processed on: 15-8-2017Processed on: 15-8-2017 PDF page: 192PDF page: 192PDF page: 192PDF page: 192
192
Chapter 10
2.3. Future perspective III: New treatment strategies in PKU
2.3.1 SNC and LNAA
In chapter 6 and 7, specific improvements are found after SNC supplementation. However,
a definite mode of action of SNC was not clearly identified in these PKU studies, despite the
clear hypotheses we had (Chapter 5). One hypothesis was synaptic functioning. Although
chapter 6 have indicated improved synaptic functioning in the B6 PKU, the differences in
age, exposure to behavioral paradigms, housing conditions and genetic backgrounds of the
PKU mouse model yield caution when relating the improved synaptic functioning to the
improved functional outcome. To examine a direct effect of SNC on neurons, one could
investigate primary neuronal cell cultures with and without Phe. SNC supplementation under
these conditions could help identify a direct effect of SNC on post-and pre-synaptic markers
or specific changes in neuronal morphology. Another hypothesis was neurotransmitter
metabolism. Neurotransmitters concentrations were measured in the whole brain of the
BTBR mice of chapter 72. From figure 5 of the discussed neurotransmitter are affecting
the functional outcome the PKU mice in the NOR, it is clear that SNC supplementation
did not influence whole brain concentration of neurotransmitters or turnover of serotonin
within these groups under these circumstances. With the caution that regional differences
in the brain may occur, it is unlikely that the neurotransmitter metabolism R. To examine
the mode of action of SNC, future research should, therefore, elaborate on the effect of
SNC on the domains raised in chapter 5 (synaptic functioning, neurotransmitter metabolism
oxidative stress, and white matter integrity). Within these studies, attention must be applied
to regional differences of the brain as the SNC effect found in chapter 6 was very specific.
Furthermore, when restoring neurotransmitter deficits in PKU is one of the biochemical aims
of treatment, combining the strengths of SNC supplementation and LNAA treatment could
be of great interest.
2.3.2. Placing SNC and LNAA on the scale of new treatment strategies in PKU
The search of new treatment strategies for PKU is broad with diverse treatment objectives.
The different treatment strategies could be placed along a figurative scale, on one end
alternatives for amino acids mixture which could improve compliance and metabolic control
and, at the other end, targeting the cause of the disease (Figure 6). The treatments will
be discussed from the left side from this schematic representation to the right side (Figure
6). First, Glycomacropeptide (GMP) is a naturally occurring protein that is lacking Phe.
This protein can be a protein source for PKU patients that could improve compliance and
metabolic control. However, due to the process of getting GMP free from the whey protein,
some Phe will be in the product offered to patients46. Second, SNC, discussed in Chapter 5,
6, and 7, is designed to relieve the effects of high Phe on the brain. Although
2 Neurotransmitter measurements were performed according to the protocols described in chapter 8
and 9
![Page 194: University of Groningen Phenylketonuria in mice and men ... · Phenylketonuria in mice and men Proefschrift ter verkrijging van de graad van doctor aan de Rijksuniversiteit Groningen](https://reader034.vdocuments.site/reader034/viewer/2022052611/5f03c1e37e708231d40a9ed0/html5/thumbnails/194.jpg)
512536-L-bw-Bruinenberg512536-L-bw-Bruinenberg512536-L-bw-Bruinenberg512536-L-bw-BruinenbergProcessed on: 15-8-2017Processed on: 15-8-2017Processed on: 15-8-2017Processed on: 15-8-2017 PDF page: 193PDF page: 193PDF page: 193PDF page: 193
10
193
Chapter 10
Figure 5 The effect of SNC supplementation on neurotransmitter concentrations in PKU mice. The
statistical analysis with a multivariate ANOVA (factors sex and group) showed no interaction effect
between sex and group. Therefore, the graphs include both male and female mice. For dopamine, no
differences were observed between the groups. For norepinephrine, the PKU mice on high Phe (C-HP
and SNC-HP) significantly differed from WTs (WT C-HP and WT SNC-HP) and PKUs on low Phe
diet (C-LP and SNC-LP). These differences were also observed in Serotonin. The turnover of serotonin
(5-HIAA/Serotonin) differed between WT C-HP and both high Phe PKU groups (C-HP p=0.013, SNC-
HP p=0.011) and between WT SNC-HP with all PKU groups (PKU C-HP p<0.001, PKU SNC-HP
p<0.001, PKU C-LP p=0.005, PKU SNC-LP p=0.041). * p<0.05, 5-HIAA= 5-Hydroxyindoleacetic acid
(metabolite of serotonin), n=12, mean±standard error of the mean.
![Page 195: University of Groningen Phenylketonuria in mice and men ... · Phenylketonuria in mice and men Proefschrift ter verkrijging van de graad van doctor aan de Rijksuniversiteit Groningen](https://reader034.vdocuments.site/reader034/viewer/2022052611/5f03c1e37e708231d40a9ed0/html5/thumbnails/195.jpg)
512536-L-bw-Bruinenberg512536-L-bw-Bruinenberg512536-L-bw-Bruinenberg512536-L-bw-BruinenbergProcessed on: 15-8-2017Processed on: 15-8-2017Processed on: 15-8-2017Processed on: 15-8-2017 PDF page: 194PDF page: 194PDF page: 194PDF page: 194
194
Chapter 10
the first positive reports are included in this thesis, at this moment, SNC supplementation
is more likely to be added to the current treatment strategy or LNAA treatment than be
a treatment strategy on its own. Third, LNAA, discussed in Chapter 8 and 9, has been
found to lower Phe concentrations, improve other non-Phe LNAA’s concentrations in
brain and improve neurotransmitter concentrations. However, the optimal composition of
LNAA’s is yet to be determined. Fourth, Phe in high concentrations can self-assemble to
toxic fibrils with an amyloid-like structure47. Inhibiting this self-assemble by antibodies or
small molecules could yield new treatment strategies47–49. Targeting the amyloid structure
is not a novel approach in neuroscience, as this is also done in neurodegenerative diseases,
such Alzheimer’s disease. Fifth, tetrahydrobiopterin (BH4) is the essential in the conversion
of Phe to tyrosine. Depending on the genotype in the PAH gene, some PKU patients benefit
from supplementation of the synthetic form of BH4. Furthermore, a recent study showed
that high doses of BH4 can also be beneficial in PKU conditions normally not responding
to BH4, namely in PKU mice50. Besides the role in Phe metabolism, BH4 is an important
cofactor of tyrosine hydroxylase and tryptophan hydroxylase, key enzymes in the synthesis
of dopamine and serotonin. High doses of BH4 can be beneficial for the turnover of these
neurotransmitters in the brain50. Fifth, Phenylalanine Ammonia Lyase (PAL) is an enzyme
derived from yeast and fungi that can degrade Phe to small amounts of ammonia and to
trans-cinnamic acid, a harmless metabolite. Several clinical trials have been performed with
an injectable form of this enzyme, rAvPAL–PEG51. This treatment is successful in lowering
Phe concentrations, but the multiple injections could cause irritation to the injection side
and immune reactions51. Research had been investing in oral administration of PAL, but, at
this moment, this is not as successful as rAvPAL–PEG52–57. Finally, gene therapy is a form
of treatment in which, for PKU, the PAH gene is carried into body by a stable virus, for
example an adeno associated virus. This virus can be directed towards the liver, however,
the corrected PAH activity is not permanent and reintroduction of the virus is difficult as
immune reaction towards the virus can occur54–56. Another possibility is muscle-directed
gene therapy. Normally, the muscle has no PAH enzyme and the cofactor to convert Phe to
tyrosine. Therefore, successful muscle-directed gene therapy doesn’t solely contain the PAH
gene but also contain the BH4-biosynthetic enzymes GTP cyclohydrolase I (GTPCH) and
6-pyruvoyl-tetrahydropterin synthase (PTPS)61.
To conclude, several new treatment strategies are explored in the PKU research field. When
depicting these along a scale they can be ranked on the target of the treatment. However, to
some extent, the scale can be replaced by non-invasive (left) to invasive (right) or even short-
term solutions (left) to long-term solutions (right). If the development indeed will follow this
last subdivision is not clear. However, when it advances are made on the right hand of the
scale, treatment strategies on the left hand of the scale become less relevant.
![Page 196: University of Groningen Phenylketonuria in mice and men ... · Phenylketonuria in mice and men Proefschrift ter verkrijging van de graad van doctor aan de Rijksuniversiteit Groningen](https://reader034.vdocuments.site/reader034/viewer/2022052611/5f03c1e37e708231d40a9ed0/html5/thumbnails/196.jpg)
512536-L-bw-Bruinenberg512536-L-bw-Bruinenberg512536-L-bw-Bruinenberg512536-L-bw-BruinenbergProcessed on: 15-8-2017Processed on: 15-8-2017Processed on: 15-8-2017Processed on: 15-8-2017 PDF page: 195PDF page: 195PDF page: 195PDF page: 195
10
195
Chapter 10
Figure 6 Schematic representation of PKU treatment strategies. Abbreviations and symbols: GMP=
Glycomacropeptide, SNC= Specific nutrient combination, LNAA= large neutral amino acid, # Phe=
Interfering in the assemble of toxic Phe fibils, BH4=tetrahydrobiopterin, PAL= Phenylalanine ammonia
lyase.
3. FINAL CONCLUSION
Taken all results and consideration together the following implications can be identified.
First, all experimental chapters (except for chapter 4) show that Phe concentrations in
plasma are not always a good predictor of the pathophysiological outcome. Future research
should focus on identifying predictors (e.g. genetic background) and markers that can help
monitor biochemical changes in the brain. Second, chapter 4 recognizes for the first time
sleep problems in PKU. Being aware of sleep problems in PKU, and, in the end, treating sleep
problems in PKU can, hopefully, improve treatment. Finally, this thesis contained studies
that showed new aspects of the disease (PKU strain differences and sleep problems) and a
treatment strategy not investigated before (SNC supplementation). Hopefully, this will be
the basis of follow-up studies in PKU that could, in the end, improve the treatment of PKU
and release the burden of the strict dietary treatment PKU patients have to adhere to.
![Page 197: University of Groningen Phenylketonuria in mice and men ... · Phenylketonuria in mice and men Proefschrift ter verkrijging van de graad van doctor aan de Rijksuniversiteit Groningen](https://reader034.vdocuments.site/reader034/viewer/2022052611/5f03c1e37e708231d40a9ed0/html5/thumbnails/197.jpg)
512536-L-bw-Bruinenberg512536-L-bw-Bruinenberg512536-L-bw-Bruinenberg512536-L-bw-BruinenbergProcessed on: 15-8-2017Processed on: 15-8-2017Processed on: 15-8-2017Processed on: 15-8-2017 PDF page: 196PDF page: 196PDF page: 196PDF page: 196
196
Chapter 10
4. REFERENCES
1 Ramus SJ, Forrest SM, Pitt DB, Saleeba JA,
Cotton RG. Comparison of genotype and
intellectual phenotype in untreated PKU
patients. J Med Genet 1993; 30: 401–5.
2 Ramus SJ, Forrest SM, Pitt DD, Cotton
RGH. Genotype and Intellectual Phenotype
in Untreated Phenylketonuria Patients.
Pediatr Res 1999; 45: 474–481.
3 Mochizuki S, Mizukami H, Ogura T, Kure
S, Ichinohe A, Kojima K et al. Long-term
correction of hyperphenylalaninemia
by AAV-mediated gene transfer leads to
behavioral recovery in phenylketonuria
mice. Gene Ther 2004; 11: 1081–6.
4 Sawin EA, Murali SG, Ney DM. Differential
effects of low-phenylalanine protein sources
on brain neurotransmitters and behavior in
C57Bl/6-Pahenu2 mice. Mol Genet Metab
2014; 111: 452–461.
5 Zagreda L, Goodman J, Druin DP,
McDonald D, Diamond A. Cognitive
deficits in a genetic mouse model of the
most common biochemical cause of human
mental retardation. J Neurosci 1999; 19:
6175–82.
6 Mazzola PN, Bruinenberg V, Anjema
K, van Vliet D, Dutra-Filho CS, van
Spronsen FJ et al. Voluntary Exercise
Prevents Oxidative Stress in the Brain of
Phenylketonuria Mice. JIMD Rep 2015.
doi:10.1007/8904_2015_498.
7 van Vliet D, Bruinenberg VM, Mazzola
PN, van Faassen MHJR, de Blaauw P,
Kema IP et al. Large Neutral Amino Acid
Supplementation Exerts Its Effect through
Three Synergistic Mechanisms: Proof of
Principle in Phenylketonuria Mice. PLoS
One 2015; 10: e0143833.
8 van Vliet D, Bruinenberg VM, Mazzola
PN, van Faassen MH, de Blaauw P,
Pascucci T et al. Therapeutic brain
modulation with targeted large neutral
amino acid supplements in the Pah-enu2
phenylketonuria mouse model. Am J Clin
Nutr 2016; 104: 1292–1300.
9 Christ SE, Price MH, Bodner KE, Saville C,
Moffitt AJ, Peck D. Morphometric analysis
of gray matter integrity in individuals with
early-treated phenylketonuria. Mol Genet
Metab 2016; 118: 3–8.
10 Fisch RO, Sines LK, Chang P. Personality
characteristics of nonretarded
phenylketonurics and their family members.
J Clin Psychiatry 1981; 42: 106–13.
11 Cazzorla C, Cegolon L, Burlina AP, Celato
A, Massa P, Giordano L et al. Quality
of Life (QoL) assessment in a cohort of
patients with phenylketonuria. BMC Public
Health 2014; 14: 1243.
12 Pietz J, Fätkenheuer B, Burgard P,
Armbruster M, Esser G, Schmidt H.
Psychiatric disorders in adult patients with
early-treated phenylketonuria. Pediatrics
1997; 99: 345–50.
13 Craft S, Gourovitch ML, Dowton SB,
Swanson JM, Bonforte S. Lateralized
deficits in visual attention in males with
developmental dopamine depletion.
Neuropsychologia 1992; 30: 341–51.
14 Stemerdink BA, Kalverboer AF, van der
Meere JJ, van der Molen MW, Huisman
J, de Jong LW et al. Behaviour and school
achievement in patients with early and
continuously treated phenylketonuria. J
Inherit Metab Dis 2000; 23: 548–62.
15 Smith I, Beasley MG, Wolff OH, Ades AE.
Behavior disturbance in 8-year-old children
with early treated phenylketonuria. Report
from the MRC/DHSS Phenylketonuria
Register. J Pediatr 1988; 112: 403–8.
![Page 198: University of Groningen Phenylketonuria in mice and men ... · Phenylketonuria in mice and men Proefschrift ter verkrijging van de graad van doctor aan de Rijksuniversiteit Groningen](https://reader034.vdocuments.site/reader034/viewer/2022052611/5f03c1e37e708231d40a9ed0/html5/thumbnails/198.jpg)
512536-L-bw-Bruinenberg512536-L-bw-Bruinenberg512536-L-bw-Bruinenberg512536-L-bw-BruinenbergProcessed on: 15-8-2017Processed on: 15-8-2017Processed on: 15-8-2017Processed on: 15-8-2017 PDF page: 197PDF page: 197PDF page: 197PDF page: 197
10
197
Chapter 10
16 Pietz J, Fätkenheuer B, Burgard P,
Armbruster M, Esser G, Schmidt H.
Psychiatric disorders in adult patients with
early-treated phenylketonuria. Pediatrics
1997; 99: 345–50.
17 Stemerdink BA, Kalverboer AF, van der
Meere JJ, van der Molen MW, Huisman
J, de Jong LW et al. Behaviour and school
achievement in patients with early and
continuously treated phenylketonuria. J
Inherit Metab Dis 2000; 23: 548–62.
18 Shedlovsky A, McDonald JD, Symula
D, Dove WF. Mouse models of human
phenylketonuria. Genetics 1993; 134:
1205–10.
19 Justice MJ, Carpenter DA, Favor J,
Neuhauser-Klaus A, Hrabé De Angelis M,
Soewarto D et al. Effects of ENU dosage on
mouse strains. Mamm Genome 2000; 11:
484–8.
20 Wahlsten D, Metten P, Crabbe JC. Survey of
21 inbred mouse strains in two laboratories
reveals that BTBR T/+ tf/tf has severely
reduced hippocampal commissure and
absent corpus callosum. Brain Res 2003;
971: 47–54.
21 Jones-Davis DM, Yang M, Rider E, Osbun
NC, da Gente GJ, Li J et al. Quantitative
trait loci for interhemispheric commissure
development and social behaviors in the
BTBR T+ tf/J mouse model of autism. PLoS
One 2013; 8: e61829.
22 MacPherson P, McGaffigan R, Wahlsten D,
Nguyen P V. Impaired fear memory, altered
object memory and modified hippocampal
synaptic plasticity in split-brain mice. Brain
Res 2008; 1210: 179–88.
23 Ding Z, Georgiev P, Thöny B.
Administration-route and gender-
independent long-term therapeutic
correction of phenylketonuria (PKU) in
a mouse model by recombinant adeno-
associated virus 8 pseudotyped vector-
mediated gene transfer. Gene Ther 2006; 13:
587–593.
24 Molenhuis RT, de Visser L, Bruining H,
Kas MJ. Enhancing the value of psychiatric
mouse models; differential expression of
developmental behavioral and cognitive
profiles in four inbred strains of mice. Eur
Neuropsychopharmacol 2014; 24: 945–54.
25 Stephenson DT, O’Neill SM, Narayan
S, Tiwari A, Arnold E, Samaroo HD et
al. Histopathologic characterization of
the BTBR mouse model of autistic-like
behavior reveals selective changes in
neurodevelopmental proteins and adult
hippocampal neurogenesis. Mol Autism
2011; 2: 7.
26 Jahja R, van Spronsen FJ, de Sonneville
LMJ, van der Meere JJ, Bosch AM, Hollak
CEM et al. Social-cognitive functioning and
social skills in patients with early treated
phenylketonuria: a PKU-COBESO study. J
Inherit Metab Dis 2016; 39: 355–362.
27 Waisbren SE, Noel K, Fahrbach K, Cella C,
Frame D, Dorenbaum A et al. Phenylalanine
blood levels and clinical outcomes in
phenylketonuria: a systematic literature
review and meta-analysis. Mol Genet Metab
2007; 92: 63–70.
28 El-Husseini AE, Craven SE, Chetkovich
DM, Firestein BL, Schnell E, Aoki C et al.
Dual palmitoylation of PSD-95 mediates
its vesiculotubular sorting, postsynaptic
targeting, and ion channel clustering. J Cell
Biol 2000; 148: 159–72.
![Page 199: University of Groningen Phenylketonuria in mice and men ... · Phenylketonuria in mice and men Proefschrift ter verkrijging van de graad van doctor aan de Rijksuniversiteit Groningen](https://reader034.vdocuments.site/reader034/viewer/2022052611/5f03c1e37e708231d40a9ed0/html5/thumbnails/199.jpg)
512536-L-bw-Bruinenberg512536-L-bw-Bruinenberg512536-L-bw-Bruinenberg512536-L-bw-BruinenbergProcessed on: 15-8-2017Processed on: 15-8-2017Processed on: 15-8-2017Processed on: 15-8-2017 PDF page: 198PDF page: 198PDF page: 198PDF page: 198
198
Chapter 10
29 Nagura H, Ishikawa Y, Kobayashi K, Takao
K, Tanaka T, Nishikawa K et al. Impaired
synaptic clustering of postsynaptic density
proteins and altered signal transmission
in hippocampal neurons, and disrupted
learning behavior in PDZ1 and PDZ2 ligand
binding-deficient PSD-95 knockin mice. Mol
Brain 2012; 5: 43.
30 Pietz J, Kreis R, Rupp A, Mayatepek
E, Rating D, Boesch C et al. Large
neutral amino acids block phenylalanine
transport into brain tissue in patients with
phenylketonuria. J Clin Invest 1999; 103:
1169–78.
31 Schindeler S, Ghosh-Jerath S, Thompson S,
Rocca A, Joy P, Kemp A et al. The effects
of large neutral amino acid supplements
in PKU: an MRS and neuropsychological
study. Mol Genet Metab 2007; 91: 48–54.
32 Koch R, Moseley KD, Yano S, Nelson
M, Moats RA. Large neutral amino acid
therapy and phenylketonuria: a promising
approach to treatment. Mol Genet Metab
2003; 79: 110–3.
33 Yano S, Moseley K, Azen C. Large neutral
amino acid supplementation increases
melatonin synthesis in phenylketonuria: a
new biomarker. J Pediatr 2013; 162: 999–
1003.
34 Kalkanoğlu HS, Ahring KK, Sertkaya D,
Møller LB, Romstad A, Mikkelsen I et
al. Behavioural effects of phenylalanine-
free amino acid tablet supplementation in
intellectually disabled adults with untreated
phenylketonuria. Acta Paediatr 2005; 94:
1218–22.
35 Matalon R, Michals-Matalon K, Bhatia
G, Burlina AB, Burlina AP, Braga C et al.
Double blind placebo control trial of large
neutral amino acids in treatment of PKU:
Effect on blood phenylalanine. J Inherit
Metab Dis 2007; 30: 153–158.
36 Matalon R, Michals-Matalon K, Bhatia
G, Grechanina E, Novikov P, McDonald
JD et al. Large neutral amino acids in the
treatment of phenylketonuria (PKU). J
Inherit Metab Dis 2006; 29: 732–8.
37 Moats RA, Moseley KD, Koch R, Nelson
M. Brain phenylalanine concentrations in
phenylketonuria: research and treatment of
adults. Pediatrics 2003; 112: 1575–9.
38 van Spronsen FJ, de Groot MJ, Hoeksma
M, Reijngoud D-J, van Rijn M. Large
neutral amino acids in the treatment of
PKU: from theory to practice. J Inherit
Metab Dis 2010; 33: 671–676.
39 Andolina D, Conversi D, Cabib S,
Trabalza A, Ventura R, Puglisi-Allegra
S et al. 5-Hydroxytryptophan during
critical postnatal period improves
cognitive performances and promotes
dendritic spine maturation in genetic
mouse model of phenylketonuria. Int J
Neuropsychopharmacol 2011; 14: 479–89.
40 Banks S, Dinges DF. Behavioral and
physiological consequences of sleep
restriction. J Clin Sleep Med 2007; 3: 519–
28.
41 Couyoumdjian A, Sdoia S, Tempesta D,
Curcio G, Rastellini E, DE Gennaro L et al.
The effects of sleep and sleep deprivation
on task-switching performance. J Sleep Res
2010; 19: 64–70.
42 Short MA, Louca M. Sleep deprivation leads
to mood deficits in healthy adolescents.
Sleep Med 2015; 16: 987–93.
43 Meerlo P, Havekes R, Steiger A. Chronically
restricted or disrupted sleep as a causal
factor in the development of depression.
Curr Top Behav Neurosci 2015; 25: 459–
81.
44 Daan S, Beersma DG, Borbély AA. Timing
of human sleep: recovery process gated by
a circadian pacemaker. Am J Physiol 1984;
246: R161-83.
![Page 200: University of Groningen Phenylketonuria in mice and men ... · Phenylketonuria in mice and men Proefschrift ter verkrijging van de graad van doctor aan de Rijksuniversiteit Groningen](https://reader034.vdocuments.site/reader034/viewer/2022052611/5f03c1e37e708231d40a9ed0/html5/thumbnails/200.jpg)
512536-L-bw-Bruinenberg512536-L-bw-Bruinenberg512536-L-bw-Bruinenberg512536-L-bw-BruinenbergProcessed on: 15-8-2017Processed on: 15-8-2017Processed on: 15-8-2017Processed on: 15-8-2017 PDF page: 199PDF page: 199PDF page: 199PDF page: 199
10
199
Chapter 10
45 Leise TL, Harrington ME, Molyneux PC,
Song I, Queenan H, Zimmerman E et
al. Voluntary exercise can strengthen the
circadian system in aged mice. Age (Dordr)
2013; 35: 2137–52.
46 Ney DM, Gleason ST, van Calcar SC,
MacLeod EL, Nelson KL, Etzel MR et
al. Nutritional management of PKU with
glycomacropeptide from cheese whey. J
Inherit Metab Dis 2009; 32: 32–9.
47 Adler-Abramovich L, Vaks L, Carny
O, Trudler D, Magno A, Caflisch A et
al. Phenylalanine assembly into toxic
fibrils suggests amyloid etiology in
phenylketonuria. Nat Chem Biol 2012; 8:
701–6.
48 De Luigi A, Mariani A, De Paola M, Re
Depaolini A, Colombo L, Russo L et al.
Doxycycline hinders phenylalanine fibril
assemblies revealing a potential novel
therapeutic approach in phenylketonuria.
Sci Rep 2015; 5: 15902.
49 Banik D, Dutta R, Banerjee P, Kundu S
SN. Inhibition of Fibrillar Assemblies
of l-Phenylalanine by Crown Ethers:
A Potential Approach toward
Phenylketonuria. J Phys Chem B 2016; 120:
7662–70.
50 Winn SR, Scherer T, Thöny B, Harding
CO. High dose sapropterin dihydrochloride
therapy improves monoamine
neurotransmitter turnover in murine
phenylketonuria (PKU). Mol Genet Metab
2016; 117: 5–11.
51 Blau N, Longo N. Alternative therapies
to address the unmet medical needs of
patients with phenylketonuria. Expert Opin
Pharmacother 2015; 16: 791–800.
52 Hoskins JA, Jack G, Wade HE, Peiris RJ,
Wright EC, Starr DJ et al. Enzymatic control
of phenylalanine intake in phenylketonuria.
Lancet (London, England) 1980; 1: 392–4.
53 Sarkissian CN, Gamez A, Wang L,
Charbonneau M, Fitzpatrick P, Lemontt
JF et al. Preclinical evaluation of multiple
species of PEGylated recombinant
phenylalanine ammonia lyase for the
treatment of phenylketonuria. Proc Natl
Acad Sci 2008; 105: 20894–20899.
54 Kang TS, Wang L, Sarkissian CN, Gámez
A, Scriver CR, Stevens RC. Converting an
injectable protein therapeutic into an oral
form: phenylalanine ammonia lyase for
phenylketonuria. Mol Genet Metab 2010;
99: 4–9.
55 Babaoğlu Aydaş S, Şirin S, Aslim B.
Biochemical analysis of Centaurea
depressa phenylalanine ammonia lyase
(PAL) for biotechnological applications in
phenylketonuria (PKU). Pharm Biol 2016;
54: 2838–2844.
56 López-Villalobos A, Lücker J, López-Quiróz
AA, Yeung EC, Palma K, Kermode AR.
Preservation of high phenylalanine ammonia
lyase activities in roots of Japanese Striped
corn: a potential oral therapeutic to treat
phenylketonuria. Cryobiology 2014; 68:
436–45.
57 Safos S, Chang TM. Enzyme replacement
therapy in ENU2 phenylketonuric mice
using oral microencapsulated phenylalanine
ammonia-lyase: a preliminary report. Artif
Cells Blood Substit Immobil Biotechnol
1995; 23: 681–92.
58 Rebuffat A, Harding CO, Ding Z, Thöny
B. Comparison of adeno-associated virus
pseudotype 1, 2, and 8 vectors administered
by intramuscular injection in the treatment
of murine phenylketonuria. Hum Gene Ther
2010; 21: 463–77.
59 Strisciuglio P, Concolino D. New Strategies
for the Treatment of Phenylketonuria (PKU).
Metabolites 2014; 4: 1007–1017.
![Page 201: University of Groningen Phenylketonuria in mice and men ... · Phenylketonuria in mice and men Proefschrift ter verkrijging van de graad van doctor aan de Rijksuniversiteit Groningen](https://reader034.vdocuments.site/reader034/viewer/2022052611/5f03c1e37e708231d40a9ed0/html5/thumbnails/201.jpg)
512536-L-bw-Bruinenberg512536-L-bw-Bruinenberg512536-L-bw-Bruinenberg512536-L-bw-BruinenbergProcessed on: 15-8-2017Processed on: 15-8-2017Processed on: 15-8-2017Processed on: 15-8-2017 PDF page: 200PDF page: 200PDF page: 200PDF page: 200
200
Chapter 10
60 Thöny B. Long-term correction of murine
phenylketonuria by viral gene transfer: liver
versus muscle. J Inherit Metab Dis 2010;
33: 677–680.
61 Ding Z, Harding CO, Rebuffat A, Elzaouk
L, Wolff JA, Thöny B. Correction of
Murine PKU Following AAV-mediated
Intramuscular Expression of a Complete
Phenylalanine Hydroxylating System. Mol
Ther 2008; 16: 673–681.
![Page 202: University of Groningen Phenylketonuria in mice and men ... · Phenylketonuria in mice and men Proefschrift ter verkrijging van de graad van doctor aan de Rijksuniversiteit Groningen](https://reader034.vdocuments.site/reader034/viewer/2022052611/5f03c1e37e708231d40a9ed0/html5/thumbnails/202.jpg)
512536-L-bw-Bruinenberg512536-L-bw-Bruinenberg512536-L-bw-Bruinenberg512536-L-bw-BruinenbergProcessed on: 15-8-2017Processed on: 15-8-2017Processed on: 15-8-2017Processed on: 15-8-2017 PDF page: 201PDF page: 201PDF page: 201PDF page: 201
10
201
Chapter 10
![Page 203: University of Groningen Phenylketonuria in mice and men ... · Phenylketonuria in mice and men Proefschrift ter verkrijging van de graad van doctor aan de Rijksuniversiteit Groningen](https://reader034.vdocuments.site/reader034/viewer/2022052611/5f03c1e37e708231d40a9ed0/html5/thumbnails/203.jpg)
512536-L-bw-Bruinenberg512536-L-bw-Bruinenberg512536-L-bw-Bruinenberg512536-L-bw-BruinenbergProcessed on: 15-8-2017Processed on: 15-8-2017Processed on: 15-8-2017Processed on: 15-8-2017 PDF page: 202PDF page: 202PDF page: 202PDF page: 202
![Page 204: University of Groningen Phenylketonuria in mice and men ... · Phenylketonuria in mice and men Proefschrift ter verkrijging van de graad van doctor aan de Rijksuniversiteit Groningen](https://reader034.vdocuments.site/reader034/viewer/2022052611/5f03c1e37e708231d40a9ed0/html5/thumbnails/204.jpg)
512536-L-bw-Bruinenberg512536-L-bw-Bruinenberg512536-L-bw-Bruinenberg512536-L-bw-BruinenbergProcessed on: 15-8-2017Processed on: 15-8-2017Processed on: 15-8-2017Processed on: 15-8-2017 PDF page: 203PDF page: 203PDF page: 203PDF page: 203
APPENDIX INederlandse samenvatting
![Page 205: University of Groningen Phenylketonuria in mice and men ... · Phenylketonuria in mice and men Proefschrift ter verkrijging van de graad van doctor aan de Rijksuniversiteit Groningen](https://reader034.vdocuments.site/reader034/viewer/2022052611/5f03c1e37e708231d40a9ed0/html5/thumbnails/205.jpg)
512536-L-bw-Bruinenberg512536-L-bw-Bruinenberg512536-L-bw-Bruinenberg512536-L-bw-BruinenbergProcessed on: 15-8-2017Processed on: 15-8-2017Processed on: 15-8-2017Processed on: 15-8-2017 PDF page: 204PDF page: 204PDF page: 204PDF page: 204
204
Appendix I
FENYLKETONURIE: STUDIES IN MUIZEN EN MENSEN
Fenylketonurie (PKU) is een erfelijke stofwisselingsziekte in het metabolisme van één van de
essentiële aminozuren, fenylalanine (Phe). Een aangeboren genetische fout veroorzaakt een
dysfunctie in het leverenzym fenylalanine hydroxylase (PAH) dat de omzetting van Phe naar
tyrosine verstoort. Dit resulteert in zeer hoge Phe concentraties in het bloed en het brein.
De stapeling van Phe is desastreus voor de ontwikkeling van het brein en in onbehandelde
patiënten uit zich dit in zwaar verminderde cognitieve capaciteit, bewegingsstoornissen en
epilepsie1. In de jaren ’50 werd het duidelijk dat verminderde Phe inname een mogelijke
behandeling kon zijn voor PKU, een beginsel waar de huidige behandeling nog steeds op
gebaseerd is2. Een verminderde Phe inname wordt bereikt door een eiwitarm dieet, aangevuld
met artificiële aminozuren, vitaminen en mineralen. Vroege introductie en het levenslang
volgen van het dieet doen de ernstige cognitieve problemen voorkomen maar blijken niet
geheel toereikend te zijn. De behandelde PKU-patiënten scoren vaak lager op kwaliteit van
leven en hersenfuncties bijvoorbeeld op het gebied van werkgeheugen, de snelheid waarin
informatie wordt verwerkt en de aanwezigheid van depressie en angststoornissen3–5. Daarom
is de ontwikkeling van nieuwe en/of aanvullende behandelingsmethoden in PKU van groot
belang.
In dit proefschrift wordt er gekeken naar twee nieuwe behandelingsmethoden. De eerste
is een suppletie van een combinatie van specifieke nutrienten (SNC) (Deel 2). De tweede
behandelingsmethode richt zich op het supplementeren van andere grote neutrale aminozuren
(large neutral amino acids (LNAA)) die de instroom van Phe in het brein hinderen (Deel
3). In deze preklinische studies wordt er gebruik gemaakt van het PKU muismodel. Er
zijn twee verschillende genetische achtergronden die worden gebruikt in het preklinische
PKU onderzoek. In het eerste deel van dit proefschrift wordt er enerzijds gekeken of er
verschillen zijn tussen deze twee genetische achtergronden en anderzijds tussen mannen en
vrouwen. Tevens wordt er gekeken naar additionele dysfuncties in zowel de PKU muis als
PKU patiënten. In deze samenvatting wordt per onderdeel de algemene conclusie besproken.
Tenslotte zal er een overkoepelende conclusie inzicht geven in de richting van toekomstig
onderzoek.
Deel I: De karakterisatie en de translationele waarde van het PKU muismodel
In preklinische studies naar PKU wordt vaak gebruik gemaakt van het PKU muismodel. Dit
model draagt een mutatie in het gen voor PAH, zoals beschreven in de PKU patiënt6. Door deze
mutatie is er nagenoeg geen enzymatische activiteit, en stijgt Phe in het bloed en in het brein
van deze muizen. Er worden in PKU onderzoek twee verschillende genetische achtergronden/
muizenlijnen gebruikt. Deze muizenlijnen zijn onstaan door vele generaties nakomelingen
van dezelfde familie te fokken. Hierdoor ontstaat er een muizenlijn waarbij de individuen
genetisch gezien erg op elkaar lijken. Dit wordt gedaan om de variaties tussen dieren te
![Page 206: University of Groningen Phenylketonuria in mice and men ... · Phenylketonuria in mice and men Proefschrift ter verkrijging van de graad van doctor aan de Rijksuniversiteit Groningen](https://reader034.vdocuments.site/reader034/viewer/2022052611/5f03c1e37e708231d40a9ed0/html5/thumbnails/206.jpg)
512536-L-bw-Bruinenberg512536-L-bw-Bruinenberg512536-L-bw-Bruinenberg512536-L-bw-BruinenbergProcessed on: 15-8-2017Processed on: 15-8-2017Processed on: 15-8-2017Processed on: 15-8-2017 PDF page: 205PDF page: 205PDF page: 205PDF page: 205
A
205
Appendix I
verminderen zodat er uiteindelijk minder muizen gebruikt hoeven te worden. De mutatie in
het PAH enzym, die het tot een PKU muis maakt, is gemaakt binnen een specifieke muizenlijn.
De eerste muizenlijn waarin de mutatie is gemaakt was de BTBR (black-and tan, brachyury)
muis. Echter deze muizenlijn wordt niet vaak meer gebruikt in andere onderzoeksgebieden
omdat er afwijkende gedragingen en hersenstructuren gevonden zijn7–10. Daardoor werd door
terugkruisen de mutatie in de bekende B6 (C57Bl/6J) muizenlijn gezet. Beide muizenlijnen
hebben dezelfde puntmutatie in het PAH gen en laten verhoogde concentraties van Phe in
bloed en brein zien. Op dit moment worden beide muizenlijnen van het muizenmodel als
gelijken gezien ondanks het feit dat er uit andere onderzoeksgebieden duidelijke indicaties
zijn dat de genetische achtergrond het fenotypisch gedrag kan beïnvloeden11. Om deze reden
hebben wij in hoofdstuk 2 de volwassen mannen van beide muizenlijnen direct met elkaar
vergeleken. Wij hebben hierbij gekeken hebben naar verschillende gedragstesten en naar
de biochemische gevolgen van de mutatie zoals Phe en neurotransmitter concentraties. In
hoofdstuk 2 hebben we aangetoond dat er duidelijke verschillen zijn in gedrag tussen deze
muislijnen. Het meest opvallende verschil werd gevonden in de leer- en geheugentaken. De
PKU BTBR muis kon de leertaken niet succesvol volbrengen maar de PKU B6 kon dit wel.
Deze verschillen kunnen niet worden toegeschreven aan biochemische verschillen in Phe
concentraties of neurotransmitter concentraties van dopamine, serotonine en norepinefrine.
In hoofdstuk 2 hebben we enkel mannelijke muizen onderzocht omdat preklinisch onderzoek
zich meestal richt op mannen. Het wordt echter in de literatuur steeds duidelijker dat mannen
anders kunnen reageren dan vrouwen12–14. Daarom hebben we in hoofdstuk 3 dezelfde
gedragstesten uitgevoerd met volwassen vrouwelijke muizen van beide muizenlijnen. In deze
studie kwam naar voren dat de uitkomst in de gedragstesten niet alleen afhankelijk was van
de mutatie en de genetische achtergrond, maar ook van het geslacht. Zowel de PKU BTBR
vrouwen als de PKU B6 vrouwen lieten problemen zien in leren en geheugen in tegenstelling
tot de eerder gevonden resultaten in de PKU B6 mannen. Dit doet vermoeden dat de gevolgen
van de PAH mutatie op hersenfuncties anders kunnen zijn in een verschillende genetische
context en tussen mannen en vrouwen.
De gedragstesten gedaan in hoofdstuk 2 en 3 waren gebaseerd op PKU-gerelateerde
verstoringen beschreven in PKU onderzoek. Een verstoring die nooit direct was onderzocht
in PKU zijn slaap-gerelateerde verstoringen, ondanks gerapporteerde problemen in de
signaalmoleculen. In hoofdstuk 4 hebben wij gekeken naar de slaapkarakteristieken van
PKU patiënten en slaap/waak ritmen van PKU muizen (beide muizenlijnen, in mannen en
vrouwen). Wanneer wij PKU patiënten vergelijken met eerstegraads familie (ouders, broers,
zussen) dan zien wij meer slaapstoornissen en verminderde slaapkwaliteit. Tevens duurde
het bij de PKU patiënten langer om in slaap te vallen en waren zij overdag slaperiger. In
de PKU-muizen zagen we dat ze minder goed aaneengesloten actief en niet-actief gedrag
![Page 207: University of Groningen Phenylketonuria in mice and men ... · Phenylketonuria in mice and men Proefschrift ter verkrijging van de graad van doctor aan de Rijksuniversiteit Groningen](https://reader034.vdocuments.site/reader034/viewer/2022052611/5f03c1e37e708231d40a9ed0/html5/thumbnails/207.jpg)
512536-L-bw-Bruinenberg512536-L-bw-Bruinenberg512536-L-bw-Bruinenberg512536-L-bw-BruinenbergProcessed on: 15-8-2017Processed on: 15-8-2017Processed on: 15-8-2017Processed on: 15-8-2017 PDF page: 206PDF page: 206PDF page: 206PDF page: 206
206
Appendix I
konden laten zien en dat ze een deel van hun rustgedrag naar de actieve fase verschoven.
Beide experimenten ondersteunen de hypothese dat slaapgedrag in PKU is veranderd.
Deel II: Het effect van een specifieke nutrienten combinatie in PKU
De huidige behandelingsmethode is vaak moeilijk vol te houden voor PKU patiënten. Dit
kan leiden tot een verminderde naleving van het dieet waardoor Phe concentraties kunnen
stijgen en fluctueren15,16. Een nieuwe behandelingsstratergie zou zich kunnen richten op het
tegengaan van de negatieve effecten van Phe op de hersenen. In het brein zijn verschillende
domeinen beschreven die aangedaan zijn door hoge Phe concentraties, zoals neurotransmitter
metabolisme17, oxidatieve stress18, integriteit van de witte stof19 en het functioneren van
synapsen20. In hoofdstuk 5 wordt er gekeken in de literatuur of er specifieke nutriënten zijn
die deze domeinen positief kunnen beïnvloeden. Uit deze literatuurstudie komt naar voren
dat een combinatie van specifieke voedingsstoffen, zoals eerder beschreven in Alzheimer’s
onderzoek21, wellicht een positief effect zou kunnen hebben in PKU. Deze specifieke
nutriëntencombinatie (SNC) bestaat uit uridine monofosfaat (UMP), docosahexaeenzuur
(DHA), eicosapentaeenzuur (EPA), choline, fosfolipiden, foliumzuur, vitaminen B12,
B6, C en E en selenium. Deze combinatie was oorspronkelijk ontworpen om de synthese
van fosfolipiden, een belangrijk onderdeel van (synaptische) membranen, te verbeteren.
Tevens impliceerde de literatuurstudie ook positieve effecten op de andere drie domeinen.
In hoofdstuk 6 hebben we voor het eerst SNC-supplementatie toegepast bij B6 wildtype
(WT; broers en zussen zonder mutatie) en PKU-muizen. Uit deze studie kwam naar voren
dat drie maanden supplementeren van SNC een positief effect heeft op de post-synaptische
marker PSD-95 (postsynaptic marker-95), in specifieke subregio’s van de hippocampus; een
hersengebied belangrijk in leren en geheugen. Op basis hiervan werd de hypothese gesteld
dat de mogelijke verbetering in het synaptische functioneren in dit gebied zou kunnen zorgen
voor een verbetering in leren en geheugen. Dit hebben we onderzocht in hoofdstuk 7 waarbij
we hebben gekeken of SNC supplementatie een positief effect kan hebben op het gedrag
van BTBR WT en PKU muizen (mannen en vrouwen). In deze langdurige interventiestudie
tonen we aan dat het supplementeren van SNC een positief effect heeft op een bepaald soort
geheugen, onafhankelijk van de Phe concentraties in het voer. Of dit komt door een positief
effect op één van de vier domeinen is niet duidelijk. In deze studie hebben we slechts gekeken
naar het neurotransmitter metabolisme en binnen de PKU muizen zagen we geen effect
van SNC supplementatie op de neurotransmitters serotonine, norepinefrine of dopamine.
Toekomstig onderzoek zou zich moeten richten op het vaststellen van de onderliggende
mechanismen van de effecten van SNC-supplementatie in PKU.
Deel III: Grote neutrale aminozuren supplementatie in PKU
Phe wordt getransporteerd over de bloed-hersenbarrière door middel van een “large
neutral amino acid transporter 1” (LAT1)22. Deze transporter deelt Phe met andere grote
neutrale aminozuren (LNAA’s), waarbij de onderlinge verhoudingen tussen de aminozuren
![Page 208: University of Groningen Phenylketonuria in mice and men ... · Phenylketonuria in mice and men Proefschrift ter verkrijging van de graad van doctor aan de Rijksuniversiteit Groningen](https://reader034.vdocuments.site/reader034/viewer/2022052611/5f03c1e37e708231d40a9ed0/html5/thumbnails/208.jpg)
512536-L-bw-Bruinenberg512536-L-bw-Bruinenberg512536-L-bw-Bruinenberg512536-L-bw-BruinenbergProcessed on: 15-8-2017Processed on: 15-8-2017Processed on: 15-8-2017Processed on: 15-8-2017 PDF page: 207PDF page: 207PDF page: 207PDF page: 207
A
207
Appendix I
van belang zijn. De binding van Phe aan deze transporter is erg hoog waardoor de hoge
concentraties Phe, zoals gezien in PKU, de overdracht van andere LNAA’s hinderen. Dit zorgt
ervoor dat naast de verhoogde Phe concentraties in het brein, verlaagde concentraties van
andere LNAA’s (non-Phe LNAA’s) in het brein gevonden worden23,24. Non-Phe LNAA’s zijn
belangrijk voor eiwitsynthese en twee van deze non-Phe LNAA’s, tyrosine en tryptofaan, zijn
belangrijke voorlopers van neurotransmitters. Het herstellen van de onderlinge verhoudingen
zou ervoor kunnen zorgen dat er verbeteringen optreden op drie verschillende vlakken; 1) er
wordt minder Phe het brein in getransporteerd, 2) non-Phe LNAA concentraties herstellen,
3) neurotransmitter concentraties verbeteren.
In hoofdstuk 8 hebben we eerst alle non-Phe LNAA’s (in gelijke delen, behalve threonine)
gegeven aan B6 WT- en PKU muizen (mannen en vrouwen), zoals eerder beschreven bij Pietz
et al. 1999 in PKU patiënten. We vonden verbeteringen op alle drie verschillende vlakken;
1) Phe concentraties waren verminderd in het brein, 2) de concentratie van sommige
non-Phe LNAA’s waren verbeterd 3) de neurotransmitters, serotonine en norepinefrine,
lieten verbeteringen zien. De resultaten gevonden in hoofdstuk 8 werden gebruikt om
de verhoudingen tussen de LNAA’s te verbeteren. Deze werden getest in hoofdstuk 9. Er
werden verschillende samenstellingen van non-Phe LNAA’s gebruikt. Elk dieet was gericht
op een bepaalde doelstelling, bijvoorbeeld door in het dieet slechts tyrosine en tryptofaan te
supplementeren zodat doel 3 (neurotransmitters concentraties verbeteren) gehaald wordt.
Vijf verschillende diëten voor PKU muizen werden vergeleken met een controle dieet gegeven
aan PKU en WT muizen en een hoog eiwit dieet voor PKU muizen. Per doel leverde dit de
volgende resultaten op: 1) Phe concentraties in het brein konden verlaagd worden door
LNAA behandeling met en zonder threonine en door suppletie van leucine en isoleucine, 2)
een verbetering in de concentratie van de non-Phe LNAA’s werd gevonden als die specifieke
LNAA was gesupplementeerd in het dieet, en 3) neurotransmitter concentraties verbeterde
wanneer het dieet enkel tyrosine en tryptofaan bevatte in beide LNAA diëten (met en zonder
threonine). Deze verbeteringen in het brein waren overigens niet altijd te zien in het bloed
van de muizen.
ALGEMENE CONCLUSIE
In dit proefschrift heb ik van verschillende kanten gekeken naar de PKU problematiek. Door
me niet te beperken tot één gedachte, heb ik op verschillende vlakken kunnen bijdragen aan
de huidige kennis over PKU. In de basis heb ik laten zien dat zowel de twee muizenlijnen
als mannen en vrouwen verschillen van elkaar. En dat toekomstig onderzoek, en de
voortvloeiende conclusies, hier rekening mee moeten houden. Tevens heb ik laten zien dat
er nog steeds onbekende aspecten van de ziekte zijn, zoals slaap-gerelateerde problemen.
Tenslotte heb ik twee nieuwe behandelingsstrategieën bekeken die hopelijk in de toekomst
de behandeling van PKU kunnen verbeteren. Overkoepelend heb ik laten zien dat Phe
![Page 209: University of Groningen Phenylketonuria in mice and men ... · Phenylketonuria in mice and men Proefschrift ter verkrijging van de graad van doctor aan de Rijksuniversiteit Groningen](https://reader034.vdocuments.site/reader034/viewer/2022052611/5f03c1e37e708231d40a9ed0/html5/thumbnails/209.jpg)
512536-L-bw-Bruinenberg512536-L-bw-Bruinenberg512536-L-bw-Bruinenberg512536-L-bw-BruinenbergProcessed on: 15-8-2017Processed on: 15-8-2017Processed on: 15-8-2017Processed on: 15-8-2017 PDF page: 208PDF page: 208PDF page: 208PDF page: 208
208
Appendix I
concentraties in het bloed, de parameter die nu als leidraad wordt gebruikt in PKU patiënten
om de ziekte te monitoren, niet geheel voorspellend is voor de functionele uitkomst van
de ziekte. Voor de toekomst hoop ik dat dit fundamentele onderzoek zal bijdragen aan de
verbetering van de huidige behandelingsmethoden van PKU.
![Page 210: University of Groningen Phenylketonuria in mice and men ... · Phenylketonuria in mice and men Proefschrift ter verkrijging van de graad van doctor aan de Rijksuniversiteit Groningen](https://reader034.vdocuments.site/reader034/viewer/2022052611/5f03c1e37e708231d40a9ed0/html5/thumbnails/210.jpg)
512536-L-bw-Bruinenberg512536-L-bw-Bruinenberg512536-L-bw-Bruinenberg512536-L-bw-BruinenbergProcessed on: 15-8-2017Processed on: 15-8-2017Processed on: 15-8-2017Processed on: 15-8-2017 PDF page: 209PDF page: 209PDF page: 209PDF page: 209
A
209
Appendix I
REFERENTIES
1 Blau N, van Spronsen FJ, Levy HL.
Phenylketonuria. Lancet 2010; 376: 1417–
27.
2 van Spronsen FJ, van Wegberg AM, Ahring
K, Bélanger-Quintana A, Blau N, Bosch
AM et al. Key European guidelines for
the diagnosis and management of patients
with phenylketonuria. Lancet Diabetes
Endocrinol 2017. doi:10.1016/S2213-
8587(16)30320-5.
3 Moyle JJ, Fox AM, Arthur M, Bynevelt
M, Burnett JR. Meta-analysis of
neuropsychological symptoms of adolescents
and adults with PKU. Neuropsychol Rev
2007; 17: 91–101.
4 Enns GM, Koch R, Brumm V, Blakely E,
Suter R, Jurecki E. Suboptimal outcomes in
patients with PKU treated early with diet
alone: revisiting the evidence. Mol Genet
Metab; 101: 99–109.
5 Jahja R, van Spronsen FJ, de Sonneville
LMJ, van der Meere JJ, Bosch AM, Hollak
CEM et al. Social-cognitive functioning and
social skills in patients with early treated
phenylketonuria: a PKU-COBESO study. J
Inherit Metab Dis 2016; 39: 355–362.
6 Shedlovsky A, McDonald JD, Symula
D, Dove WF. Mouse models of human
phenylketonuria. Genetics 1993; 134:
1205–10.
7 Wahlsten D, Metten P, Crabbe JC. Survey of
21 inbred mouse strains in two laboratories
reveals that BTBR T/+ tf/tf has severely
reduced hippocampal commissure and
absent corpus callosum. Brain Res 2003;
971: 47–54.
8 Ding Z, Georgiev P, Thöny B.
Administration-route and gender-
independent long-term therapeutic
correction of phenylketonuria (PKU) in
a mouse model by recombinant adeno-
associated virus 8 pseudotyped vector-
mediated gene transfer. Gene Ther 2006; 13:
587–593.
9 MacPherson P, McGaffigan R, Wahlsten D,
Nguyen P V. Impaired fear memory, altered
object memory and modified hippocampal
synaptic plasticity in split-brain mice. Brain
Res 2008; 1210: 179–88.
10 Jones-Davis DM, Yang M, Rider E, Osbun
NC, da Gente GJ, Li J et al. Quantitative
trait loci for interhemispheric commissure
development and social behaviors in the
BTBR T+ tf/J mouse model of autism. PLoS
One 2013; 8: e61829.
11 Sittig LJ, Carbonetto P, Engel KA, Krauss
KS, Barrios-Camacho CM, Palmer AA.
Genetic Background Limits Generalizability
of Genotype-Phenotype Relationships.
Neuron 2016; 91: 1253–1259.
12 Miller LR, Marks C, Becker JB, Hurn PD,
Chen W-J, Woodruff T et al. Considering
sex as a biological variable in preclinical
research. FASEB J 2017; 31: 29–34.
13 Soldin OP, Mattison DR. Sex differences in
pharmacokinetics and pharmacodynamics.
Clin Pharmacokinet 2009; 48: 143–57.
14 Sandberg K, Umans JG, Georgetown
Consensus Conference Work Group the
GCCW. Recommendations concerning
the new U.S. National Institutes of Health
initiative to balance the sex of cells and
animals in preclinical research. FASEB J
2015; 29: 1646–52.
![Page 211: University of Groningen Phenylketonuria in mice and men ... · Phenylketonuria in mice and men Proefschrift ter verkrijging van de graad van doctor aan de Rijksuniversiteit Groningen](https://reader034.vdocuments.site/reader034/viewer/2022052611/5f03c1e37e708231d40a9ed0/html5/thumbnails/211.jpg)
512536-L-bw-Bruinenberg512536-L-bw-Bruinenberg512536-L-bw-Bruinenberg512536-L-bw-BruinenbergProcessed on: 15-8-2017Processed on: 15-8-2017Processed on: 15-8-2017Processed on: 15-8-2017 PDF page: 210PDF page: 210PDF page: 210PDF page: 210
210
Appendix I
15 Walter JH. Vitamin B12 deficiency and
phenylketonuria. Mol Genet Metab 2011;
104 Suppl: S52-4.
16 MacDonald A, Gokmen-Ozel H, van
Rijn M, Burgard P. The reality of dietary
compliance in the management of
phenylketonuria. J Inherit Metab Dis 2010;
33: 665–70.
17 Burlina AB, Bonafé L, Ferrari V, Suppiej
A, Zacchello F, Burlina AP. Measurement
of neurotransmitter metabolites in the
cerebrospinal fluid of phenylketonuric
patients under dietary treatment. J Inherit
Metab Dis 2000; 23: 313–6.
18 Ribas GS, Sitta A, Wajner M, Vargas CR.
Oxidative stress in phenylketonuria: what is
the evidence? Cell Mol Neurobiol 2011; 31:
653–62.
19 Anderson PJ, Leuzzi V. White matter
pathology in phenylketonuria. Mol Genet
Metab 2010; 99 Suppl 1: S3-9.
20 Horling K, Schlegel G, Schulz S, Vierk R,
Ullrich K, Santer R et al. Hippocampal
synaptic connectivity in phenylketonuria.
Hum Mol Genet 2014. doi:10.1093/hmg/
ddu515.
21 van Wijk N, Broersen LM, de Wilde MC,
Hageman RJJ, Groenendijk M, Sijben
JWC et al. Targeting synaptic dysfunction
in Alzheimer’s disease by administering a
specific nutrient combination. J Alzheimers
Dis 2014; 38: 459–79.
22 Kanai Y, Segawa H, Miyamoto K i, Uchino
H, Takeda E, Endou H. Expression cloning
and characterization of a transporter for
large neutral amino acids activated by the
heavy chain of 4F2 antigen (CD98). J Biol
Chem 1998; 273: 23629–32.
23 van Spronsen FJ, Hoeksma M, Reijngoud
D-J. Brain dysfunction in phenylketonuria:
is phenylalanine toxicity the only possible
cause? J Inherit Metab Dis 2009; 32: 46–51.
24 de Groot MJ, Sijens PE, Reijngoud
D-J, Paans AM, van Spronsen FJ.
Phenylketonuria: brain phenylalanine
concentrations relate inversely to cerebral
protein synthesis. J Cereb Blood Flow
Metab 2015; 35: 200–5.
![Page 212: University of Groningen Phenylketonuria in mice and men ... · Phenylketonuria in mice and men Proefschrift ter verkrijging van de graad van doctor aan de Rijksuniversiteit Groningen](https://reader034.vdocuments.site/reader034/viewer/2022052611/5f03c1e37e708231d40a9ed0/html5/thumbnails/212.jpg)
512536-L-bw-Bruinenberg512536-L-bw-Bruinenberg512536-L-bw-Bruinenberg512536-L-bw-BruinenbergProcessed on: 15-8-2017Processed on: 15-8-2017Processed on: 15-8-2017Processed on: 15-8-2017 PDF page: 211PDF page: 211PDF page: 211PDF page: 211
A
211
Appendix I
![Page 213: University of Groningen Phenylketonuria in mice and men ... · Phenylketonuria in mice and men Proefschrift ter verkrijging van de graad van doctor aan de Rijksuniversiteit Groningen](https://reader034.vdocuments.site/reader034/viewer/2022052611/5f03c1e37e708231d40a9ed0/html5/thumbnails/213.jpg)
512536-L-bw-Bruinenberg512536-L-bw-Bruinenberg512536-L-bw-Bruinenberg512536-L-bw-BruinenbergProcessed on: 15-8-2017Processed on: 15-8-2017Processed on: 15-8-2017Processed on: 15-8-2017 PDF page: 212PDF page: 212PDF page: 212PDF page: 212
![Page 214: University of Groningen Phenylketonuria in mice and men ... · Phenylketonuria in mice and men Proefschrift ter verkrijging van de graad van doctor aan de Rijksuniversiteit Groningen](https://reader034.vdocuments.site/reader034/viewer/2022052611/5f03c1e37e708231d40a9ed0/html5/thumbnails/214.jpg)
512536-L-bw-Bruinenberg512536-L-bw-Bruinenberg512536-L-bw-Bruinenberg512536-L-bw-BruinenbergProcessed on: 15-8-2017Processed on: 15-8-2017Processed on: 15-8-2017Processed on: 15-8-2017 PDF page: 213PDF page: 213PDF page: 213PDF page: 213
APPENDIX IIDankwoord
![Page 215: University of Groningen Phenylketonuria in mice and men ... · Phenylketonuria in mice and men Proefschrift ter verkrijging van de graad van doctor aan de Rijksuniversiteit Groningen](https://reader034.vdocuments.site/reader034/viewer/2022052611/5f03c1e37e708231d40a9ed0/html5/thumbnails/215.jpg)
512536-L-bw-Bruinenberg512536-L-bw-Bruinenberg512536-L-bw-Bruinenberg512536-L-bw-BruinenbergProcessed on: 15-8-2017Processed on: 15-8-2017Processed on: 15-8-2017Processed on: 15-8-2017 PDF page: 214PDF page: 214PDF page: 214PDF page: 214
214
Appendix II
Nu ik hier aan het einde van mijn promotieonderzoek sta, overheerst het gevoel dat ik hier
niet alleen sta. Ik zou graag in dit gedeelte van mij proefschrift uitspreken hoe dankbaar ik
jullie ben voor jullie bijdrage aan dit proefschrift, op welke manier dan ook. In dit dankwoord
zou ik graag zoveel mogelijk specifiek mensen bedanken, maar mocht je jezelf hieronder niet
terug vinden dan wil ik je toch graag bedanken, ten eerste, voor het lezen van (dit deel) van
mij proefschrift en, ten tweede, voor jouw aandeel aan dit proefschrift. Oprecht geloof ik dat
alle kleine beetjes het grotere geheel maken.
Ik zou graag beginnen met het bedanken van mijn promotoren prof.dr. Eddy van der Zee en
prof. dr. Francjan van Spronsen.
Beste Eddy, ik mocht mijn eerste onderzoeksstage van mijn master bij jou lopen. Ik genoot
meteen van de vrijheid die ik kreeg en als ik het mij goed herinner heb ik je slechts 3 keer
face-to-face gesproken. Het verbaasde mij dan ook wel een beetje (en misschien jou ook),
dat je meteen positief reageerde toen ik 1,5 jaar later je kamer instapte om te vragen of
ik misschien de PhD positie mocht hebben waar je die ochtend geld voor had gekregen.
Omdat ik eigenlijk niet eens wist waar het geld precies voor was, had ik eerst een introductie
gesprek nodig. Je wist me al snel te enthousiast te krijgen voor PKU én er waren vast ook
wel slaapproblemen. Dit was het begin van een traject waarbij ik altijd het gevoel had dat
je achter me stond. Je liet me altijd vrij om mijn eigen beslissingen te maken, wist me te
remmen wanneer het nodig was en te stimuleren om positief te kijken naar mijn data als ik
de limitaties zag. Ik heb bewondering voor jouw inzicht in mensen en ik kijk met veel plezier
terug aan de gesprekken die we hadden over perfecte (maar onmogelijke) experimenten en
de nu gedeelde hobby: paarden.
Beste Francjan, ik kan me nog goed herrineren hoe ik als “bioloog” opgenomen werd in
de UMCG groep. Het onthaal was ontzettend hartelijk, maar mijn liefde voor het werken
met muizen werd niet volledig begrepen. Hoezo moest ik bijvoorbeeld muizen helpen met
de bevalling? Ondanks dat, heb ik mij door jou altijd thuis gevoeld in de UMCG groep.
De mogelijkheden die ik kreeg om elk jaar naar de PKU congressen te gaan, heeft mij heel
wat van de wereld laten zien. Samen met Eddy, zorgden jullie voor de perfecte balans. Jij
gaf mij meer sturing op zoek naar een gerichte boodschap/conclusie/deadline en stelde je
gerichte vragen over wat de implicaties waren voor de kliniek. Bedankt voor het zijn van het
tegengewicht.
Hoewel de promoters natuurlijk aan de basis stonden van mij Phd zou ik graag ook de
mensen willen bedanken waardoor het werk ook daadwerkelijk mogelijk was. Bedankt,
team van Nutricia: Amos, Mirjam, Maryam, Danielle, Martin en Egbert.
![Page 216: University of Groningen Phenylketonuria in mice and men ... · Phenylketonuria in mice and men Proefschrift ter verkrijging van de graad van doctor aan de Rijksuniversiteit Groningen](https://reader034.vdocuments.site/reader034/viewer/2022052611/5f03c1e37e708231d40a9ed0/html5/thumbnails/216.jpg)
512536-L-bw-Bruinenberg512536-L-bw-Bruinenberg512536-L-bw-Bruinenberg512536-L-bw-BruinenbergProcessed on: 15-8-2017Processed on: 15-8-2017Processed on: 15-8-2017Processed on: 15-8-2017 PDF page: 215PDF page: 215PDF page: 215PDF page: 215
A
215
Appendix II
Tevens wou ik graag mijn leescommissie bedanken voor het lezen van mijn thesis. Thank
you, prof. dr. C.O. Harding, prof. dr. S. Spijker, and prof. dr. G.J. van Dijk.
Vervolgens zou ik graag de mensen willen bedanken die een substantiele bijdrage hebben
geleverd aan mijn PhD maar waarbij dit helaas niet heeft geresulteerd in een hoofdstuk. Dear
Tiziana Pascucci and Elena Fiori, thank you for the BTBR PKU mice and the opportunity to
work with you on your comprehensive study. Dear Gjalt, Christine and Nick, thank you for
given me the feeling that our PKU research could have been in Nature/Science. Despite our
efforts we were not able to succeed with our PKU mice but I still believe a great deal in your
work. I hope that someday your PKU article will turn up in one of those journals.
Het werk beschreven in deze thesis was ook niet mogelijk geweest door alle hulp van
ondersteunende krachten. Beginnend met de ruggengraat van de afdeling, de analisten;
Kunja, Jan, Wanda, Folkert en Roel. Heel erg bedankt voor de vele adviezen en hulp bij tig
kleuringen, perfusies en macro’s voor de microscoop. Ik heb het altijd super gewaardeerd
dat jullie letterlijk elk moment van de dag klaar staan voor mij en alle studenten. En Wanda,
ik moet bekennen dat ik nu nog ergens opgesloten zou zitten als jij mij niet elke keer in
het weekend bevrijdde. Verder, vooral aan het einde van mijn Phd, met de groeiende fok,
was het niet meer te doen om alleen zorg te dragen voor alle PKU dieren. Ik zou graag
alle dierverzorgers; Sinterklaas, Roelie, Martijn, Saskia, Linda, Bo, Wendy, Sjoerd, Brendan
en Diane, bedanken voor jullie ondersteuning en de goede zorg voor de dieren. Tenslotte,
heb ik tijdens mijn PhD veel ondersteuning gehad van HBO/bachelor/master studenten. Els,
Lisette, Minke, Roosmarijn, Wim, Kirsten, Julia, Rafaella, Stefan, Corrine, Mariecke, Anne,
Nienke, Jelmer, Iris, Delan, Cas en Birgit. Super bedankt voor jullie inzet, harde werken en
gezelligheid.
En dan als laatste, zou ik graag de mensen bedanken waardoor het werk zo leuk was om te
doen.
Kees en Robbert jullie waren mijn begeleiders van mijn stages tijdens mijn master project.
Bedankt, voor jullie goede begeleiding van mijn projecten. Door jullie sturing maar ook
vooral het vertrouwen in mijn zelfstandigheid, heb ik een goede basis gekregen voor mijn
Phd. Ik was vereerd om tijdens mijn PhD een collega te worden van jullie en ben erg blij dat
dit uiteindelijk is uitgegroeid tot een vriendschap.
Lieve “UMCG- mensen” (Martijn, Danique, Rianne, Annemieke, Esther, Karen, Priscila,
Wiggert) wat hebben we samen wat mooie tijden beleefd op congres. De tripjes naar
Barcelona, Berlijn, Antwerpen, Rome etc. zullen mij altijd bij blijven. Jullie inzichten in de
PKU-patiënt gaven mij vooral in het begin van mijn PhD context en ik heb daarom veel van
jullie kunnen leren, bedankt.
![Page 217: University of Groningen Phenylketonuria in mice and men ... · Phenylketonuria in mice and men Proefschrift ter verkrijging van de graad van doctor aan de Rijksuniversiteit Groningen](https://reader034.vdocuments.site/reader034/viewer/2022052611/5f03c1e37e708231d40a9ed0/html5/thumbnails/217.jpg)
512536-L-bw-Bruinenberg512536-L-bw-Bruinenberg512536-L-bw-Bruinenberg512536-L-bw-BruinenbergProcessed on: 15-8-2017Processed on: 15-8-2017Processed on: 15-8-2017Processed on: 15-8-2017 PDF page: 216PDF page: 216PDF page: 216PDF page: 216
216
Appendix II
Het was een komen en gaan van PhD-ers tijdens mijn tijd op het Zernicke. En hoewel ik
nu aansluit in de rij van Phd-ers die gaan, heb ik het gevoel dat er vriendschappen zijn
onstaan die blijven. Kees, Martijn, Iris, Erin, Leonie, Kata, Yun, Doortje, Priscila, Els,
Frank, Peter, Marelle, Ewelina, Vincent, mijn mede-Henk’s kanjers; Henriëtte, Paulien,
Jan S., Fiona en Simon bedankt voor jullie gezelligheid. Het wordt een beetje een pick
and match maar bedankt voor de Phd-dinners, stapavonden, sinterklaastaferelen, etentjes,
lunches, kopjes thee, eierballen, hardloop-rondjes om het Zernicke, en albert hein to-
go tripjes. De weekenden, de feestdagen, en de morning-afters zijn absoluut dragelijker
geworden door jullie.
Lieve Daniëlle (Daan) en Jorien (Jo), mijn partners in crime. Wat hebben we veel samen
meegemaakt en wat ben ik ontzettend trots dat jullie mijn vriendinnen zijn. Jullie humor,
enthousiasme, en dommigheid maakt alles gewoon net wat leuker. Ik durf het bijna niet op
zo’n officiële plek vast te leggen, maar “echte liefde onverwoestbaar”.
Lieve Pappa en Mamma, jullie steun is mij ontzettend waardevol geweest. Jullie geven mij
balans. Pappa, wanneer ik een steuntje in mijn rug nodig had om nog even door te gaan,
stond jij daar om me aan te moedigen om dat gas nog even wat harder in te trappen. Mamma,
als het allemaal even teveel werd, kon ik bij jou terecht om te horen dat ik in mijzelf moest
geloven en vooral op mijzelf moest passen. Vooral jullie steun en vertrouwen heeft er voor
gezorgd dat dit boekje heb kunnen afronden. Hoe dankbaar ik ben dat ik deze dag met jullie
beide aan mij zij kan vieren, is niet uit de drukken in woorden. Lieve JP, mijn grote broer,
wat ben ik trots dat ik je kleine zusje mag zijn. Ik kan me nog goed herinneren dat je me
belde tijdens het voeren van de muizen dat jullie (samen met Marloes) in verwachting waren
van jullie dochter, mijn nichtje, Niva. Wat zijn jullie een mooi gezin en wat ben ik trots dat
ik tante ben geworden.
En tot slot, lieve Daan, halverwege in het proces kwam jij om de hoek kijken. Ik was bang
dat mijn onmogelijke uren je misschien op afstand zouden houden maar niets was minder
waar. Ik kan me nog goed herinneren dat je ’s avonds voor het eerst mee bent gegaan naar
mijn werk zodat ik een ziek muisje kon controleren én dat je me hielp met het vieste klusje
bij het offeren van dieren (Els is je denk ik nog steeds dankbaar). Ik wil je graag ontzettend
bedanken voor het feit dat je altijd voor mij klaar staat. Ik kijk ontzettend uit naar de
avonturen die we nog gaan beleven.
![Page 218: University of Groningen Phenylketonuria in mice and men ... · Phenylketonuria in mice and men Proefschrift ter verkrijging van de graad van doctor aan de Rijksuniversiteit Groningen](https://reader034.vdocuments.site/reader034/viewer/2022052611/5f03c1e37e708231d40a9ed0/html5/thumbnails/218.jpg)
512536-L-bw-Bruinenberg512536-L-bw-Bruinenberg512536-L-bw-Bruinenberg512536-L-bw-BruinenbergProcessed on: 15-8-2017Processed on: 15-8-2017Processed on: 15-8-2017Processed on: 15-8-2017 PDF page: 217PDF page: 217PDF page: 217PDF page: 217
A
217
Appendix II
![Page 219: University of Groningen Phenylketonuria in mice and men ... · Phenylketonuria in mice and men Proefschrift ter verkrijging van de graad van doctor aan de Rijksuniversiteit Groningen](https://reader034.vdocuments.site/reader034/viewer/2022052611/5f03c1e37e708231d40a9ed0/html5/thumbnails/219.jpg)
512536-L-bw-Bruinenberg512536-L-bw-Bruinenberg512536-L-bw-Bruinenberg512536-L-bw-BruinenbergProcessed on: 15-8-2017Processed on: 15-8-2017Processed on: 15-8-2017Processed on: 15-8-2017 PDF page: 218PDF page: 218PDF page: 218PDF page: 218
![Page 220: University of Groningen Phenylketonuria in mice and men ... · Phenylketonuria in mice and men Proefschrift ter verkrijging van de graad van doctor aan de Rijksuniversiteit Groningen](https://reader034.vdocuments.site/reader034/viewer/2022052611/5f03c1e37e708231d40a9ed0/html5/thumbnails/220.jpg)
512536-L-bw-Bruinenberg512536-L-bw-Bruinenberg512536-L-bw-Bruinenberg512536-L-bw-BruinenbergProcessed on: 15-8-2017Processed on: 15-8-2017Processed on: 15-8-2017Processed on: 15-8-2017 PDF page: 219PDF page: 219PDF page: 219PDF page: 219
APPENDIX IIICurriculum Vitae
![Page 221: University of Groningen Phenylketonuria in mice and men ... · Phenylketonuria in mice and men Proefschrift ter verkrijging van de graad van doctor aan de Rijksuniversiteit Groningen](https://reader034.vdocuments.site/reader034/viewer/2022052611/5f03c1e37e708231d40a9ed0/html5/thumbnails/221.jpg)
512536-L-bw-Bruinenberg512536-L-bw-Bruinenberg512536-L-bw-Bruinenberg512536-L-bw-BruinenbergProcessed on: 15-8-2017Processed on: 15-8-2017Processed on: 15-8-2017Processed on: 15-8-2017 PDF page: 220PDF page: 220PDF page: 220PDF page: 220
220
Appendix III
![Page 222: University of Groningen Phenylketonuria in mice and men ... · Phenylketonuria in mice and men Proefschrift ter verkrijging van de graad van doctor aan de Rijksuniversiteit Groningen](https://reader034.vdocuments.site/reader034/viewer/2022052611/5f03c1e37e708231d40a9ed0/html5/thumbnails/222.jpg)
512536-L-bw-Bruinenberg512536-L-bw-Bruinenberg512536-L-bw-Bruinenberg512536-L-bw-BruinenbergProcessed on: 15-8-2017Processed on: 15-8-2017Processed on: 15-8-2017Processed on: 15-8-2017 PDF page: 221PDF page: 221PDF page: 221PDF page: 221
A
221
Appendix III
Vibeke Marijn Bruinenberg was born on 19 June 1988 in Groningen, The Netherlands. After
completing her pre-university education (VWO: two profiles Natuur &Techniek, Natuur &
Gezondheid + economics) in 2006, she started her bachelor’s in Life science & Technology.
Within this bachelor, she specialized in behavior and neuroscience. After graduating in 2009,
she got accepted for the research master Behavioral and Cognitive neuroscience. In this
master, she completed two internships, one at the lab of prof. E.A. van der Zee, University
of Groningen (the Netherlands) and the other in the lab of prof. dr. T. Abel, University of
Pennsylvania (United States of America). In the first internship, she investigated the effect
of a passive form of exercise, whole body stimulation, on the circadian rhythm of aging
mice under the supervision of C Mulder. In her second internship, she investigated together
with dr. R. Havekes the molecular mechanisms of hippocampal memory formation and the
consequences of insufficient sleep. In these studies, she worked with adeno associated viruses
to specifically alter mechanism to improve learning and memory after sleep deprivation. In
2011, she graduated the research master with honors. Hereafter, she completed the courses
of the master Science Business and Policy. Before starting her internship, she started to work
as research assistant at the department of molecular neurobiology, University of Groningen,
in 2012. In 2014, this resulted in a Phd candidacy funded by Nutricia research (Utrecht,
the Netherlands) at the Department of Molecular Neurobiology (University of Groningen,
the Netherlands) and Beatrix Children’s Hospital (University Medical Center Groningen,
the Netherlands) under the supervision of prof. dr. E.A. van der Zee and prof. dr. FJ van
Spronsen. The results of her PhD are summarized in this dissertation.
![Page 223: University of Groningen Phenylketonuria in mice and men ... · Phenylketonuria in mice and men Proefschrift ter verkrijging van de graad van doctor aan de Rijksuniversiteit Groningen](https://reader034.vdocuments.site/reader034/viewer/2022052611/5f03c1e37e708231d40a9ed0/html5/thumbnails/223.jpg)
512536-L-bw-Bruinenberg512536-L-bw-Bruinenberg512536-L-bw-Bruinenberg512536-L-bw-BruinenbergProcessed on: 15-8-2017Processed on: 15-8-2017Processed on: 15-8-2017Processed on: 15-8-2017 PDF page: 222PDF page: 222PDF page: 222PDF page: 222
![Page 224: University of Groningen Phenylketonuria in mice and men ... · Phenylketonuria in mice and men Proefschrift ter verkrijging van de graad van doctor aan de Rijksuniversiteit Groningen](https://reader034.vdocuments.site/reader034/viewer/2022052611/5f03c1e37e708231d40a9ed0/html5/thumbnails/224.jpg)
512536-L-bw-Bruinenberg512536-L-bw-Bruinenberg512536-L-bw-Bruinenberg512536-L-bw-BruinenbergProcessed on: 15-8-2017Processed on: 15-8-2017Processed on: 15-8-2017Processed on: 15-8-2017 PDF page: 223PDF page: 223PDF page: 223PDF page: 223
APPENDIX IVPublications
![Page 225: University of Groningen Phenylketonuria in mice and men ... · Phenylketonuria in mice and men Proefschrift ter verkrijging van de graad van doctor aan de Rijksuniversiteit Groningen](https://reader034.vdocuments.site/reader034/viewer/2022052611/5f03c1e37e708231d40a9ed0/html5/thumbnails/225.jpg)
512536-L-bw-Bruinenberg512536-L-bw-Bruinenberg512536-L-bw-Bruinenberg512536-L-bw-BruinenbergProcessed on: 15-8-2017Processed on: 15-8-2017Processed on: 15-8-2017Processed on: 15-8-2017 PDF page: 224PDF page: 224PDF page: 224PDF page: 224
224
Appendix IV
Bruinenberg VM, Gordijn MCM, MacDonald A, van Spronsen FJ, Van der Zee EA. Sleep
Disturbances in Phenylketonuria: An Explorative Study in Men and Mice. Front Neurol.
2017 Apr 26;8:167. doi: 10.3389/fneur.2017.00167. eCollection 2017.
Bruinenberg VM, van der Goot E, van Vliet D, de Groot MJ, Mazzola PN, Heiner-Fokkema
MR, van Faassen M, van Spronsen FJ, van der Zee EA. The Behavioral Consequence of
Phenylketonuria in Mice Depends on the Genetic Background. Front Behav Neurosci. 2016
Dec 20;10:233. doi: 10.3389/fnbeh.2016.00233. eCollection 2016.
van Vliet D, Bruinenberg VM, Mazzola PN, van Faassen MH, de Blaauw P, Pascucci T,
Puglisi-Allegra S, Kema IP, Heiner-Fokkema MR, van der Zee EA, van Spronsen FJ.
Therapeutic brain modulation with targeted large neutral amino acid supplements in the
Pah-enu2 phenylketonuria mouse model. Am J Clin Nutr. 2016 Nov;104(5):1292-1300.
Epub 2016 Sep 21.
Havekes R, Park AJ, Tolentino RE, Bruinenberg VM, Tudor JC, Lee Y, Hansen RT, Guercio
LA, Linton E, Neves-Zaph SR, Meerlo P, Baillie GS, Houslay MD, Abel T. Compartmentalized
PDE4A5 Signaling Impairs Hippocampal Synaptic Plasticity and Long-Term Memory.J
Neurosci. 2016 Aug 24;36(34):8936-46. doi: 10.1523/JNEUROSCI.0248-16.2016.
Havekes R, Park AJ, Tudor JC, Luczak VG, Hansen RT, Ferri SL, Bruinenberg VM,
Poplawski SG, Day JP, Aton SJ, Radwańska K, Meerlo P, Houslay MD, Baillie GS, Abel T.
Sleep deprivation causes memory deficits by negatively impacting neuronal connectivity in
hippocampal area CA1. Elife. 2016 Aug 23;5. pii: e13424. doi: 10.7554/eLife.13424.
Bruinenberg VM, van Vliet D, Attali A, de Wilde MC, Kuhn M, van Spronsen FJ, van
der Zee EA. A Specific Nutrient Combination Attenuates the Reduced Expression of PSD-
95 in the Proximal Dendrites of Hippocampal Cell Body Layers in a Mouse Model of
Phenylketonuria. Nutrients. 2016 Mar 26;8(4):185. doi: 10.3390/nu8040185.
van Vliet D, Bruinenberg VM, Mazzola PN, van Faassen MH, de Blaauw P, Kema IP, Heiner-
Fokkema MR, van Anholt RD, van der Zee EA, van Spronsen FJ. Large Neutral Amino Acid
Supplementation Exerts Its Effect through Three Synergistic Mechanisms: Proof of Principle
in Phenylketonuria Mice. PLoS One. 2015 Dec 1;10(12):e0143833. doi: 10.1371/journal.
pone.0143833. eCollection 2015.
Mazzola PN, Bruinenberg V, Anjema K, van Vliet D, Dutra-Filho CS, van Spronsen FJ, van
der Zee EA. Voluntary Exercise Prevents Oxidative Stress in the Brain of Phenylketonuria
Mice. JIMD Rep. 2016;27:69-77. doi: 10.1007/8904_2015_498. Epub 2015 Oct 7.
![Page 226: University of Groningen Phenylketonuria in mice and men ... · Phenylketonuria in mice and men Proefschrift ter verkrijging van de graad van doctor aan de Rijksuniversiteit Groningen](https://reader034.vdocuments.site/reader034/viewer/2022052611/5f03c1e37e708231d40a9ed0/html5/thumbnails/226.jpg)
512536-L-bw-Bruinenberg512536-L-bw-Bruinenberg512536-L-bw-Bruinenberg512536-L-bw-BruinenbergProcessed on: 15-8-2017Processed on: 15-8-2017Processed on: 15-8-2017Processed on: 15-8-2017 PDF page: 225PDF page: 225PDF page: 225PDF page: 225
A
225
Appendix IV
Havekes R, Bruinenberg VM, Tudor JC, Ferri SL, Baumann A, Meerlo P, Abel T. Transiently
increasing cAMP levels selectively in hippocampal excitatory neurons during sleep deprivation
prevents memory deficits caused by sleep loss. J Neurosci. 2014 Nov 19;34(47):15715-21.
doi: 10.1523/JNEUROSCI.2403-14.2014.