university of groningen growth factors, cytokines and vegf ... · 7 chapter 1 introduction vegf in...

University of Groningen

Growth factors, Cytokines and VEGF in human neoplastic and inflammatory pathologiesArtico, Marco

IMPORTANT NOTE: You are advised to consult the publisher's version (publisher's PDF) if you wish to cite fromit. Please check the document version below.

Document VersionPublisher's PDF, also known as Version of record

Publication date:2016

Link to publication in University of Groningen/UMCG research database

Citation for published version (APA):Artico, M. (2016). Growth factors, Cytokines and VEGF in human neoplastic and inflammatory pathologies:Immunohistochemical basis for nuclear medicine studies. [Groningen]: University of Groningen.

CopyrightOther than for strictly personal use, it is not permitted to download or to forward/distribute the text or part of it without the consent of theauthor(s) and/or copyright holder(s), unless the work is under an open content license (like Creative Commons).

Take-down policyIf you believe that this document breaches copyright please contact us providing details, and we will remove access to the work immediatelyand investigate your claim.

Downloaded from the University of Groningen/UMCG research database (Pure): http://www.rug.nl/research/portal. For technical reasons thenumber of authors shown on this cover page is limited to 10 maximum.

Download date: 16-02-2019

https://www.rug.nl/research/portal/en/publications/growth-factors-cytokines-and-vegf-in-human-neoplastic-and-inflammatory-pathologies(55754b5d-2dca-4438-a14e-b1ef688596fc).html

1

Growth factors, Cytokines and VEGF in

human neoplastic and inflammatory

pathologies

Immunohistochemical basis for Nuclear Medicine studies

2

ISBN: 978-90-367-9114-4

Copyright © 2016 Marco Artico. All rights are reserved. No part of

this publication may be reproduced or translated in any form or by

any mean without permission from the author.

The work presented in this thesis has started at the University of

Rome “Sapienza”, where the majority of work has been performed.

Some articles have been made in cooperation with the University

Medical Center Groningen, NL .

Cover picture: VEGF molecule; IHC analysis: Expression of VEGFR1

in mouse subcutaneous tissue implanted and colonized by human

HT 29 colon carcinoma cells; tumour blush

3

RIJKSUNIVERSITEIT GRONINGEN

Proefschrift

ter verkrijging van het doctoraat in de

Medische Wetenschappen

aan de Rijkuniversiteit Groningen

op gezag van de

Rector Magnificus, Prof. E. Sterken,

in het openbaar te verdedigen op

Maandag 31-10-2016

om 16:15 uur

door

Marco Artico

geboren op 24 februari 1962

te Roma, Italië

4

Promotores:

Prof. Dr. A. Signore

Prof. Dr. R.A. Dierckx

Beoordelingscommissie:

Prof. Dr. R. Slart

Prof. Dr. C. van de Wiele

Prof. Dr. L. Zamai

5

Index of chapters

1 Introduction (partially published in: Int J Oncol, 49: 437-447, 2016).

2 Artico, M., Bronzetti, E., Pompili, E., Ionta, B., Alicino, V., D'Ambrosio,

A., Santoro, A., Pastore, FS, Elenkov I, Fumagalli L. Immunohistochemical

profile of neurotrophins in human cranial dura mater and meningiomas (2009)

Oncology Reports, 21 (6), pp. 1373-80.

3 Artico, M., Bianchi, E., Magliulo, G., De Vincentiis, M., De Santis, E.,

Orlandi, A., Santoro, A., Pastore, F.S., Giangaspero, F., Caruso, R., Re, M.,

Fumagalli, L. Neurotrophins, their receptors and Ki-67 in human GH-secreting

pituitary adenomas: An immunohistochemical analysis (2012) International

Journal of Immunopathology and Pharmacology, 25 (1), pp. 117-25.

4 Bianchi, E., Scarinci, F., Grande, C., Plateroti, R., Plateroti, R., Plateroti,

A.M., Fumagalli, L., Capozzi, P., Feher, J., Artico, M. Immunohistochemical

profile of vegf, tgf-ß and pge2in human pterygium and normal conjunctiva:

Experimental study and review of the literature (2012) International Journal of

Immunopathology and Pharmacology, 25 (3), pp. 607-15.

5 Bianchi E*, Artico M*, Di Cristofano C, Leopizzi M, Taurone S, Pucci M,

Gobbi P, Mignini F, Petrozza V, Pindinello I, Conconi MT, Della Rocca C. Growth

factors, their receptor expression and markers for proliferation of endothelial

and neoplastic cells in human osteosarcoma (2013) International Journal of

Immunopathology and Pharmacology, 26 (3), pp. 621-32. (*Authors equally

contributed).

6

6 Taurone S, Bianchi E, Attanasio G, Gioia CD, Ierinó R, Carubbi C, Galli D,

Pastore FS, Giangaspero F, Filipo R, Zanza C, Artico M. Immunohistochemical

profile of cytokines and growth factors expressed in vestibular schwannoma

and in normal vestibular nerve tissue (2015) Molecular Medicine Reports, 12

(1), pp. 737-45.

7 Bianchi E, Taurone S, Bardella L, Signore A, Pompili E, Sessa V,

Chiappetta C, Fumagalli L, Di Gioia C, Pastore FS, Scarpa S, Artico M.

Involvement of pro-inflammatory cytokines and growth factors in the

pathogenesis of the Dupuytren’s contracture. (2015) Clinical Science 129 (8).

pp 711-20.

8 Filippo Galli*, Marco Artico*, Samanta Taurone, Isabella Manni, Enrica

Bianchi, Giulia Piaggio, Bruce D. Weintraub, Mariusz W. Szkudlinski, Enzo

Agostinelli, Rudi A.J.O. Dierckx, Alberto Signore. Radiolabeling of VEGF165 with

99mTc to evaluate VEGFR expression in tumor angiogenesis (2016) submitted on

August 2016 to International Journal of Oncology. (*Authors equally

contributed)

9 Conclusions and future perspectives

10 English summary

11 Dutch summary

12 Curriculum vitae et studiorum

13 Acknowledgements

7

Chapter 1

Introduction

VEGF in Nuclear Medicine: Clinical

Applications, Future Perspectives and

Review of the Literature

1S. Taurone*, 2F. Galli*. 2,3A. Signore, 4E. Agostinelli,

3R.A.J.O. Dierckx, 5A. Minni, 5M. Pucci and 5M. Artico

1G.B. Bietti Eye Foundation-IRCCS, Rome, Italy.

2Nuclear Medicine Unit, Department of Medical-Surgical Sciences and of

Translational Medicine, Fac. of Medicine and Psychology, “Sapienza” University,

Rome, Italy.

3Department of Nuclear Medicine and Molecular Imaging, University of

Groningen, University Medical Center Groningen, Groningen, The Netherlands.

4Department of Biochemistry, “Sapienza” University, Rome, Italy.

5Department of Sensory Organs, “Sapienza” University, Rome, Italy

*Samanta Taurone and Filippo Galli contributed equally to this publication

Partially published in:

International Journal of Oncology 49 (29), 437-447, 2016

Key words: VEGF – VEGFR – IHC – PET – SPECT – Nuclear medicine

8

Introduction

The clinical study of human inflammatory and neoplastic pathologies requires

an accurate evaluation of tissues microenvironment to better understand the

complex mechanisms which may represent the cause of the physiopathological

evolution of these diseases. In this perspective immunohistochemistry (IHC)

potentially represents an ideal investigative tool which may be very useful in

the preliminary approach addressed to the preparation of innovative

radiolabeled drug used in nuclear medicine diagnosis and therapy of the above

mentioned pathologies. Potential new antigens and/or receptors involved in the

progression of tumors or inflammatory conditions, and discovered in sick

tissues by IHC, may lead to an interesting selective determination of novel

radiolabeled ligands or anti-targets antibodies. For these reasons in this Ph.D.

thesis we have tried to establish some intriguing and possibly important

correlations between growth factors and/or inflammatory cytokines

“immunolabeling” granted by IHC and their potential application in nuclear

medicine. The majority of humans neoplasms demonstrates a concrete

correlation between factors stimulating vessels’ growth (especially VEGF) and

progression of the tumor.

Clinical trials with antiangiogenic drugs revealed their potential against cancer.

However, a large percentage of patients still does not benefit from this

therapeutic approach highlighting the need of diagnostic tools to non-invasively

evaluate and monitor response to therapy. In this perspective the role of

Nuclear Medicine remains pivotal, being the discipline that allows the more

effective approach to non-invasive lesion detection, especially neoplastic ones,

with encouraging results even in advances diseases. It would also allow to

predict which patient will likely benefit from antiangiogenic therapy. Reasons

for treatment failure may be that low expression of drug’s targets or prevalence

of other pathways, therefore, molecular imaging has been explored as a

9

diagnostic technique of choice. Since the VEGF/VEGFR pathway is the main

responsible of tumor angiogenesis, many new drugs target either the soluble

ligand or its receptor to inhibit signaling leading to tumor regression. It is

currently impossible to evaluate local VEGF or VEGFR levels and their non-

invasive measurement in tumors might give insight to the available target for

VEGF/VEGFR-dependent antiangiogenic therapies allowing therapy decision

making and monitoring of response. Angiogenesis is the process that leads to

the formation of new blood vessels, and, if induced by tumors, can also

contribute to the growth of the disorganized vasculature able to sustain cancer

progression over 2-3 mm and metastasization (1). The events that trigger

tumor angiogenesis derive from the interaction between cancer cells and host

microenvironment that includes immune cells, connective tissue and soluble

factors. Vascular endothelial growth factor (VEGF) and its receptor (VEGFR) are

the main contributors to proliferation of endothelial cells, thus representing

suitable targets for antiangiogenic therapies (2).

VEGF

Vascular endothelial growth factor (VEGF) is the most important mediator of

angiogenesis. It is overexpressed in various tumors, stimulating endothelial cell

proliferation and migration, and leading to the formation of new blood vessels

from preexisting ones (8). The VEGF family is composed of five glycoproteins

(VEGF-A, VEGF-B, VEGF-C, VEGF-D and VEGF-E). VEGF-A is a homodimeric,

disulfide-bound glycoprotein, which exists in several isoforms with different

numbers of amino acid residues, such as VEGF121, VEGF165, VEGF189 and

VEGF206. Different VEGF-A isoforms exhibit varying biological properties, such as

the ability to bind to cell surface heparin sulfate proteoglycans. VEGF121,

commonly existing as a homodimer, is freely diffusible without heparin binding.

The angiogenic actions of VEGF are mediated primarily via two closely related

endothelium-specific receptor tyrosine kinases, Flt-1 (VEGFR1) and Flk-1/KDR

10

(VEGFR2) (9). Both are largely restricted to vascular endothelial cells and are

overexpressed on the endothelium of tumor vasculature, yet they are almost

undetectable in the vascular endothelium of adjacent normal tissues (10). All of

the VEGF-A isoforms bind to both VEGFR1 and VEGFR2. VEGF and its receptors

are overexpressed in a variety of solid tumor biopsy specimens, and over-

expression of VEGFR2 or VEGF-A has been considered as a poor prognostic

marker in various clinical studies (11-13). Indeed, new vasculature allows

tumor cells to grow by supplying nutrients and oxygen, enabling disposal of

metabolic waste products and providing a route for metastatic spreading. VEGF

production by tumor cells is thought to be regulated by hypoxemia, growth

factors signaling, cytokines, and cell differentiation (8).

Given the role of VEGF and VEGFR in several oncological and non oncological

diseases, pharmaceutical companies and researchers are deeply involved in

developing agents potentially useful in the prevention of VEGF-A binding to its

receptors (14), or antibodies blocking VEGFR2 (11) or small molecules that

inhibit the kinase activity of VEGFR2 (15, 16) and thereby block growth factor

signaling.

Indeed, VEGF/VEGFR targeting has already been proved successful in many

cancer types (17).

The VEGF/VEGFR pathway

The VEGF-VEGFR system is unique in that it consists of a very limited number

of molecules that play a central role in angiogenesis. The likely mechanism is

that bevacizumab binds to VEGF both soluble and bound to the extracellular

matrix and thereby prevents VEGF binding to its receptors, blocking the biologic

pathways induced after VEGF binding. Bevacizumab is approved both by the

United States Food and Drug Administration (FDA) and the European Medicines

Agency (EMA) for the treatment of metastatic colorectal cancer, non small cell

11

lung cancer, breast cancer and glioblastoma multiforme in combination with

chemotherapy.

VEGF-A and its receptors are the best-characterized signaling pathway in

developmental angiogenesis as well as tumor angiogenesis (10). VEGFR2

appears to be the most important receptor in VEGF-induced mitogenesis,

angiogenesis, and permeability increase, whereas the role of VEGFR1 in

endothelial cell function is less clear (18). During the exponential growth stage,

VEGFR expression is highly up-regulated on the newly developed tumor

vasculature. Being the naturally existing VEGFR ligand, VEGF121 offers several

advantages over the synthetic small-molecule VEGFR ligands or anti-VEGFR

antibodies, especially as a tracer. It has much higher binding affinity to VEGFR

(nanomolar range) than reported peptidic VEGFR inhibitors (submicromolar to

micromolar range) (19, 20). If Compared to antibody-based

radiopharmaceuticals, VEGF121 clears much faster from the blood pool and the

non-targeting organs because of its smaller size. Regulation of inflammatory

cell recruitment by VEGFR1 appears to be exerted mainly through placental

growth factor (PGF). Notably, the expression of PGF is very low under

physiological conditions, but it may be strongly upregulated in various cell types

by different pathological stimuli such as hypoxia, inflammatory cytokines, or

oncogenes (21-23). PGF has recently been regarded as an attractive candidate

for anti-angiogenic therapy. Indeed, it has been shown that PGF plays a key

role in promoting pathological angiogenesis associated with tumor progression

(24) and overexpression of PGF in a mouse melanoma model resulted in

increased tumor growth and metastasis (25). Tumor cells may also express

VEGFR2, although epithelial and mesenchymal tumor cells typically express

VEGFR1 rather than VEGFR2 (26, 27). Nevertheless, increased expression of

VEGFR2 on tumor cells has been described for melanoma and hematological

malignancies (28). It has been shown that VEGFR2-mediated signaling allowed

survival of cancer cells under chronic hypoxic conditions and might contribute

to a more aggressive phenotype (29). VEGF-C, VEGFR3 and its involvement in

lymphatic endothelial cell proliferation should also be considered for their

12

potential important role in the pathogenesis of reticulo-endothelial diseases. A

soluble form of the VEGFR2 (sVEGFR2) has been also described and it may

have important biological roles. sVEGFR2 binds VEGFC and prevents activation

of VEGFR3, consequently inhibiting lymphatic endothelial cell proliferation (31).

Notably, regulation of sVEGFR2 in advanced metastatic neuroblastoma may

promote lymphogenic spread of metastases (32). The expression of VEGFR3 in

tumor cells is still controversial (33); however, it has been ascertained that

inhibition of VEGFR3 activity arrests tumor vascularization, leading to decreased

vascular density in several tumor models (34). The axis VEGF-C/VEGFR3 plays

a fundamental role in the tumor microenvironment by promoting the formation

of new lymphatic vessels from preexisting ones (35). VEGF-C, produced by

neoplastic cells, induces lymphatic endothelial destabilization, resulting in

endothelial sprouting as well as leakage and enlargement of the vessels. These

modifications induce entry of tumor cells into the lymphatics vessels and further

dissemination of metastasis to sentinel lymph nodes (36, 37).

VEGF and cancer-related inflammation

Growing evidence supports an important link between chronic inflammation and

tumor development. Induction of VEGFR2 expression in tumor cells, and also in

intestinal epithelium during colitis, is mediated by the pro-inflammatory

cytokine interleukin-6, which is a strong promoter of tumor growth in

experimental colitis-associated colon cancer (30). High expression of VEGFs

and/or VEGFRs in various tumor biopsy specimens is indicative of poor

prognosis for cancer patients (2, 38, 39). Therefore, non-invasive imaging and

quantification of VEGFR expression is of relevant importance in cancer patient

management. Many strategies have been adopted to block the VEGF/VEGFR

signaling pathway for cancer treatment, such as agents that can bind to VEGF-

A to prevent its interaction with VEGFRs (bevacizumab, VEGF-trap, etc.) (40,

13

41) antibodies/antibody fragments that target VEGFR-2 (ramucirumab, CDP791,

etc.) (42, 43) and small molecule inhibitors that interrupt the downstream

signaling of VEGFR-2 (axitinib, sunitinib, sorafenib, etc.) (44–45). Many of

these agents have been approved by the Food and Drug Administration (FDA)

for various medical indications in cancer therapy (2, 46).

VEGFR-2 mediates the majority of VEGF-A signaling in the tumor

microenvironment including microvascular permeability and endothelial cell

proliferation (8, 10). Several agents, including antibodies and soluble receptor

constructs, have been developed to target the VEGF system. The drug that is

currently most widely used in the clinical practice to modulate VEGF-A is the

humanized monoclonal antibody. It blocks VEGF-induced endothelial cell

proliferation, permeability, and survival, and it inhibits human tumor cell line

growth. One of the greatest challenges in bevacizumab therapy is the lack of

predictive biomarkers and tools that can predict the efficacy of anti-VEGF

therapy (48).

Anti-VEGF drugs

Development of anti-angiogenic therapy including anti-VEGF antibodies and

VEGF-tyrosine kinase receptors has been a major landmark in cancer therapy

leading improvement in survival in several cancers.

The pharmacologic inhibition of angiogenesis via the VEGF pathway is an

important therapeutic approach that prevents cancer growth and metastasis

formation. In addition to anti-VEGF antibodies, other strategies have been

explored and include the blocking of its signaling receptor, receptor tyrosine

kinase inhibitors (49-52), and gene therapy approaches, in which the vector

produces an antisense molecule or a soluble receptor that acts in a dominant

negative manner (53).

Several studies have shown that anti-VEGF treatment, in association with

chemotherapy (54) or radiation therapy (55, 56), results in greater anti-tumor

14

effects than either treatment alone. An issue that is now being debated is the

mechanism of such potentiation, and a variety of hypotheses, which are not

mutually exclusive, have been put forward. Klement et al. proposed that

chemotherapy, especially when delivered at low dose, preferentially damages

endothelial cells and the blockade of VEGF blunts a key survival signal for

endothelial cells, thereby amplifying the antitumor-cell effects of chemotherapy

(54). Jain et al. proposed that antiangiogenic therapy ‘normalizes’ the tumor

vasculature, leading to pruning of excessive endothelial cells and perivascular

cells, reduction in vessel tortuosity and drop in interstitial pressure and

consequent improved oxygenation and delivery of chemotherapy to tumor cells

(57). These effects are accompanied by a reduction in permeability of

macromolecules (58, 59). Most recently, Willett et al. have shown that VEGF

blockade by bevacizumab decreases tumor perfusion, vascular volume,

microvascular density, interstitial fluid pressure and the number of viable

circulating endothelial and progenitor cells in colorectal cancer patients (60).

Surprisingly, these studies have also shown that permeability to small

molecules actually increases following VEGF blockade (60).

Bevacizumab has been initially approved for the treatment of metastatic

colorectal cancer in combination with intravenous 5-fluorouracil-based

chemotherapy (61). Subsequently, bevacizumab has been approved for various

indications in nonsquamous cell lung carcinoma (NSCLC), metastatic renal cell

carcinoma, and glioblastoma multiforme (62-66). The antitumor activity of

bevacizumab is primarily manifested in combination with chemotherapy, except

for renal cell carcinoma, where it has shown efficacy as a single agent (67).

Presently, bevacizumab is being used in nearly 1000 clinical trials, and despite

promising results, its effects in many types of cancer are modest or even

irrelevant (68). Furthermore, recent studies have raised the possibility that

treatment with bevacizumab may be associated with a more aggressive

invasive tumor phenotype, particularly in glioblastoma (69), which is often a

greatly vascularized brain tumor. Although the clinical impact of these results is

far from clear, it is obvious that antiangiogenic therapy will have to be closely

15

evaluated depending on disease stage and molecular profile of different

patients and tumours.

Preclinical data with anti-VEGFR2 antibodies have demonstrated a reduction in

VEGF-induced signaling as well as angiogenesis and primary or metastatic

growth in a variety of different tumor models (70 - 73); therefore, the specific,

antibody-based blockade of VEGFR2 has also received special attention in

clinical trials. Ramucirumab (IMC-1121B; Imclone Systems) is currently being

tested in several clinical trials, including breast cancer, gastric cancer, and HCC

(74). Basing on preliminary results, this antibody has shown activity in patients

previously treated with other antiangiogenic agents, suggesting a more efficient

antitumor response by direct targeting of VEGFR2.

Small molecule inhibitors of VEGFR tyrosine kinase activity represent another

major approach to blocking VEGF-mediated angiogenesis. Several tyrosine

kinase inhibitors have been developed to selectively inhibit VEGFR2, but they

have also activity on other VEGFRs and tyrosine kinase receptors, including

basic fibroblast growth factor (FGF) receptor, EGFR family members, PDGFR-a,

PDGFR-b, c-kit, and Flt3. Sunitinib was approved in 2006 for its clinical use in

imatinib-resistant gastrointestinal stromal tumors and advanced metastatic

renal cell carcinoma (75, 76), whereas sorafenib received FDA approval for the

treatment of metastatic renal cell carcinoma (77) and HCC (78). Sunitinib and

sorafenib have shown clinical efficacy as single agents, possibly due to their

ability to inhibit multiple RTKs and in particular those regulating tumor

angiogenesis. Additional clinical trials aimed to evaluate combinations of

sorafenib and sunitinib with different chemotherapeutic agents and other

antiangiogenic agents are under evaluation

There has been a worldwide research program to develop antiangiogenic

agents for the treatment of cancer. Many families of antiangiogenic drugs now

exist, but their clinical development has been hampered by scarce data

concerning the optimal biologically active dose. In addition, although the

classical phase I study design focuses on toxicity as an endpoint to establish

the maximum tolerated dose, many humanized monoclonal antibodies have no

16

clinically significant toxicity, which precludes identification of the maximum

tolerated dose. Furthermore, biologic dose–response relationships may follow a

bell-shaped curve (79) and therefore the maximum tolerated dose may not

even be the best dose for clinical applications. To overcome these issues,

biologic pharmacodynamic investigations (80) have entered phase I clinical trial

design with the goal of establishing the optimum biologically active dose.

Efficacy of anti-VEGF therapy

Antiangiogenic therapies are promising approaches for cancer treatment.

However, their systematic application remains problematic because of poor

understanding of mechanisms of action and occurrence of resistance (81).

Indeed, a significant fraction of patients do not respond to antiangiogenic drugs

(82), whereas those who respond have relatively modest benefits, mostly in

progression-free survival rather than in overall survival. In addition, a number

of significant toxicities have been observed in patients treated with

antiangiogenic agents, emphasizing that a careful assessment of the risk-

benefit ratio needs to be conducted in individual patients. Despite disease

stabilization and increase in the proportion of patients with progression-free

survival, tumors eventually become resistant to antiangiogenic agents and

relapse (83 - 86).

Antiangiogenic therapy depends on several factors, including the tumor stage,

the nature of the tumor vascular bed and the origin and genotype of the

neoplastic cells. Tumorigenesis (87), and progression (88) are often associated

with a modified expression of different angiogenic factors (88). Advanced

human breast cancers may express different pro-angiogenic factors, including

VEGF, acidic and basic fibroblast growth factors (aFGF and bFGF), transforming

growth factor β1 (TGFβ1), platelet-derived growth factor (PDGF), placental

growth factor (PGF) and pleiotrophin (88). The mechanism of action of certain

drugs is also different at various stages of tumorigenesis. For example, the

17

release of VEGF, following the remodelling of the extracellular matrix by matrix

metalloproteinase 9 (MMP9), is reported to be a component of the RIP1–Tag2

angiogenic switch (89, 90-93). Inhibition of VEGF is not effective against

established β-cell islet tumors (90, 94), and this finding may led to hypothesize

that the vasculature matures with increased pericyte coverage, thereby

reducing dependence on VEGFR2. The success of targeted therapies, such as

trastuzumab (Genentech), is often dependent on the expression of the drug’s

target by the tumor (95). Given that bevacizumab is a monoclonal antibody

with a well-defined target, it is logical that VEGF expression might predict

benefit. However, in retrospective subset analyses, VEGF expression by primary

tumors of metastatic, treatment-refractory breast cancers (96) or metastatic

colorectal cancers did not predict benefit from the addition of bevacizumab

(97). The reasons responsible for this behaviour are not entirely clear. Perhaps

VEGF expression by primary tumors is not representative of metastatic disease,

but detailed research indicates that they are equivalent (98).

Imaging of tumor angiogenesis

Positron emission tomography (PET), very sensitive technique (down to 10-12

molar) and quantitative with superb tissue penetration, has been widely used in

clinical oncology for tumor staging and treatment monitoring, where 18F-FDG (

fluorodeoxyglucose) was used as the tracer for measuring tumor glucose

metabolism (107, 108). High-resolution PET scanners continue to be developed

and made available for imaging small animals, improving the capacity for in

vivo studies in mice, primates, and humans (Fig. 1 and 2).

As already discussed, anti-angiogenic targeted therapies are a promising

approach for the treatment of cancer. However, clinical trials showed variable

response due to intra- and inter-tumor heterogeneity and non-invasive tools to

monitor treatment response and drug efficacy are needed.

18

Several methods have been developed to image tumor angiogenesis, but there

is no general agreement as to which strategy is the most suitable for

monitoring anti-angiogenic therapy in single-center and multicenter trials.

There is also evidence that angiogenic imaging data may be a useful predictor

of response to chemo-radiotherapy, the success of which depends on good

perfusion of the tumor (Fig. 3).

Personalized medicine allows to identify the right patient population for the

right therapy at the right time, as well as to provide quantitative, non-invasive,

and accurate information about the therapeutic responses in real-time. In this

scenario nuclear medicine offers several radiopharmaceuticals for “in vivo”

imaging of angiogenic markers, but to date, none emerged as a gold standard.

As an example, radiolabeled bevacizumab is one of the most studied

radiopharmaceuticals since it is able to bind VEGF with high affinity. Indeed,

development of a bevacizumab-based imaging agent can play important roles

in these aspects, as well as elucidating the function and modulation of

VEGF/VEGFR signaling during cancer development/intervention.

Targeting vascular endothelial growth factor

Being the most important angiogenic effector and already established

therapeutic target, many VEGF-targeting radiopharmaceuticals were developed

and studied in vitro and in vivo. In particular, the mAb bevacizumab is one of

the most studied radiolabelled anti-VEGF drugs and, to date, it has been

labeled with a number of PET isotopes such 89Zr (109, 110), 124In (111), 86Y

(112), and 64Cu (113). In addition, it has also been investigated with various

other imaging techniques such as single photon emission computed

tomography (SPECT) (114, 115), ultrasound (116), and optical imaging (117,

118). Studies with radiolabeled bevacizumab for imaging tumor angiogenesis

were performed in preclinical models proposing that its accumulation in the

tumor was due to interactions with the VEGF-A-165 and -189 isoforms,

19

associated with the tumor cell surface and/or the extracellular matrix (137-

139). However, in a clinical study with 111In-bevacizumab in patients affected

by colorectal cancer liver metastases, there was a lack of correlation between

radiolabelled bevacizumab uptake and VEGF-A expression in the lesions (140).

Authors speculated that the accumulation of the mAb was due to enhanced

vascular permeability leading to unspecific uptake in the tumor. This could limit

the usefulness of radiolabeled bevacizumab in imaging tumor angiogenesis.

However, this radiopharmaceutical showed promising results in many other

cancers like breast cancer. Various studies have reported overexpression of

VEGF-A in the breast cancer microenvironment, compared with normal breast

tissue (142-145). All VEGF-A splice variants are bound by the clinically used

monoclonal antibody bevacizumab. When labeled with the PET isotope 89Zr, it

preserves its VEGF-A–binding properties. Thus, tracer dosages of radiolabeled

bevacizumab can be used for tumor-specific, whole-body imaging of VEGF-A. In

preclinical studies (146, 147) and in a study in renal cell cancer patients (148),

we have already shown an excellent tumor-to-background ratio with an

optimum at 4 d after tracer injection when using 89Zr-bevacizumab. 89Zr-

bevacizumab might be potentially valuable for biologic characterization of

tumors and for prediction and evaluation of the effect of VEGF-A–targeting

therapeutics. VEGF-A is reported in several studies to be over expressed in

malignant breast tumors and in ductal carcinoma in situ (145,149), thus

covering the full spectrum from early-stage breast cancer to more advanced

stages. More frequent VEGF-A staining was found to be related to

aggressiveness as assessed by VEGF-A staining in a study with 1,788 breast

tumors (145). 89Zr-bevacizumab PET proved to be able to detect a broad range

of VEGF-A expression levels. Quantitative tumor analyses showed a more than

10-fold difference between individual SUV(standardized uptake value)max

measurements, suggesting large differences in VEGF-A tumor levels between

patients, 89Zr-bevacizumab might be potentially valuable for biologic

characterization of tumors and for prediction and evaluation of the effect of

VEGF-A–targeting therapeutics.

20

Because of better and more accurate scatter and attenuation corrections

associated with PET, 86Y-labeled bevacizumab was developed for imaging

VEGF-A tumor angiogenesis and as a surrogate marker for 90Y-based RIT

(Radioimmunotherapy Trial). The 111In and 89Zr-labeled probes have been

proposed as surrogate imaging markers for 90Y therapy, however, deviations

were observed due to subtle differences in the metalchelate complexes and

metabolism (150, 151) highlighting the need for the development of isotopically

matched 86Y-labeled probes for 90Y.

However, 86Y possesses its own set of challenges, in particular, its high positron

energy (Emax 1⁄4 3.1 MeV) and emission of 1.08 MeV (83% abundance),

which can significantly affect the image quality and recovery coefficients due to

spurious coincidences. When appropriate corrections are performed, the image

quality is greatly improved and is quantifiable (152 – 154).

PET imaging with 86Y-CHX-A00-DTPA-bevacizumab may have a useful role in

patient selection for bevacizumab-related therapy as it would indicate

accessibility of the antibody to VEGF-A target sites. However, 86Y-CHX-A00-

DTPA-bevacizumab imaging by itself may not predict the response to therapy

as it is only indicative of how much bevacizumab reaches the tumor and not

the overall tumor microenvironment and the biomolecular characteristics. The

primary use of 86Y-CHX-A00- DTPA-bevacizumab will be for the selection of

patients for 90Y-CHX-A00-DTPA-bevacizumab RIT, monitoring of those patients

during therapy as well as to provide information for dosimetry calculations

(150, 155) To achieve the long-term goal of clinical translation of 86Y-CHX-A00-

DTPA-bevacizumab, PET/CT and MRI studies are currently being performed

with mice bearing orthotopic and disseminated ascites forming colorectal and

ovarian tumors.

In conclusion, the utility of 86Y-CHX-A00-DTPA-bevacizmab for noninvasive PET

imaging of VEGF-A secreting tumors in preclinical models has been

demonstrated (156) 86Y-CHX-A00-DTPA-bevacizumab may be useful for the

assessment of bevacizumab uptake and localization, which may be important

for risk stratification, patient screening and appropriate dosage selection.

21

Ultimately, 86Y-CHX-A00- DTPA-bevacizumab would serve as a surrogate PET

marker for dosimetry and selection of subjects for 90Y CHX-A00-DTPA-

bevacizumab RIT of VEGF-A–secreting cancers (156).

The limiting factor for more general application of imaging with radionuclides is

the radiation burden. In a study comparing the risks of radiation-induced

cancer from mammography, molecular breast imaging, and positron emitting

mammography, the cumulative cancer incidence is 15–30 times higher for

positron emission mammography and molecular breast imaging than for

mammography (157). The estimated radiation burden of 89Zr-bevacizumab-PET

is 19 mSv per tracer injection, on the basis of extrapolation from 111In-

bevacizumab data and a dosimetry study on 89Zr-U36, compared with 5.3 mSv

for 18F-FDG PET (158-161).

Besides bevacizumab, other radiolabeled anti-VEGF antibodies such as I-labeled

VG76e (121) and HuMV833 (122) have been reported. Phase I trials of the

latter revealed that antibody distribution and clearance was quite

heterogeneous, not only between and within patients but also between and

within individual tumors, which underscored the importance of patient selection

to achieve maximum therapeutic effect.

Targeting VEGF receptor

In addition to VEGF, VEGFR is another important target for cancer diagnosis

and monitoring the therapeutic efficacy of anti-angiogenic therapies. Over the

last decade, imaging of VEGFR expression has gained enormous interest not

only in cancer but also in many other angiogenesis-related diseases (119, 120).

Examination of the tumor in the same animals or cancer patients with both

VEGF- and VEGFR-targeted radiopharmaceuticals or fluorescent probes in

comparison to IHC expression of VEGFR1 and VEGFR2 in tissue animals (Fig. 4

and 5) or in human neoplastic tissues (Fig. 6 and 7) may give important

insights about distribution and expression kinetics of VEGF and VEGFRs during

22

cancer development and cancer therapy. Substantial effort has been devoted to

non-invasive imaging of VEGFR expression in cancer over the last two decades

and various agents have been developed for SPECT (125–128), PET (126, 129–

133), optical imaging, magnetic resonance imaging (MRI) (134) and ultrasound

(US) (135). Because of the high affinity to VEGFRs, VEGF121 has emerged as a

particularly desirable candidate for tracer development in the literature (123).

To avoid significant interference with VEGFR binding, site-specific labeling of

VEGF-based proteins has been adopted in many literature reports which

typically utilizes a cysteine residue for radiolabeling (126, 136). However, in

many of the reported studies, liver and kidney uptake of the tracer was very

high (in some cases > 100 percentage of injected dose per gram of tissue

[%ID/g]) which significantly hampered the clinical translation/applications of

these tracers. The aim is to develop a PET tracer for the imaging of VEGFR

expression using lysine tagged recombinant human VEGF121 (denoted as K3-

VEGF121). The three lysine residues at the N-terminus, far from the VEGFR

binding sites, can facilitate radiolabeling without affecting the biological activity

and receptor binding. In the design of novel radiotracers, it is important to

minimize the radiation dose to normal organs without compromising the

imaging characteristics. VEGF121 and its derivatives have been labeled with

many PET/SPECT isotopes.

Considered these premises about the importance of IHC in the detection of new

potential targets in nuclear medicine management of neoplastic and

inflammatory conditions in the 2nd chapter of this thesis are reported the results

of a previously published study which correlates the immunohistochemical

expression of neutotrophins between meningiomas and normal dura mater. In

the 3rd chapter are presented the results of a study performed on human GH-

secreting pituitary adenomas to investigate the IHC expression of

neurotrophins, their receptors and Ki-67. In the 4th chapter I report the results

of an experimental study which investigates the IHC expression of VEGF, TGF-

and PGE2 in human pterygium and normal conjunctiva. In the 5th chapter are

presented the experimental evidences of IHC expression of some growth

23

factors, their receptors and markers of proliferation of human osteosarcomas.

In the 6th chapter are illustrated the experimental results of a study performed

on IHC expression cytokines and growth factors in vestibular schwannomas and

normal vestibular nerve. In the 7th chapter are discussed the experimental

results of an IHC study on the involvement and the expression of some pro-

inflammatory cytokines and growth factors in the pathogenesis of Dupuytren’s

contracture. In the 8th chapter are discussed the results of a study (submitted

for publication) concerning the tumor uptake of 99mTc-HINIC-VEGF165 which

correlates with VEGF production and not with VEGFR expression. In the chapter

9th are finally discussed the conclusions and the future perspectives deriving

from the analysis of the obtained results and from possible applications in the

field of the nuclear medicine.

24

REFERENCES

1. Folkman J. Tumor angiogenesis: therapeutic implications. N Engl J Med.

1971;285:1182–1186

2. Folkman J. Angiogenesis: an organizing principle for drug discovery? Nat

Rev Drug Discov. 2007;6:273–286.

3. Ellis, L. M., Liu, W., and Wilson, M. (1996). Down-regulation of vascular

endothelial growth factor in human colon carcinoma cell lines by antisense

transfection decreases endothelial cell proliferation.Surgery120,871–878.

4. Gerber, H. P., Kowalski, J., Sherman, D., Eberhard, D. A., and Ferrara,

N. (2000). Complete

inhibition of rhabdomyosarcoma xenograft growth and neovascularization

requires blockade of both tumor and host vascular endothelial growth factor.

Cancer Res.60, 6253–6258

5. Kim, K. J., Li, B., Winer, J., Armanini, M., Gillett, N., Phillips, H. S., and

Ferrara, N. (1993).

Inhibition of vascular endothelial growth factor-induced angiogenesis

suppresses tumour growth in vivo.Nature362,841–844

6. Klohs, W. D., and Hamby, J. M. (1999). Antiangiogenic agents.Curr.

Opin. Biotechnol.10,

544–549.

7. Prewett, M., Huber, J., Li, Y., Santiago, A., O’Connor, W., King, K.,

Overholser, J., Hooper, A., Pytowski, B., Witte, L., Bohlen, P., and Hicklin, D. J.

(1999). Antivascular endothelial growth factor receptor (fetal liver kinase 1)

monoclonal antibody inhibits tumor angiogenesis and growth of several mouse

and human tumors.Cancer Res.59,5209–5218.

8. Ferrara N, Davis-Smyth T . The biology of vascular endothelial growth

factor. Endocr Rev. 1997;18:4–25.

9. Sato Y, Kanno S, Oda N, et al. Properties of two VEGF receptors, Flt-1

and KDR, in signal transduction. Ann N Y Acad Sci. 2000;902:201–205.

25

10. Ferrara N. The role of VEGF in the regulation of physiological and

pathological angiogenesis. EXS. 2005;94:209–231.

11. Tang RF, Itakura J, Aikawa T, et al. Overexpression of lymphangiogenic

growth factor VEGF-C in human pancreatic cancer. Pancreas. 2001;22:285–292

12. Ryden L, Linderholm B, Nielsen NH, Emdin S, Jonsson PE, Landberg G.

Tumor specific VEGF-A and VEGFR2/KDR protein are co-expressed in breast

cancer. Breast Cancer Res Treat. 2003;82:147–154.

13. Decaussin M, Sartelet H, Robert C, et al. Expression of vascular

endothelial growth factor (VEGF) and its two receptors (VEGF-R1-Flt1 and

VEGF-R2-Flk1/KDR) in non-small cell lung carcinomas (NSCLCs): correlation

with angiogenesis and survival. J Pathol. 1999;188:369–377.

14. Sun J, Wang DA, Jain RK, et al. Inhibiting angiogenesis and

tumorigenesis by a synthetic molecule that blocks binding of both VEGF and

PDGF to their receptors. Oncogene. 2005;24:4701–4709.

15. Prewett M, Huber J, Li Y, et al. Antivascular endothelial growth factor

receptor (fetal liver kinase 1) monoclonal antibody inhibits tumor angiogenesis

and growth of several mouse and human tumors. Cancer Res. 1999;59:5209–

5218.

16. Wood JM, Bold G, Buchdunger E, et al. PTK787/ZK 222584, a novel and

potent inhibitor of vascular endothelial growth factor receptor tyrosine kinases,

impairs vascular endothelial growth factor-induced responses and tumor growth

after oral administration.

17. Wedge SR, Ogilvie DJ, Dukes M, et al. ZD4190: an orally active inhibitor

of vascular endothelial growth factor signaling with broad-spectrum antitumor

efficacy. Cancer Res. 2000;60:970–975.

18. Ferrara N. Vascular endothelial growth factor: basic science and clinical

progress. Endocr Rev. 2004;25:581–611.

19. El-Mousawi M, Tchistiakova L, Yurchenko L, et al. A vascular endothelial

growth factor high affinity receptor 1-specific peptide with antiangiogenic

activity identified using a phage display peptide library. J Biol

Chem.2003;278:46681–46691.

26

20. Goncalves M, Estieu-Gionnet K, Berthelot T, et al. Design, synthesis, and

evaluation of original carriers for targeting vascular endothelial growth factor

receptor interactions. Pharm Res. 2005;22:1411–1421

21. Failla, C. M., Odorisio, T., Cianfarani, F., Schietroma, C., Puddu, P., and

Zambruno, G. (2000).Placenta growth factor is induced in human keratinocytes

during wound healing.J. Invest.Dermatol.115,388–395

22. Green, C. J., Lichtlen, P., Huynh, N. T., Yanovsky, M., Laderoute, K. R.,

Schaffner, W., and Murphy, B. J. (2001). Placenta growth factor gene

expression is induced by hypoxia in fibroblasts: a central role for metal

transcription factor-1.Cancer Res.61,2696–2703

23. Larcher, F., Franco, M., Bolontrade, M., Rodriguez-Puebla, M., Casanova,

L., Navarro, M., Yancopoulos, G., Jorcano, J. L., and Conti, C. J. (2003).

Modulation of the angiogenesis response through Ha-ras control, placenta

growth factor, and angiopoietin expression in mouse skin carcinogenesis.Mol.

Carcinog.37,83–90.

24. Carmeliet, P., De Smet, F., Loges, S., and Mazzone, M. (2009).

Branching morphogenesis and antiangiogenesis candidates: tip cells lead the

way.Nat. Rev. Clin. Oncol.6,315–326

25. Li, B., Sharpe, E. E., Maupin, A. B., Teleron, A. A., Pyle, A. L., Carmeliet,

P., and Young, P. P. (2006). VEGF and PlGF promote adult vasculogenesis by

enhancing EPC recruitment and vessel formation at the site of tumor

neovascularization.FASEB J.20,1495–1497.

26. Hicklin, D. J., and Ellis, L. M. (2005). Role of the vascular endothelial

growth factor pathway in tumor growth and angiogenesis.J. Clin.

Oncol.23,1011–1027

27. Podar, K., and Anderson, K. C. (2005). The pathophysiologic role of

VEGF in hematologic malignancies: therapeutic implications.Blood105,1383–

1395.

28. Youssoufian, H., Hicklin, D. J., and Rowinsky, E. K. (2007). Review:

monoclonal antibodies to the vascular endothelial growth factor receptor-2 in

cancer therapy. Clin. Cancer Res.13, 5544s–5548s.

27

29. Calvani, M., Rapisarda, A., Uranchimeg, B., Shoemaker, R. H., and

Melillo, G. (2006). Hypoxic induction of an HIF-1alpha-dependent bFGF

autocrine loop drives angiogenesis in human endothelial cells.Blood107,2705–

2712.

30. Waldner,M.J.,Wirtz,S.,Jefremow,A.,Warntjen,M.,Neufert,C.,Atreya,R.,Bec

ker,C., Weigmann, B., Vieth, M., Rose-John, S., and Neurath, M. F. (2010).

VEGF receptor signaling links inflammation and tumorigenesis in colitis-

associated cancer.J. Exp. Med.207,2855–2868

31. Albuquerque, R. J. C., Hayashi, T., Cho, W. G., Kleinman, M. E., Dridi, S.,

Takeda, A., Baffi, J. Z., Yamada, K., Kaneko, H., Green, M. G., Chappell, J.,

Wilting, J.,et al. (2009). Alternatively spliced vascular endothelial growth factor

receptor-2 is an essential endogenous inhibitor of lymphatic vessel growth.Nat.

Med.15,1023–1030

32. Becker, J., Pavlakovic, H., Ludewig, F., Wilting, F., Weich, H. A.,

Albuquerque, R., Ambati, J., and Wilting, J. (2010). Neuroblastoma progression

correlates with downregulation of the lymphangiogenesis inhibitor sVEGFR-

2.Clin. Cancer Res.16,1431–1441

33. Petrova, T. V., Bono, P., Holnthoner, W., Chesnes, J., Pytowski, B.,

Sihto, H., Laakkonen, P., Heikkila, P., Joensuu, H., and Alitalo, K. (2008).

VEGFR-3 expression is restricted to blood and lymphatic vessels in solid

tumors.Cancer Cell13,554–556

34. Laakkonen, P., Waltari, M., Holopainen, T., Takahashi, T., Pytowski, B.,

Steiner, P., Hicklin, D., Persaud, K., Tonra, J. R., Witte, L., and Alitalo, K.

(2007). Vascular endothelial growth factor receptor 3 is involved in tumor

angiogenesis and growth.Cancer Res.67,593–599

35. He, Y., Rajantie, I., Ilmonen, M., Makinen, T., Karkkainen, M. J., Haiko,

P., Salven, P., and Alitalo, K. (2004). Preexisting lymphatic endothelium but not

endothelial progenitor cells are essential for tumor lymphangiogenesis and

lymphatic metastasis. Cancer Res. 64, 3737–3740.

36. Achen, M. G., and Stacker, S. A. (2008). Targeting tumor stroma.Curr.

Cancer Drug Targets8, 446

28

37. He, Y., Rajantie, I., Pajusola, K., Jeltsch, M., Holopainen, T., Yla-

Herttuala, S., Harding, T., Jooss, K., Takahashi, T., and Alitalo, K. (2005).

Vascular endothelial cell growth factor receptor 3-mediated activation of

lymphatic endothelium is crucial for tumor cell entry and spread via lymphatic

vessels.Cancer Res.65,4739–4746

38. Gerber HP, Ferrara N. Pharmacology and pharmacodynamics of

bevacizumab as monotherapy or in combination with cytotoxic therapy in

preclinical studies. Cancer Res. 2005;65:671–680.

39. Sandler A, Gray R, Perry MC, Brahmer J, Schiller JH, Dowlati A,

Lilenbaum R, Johnson DH. Paclitaxel-carboplatin alone or with bevacizumab for

non-small-cell lung cancer. N Engl J Med. 2006;355:2542–2550.

40. Miles DW, Chan A, Dirix LY, Cortes J, Pivot X, Tomczak P, Delozier T,

Sohn JH, Provencher L, Puglisi F, Harbeck N, Steger GG, Schneeweiss A,

Wardley AM, Chlistalla A, Romieu G. Phase III study of bevacizumab plus

docetaxel compared with placebo plus docetaxel for the first-line treatment of

human epidermal growth factor receptor 2-negative metastatic breast cancer.

J. Clin. Oncol. 2010;28:3239–3247.

41. Robert NJ, Dieras V, Glaspy J, Brufsky AM, Bondarenko I, Lipatov ON,

Perez EA, Yardley DA, Chan SY, Zhou X, Phan SC, O'Shaughnessy J. RIBBON-1:

randomized, double-blind, placebo-controlled, phase III trial of chemotherapy

with or without bevacizumab for first-line treatment of human epidermal

growth factor receptor 2-negative, locally recurrent or metastatic breast cancer.

J. Clin. Oncol. 2011;29:1252–1260.

42. Miller K, Wang M, Gralow J, Dickler M, Cobleigh M, Perez EA, Shenkier T,

Cella D, Davidson NE. Paclitaxel plus bevacizumab versus paclitaxel alone for

metastatic breast cancer. N Engl J Med. 2007;357:2666–2676.

43. Valachis A, Polyzos NP, Patsopoulos NA, Georgoulias V, Mavroudis D,

Mauri D. Bevacizumab in metastatic breast cancer: a meta-analysis of

randomized controlled trials. Breast Cancer Res Treat. 2010;122:1–7.

44. Pivot X, Schneeweiss A, Verma S, Thomssen C, Passos-Coelho JL,

Benedetti G, Ciruelos E, von Moos R, Chang HT, Duenne AA, Miles DW. Efficacy

29

and safety of bevacizumab in combination with docetaxel for the first-line

treatment of elderly patients with locally recurrent or metastatic breast cancer:

Results from AVADO. Eur J Cancer. 2011;47:2387–2395.

45. Vach W, Høilund-Carlsen PF, Fischer BM, Gerke O, Weber W. How to

study optimal timing of PET/CT for monitoring of cancer treatment. Am J Nucl

Med Mol Imaging. 2011;1:54–62.

46. Rakheja R, Ciarallo A, Alabed YZ, Hickeson M. Intravenous

administration of diazepam significantly reduces brown fat activity on 18F-FDG

PET/CT. Am J Nucl Med Mol Imaging. 2011;1:29–35.

47. Eary JF, Hawkins DS, Rodler ET, Conrad EUI. 18F-FDG PET in sarcoma

treatment response imaging. Am J Nucl Med Mol Imaging. 2011;1:47–53.

48. Iagaru A. 18F-FDG PET/CT: timing for evaluation of response to therapy

remains a clinical challenge. Am J Nucl Med Mol Imaging. 2011;1:63–64.

49. Mendel DB, Schreck RE, West DC, Li G, Strawn LM, Tanciongco SS, et al.

The angiogenesis inhibitor SU5416 has long-lasting effects on vascular

endothelial growth factor receptor phosphorylation and function. Clin Cancer

Res2000;6:4848–58.

50. Laird AD, Vajkoczy P, Shawver LK, Thurnher A, Liang C, Mohammadi M,

et al. SU6668 is a potent antiangiogenic and antitumor agent that induces

regression of established tumors. Cancer Res 2000;60:4152–60.

51. Wedge SR, Ogilvie DJ, Dukes M, Kendrew J, Curwen JO, Hennequin LF,

et al. ZD4190: an orally active inhibitor of vascular endothelial growth factor

signaling with broad-spectrum antitumor efficacy. Cancer Res 2000;60:970–5.

52. Drevs J, Hofmann I, Hugenschmidt H, Wittig C, Madjar H, Muller M, et

al. Effects of PTK787/ZK 222584, a specific inhibitor of vascular endothelial

growth factor receptor tyrosine kinases, on primary tumor, metastasis, vessel

density, and blood flow in a murine renal cell carcinoma model. Cancer

Res2000;60:4819–24.

53. Davidoff AM, Leary MA, Ng CY, Vanin EF. Gene therapy-mediated

expression by tumor cells of the angiogenesis inhibitor flk-1 results in inhibition

of neuroblastoma growth in vivo. J Pediatr Surg 2001;36:30–6.

30

54. Klement, G. et al. Continuous low-dose therapy with vinblastine and

VEGF receptor-2 antibody induces sustained tumor regression without overt

toxicity. J. Clin. Invest. 105, R15–R24 (2000).

55. Lee, C. G. et al. Anti-vascular endothelial growth factor treatment

augments tumor radiation response under normoxic or hypoxic conditions.

Cancer Res. 60, 5565–5570 (2000)

56. Kozin, S. V. et al. Vascular endothelial growth factor receptor-2-blocking

antibody potentiates radiation-induced long-term control of human tumor

xenografts. Cancer Res. 61, 39–44 (2001).

57. Jain, R. K. Normalizing tumor vasculature with antiangiogenic therapy: a

new paradigm for combination therapy. Nature Med. 7, 987–989 (2001)

58. Yuan, F. et al. Time-dependent vascular regression and permeability

changes in established human tumor xenografts induced by an anti-vascular

endothelial growth factor/vascular permeability factor antibody. Proc. Natl

Acad. Sci. USA 93, 14765–14770 (1996)

59. Pham, C. D. et al. Magnetic resonance imaging detects suppression of

tumor vascular permeability after administration of antibody to vascular

endothelial growth factor. Cancer Invest. 16, 225–230 (1998)

60. Willett, C. G. et al. Direct evidence that the VEGF-specific antibody

bevacizumab has antivascular effects in human rectal cancer. Nature Med. 10,

145–147 (2004).

61. Hurwitz, H., Fehrenbacher, L., Novotny, W., Cartwright, T., Hainsworth,

J., Heim, W., Berlin, J., Baron, A., Griffing, S., Holmgren, E., Ferrara, N., Fyfe,

G.,et al. (2004). Bevacizumab plus irinotecan, fluorouracil, and leucovorin for

metastatic colorectal cancer.N. Engl. J. Med.350,2335–2342

62. Escudier, B., Bellmunt, J., Negrier, S., Bajetta, E., Melichar, B., Bracarda,

S., Ravaud, A., Golding, S., Jethwa, S., and Sneller, V. (2010). Phase III trial of

bevacizumab plus interferon alfa-2a in patients with metastatic renal cell

carcinoma (AVOREN): final analysis of overall survival.J. Clin. Oncol.28,2144–

2150

31

63. Friedman, H. S., Prados, M. D., Wen, P. Y., Mikkelsen, T., Schiff, D.,

Abrey, L. E., Yung, W. K. A., Paleologos, N., Nicholas, M. K., Jensen, R.,

Vredenburgh, J., Huang, J., et al. (2009). Bevacizumab alone and in

combination with irinotecan in recurrent glioblastoma.J. Clin. Oncol.27,4733–

4740.

64. Kreisl, T. N., Kim, L., Moore, K., Duic, P., Royce, C., Stroud, I., Garren,

N., Mackey, M., Butman, J. A., Camphausen, K., Park, J., Albert, P. S.,et al.

(2009). Phase II trial of singleagent bevacizumab followed by bevacizumab plus

irinotecan at tumor progression in recurrent glioblastoma.J. Clin. Oncol.27,740–

745

65. Rini, B. I., Halabi, S., Rosenberg, J. E., Stadler, W. M., Vaena, D. A., Ou,

S. S., Archer, L., Atkins, J. N., Picus, J., Czaykowski, P., Dutcher, J., and Small,

E. J. (2008). Bevacizumab plus interferon alfa compared with interferon alfa

monotherapy in patients with metastatic renal cell carcinoma: CALGB 90206. J.

Clin. Oncol.26,5422–5428.

66. Sandler, A., Gray, R., Perry, M. C., Brahmer, J., Schiller, J. H., Dowlati,

A., Lilenbaum, R., and Johnson, D. H. (2006). Paclitaxel-carboplatin alone or

with bevacizumab for non-small-cell lung cancer.N. Engl. J. Med.355,2542–

2550

67. Yang, J. C., Haworth, L., Sherry, R. M., Hwu, P., Schwartzentruber, D. J.,

Topalian, S. L., Steinberg, S. M., Chen, H. X., and Rosenberg, S. A. (2003). A

randomized trial of bevacizumab, an anti-vascular endothelial growth factor

antibody, for metastatic renal cancer. N. Engl. J. Med.349,427–434

68. Van Meter, M. E., and Kim, E. S. (2010). Bevacizumab: current updates

in treatment.Curr. Opin. Oncol.22,586–591.

69. Keunen, O., Johansson, M., Oudin, A., Sanzey, M., Rahim, S. A., Fack,

F., Thorsen, F., Taxt, T., Bartos, M., Jirik, R., Miletic, H., Wang, J.,et al. (2011).

Anti-VEGF treatment reduces blood supply and increases tumor cell invasion in

glioblastoma.Proc. Natl. Acad. Sci. USA108, 3749–3754.

70. Bruns, C. J., Shrader, M., Harbison, M. T., Portera, C., Solorzano, C. C.,

Jauch, K. W., Hicklin, D. J., Radinsky, R., and Ellis, L. M. (2002). Effect of the

32

vascular endothelial growth factor receptor-2 antibody DC101 plus gemcitabine

on growth, metastasis and angiogenesis of human pancreatic cancer growing

orthotopically in nude mice.Int. J. Cancer 102, 101–108.

71. Prewett, M., Huber, J., Li, Y., Santiago, A., O’Connor, W., King, K.,

Overholser, J., Hooper, A., Pytowski, B., Witte, L., Bohlen, P., and Hicklin, D. J.

(1999). Antivascular endothelial growth factor receptor (fetal liver kinase 1)

monoclonal antibody inhibits tumor angiogenesis and growth of several mouse

and human tumors.Cancer Res.59,5209–5218.

72. Shaheen, R. M., Tseng, W. W., Vellagas, R., Liu, W., Ahmad, S. A., Jung,

Y. D., Reinmuth, N., Drazan, K. E., Bucana, C. D., Hicklin, D. J., and Ellis, L. M.

(2001). Effects of an antibody to vascular endothelial growth factor receptor-2

on survival, tumor vascularity, and apoptosis in a murine model of colon

carcinomatosis.Int. J. Oncol.18,221–226

73. Zhu, Z., Lu, D., Kotanides, H., Santiago, A., Jimenez, X., Simcox, T.,

Hicklin, D. J., Bohlen, P., and Witte, L. (1999). Inhibition of vascular endothelial

growth factor induced mitogenesis of human endothelial cells by a chimeric

anti-kinase insert domain-containing receptor antibody.Cancer Lett.136,203–

213.

74. Spratlin, J. (2011). Ramucirumab (IMC-1121B): monoclonal antibody

inhibition of vascular endothelial growth factor receptor-2.Curr. Oncol.

Rep.13,97–102

75. Demetri, G. D., van Oosterom, A. T., Garrett, C. R., Blackstein, M. E.,

Shah, M. H., Verweij, J., McArthur, G., Judson, I. R., Heinrich, M. C., Morgan, J.

A., Desai, J., Fletcher, C. D.,et al. (2006). Efficacy and safety of sunitinib in

patients with advanced gastrointestinal stromal tumour after failure of imatinib:

a randomised controlled trial.Lancet368,1329–1338

76. Motzer, R. J., Michaelson, M. D., Rosenberg, J., Bukowski, R. M., Curti,

B. D., George, D. J., Hudes, G. R., Redman, B. G., Margolin, K. A., and Wilding,

G. (2007). Sunitinib efficacy against advanced renal cell carcinoma.J.

Urol.178,1883–1887.

33

77. Escudier, B., Eisen, T., Stadler, W. M., Szczylik, C., Oudard, S.p., Siebels,

M., Negrier, S., Chevreau, C., Solska, E., Desai, A. A., Rolland, F.d.r., Demkow,

T.,et al. (2007). Sorafenib in advanced clear-cell renal-cell carcinoma.N. Engl. J.

Med.356,125–134.

78. Llovet, J. M., Ricci, S., Mazzaferro, V., Hilgard, P., Gane, E., Blanc, J. F.,

de Oliveira, A. C., Santoro, A., Raoul, J. L., Forner, A., Schwartz, M., Porta,

C.,et al. (2008). Sorafenib in advanced hepatocellular carcinoma.N. Engl. J.

Med.359,378–390

79. Gruber BL, Marchese MJ, Kew R. Angiogenic factors stimulate mast-cell

migration. Blood 1995;86:2488–93.

80. Thomas A, Morgan B, Drevs J, Jivan A, Buchert M, Horsfield M, et al.

Pharmacodynamic results using dynamic contrast enhanced magnetic

resonance imaging of 2 Phase 1 studies of the VEGF inhibitor PTK787/ZK

222584 in patients with liver metastases from colorectal cancer. Proc ASCO

2001;20.

81. Jain, R. K., Duda, D. G., Clark, J. W., and Loeffler, J. S. (2006). Lessons

from phase III clinical trials on anti-VEGF therapy for cancer.Nat. Clin. Pract.

Oncol.3,24–40

82. Burris, H., III, and Rocha-Lima, C. (2008). New therapeutic directions for

advanced pancreatic cancer: targeting the epidermal growth factor and

vascular endothelial growth factor pathways.Oncologist13,289–298.

83. Bergers, G., and Hanahan, D. (2008). Modes of resistance to anti-

angiogenic therapy.Nat. Rev. Cancer8,592–603

84. Ellis, L. M., and Hicklin, D. J. (2008a). Pathways mediating resistance to

vascular endothelial growth factor-targeted therapy.Clin. Cancer Res.14,6371–

6375

85. Kerbel, R. S. (2008). Tumor angiogenesis.N. Engl. J. Med.358,2039–

2049.

86. Shojaei, F., and Ferrara, N. (2008b). Role of the microenvironment in

tumor growth and in refractoriness/resistance to anti-angiogenic therapies.Drug

Resist. Updat.11,219–230.

34

87. Ferrara, N. Vascular endothelial growth factor: basic science and clinical

progress. Endocr. Rev. 25, 581–611 (2004)

88. Relf, M. et al. Expression of the angiogenic factors vascular endothelial

cell growth factor, acidic and basic fibroblast growth factor, tumor growth

factor β-1, platelet-derived endothelial cell growth factor, placenta growth

factor, and pleiotrophin in human primary breast cancer and its relation to

angiogenesis. Cancer Res. 57, 963–969 (1997)

89. Christofori, G., Naik, P. & Hanahan, D. Vascular endothelial growth factor

and its receptors, flt-1 and flk-1, are expressed in normal pancreatic islets and

throughout islet cell tumorigenesis. Mol. Endocrinol. 9, 1760–1770 (1995).

90. Inoue, M., Hager, J. H., Ferrara, N., Gerber, H. P. & Hanahan, D. VEGF-A

has a critical, nonredundant role in angiogenic switching and pancreatic βcell

carcinogenesis. Cancer Cell 1, 193–202 (2002).

91. Joyce, J. A. et al. Stage-specific vascular markers revealed by phage

display in a mouse model of pancreatic islet tumorigenesis. Cancer Cell 4, 393–

403 (2003).

92. Bergers, G., Javaherian, K., Lo, K. M., Folkman, J. & Hanahan, D. Effects

of angiogenesis inhibitors on multistage carcinogenesis in mice. Science 284,

808–812 (1999).

93. Bergers, G. et al. Matrix metalloproteinase-9 triggers the angiogenic

switch during carcinogenesis. Nature Cell Biol. 2, 737–744 (2000).

94. Bergers, G., Song, S., Meyer-Morse, N., Bergsland, E. & Hanahan, D.

Benefits of targeting both pericytes and endothelial cells in the tumor

vasculature with kinase inhibitors. J. Clin. Invest. 111, 1287–1295 (2003)

95. Slamon, D. J. et al. Use of chemotherapy plus a monoclonal antibody

against HER2 for metastatic breast cancer that overexpresses HER2. N. Engl. J.

Med. 344, 783–792 (2001).

96. Hillan, K. J. et al. The role of VEGF expression in response to

bevacizumab plus capcitabine in metastatic breast cancer (MBC). J. Clin. Oncol.

21, 284S–284S (2003).

35

97. Jubb, A. M. et al. Impact of vascular endothelial growth factor-A

expression, thrombospondin-2 expression, and microvessel density on the

treatment effect of bevacizumab in metastatic colorectal cancer. J. Clin. Oncol.

24, 217–227 (2006)

98. Kuramochi, H. et al. Vascular endothelial growth factor messenger RNA

expression level is preserved in liver metastases compared with corresponding

primary colorectal cancer. Clin. Cancer Res. 12, 29–33 (2006)

99. Miller, J. C., Pien, H. H., Sahani, D., Sorensen, A. G. & Thrall, J. H.

Imaging angiogenesis: applications and potential for drug development. J. Natl

Cancer Inst.97, 172–187 (2005)

100. Jain RK, Munn LL, Fukumura D. Dissecting tumour pathophysiology

using intravital microscopy. Nat Rev Cancer 2002;2:266–76

101. Bergers G, Benjamin L. Tumorigenesis and the angiogenic switch. Nat

Rev Cancer 2003;3:401–10

102. McDonald D, Choyke P. Imaging of angiogenesis: from microscope to

clinic. Nat Med 2003;9:713–25

103. Rosen L. Antiangiogenic strategies and agents in clinical trials.

Oncologist 2000;5 Suppl 1:20–7

104. Davis DW, McConkey DJ, Abbruzzese JL, Herbst RS. Surrogate markers

in antiangiogenesis clinical trials. Br J Cancer 2003;89:8–14

105. Anderson H, Price P, Blomley M, Leach MO, Workman P. Measuring

changes in human tumour vasculature in response to therapy using functional

imaging techniques. Br J Cancer 2001;85:1085–93

106. Miles KA. Functional computed tomography in oncology. Eur J Cancer

2002;38:2079–84

107. Vach W, Høilund-Carlsen PF, Fischer BM, Gerke O, Weber W. How to

study optimal timing of PET/CT for monitoring of cancer treatment. Am J Nucl

Med Mol Imaging. 2011;1:54–62

108. Iagaru A. 18F-FDG PET/CT: timing for evaluation of response to therapy

remains a clinical challenge. Am J Nucl Med Mol Imaging. 2011;1:63–64

36

109. Nagengast WB, de Vries EG, Hospers GA, Mulder NH, de Jong JR,

Hollema H, Brouwers AH, van Dongen GA, Perk LR, Lub-de Hooge MN. In vivo

VEGF imaging with radiolabeled bevacizumab in a human ovarian tumor

xenograft. J Nucl Med. 2007;48:1313–1319

110. Nagengast WB, de Korte MA, Oude Munnink TH, Timmer-Bosscha H, den

Dunnen WF, Hollema H, de Jong JR, Jensen MR, Quadt C, Garcia-Echeverria C,

van Dongen GA, Lub-de Hooge MN, Schroder CP, de Vries EG. 89Zr-

bevacizumab PET of early antiangiogenic tumor response to treatment with

HSP90 inhibitor NVP-AUY922. J Nucl Med. 2010;51:761–767.

111. Christoforidis JB, Carlton MM, Knopp MV, Hinkle GH. PET/CT imaging of

I-124-radiolabeled bevacizumab and ranibizumab after intravitreal injection in a

rabbit model. Invest Ophthalmol Vis Sci. 2011;52:5899–5903

112. Nayak TK, Garmestani K, Baidoo KE, Milenic DE, Brechbiel MW. PET

imaging of tumor angiogenesis in mice with VEGF-A-targeted 86Y-CHX-A''-

DTPA-bevacizumab. Int J Cancer. 2011;128:920–926

113. Paudyal B, Paudyal P, Oriuchi N, Hanaoka H, Tominaga H, Endo K.

Positron emission tomography imaging and biodistribution of vascular

endothelial growth factor with 64Cu-labeled bevacizumab in colorectal cancer

xenografts. Cancer Sci.2011;102:117–121.

114. Stollman TH, Scheer MG, Leenders WP, Verrijp KC, Soede AC, Oyen WJ,

Ruers TJ, Boerman OC. Specific imaging of VEGF-A expression with

radiolabeled anti-VEGF monoclonal antibody. Int J Cancer. 2008;122:2310–

2314

115. Nagengast WB, Hooge MN, van Straten EM, Kruijff S, Brouwers AH, den

Dunnen WF, de Jong JR, Hollema H, Dierckx RA, Mulder NH, de Vries EG,

Hoekstra HJ, Hospers GA. VEGF-SPECT with 111In-bevacizumab in stage III/IV

melanoma patients.Eur J Cancer. 2011;47:1595–1602

116. Zhang L, Xu JS, Sanders VM, Letson AD, Roberts CJ, Xu RX.

Multifunctional microbubbles for image-guided antivascular endothelial growth

factor therapy. J Biomed Opt. 2010;15:030515

37

117. Withrow KP, Newman JR, Skipper JB, Gleysteen JP, Magnuson JS, Zinn

K, Rosenthal EL. Assessment of bevacizumab conjugated to Cy5.5 for detection

of head and neck cancer xenografts. Technol Cancer Res Treat. 2008;7:61–66

118. Terwisscha van Scheltinga AG, van Dam GM, Nagengast WB,

Ntziachristos V, Hollema H, Herek JL, Schroder CP, Kosterink JG, Lub-de Hoog

MN, de Vries EG. Intraoperative near-infrared fluorescence tumor imaging with

vascular endothelial growth factor and human epidermal growth factor receptor

2 targeting antibodies. J Nucl Med. 2011;52:1778–1785.

119. Chan C, Sandhu J, Guha A, Scollard DA, Wang J, Chen P, Bai K, Lee L,

Reilly RM. A human transferrin-vascular endothelial growth factor (hnTf-VEGF)

fusion protein containing an integrated binding site for 111In for imaging tumor

angiogenesis. J Nucl Med. 2005;46:1745–1752

120. Hao G, Hajibeigi A, De León-Rodríguez LM, Öz OK, Sun X. Peptoid-

based PET imaging of vascular endothelial growth factor receptor (VEGFR)

expression. Am J Nucl Med Mol Imaging. 2011;1:65–75

121. Collingridge DR, Carroll VA, Glaser M, Aboagye EO, Osman S, Hutchinson

OC, Barthel H, Luthra SK, Brady F, Bicknell R, Price P, Harris AL. The

development of [124I] iodinated-VG76e: a novel tracer for imaging vascular

endothelial growth factor in vivo using positron emission tomography. Cancer

Res. 2002;62:5912–5919

122. Jayson GC, Zweit J, Jackson A, Mulatero C, Julyan P, Ranson M,

Broughton L, Wagstaff J, Hakannson L, Groenewegen G, Bailey J, Smith N,

Hastings D, Lawrance J, Haroon H, Ward T, McGown AT, Tang M, Levitt D,

Marreaud S, Lehmann FF, Herold M, Zwierzina H. Molecular imaging and

biological evaluation of HuMV833 anti-VEGF antibody: implications for trial

design of antiangiogenic antibodies. J Natl Cancer Inst. 2002;94:1484–1493

123. Cai W, Chen X. Multimodality imaging of vascular endothelial growth

factor and vascular endothelial growth factor receptor expression. Front Biosci.

2007;12:4267–79.

124. Cai W, Hong H. Peptoid and positron emission tomography: an appealing

combination. Am J Nucl Med Mol Imaging. 2011;1:76–79.

38

125. Chan C, Sandhu J, Guha A, Scollard DA, Wang J, Chen P, Bai K, Lee L,

Reilly RM. A human transferrin-vascular endothelial growth factor (hnTf-VEGF)

fusion protein containing an integrated binding site for 111In for imaging tumor

angiogenesis. J Nucl Med. 2005;46:1745–52.

126. Backer MV, Levashova Z, Patel V, Jehning BT, Claffey K, Blankenberg FG,

Backer JM. Molecular imaging of VEGF receptors in angiogenic vasculature with

single-chain VEGF-based probes. Nat Med. 2007;13:504–9.

127. Blankenberg FG, Backer MV, Levashova Z, Patel V, Backer JM. In vivo

tumor angiogenesis imaging with site-specific labeled 99mTc-HYNIC-VEGF. Eur J

Nucl Med Mol Imaging. 2006;33:841–8.

128. Li S, Peck-Radosavljevic M, Kienast O, Preitfellner J, Havlik E, Schima W,

Traub-Weidinger T, Graf S, Beheshti M, Schmid M, Angelberger P, Dudczak R.

Iodine-123-vascular endothelial growth factor-165 (123I-VEGF165).

Biodistribution, safety and radiation dosimetry in patients with pancreatic

carcinoma. Q J Nucl Med Mol Imaging.2004;48:198–206.

129. Cai W, Chen K, Mohamedali KA, Cao Q, Gambhir SS, Rosenblum MG,

Chen X. PET of vascular endothelial growth factor receptor expression. J Nucl

Med.2006;47:2048–56.

130. Wang H, Cai W, Chen K, Li ZB, Kashefi A, He L, Chen X. A new PET

tracer specific for vascular endothelial growth factor receptor 2. Eur J Nucl Med

Mol Imaging.2007;34:2001–10.

131. Hsu AR, Cai W, Veeravagu A, Mohamedali KA, Chen K, Kim S, Vogel H,

Hou LC, Tse V, Rosenblum MG, Chen X. Multimodality molecular imaging of

glioblastoma growth inhibition with vasculature-targeting fusion toxin

VEGF121/rGel. J Nucl Med.2007;48:445–54.

132. Eder M, Krivoshein AV, Backer M, Backer JM, Haberkorn U, Eisenhut M.

ScVEGF-PEG-HBED-CC and scVEGF-PEG-NOTA conjugates: comparison of easy-

to-label recombinant proteins for [68Ga]PET imaging of VEGF receptors in

angiogenic vasculature. Nucl Med Biol. 2010;37:405–12.

39

133. Wang H, Gao H, Guo N, Niu G, Ma Y, Kiesewetter DO, Chen X. Site-

Specific Labeling of scVEGF with Fluorine-18 for Positron Emission Tomography

Imaging.Theranostics. 2012;2:607–617.

134. De Leon-Rodriguez LM, Lubag A, Udugamasooriya DG, Proneth B,

Brekken RA, Sun X, Kodadek T, Dean Sherry A. MRI detection of VEGFR2 in

vivo using a low molecular weight peptoid-(Gd)8-dendron for targeting. J Am

Chem Soc.2010;132:12829–31.

135. Willmann JK, Paulmurugan R, Chen K, Gheysens O, Rodriguez-Porcel M,

Lutz AM, Chen IY, Chen X, Gambhir SS. US imaging of tumor angiogenesis with

microbubbles targeted to vascular endothelial growth factor receptor type 2 in

mice. Radiology.2008;246:508–18.

136. Backer MV, Backer JM. Imaging key biomarkers of tumor angiogenesis.

Theranostics. 2012;2:502–15

137. Nagengast WB, de Vries EG, Hospers GA, Mulder NH, de Jong JR,

Hollema H, Brouwers AH, van Dongen GA, Perk LR, Lub-de Hooge MN. In vivo

VEGF imaging with radiolabeled bevacizumab in a human ovarian tumor

xenograft. J Nucl Med.2007;48:1313–9.

138. Stollman TH, Scheer MG, Leenders WP, Verrijp KC, Soede AC, Oyen WJ,

Ruers TJ, Boerman OC. Specific imaging of VEGF-A expression with

radiolabeled anti-VEGF monoclonal antibody. Int J Cancer. 2008

139. Helisch A, Forster GJ, Reber H, Buchholz HG, Arnold R, Goke B, Weber

MM, Wiedenmann B, Pauwels S, Haus U, Bouterfa H, Bartenstein P. Pre-

therapeutic dosimetry and biodistribution of 86Y-DOTA-Phe1-Tyr3-octreotide

versus 111In-pentetreotide in patients with advanced neuroendocrine

tumours. Eur J Nucl Med Mol Imaging. 2004;31:1386–92.

140. Scheer MG, Stollman TH, Boerman OC, Verrijp K, Sweep FC, Leenders

WP, Ruers TJ, Oyen WJ. Imaging liver metastases of colorectal cancer patients

with radiolabelled bevacizumab: Lack of correlation with VEGF-A

expression. Eur J Cancer.2008;44:1835–40.

40

141. Ferlay J, Shin HR, Bray F, Forman D, Mathers C, Parkin DM Estimates of

worldwide burden of cancer in 2008: GLOBOCAN 2008. Int J

Cancer.2010;127:2893–2917.

142. Vogl G, Bartel H, Dietze O, Hauser-Kronberger C. HER2 is unlikely to be

involved in directly regulating angiogenesis in human breast cancer. Appl

Immunohistochem Mol Morphol. 2006;14:138–145.

143. Kostopoulos I, Arapantoni-Dadioti P, Gogas H, et al. Evaluation of the

prognostic value of HER-2 and VEGF in breast cancer patients participating in a

randomized study with dose-dense sequential adjuvant chemotherapy. Breast

Cancer Res Treat. 2006;96:251–261

144. Fuckar D, Dekanic A, Stifter S, et al. VEGF expression is associated with

negative estrogen receptor status in patients with breast cancer. Int J Surg

Pathol. 2006;14:49–55.

145. Liu Y, Tamimi RM, Collins LC, et al. The association between vascular

endothelial growth factor expression in invasive breast cancer and survival

varies with intrinsic subtypes and use of adjuvant systemic therapy: results

from the Nurses’ Health Study. Breast Cancer Res Treat. 2011;129:175–184.

146. Nagengast WB, de Vries EG, Hospers GA, et al. In vivo VEGF imaging

with radiolabeled bevacizumab in a human ovarian tumor xenograft. J Nucl

Med. 2007;48:1313–1319.

147. Nagengast WB, de Korte MA, Oude Munnink TH, et al. 89Zr-

bevacizumab PET of early antiangiogenic tumor response to treatment with

HSP90 inhibitor NVP-AUY922. J Nucl Med. 2010;51:761–767.

148. Oosting SF, Brouwers AH, Van Es SC, et al. 89Zr-bevacizumab PET

imaging in metastatic renal cell carcinoma patients before and during

antiangiogenic treatment. J Clin Oncol. 2012;30(suppl): abstract 10581.

149. Bluff JE, Menakuru SR, Cross SS, et al. Angiogenesis is associated with

the onset of hyperplasia in human ductal breast disease. Br J Cancer.

2009;101:666–672.

150. Helisch A, Forster GJ, Reber H, Buchholz HG, Arnold R, Goke B, Weber

MM, Wiedenmann B, Pauwels S, Haus U, Bouterfa H, Bartenstein P. Pre-

41

therapeutic dosimetry and biodistribution of 86Y-DOTA-Phe1-Tyr3-octreotide

versus 111In-pentetreotide in patients with advanced neuroendocrine tumours.

Eur J Nucl Med Mol Imaging. 2004;31:1386–92

151. Perk LR, Visser OJ, Stigter-van Walsum M, Vosjan MJ, Visser GW,

Zijlstra JM, Huijgens PC, van Dongen GA. Preparation and evaluation of (89)Zr-

Zevalin for monitoring of (90)Y-Zevalin biodistribution with positron emission

tomography. Eur J Nucl Med Mol Imaging. 2006;33:1337–45

152. Liu X, Laforest R. Quantitative small animal PET imaging with

nonconventional nuclides. Nucl Med Biol. 2009;36:551–9

153. Herzog H, Tellmann L, Scholten B, Coenen HH, Qaim SM. PET imaging

problems with the non-standard positron emitters Yttrium-86 and Iodine-124. Q

J Nucl Med Mol Imaging. 2008;52:159–65.

154. Buchholz HG, Herzog H, Forster GJ, Reber H, Nickel O, Rosch F,

Bartenstein P. PET imaging with yttrium-86: comparison of phantom

measurements acquired with different PET scanners before and after applying

background subtraction. Eur J Nucl Med Mol Imaging. 2003;30:716–20

155. Palm S, Enmon RM, Jr, Matei C, Kolbert KS, Xu S, Zanzonico PB, Finn

RL, Koutcher JA, Larson SM, Sgouros G. Pharmacokinetics and Biodistribution of

(86)Y-Trastuzumab for (90)Y dosimetry in an ovarian carcinoma model:

correlative MicroPET and MRI. J Nucl Med. 2003;44:1148–55

156. Nayak TK1, Garmestani K, Baidoo KE, Milenic DE, Brechbiel MW. PET

imaging of tumor angiogenesis in mice with VEGF-A-targeted (86)Y-CHX-A″-

DTPA-bevacizumab. Int J Cancer. 2011 Feb 15;128(4):920-6.

157. O’Connor MK, Li H, Rhodes DJ, Hruska CB, Clancy CB, Vetter RJ.

Comparison of radiation exposure and associated radiation-induced cancer risks

from mammography and molecular imaging of the breast. Med Phys.

2010;37:6187–6198.

158. de Jong JR, Warnders FJ, Nagengast WB, et al. Radiation dosimetry of

111In-bevacizumab for VEGF-SPECT in melanoma patients. Eur J Nucl Med Mol

Imaging. 2010;37(suppl):S477–S477.

42

159. Börjesson PK, Jauw YW, de Bree R, et al. Radiation dosimetry of 89Zr-

labeled chimeric monoclonal antibody U36 as used for immuno-PET in head and

neck cancer patients. J Nucl Med. 2009;50:1828–1836

160. Murano T, Minamimoto R, Senda M, et al. Radiation exposure and risk-

benefit analysis in cancer screening using FDG-PET: results of a Japanese

nationwide survey. Ann Nucl Med. 2011;25:657–666.

161. Gaykema SB1, Brouwers AH, Lub-de Hooge MN, Pleijhuis RG, Timmer-

Bosscha H, Pot L, van Dam GM, van der Meulen SB, de Jong JR, Bart J, de

Vries J, Jansen L, de Vries EG, Schröder CP. 89Zr-bevacizumab PET imaging in

primary breast cancer. J Nucl Med. 2013 Jul; 54:1014-8.

43

FIGURE 1. Coronal CT image (A) with clear subcutaneous localization of SKOV-

3 tumor (arrow). Fusion of microPET and CT images (B) (168 h after injection)

enables adequate quantitative measurement of 89Zr-bevacizumab in the tumor.

FROM: J Nucl Med. 2007;48:1313-1319

FIGURE 2. Coronal planes of microPET images 24 h (A), 72 h (B), and 168 h

(C) after injection of 89Zr-bevacizumab. At 24 h, most uptake is in well-perfused

organs. In time, relative uptake in the tumor (arrow) increases.

FROM: J Nucl Med. 2007;48:1313-1319

44

FIGURE 3. (A) In-111-bevacizumab scan: Scintigraphic imaging of a liver

metastasis with In-111-bevacizumab. (B) 4-phase CT scan: Imaging of liver

metastasis. (C) PET/CT scan: Combined FDG-PET scan and CT scan of the liver

lesion. FROM: European Journal of Cancer. 2008;44:1835-1840

FIGURE 4. IHC analysis. Expression of VEGFR1 in mouse subcutaneous tissue

implanted and colonized by human HT 29 colon carcinoma cells. VEGFR1

appears heterogeneously distributed between tumor cells. (10x, boxed area:

20x).

45

FIGURE 5. IHC analysis. Expression of VEGFR2 in mouse subcutaneous tissue

implanted and colonized by human HT-29 colon carcinoma cells (10x). VEGFR2

immunoreactivity is present between tumor cells and it is particularly expressed

in the wall of the blood vessels. (boxed area: 40x)

FIGURE 6. Immunohistochemical staining for VEGF-A in human glioblastoma (GBM) in a 7-year old patient. Numerous tumor cells show strong cytoplasmic staining for VEGF-A. Human GBM stem-like cells (giant multinucleated cells proliferating) form three typical rings (GBSCs). (40x)

46

FIGURE 7. Immunohistochemical staining for VEGF-A in a case of

nasopharyngeal angiofibroma (age of patient: 14 years). Marked

immunoreactivity is visible in the fibrous tissue and in pathological vessels. IHC

for VEGF demonstrates expression in more than 50% of stromal cells (boxed

area: 40x).

47

Chapter 2

Immunohistochemical profile of

neurotrophins in Human Cranial Dura

Mater and Meningiomas

M. Artico, E. Bronzetti*, E. Pompili*, B. Ionta ,

V. Alicino, A. D'Ambrosio*, A. Santoro§,

F.S. Pastore°, I. Elenkov* and L. Fumagalli*

Department of Otorhinolaringology, Audiology and Phoniatry “G. Ferreri",

*Department of Cardiovascular and Respiratory Sciences, Section of

Experimental Morphology,

§Department of Neurological Sciences, Neurosurgery, University of Rome "La

Sapienza", °Division of Neurosurgery, University of Rome "Tor Vergata", Rome,

Italy

Oncology Reports 2009; 21 (6): 1373-1380

Key words: neurotrophins (NTs) - human - dura mater -

immunohistochemistry – meningioma

48

Abstract

The immunohistochemical profile of neurotrophins and their receptors in the

human cranial dura mater was studied by examining some dural zones in

specimens harvested from different regions (frontal, temporal, parietal and

occipital). Dural specimens were obtained (pending the informed written

consent of the patients) during neurosurgical operations performed in ten

patients for surgical treatment of intracranial lesions (meningiomas, traumas,

gliomas, vascular malformations). The dural fragments were taken in the area

of the craniotomy at least 8 centimeters from the lesion as well as in the area

in which the meningioma had its the dural attachment. Immunohistochemical

characterization and distribution of neurotrophins, with their receptors, were

analyzed and discussed. The concrete role played by these neurotrophic factors

in general regulation, vascular permeability, algic responsivity and release of

locally active substances in the human dura mater is still controversial. Our

study revealed a general structural alteration of dural tissue due to the strong

invasivity of meningiomatous lesions, together with an improved expression of

BDNF in highly proliferating neoplastic cells and an evident production of NGF

in inflammatory cells, suggesting that BDNF has a role in supporting the

proliferation rate of neoplastic cells, while NGF is envolved in the activation of a

chronic inflammatory response in neoplastic areas.

Introduction

Meningiomas are the most common benign intracranial tumors but some

meningiomas show malignancy with invasion into the surrounding structures,

as well as a high recurrence rate and extracranial metastases (1). Meningiomas

arise from arachnoidal cells, most of which lie in close proximity to the venous

sinuses: in fact, this is the most common site for meningioma formation. They

http://en.wikipedia.org/wiki/Benign

http://en.wikipedia.org/wiki/Tumor

49

are most frequently attached to the dura mater over the superior parasagittal

surface of the frontal and parietal lobes, along the sphenoid ridge, in the

olfactory grooves, the Sylvian region, superior cerebellum along the falx

cerebri, cerebellopontine angle, and spinal cord. The tumor is usually well-

circumscribed, with the base lying on the dura mater.

Histologically, the cells are relatively uniform, with a tendency to form highly-

circumscribed whorls and to generally disrupt the distribution and the structure

of collagen fibers (main component of dural tissue) and to originate

“psammoma bodies” (laminated concretions) which can calcify, and are often

strongly vascularized.

The remarkable proliferation rate and vascularisation which determine a rapid

replacement of normal dural tissue by the neoplastic cells, is regulated by

several different growth factors, such as NGF related to an increased activation

of the inflammatory cells at the beginning of the neoplastic invasion, and BDNF,

involved in the increased activation of the tumoral cells.

Neurotrophins (NTs), also known as neurotrophic factors, constitute a family of

dimeric proteins working as polypeptidic growth factors and acting like

extracellular ligands. NTs , including NGF (Levi-Montalcini , 1952), BDNF, NT-3,

NT-4, are involved in vertebrate neuronal cell development, differentiation,

survival and functional activities.

Neurotrophins are also involved in the modulation of adult central nervous

system functions and organization, as well as in the neural control of different

activities related to vegetative innervation of several organs (2-6). A definite

role of NTs in the dural and leptomeningeal compartments is not well

ascertained but a previous study on the expression of mRNAs for NTs revealed

high levels of NT3 and NGF in the normal rat dura mater (7). Our observations

on the localization and possible roles in different non-neuronal tissues as

lymphoid, lung and prostate (8-11) encouraged us to persist in our

experimental investigations in order to find a possible involvement of NTs in

dura mater, both in physiological and pathological conditions (meningiomas).

http://en.wikipedia.org/w/index.php?title=Sphenoid_ridge&action=edit&redlink=1

http://en.wikipedia.org/wiki/Olfactory

http://en.wikipedia.org/w/index.php?title=Sylvian_region&action=edit&redlink=1

http://en.wikipedia.org/wiki/Cerebellum

http://en.wikipedia.org/wiki/Falx_cerebri

http://en.wikipedia.org/wiki/Falx_cerebri

http://en.wikipedia.org/wiki/Cerebellopontine_angle

http://en.wikipedia.org/wiki/Spinal_cord

http://en.wikipedia.org/wiki/Dura

http://en.wikipedia.org/wiki/Psammoma_body

50

In fact our study investigates the immunohistochemical localization of NTs and

their receptors both in the normal human cranial dura mater and in the dural

tissue close to the dural attachment of the meningiomatous mass, focusing on

a possible correlation between the dural distribution of these neurotrophic

factors and the physiopathological mechanisms involved in meningioma

development.

Materials and Methods

Patients

Neurosurgical operations were performed on ten adult patients (age range 30-

75 years) and 2 fragments (for each subject) of dura mater were obtained

from occipital (1 basal -posterior cranial fossa and 1 apical), frontal (1 basal -

anterior cranial fossa- and 1 apical -parasagittal-), parietal (1 parasagittal and 1

convexity), and temporal (1 basal -middle cranial fossa- and 1 apical-

corresponding with the dural area located at least 1 cm behind the temporal

crest ) regions.

The dural fragments were taken from the craniotomy area distant at least 8

centimeters from the lesion or in the areas close to the meningioma (four

meningotheliomatous-psammomatous and five transitional). Human dural

tissue was surgically removed and processed for immunohistochemical and RT-

PCR analysis. Experiments were performed in compliance with the Italian laws

and guidelines concerning the informed consent of the patients. The following

molecules were investigated: nerve growth factor (NGF), brain derived

neurotrophic factor (BDNF), NT-3, NT-4 and the neurotrophin receptors such as

tyrosine kinase A (TrKA), tyrosine kinase B (TrKB), tyrosine kinase C (TrKC) and

protein 75 (p75).

51

Immunohistochemistry

Small fragments of dural tissue were washed in PBS, fixed in 10 % formalin

and embedded in paraffin according to a standard procedure. Serial 10 m

thick sections were cut using a rotatory microtome, mounted on gelatin-coated

slides and processed for immunohistochemistry. To study the

immunolocalization of neurotrophins and their own receptors, the antibodies

used were: i) rabbit anti nerve growth factor (anti NGF) polyclonal antibody

(Santa Cruz, CA, U.S.A.). It displayed less than 1% cross-reactivity against

recombinant human NT-3, NT-4 and BDNF; ii) rabbit anti tyrosine kinase A (

anti TrKA) polyclonal antibody (Santa Cruz, CA, USA). It recognized an epitope

corresponding to aminoacids 763 to 777, mapping adjacent to the carboxy

terminus of human TrKA p140; iii) goat polyclonal antibody to human p75 NT

receptor (Santa Cruz, CA, U.S.A.). It recognized the amino acid sequence

mapping the carboxy terminus of the p75 NT receptor precursor of human

origin; iv) rabbit anti brain derived neurotrophic factor (anti-BDNF) polyclonal

antibody (Santa Cruz, CA, U.S.A.). It recognized the amino-terminal of mouse

BDNF; v) rabbit anti tyrosine kinase B (anti TrKB) polyclonal antibody (Santa

Cruz, CA, U.S.A.). It recognized an epitope corresponding to aminoacids 794 to

808 of mouse TrKB p145; vi) rabbit anti neurotrophin 3 (anti NT-3) polyclonal

antibody (Santa Cruz, CA, U.S.A.). It was raised against the amino-terminal of

mouse NT-3; vii) rabbit polyclonal anti tyrosine kinase C (anti TrKC) antibody

(Santa Cruz, CA, U.S.A.). It recognized an epitope corresponding to aminoacids

798 to 812 of porcine TrKC p140. The immunohistochemical recognition of

macrophages was performed using a mouse monoclonal anti human CD68

antibody (DakoCytomation, Denmark). Incubation with primary antibodies was

performed overnight at 4° C at a final concentration of 2-5 μg/ml. Optimal

antisera dilutions and incubation times were assessed in a series of preliminary

experiments. After exposure to the primary antibodies, slides were rinsed twice

in phosphate buffer and incubated (1 h and 30 min at room temperature) with

the appropriate secondary antibody conjugated to horseradish peroxidase

52

(HRP) (final dilution 1:100). The secondary antibody-HRP linked against rabbit

immunoglobulins was purchased from Boehringer (Boehringer Mannheim

GmbH, Mannheim, Germany), while secondary antibodies-HRP linked against

mouse and goat immunoglobulins were from Sigma (Sigma Chemicals Co, St

Louis, MO, USA). After a further wash with phosphate buffer, slides were

treated with 0.05% 3,3-diaminobenzidine and 0.1% H2O2. Finally, sections

were counterstained with Mayer's hematoxylin and observed by using a light

microscope. To block endogenous peroxidase activity, slides were pretreated

with 3 % H2O2, whereas the non-specific binding of immunoglobulins was

prevented by adding 3 % fetal calf serum to the incubation medium. Negative

control experiments were done: i) by omitting the primary antibody; ii) by

substituting the primary antibody with equivalent amount of non specific

immunoglobulins; iii) by pre-incubating the primary antibody with the specific

blocking peptide (antigen/antibody = 5 according to customer's instructions).

In preliminary experiments, immunohistochemistry was also performed on

frozen sections of human dural tissue. No differences were found in the

intensity or distribution of immunostaining using the two types of sections, but

microanatomical details were better preserved in paraffin-embedded material.

The intensity of immune reaction was assessed microdensitometrically by an

IAS 2000 image analyzer (Delta Sistemi, Rome, Italy) connected via a TV

camera to the microscope. The system was calibrated taking the background

obtained in sections exposed to non-immune serum as zero. Ten 100 μm2

areas were delineated in each section by a measuring diaphragm. Quantitative

data of the intensity of the immune staining were analyzed statistically by

analysis of variance (ANOVA) followed by Duncan's multiple range test as a

post hoc test. The parameters examined by quantitative analysis were: 1) the

dural regions from which the fragments were taken (A=basal region of the

cranial dura, B=apical region of the cranial dura); 2) examined zones (I = vasal

zone, strictly corresponding to vasal perimeter; II=perivasal zone,

corresponding to a ring 100 m in diameter around the vessel; III = dural or

53

intervasal zone, at least 50 m away from the nearest vessel boundary); 3)

distribution of the immunoreactivity. These values were transformed into a

single number expressed as conventional unit, including the standard deviation.

This number can be read on the display of the Quantimet 500 image analyzer.

RT-PCR

Total RNA was isolated from human dural tissue by using TRIzol reagent

(Invitrogen, Carlsbad, CA, USA) according to customer’s instructions. cDNA was

synthezised from 1 g total RNA in a final reaction volume of 20 l. Briefly, a

mixture of total RNA, oligo (dT), dNTP mix and DEPC-treated distilled water

was preincubated for 5 min at 65 °C; then SuperScript III reverse transcriptase

(200U), RNase Ribonuclease Inhibitor, DTT and buffer (250 mM Tris pH 8.3,

375 mM KCl, 15 mM MgCl2) were added to the mixture and incubation was

continued for 45 min at 50°C. Finally, Superscript III was disactivated by

heating for 15 min at 70° C. All reagents were from Invitrogen. Three to five l

of the resulting cDNA were amplified by polymerase chain reaction (PCR). Each

PCR tube contained the following reagents: 0.2 mM of both sense and

antisense primers, 3 to 5 ml template cDNA, 0.2 mM 4-dNTP mix (Invitrogen,

CA, U.S.A.), 2.5 U Platinum Taq DNA polymerase (Invitrogen, CA, U.S.A.) and

1X reaction buffer (Invitrogen, CA, U.S.A.). MgCl2 was added at a final

concentration of 1 mM for BDNF, NT3, TrKA and TrKB and at a final

concentration of 1.5 mM for NGF, TrKC and p75. The final volume was 50 ml.

The PCR primers used for amplifying neurotrophins and their receptors (M-

Medical, Florence, Italy) were: for NGF forward TCATCATCCCATCCCATCTT,

reverse CTTGACAAAGGTGTGAGTCG; for BDNF forward

AGCCTCCTCTGCTCTTTCTGCTGGA, reverse CTTTTGTCTATGCCCCTGCAGCCTT;

for NT3 forward TTTCTCGCTTATCTCCGTGGCATCC, reverse

GGCAGGGTGCTCTGGTAATTTTCCT; for NT4 forward GCTGTGGACTTGCGTGG,

reverse GCCCGCACATAGGACTG; for TrKA forward TCTTCACTGAGTTCCTGGAG,

reverse TTCTCCACCGGGTCTCCAGA; for TrKB forward

54

AAGACCCTGAAGGATGCCAG, reverse AGTAGTCAGTGCTGTACACG; for TrKC

forward GGAAAGGTCTTCCTGGCCGAGTGC, reverse

GCTTTCCATAGGTGAAGATCTCCC; for p75 forward TGGACAGCGTGACGTTCTCC,

reverse GATCTCCTCGCACTCGGCGT. The specificity of the primers was verified

by searching for every possible homology to cDNAs of unrelated known

proteins in the NCBI data base. PCR reaction consisted of incubation for 2 min

at 94° C followed by 30-35 cycles of incubation at 94° C for 30 sec, 56° C (for

NGF, NT4, TrKA and TrKB) or 62° C (for BDNF, NT3, p75 and TrKC) for 30 sec

and 72° C for 1 min. PCR products were separated by agarose gel

electrophoresis (Submarine Agarose Gel Unit, Hoefer, San Francisco, CA, USA)

and visualized using a digital gel documentation system (GelDoc 2000

System/Quantity One Software; Bio-Rad Laboratories, Hercules, CA, USA).

Results


Immunoreactivity for neurotrophins and their receptors has been observed both

in the normal dura mater and in the dural tissue close to the meningiomatous

area. The sections harvested from normal dura mater generally revealed a

marked immunoreactivity in the endothelium of the dural vessels, in collagene

fibers and in fibroblasts .

In fact, immunoreaction for NGF was clearly demonstrated in fibroblasts and

collagen fibers and also appeared to same degree in the endothelium of the

dural vessels (Fig.1A). In the same way TrkA immunoreactivity was strongly

marked in the dural vessel endothelium, in fibroblasts and collagen fibers

(Fig.1C). A moderate immunoreactivity for the p75NTR was demonstrated in

the dural vessel endothelium and weakly expressed in fibroblasts and collagene

fibers (Fig.1E). BDNF immunoreactivity was appreciable in the dural vessel

wall, in fibroblasts and collagen fibers (Fig.2A), and in the same compartments

we observed a reaction for TrkB (Fig.2C). Moderate immunoreactivity was

55

demonstrated for NT-3 and NT-4 in the previous compartments (Fig.3A,3C). On

the other hand, TrkC immunoreactivity was appreciable in the same areas

(Fig.3E ). Meningiomatous sections revealed a general structural alteration of

collagen fiber with compressed fibroblasts within the well-circumscribed whorls,

which completely replaced the normal dural tissue. We also observed an

evident immunoreaction in the dural vessel wall, in the aggregates of

fibroblasts/macrophages and in the whorls (vorticoid areas), which may calcify

in some histotypes, thus forming laminar concentrically arranged masses

named psammomatous bodies. The macrophage aggregates showed a strong

immunoreactivity for NGF and TrkA, while a moderate reaction was

demonstrated for blood vessel endothelium (Fig.1B,1D); P75NTR

immunoreactivity was, on the contrary, very weak in the same compartments

(Fig.1F). The neoplastic cells in the whorls showed a remarkable

immunoreactivity for BDNF and TrkB (Fig.2B,2D), thus confirming our previous

results in other neoplastic tissues, as lung and prostate (11, 12), in which we

demonstrated a significant role of BDNF in the increased proliferation rate of

neoplastic lesions. NT-3 was weak and NT-4 immunoreaction was moderate in

the neoplastic cells of the whorls (Fig.3B,3D), in the dural vessel wall and in

the macrophage aggregates. The same result was observed for TrkC and p75

(Fig.3F).

RT-PCR

RT-PCR analysis confirmed the findings of the immunohistochemical

investigation both in the normal dura and in the dural area close to

meningiomatous tissue. In fact, we observed a strong expression of specific

transcripts for BDNF and TrKB, moderate for NT-4 in the meningiomatous

tissue, and a relevant expression of NGF in the dura mater close to the tumor

lesion (Fig 4 ).

56

Discussion

Notwithstanding the common (mesodermal) origin of all the meninges there

are, in any case, relevant differences in the biological behaviour of the

leptomeninx (arachnoid and pia mater) and pachimeninx (dura mater). In fact,

only the leptomeninx contains the meningoblasts (cells responsible for the

genesis and the development of meningiomas).The dura mater does not play a

role in the onset of meningiomas (it only rarely developing other unusual

tumors such as some sarcomas) but often has close a relationship with the

meningiomatous lesions which are characterized by a close contiguity with the

pachimeninx itself, with the exception of those rare meningiomas without dural

attachment that are often intraventricular. These close relationships between

meningiomas and dura mater persuaded us to investigate the

immunohistochemical profile of neurotrophins in the normal dura and in the

dura adjacent to the meningiomatous lesion in order identify any differences in

the localization of neurotrophins in that compartments, and to demonstrate a

possible direct role in tumorigenesis and in the progression of these specific

neoplastic lesions. Numerous studies have stressed the relevance of the

morphological structure of dural innervation, in fact some interesting

investigations in rats (12-17) have focused on the peptidergic,

catecholaminergic and nitroxidergic innervation of dura mater encephali (18),

revealing a possible relationship with the etiopathogenesis of headache and

dural pain (13,15,19-20). The dura mater shows a high density of sympathetic

nerve fibers and an impressive population of mast cells, mainly perivascular. It

also receives significant sensory projections from the trigeminal system. The

presence of these three elements in the meningeal layer suggests a relevant

functional interaction between the nervous and the immune system, both

mediated by neurotrophic factors (6,13-14,20-21). It is well known that NGF

has an inflammatory role and its increase is directly related to inflammation and

diseases of the immune system (4,6,22), probably due to the direct action of

57

NGF on mast cells and sensory neurons, as proposed by Woolf et al. (19).

Interestingly, dura mater cells contain high levels of NGF and TrKC, and

moderate levels of BDNF and NT-4, suggesting that NGF is essential in

preserving the integrity of the mast cell/nerve unit (7). Neurotrophins (NTs) are

neurotrophic signalling polypeptides which include nerve growth factor (NGF),

brain derived growth factor (BDNF), neurotrophin-3 (NT-3), NT-4/5 and NT-6,

the latter apparently being specific for fish (2-3). The biological effects of NTs

are mediated by the binding with two families of membrane receptors, the high

affinity tyrosine kinase (TrK) and low affinity p75 receptor (p75NT receptor)

(2). The TrK family includes TrKA, TrKB and TrKC receptors, whereas p75NT

receptor belongs to the trans-membrane molecules serving as receptor for

tumor necrosis factor and cytokines (3). TrKA is specifically activated by NGF,

whereas TrKB and TrKC are primarily receptors for BDNF and NT-3 respectively

(3). The physiological role of NTs in the development, maintenance and

regeneration of the sympathetic and sensory nervous system has been well

established (23-25) and mainly NGF induces differentiation and decreases

growth rate in a variety of neoplastic cells from neurogenic and non neurogenic

origin (26-29). There is increasing evidence that NTs may act together with a

paracrine mechanism in the regulation of the functional activity of neuronal and

non-neuronal structures (30). We have investigated the possible role of NTs in

the physiopathology of dura diseases, especially in neoplastic lesions. NGF

showed an appreciable expression rate in the normal dura mater and in the

dural close to the meningiomatous tissue, but the distribution of this growth

factor and its high affinity receptor TrkA in the whorls (vorticoid areas)

appeared markedly different. In fact NGF and TrKA resulted markedly

expressed in macrophages, thus confirming their functional involvement in the

persistence of a chronic inflammatory condition in the tumoral lesion. BDNF

and TrKB were, on the contrary, strongly expressed in the vorticoid areas and

this finding suggests that they play a direct role in the development and

progression of the meningiomatous cells. NGF is found in many tissues and

cells including the brain, meninges, and cerebrospinal fluid (32), while BDNF is

58

expressed throughout the central nervous system as well as in the periphery,

mainly in sensory neurons expressing NGF receptors. Peripheral noxious stimuli,

such as trauma or inflammation, up-regulate NGF in the affected tissue, as well

as BDNF in the sensory ganglia. However , while NGF contributes specifically to

inflammation and neuropathic pain inducing the sensitization of peripheral

nociceptors, BDNF released within the central nervous system acts as role a

pain modulator contributing to the central sensitization, probably via the

activation of NMDA receptors (22). BDNF is directly produced by meningeal

cells (22,25,28,31-33) together with pro-inflammatory cytokines, reducing

cellular apoptosis (1,33) and promoting cellular survival in an autocrine or

paracrine manner in TrKB expressing human neuroblastoma (30,33-34). The

expression of p75 appeared moderate in the normal dura mater, but weak both

in the meningiomatous tissue and in the surrounding dural compartment,

because this receptor, as it is known in literature, is lost during tumor

progression (28). RT-PCR analysis has confirmed our immunohistochemical

observations: in fact, we have described a moderate expression of NGF and its

high-affinity receptor TrKA in normal dura mater, in the meningioma tissues

and in the surrounding dural compartments. This finding encouraged us to

believe in a direct role of NGF/TrKA in the maintenance of a chronic

inflammatory condition, necessary to the beginning and the consequent

progression of the neoplastic lesion. On the other hand, other neurotrophins

such as BDNF, its hifh-affinity TrKB and NT-4 were markedly expressed both in

the meningioma specimens and in the surrounding dural tissue. This finding

suggests a direct envolvement of BDNF/NT-4 in the development and

proliferation of the tumor cells (see Table I-II). The data described above

confirmed our previous experimental findings (8-11), hence improving our

knowledge about the role of the neurotrophins in the regulation of the

meningeal microenvironment, and their direct participation in the neoplastic

transformation and cellular survival, both essential aspects of the malignant

development.

59

Table I - Normal Dura Mater

Fibroblasts Collagen

Fibers

Macrophages Blood vessels

endothelium

NGF ++ ± + BDNF + - + NT-3 ± - ± NT-4 ± - ± TrKA + ± + TrKB ± - ± TrKC + - + P75NTR + - ±

Table II – Meningioma/Surrounding Dural Tissue

Fibroblasts

Collagen Fibers

Macrophages Vorticoid

areas

Blood vessels

endothelium

NGF ± ++ ± + BDNF ± ± ++ + NT-3 - ± +/++ ± NT-4 - ± +/++ ± TrKA ± + ± ± TrKB - ± ++ ± TrKC - ± + ± P75NTR - - ± ±

Table Legends: ±,weak immunoreactivity; +, moderate immunoreactivity;

++, strong immunoreactivity.

60

Fig.1. Micrographs of NGF immunostaining in normal human dura mater (A)

and in the transitional meningioma (B)/surrounding dural tissue, 40x. The

immunoreactivity for NGF is evident in close to proximity the blood vessels

endothelium (e), in fibroblasts (f) and collagen fibers (cf) in the normal dura

mater and in dural tissue close to meningioma .The immunostaining for NGF in

the transitional meningioma (B) is more evident in the aggregated

macrophages (m) and fibroblasts (f). Micrographs of TrKA immunostaining

normal human dura mater (C) and in the meningotheliomatous-psammomatous

meningioma (D)/surrounding dural tissue. In micrographs (C) a vessel with its

endothelium (e) is clearly visible. Moreover another small vessel within the wall

of the vessel (vasum vasorum) may be observed and an intense

immunoreactivity for TrkA is present in the wall of this vessel and in the

aggregated fibroblasts (f) and collagen fibers (cf). Micrographs of TrKA

reactivity in a meningotheliomatous-psammomatous meningioma (D) and

61

surrounding dural tissue, macrophages and the endothelium of the vessels are

characterized by a moderate immunoreaction. Micrographs of the

immunoreactivity for p75NTR in the normal dura (E) and in a transitional

meningioma (F)/surrounding dural tissue. P75NTR shows a moderate

immunoreaction in the endothelium, a weak expression in macrophages (m),

fibroblasts (f) and collagen fibers (cf).

Fig.2. Micrographs of BDNF immunoreactivity in normal human dura mater (A)

and in meningotheliomatous-psammomatous meningioma (B)/surrounding

dural tissue, 40x. An appreciable immunoreactivity is visible in fibroblasts (f)

and collagen fibers (cf), as well as in the endothelium of vessels (e). An

analogous positive immunoreactivity for BDNF is markedly visible in the

vorticoid areas (va) and in the endothelium (e) and moderate immunoreactivity

may be observed in the aggregates of macrophages (m) . The TrkB

immunoreactivity appears to be moderate or weak in the fibroblasts (f) and

collagen fibers (cf) of the dura mater (C), but is more intense in the vorticoid

areas (va) of the transitional meningioma (D).

62

Fig.3 Micrographs of NT-3 and NT-4 immunoreactivity in normal dura mater (A,

C), in transitional meningioma (B) and in meningotheliomatous-psammomatous

meningioma (D)/surrounding dural tissue, 40x. The immunoreactivity for NT-3

appears weak or moderate in all the observed structures both in the normal

dura mater (A) and in the transitional meningioma (B)/surrounding dural tissue.

A moderate immunoreactivity for NT-4 may be observed in the normal dura

mater (C) while the immunoreactivity appears to be appreciable in the

meningiomatous vorticoid areas (va) . Micrographs of the immunoreaction for

TrkC in the normal dura mater (E) and in the meningotheliomatous-

psammomatous meningioma (F)/ surrounding dural tissue; the

immunoreactivity appears to be moderate both in fibroblasts (f) and collagen

fibers (cf) and in the endothelium of the vessels (e) in the normal dura mater.

An appreciable immunoreactivity is visible in the vorticoid areas (va) of the

meningioma (F).

63

Fig.4 RT-PCR comparative analysis between normal dura mater and

meningioma/surrounding dural tissue. Specific transcripts for NGF, BDNF, NT-3,

NT-4 and high affinity receptors TrkB andTrkC.

64

References

1. Nagashima G, Aoyagi M, Yamamoto M, Yamamoto S.: P53

overexpression and proliferative potential in Malignant Meningiomas. Acta

Neurochir 1999; 141: 53 – 61.

2. Barbacid M: The TrK family of neurotrophin receptors. J Neuroimmunol

1994; 25 : 1386 – 1403.

3. Kaplan DR and Miller FD: Signal transduction by the neurotrophin

receptors. Current Opin Cell Biol 1997; 9 : 213 – 221.

4. Vega JA, Garcia-Suarez O, Hannestad J, Perez-Perez M, Germanà A.:

Neurotrophins and the immune system. J Anat 2003; 203 (1): 1 – 19. Review.

5. Otten U, Marz P, Heese K, Hock C, Kunz D, Rose-John S.: Cytokines and

neurotrophins interact in normal and diseased states. Ann N Y Acad Sci 2000;

917 : 322 – 330. Review.

6. Stanisz AM and Stanisz JA.: Nerve growth factor and neuroimmune

interactions in inflammatory diseases. Ann NY Acad Sci 2000; 917: 268 – 272.

7. Timmusk T : Expression of mRNA for neurotrophins and their receptors

in the rat choroid plexus and dura mater. Neuroreport 1995; 6 (15) : 1997 –

2000.

8. Bronzetti E, Artico M, Lo Vasco VR, Felici LM, Bosco S, Magliulo G,

Pompili E, Fumagalli L: Expression of neurotransmitters and neurotrophins in

human adenoid tissue. Int J Mol Med. 2005; 15 (6) : 921 – 928.

9. Bronzetti E, Artico M, Pompili E, Felici LM, Stringaro A, Bosco S, Magliulo

G, Colone M, Arancia G, Vitale M, Fumagalli L: Neurotrophins and

meurotransmitters in human palatine tonsils: an immunohistochemical and RT-

PCR analysis. Int J Mol Med 2006; 18 (1) : 49 – 58.

10. Ricci A, Felici LM, Mariotta S, Mannino F, Schmid G, Terzano C, Cardillo

G, Amenta F, Bronzetti E: Neurotrophins and neurotrophin receptor protein

expression in the human lung. Am J Respir Cell Mol Biol 2004; 30 (1) : 12 – 19.

Epub 2003 Jun 5.

65

11. Bronzetti E, Artico M, Forte F, Pagliarella G, Felici LM, D’Ambrosio A,

Vespasiani G, Bronzetti B: A possible role of BDNF in prostate cancer detection.

Oncology Reports 2008; 19 : 969 – 974.

12. Goadsby PJ, Edvinsson L: Human in vivo evidence for trigeminovascular

activation in cluster headache. Neuropeptide changes and effects of acute

attacks therapies. Brain 1994; 117: 427 – 434.

13. Artico M, De Santis S, Cavallotti C: Cerebral dura mater and cephalalgia:

relationships between mast cells and cathecolaminergic nerve fibers in the rat.

Cephalalgia 1998; 18 : 183 – 191.

14. Keller JT, Dimlich RVW, Zuccarello M.: Relationship of trigeminovascular

and sympathetic nerve fibers to mast cells in the dura mater of the rat. J Cer

Blood Flow Metab 1989a; 9 : S685.

15. Olesen J, EdvinssonL.: Basic Mechanisms of Headache. Elsevier,

Amsterdam 1988; p.1492

16. Keller JT, Marfurt CF, Dimlich RVW, Tierney BE.: Sympathetic

innervations of the supratentorial dura mater of the rat. J Comp Neurol 1989b;

290: 310 – 321.

17. Fricke B, Duering von M, Andres KH.: Topography and

immunocytochemical characterization of nerve fibers in the leptomeningeal

compartments of the rat. A light- and electron-microscopical study. Cell Tissue

Res 1997; 287: 11 – 22.

18. Andres KH, von Duering M, Muszynski K, Schmidt RF.: Nerve fibers and

their terminals of the dura mater encephali of the rat. Anat Embryol 1987; 175:

289 – 301.

19. Woolf CJ, Ma QP.: Peripheral cell types contributing to the hyperalgesic

action of nerve growth factor in inflammation. J Neurosci 1996; 16: 2716 –

2723.

20. Dimitriadou et al.: Functional relationships between sensory nerve fibers

and mast cells of dura mater in normal and inflammatory conditions.

Neuroscience 1997; 7 : 829 – 839.

66

21. Lomen HC, Shooter EM.: Widespread neurotrophin receptor expression in

the immune system and other non-neuronal rat tissue. J Neurochem 1995; 64:

1780 – 1789.

22. Blandini F et al.: Peripheral levels of BDNF and NGF in primary

headaches. Cephalalgia, 2005; 26: 136 – 142.

23. Snider WD.: Functions of the neurotrophins during nervous system

development: what the knockouts are teaching us. Cell 1994; 77 (5) : 627 –

638.

24. Weiner HL.: The role of growth factor receptors in central nervous

system development and neoplasia. Neurosurgery 1995; 35 : 179 – 194.

25. Barbara E. Lazio, MD, and Lawrence S. Chin., M.: Growth factors in

central nervous system development and tumorigenesis. Neurosurg Focus

1997; 3 (3).

26. Yaeger MJ, Koestner A, Marushige Y.: The reverse transforming effects

of nerve growth factor on five human neurogenic tumor cell lines : in vitro

results. Acta Neuropathol 1991; 83 (1) : 72 – 80.

27. Pawel P, Jagodzinski, Wojciech Kaczmarski, Ryszard Zukiel.: Nuclear

accumulation of nerve growth factor and its receptor in meningioma and glioma

tumoury cells. Bulletin of the Polish Academy of Sciences/Biological Sciences

1992; 40: 145 – 152.

28. Cross M, Dexter TM.: Growth factors in development, transformation,

and tumorigenesis. Cell 1991; 64: 270 – 280.

29. Alex Kruttgen, Imke Schneider, Joachim Weis.: The dark side of the NGF

family: Neurotrophin in neoplasias. Brain Pathol 2006; 16: 304 – 310.

30. Lewin GR, Renz H.: Abundant production of brain-derived neurotrophic

factor by adult visceral epithelia implications for paracrine and target-derived

neurotrophic functions. Am J Pathol 1999; 155: 1183 – 1193.

31. Damien B.: Differential Gene Expression during Meningeal-Meningococcal

interaction: evidence for self-defense and early release of cytokines and

chemokines. Infection and Immunity 2001; 69: 2718 – 2722.

32. Tsujino Kumiko.: Establishment and characterization of cell lines derived

from a transplantable rat malignant meningioma: morphological heterogeneity

67

and production of nerve growth factor. Acta Neuropathologica 1997; 93: 461 –

470.

33. Eberhart CG, Kaufman WE, Tihan T, Burger PC.: Apoptosis, neuronal

maturation and neurotrophin expression within medulloblastoma nodules. J

Neuropathol Exp Neurol 2001; 60: 462 – 469.

34. Lavoie JF, Lesauteur L, Kohn J, Wong J, Furtoss O, Thiele CJ, Miller FD,

Kaplan DR.: TrKA induces apoptosis of neuroblastoma cells and does so via a

p53-dependent mechanism. J Biol Chem 2005; 280: 29199 – 29207.

68

Chapter 3

Neurotrophins, their receptors and MIB-1

in Human GH-secreting Pituitary

Adenomas : an immunohistochemical

analysis

M. Artico 1, E. Bianchi 1, G. Magliulo 1, M. De Vincentiis 1,

E. De Santis 2, A. Orlandi 3, A. Santoro 4, F.S. Pastore 5,

F. Giangaspero 6 , R. Caruso 4, M. Re 7 and L. Fumagalli 2

1Department of Sensory Organs, University of Rome “Sapienza”, 2Department of

Anatomical Histological, Forensic and Locomotor system Sciences, University of

Rome “Sapienza”, Rome,Italy; 3Chair of Pathology, University of Rome “Tor

Vergata”, Italy ; 4Department of Neurological Sciences, Neurosurgery,

University of Rome “Sapienza”, Rome, Italy; 5Division of Neurosurgery,

University of Rome “Tor Vergata”, Rome, Italy; 6Department of Radiology,

Oncology and Pathology, University of Rome “ Sapienza” & IRCCS Neuromed,

Pozzilli (Is), Italy; 7Department of Clinical Sciences, Polytechnic University of

Marche, Ancona, Italy

International Journal of Immunopathology and

Pharmacology 2012; 25 (1): 117-125

Key words: Pituitary Gland – Adenoma – Neurotrophins – MIB-1 –


69

Abstract

Pituitary Adenomas are a diverse group of tumors arising from the pituitary

gland. Typically, they are small, slow – growing, hormonally inactive lesions

that come to light as incidental findings on radiologic or postmortem

examinations, although some small, slow – growing lesions with excessive

hormonal activity may manifest with a clinical syndrome. The family of

neurotrophins plays a key role in the development and maintenance of the

pituitary endocrine cell function and in the regulation of hypothalamo – pituitary

– adrenocortical axis activity. The objective of our experimental study was to

investigate the localization of the neurotrophins, their relative receptors and

detect the expression level of MIB-1 (anti-ki67) to determine if all these factors

participate in the transformation and development of human pituitary

adenomas. A very strong expression of NT-3 and its receptor TrKC was

observed in the extracellular matrix (ECM) and vessel endothelium, together

with a clear/marked presence of BDNF and its receptor TrKB, thus confirming

their direct involvement in the progression of pituitary adenomas. On the

contrary, NGF and its receptor TrKA and p75NTR were weakly expressed in the

epithelial gland cells and the ECM.

70

Introduction

Pituitary Adenomas are a diverse group of tumors arising from the pituitary

gland (1 – 2) which can be sub-classified as either functional or nonfunctional,

depending on their hormonal activity in vivo (2 – 4). Small, slow – growing,

hormonally inactive lesions are typically identified as incidental findings on

radiologic or postmortem examinations: other small, slow – growing lesions

with excessive hormonal activity can manifest with a clinical syndrome (2 – 4).

Tumors that grow more rapidly, even if hormonally inactive, are capable of

producing symptoms related to the presence of an intracranial mass, such as

visual field disturbances. Given the small size of many pituitary tumors and their

propensity to exist with only insidious, nonspecific symptoms, an accurate

estimate of the incidence of pituitary adenomas in the general population

appears challenging (4). Ezzat S et al found prolactinomas to be the most

common form of pituitary adenoma (1). Burrow and co – workers (5)

evaluated postmortem radiographic, macroscopic and microscopic findings in

the pituitary tumors and found a significant incidence (11%) of prolactinoma in

both men and women at all ages, despite the fact that the etiologies of most

pituitary tumors remain unknown, as confirmed by more recent experimental

findings (6 – 7). The family of neurotrophins plays a key role in the

development and maintenance of nerve cell populations in the peripheral and

central nervous system (8 – 12). Several lines of evidence suggest that

neurotrophins, more particularly NGF, may be involved in pituitary endocrine

cell function (13 – 14). Animal studies have shown that neurotrophins,

especially NGF, play a dual role in pituitary physiology. Firstly, a local role, in

the anterior pituitary gland, as a stimulator of differentiation and proliferation of

somatomammotroph cells into mammotroph or lactotrope cells during

development (15 – 18) as well as a stimulator of proliferation of the thyrotrope

cells (18). Secondly, a systemic role as a neurohormone which is co – secreted

with prolactin into the bloodstream (16). Furthermore, NGF may regulate

endocrine function by stimulating the hypothalamo – pituitary – adrenocortical

axis activity during stress responses, pregnancy and lactation (19). In vitro

71

studies revealed that escape from NGF control appears to be one of the

mechanisms involved in the development and progression of human

prolactinomas (20). NGF and Trk receptors have been identified in endocrine

cells (cells containing conventional anterior – pituitary hormones) in the anterior

pituitary gland of adult rats (14, 17 – 18), and Aguado et al (14) reported the

presence of numerous endocrine cells containing TrkA and TrkB receptors in

human anterior pituitary gland and some pituitary adenomas, suggesting a

direct role of the neurotrophins in the normal development of the pituitary

gland and in the progression of some pituitary adenomas. Previous observations

found that prolactinomas, the most common pituitary tumor, express NGF and

its receptors (TrkA and TrkB) and are therefore highly sensitive to the action of

that neurotrophic factor. In fact, NGF mediates a long – lasting conversion of

the more transformed dopamine – resistant prolactinomas into a differentiated,

less malignant lactotroph – like phenotype re – expressing the D-2 receptor

protein: the latter is very important in the pharmacological therapy of these

tumors because D-2 receptor agonists are strongly effective in lowering plasma

PRL levels in patients with prolactinomas (21). It has been also suggested that

BDNF, expressed together with its receptor TrkB in the anterior lobe of the

pituitary gland, is involved in the control of thyroid function, in the proliferation

and differentiation of melanotrope cells and in the regulation of the

hypothalamic – pituitary – adrenal axis (22 – 23). All these findings prompted

us to investigate the localization and intra – cellular distribution of the

neurotrophins and their relative receptors, to determine whether these growth

factors participate in the transformation and development of the human

pituitary adenomas. Although most pituitary microadenomas can be completely

excised, it is difficult to totally remove invasive pituitary macroadenomas and,

until now, no routine markers have been available to predict the aggressive

behavior or recurrence of this lesion. However, Ki-67, a nuclear antigen

recognized by the monoclonal antibody MIB-1 has proved to be useful in

assessing several brain tumors, providing information about cell proliferation

and, consequently, long – term prognosis (24 – 28). Generally, the Ki-67

labeling index (LI) in pituitary adenomas is relatively low in comparison to other

72

brain tumors (29 – 31), in which it is employed, together with a thorough

clinical, hormonal and MR image follow – up, to identify the predicted

recurrence of the tumor as early as possible. Hence, we decided to investigate,

together with the analysis of the neurotrophins pattern, the expression level of

MIB-1 (anti-Ki67) to define its possible role as a prognostic factor in pituitary

adenomas.


Patients

Small specimens of human GH – secreting pituitary adenomas were harvested,

during surgical operation, from 10 patients, and then processed for

immunohistochemical analysis. Control specimens were obtained from 2

autoptic cases. Experiments were performed in compliance with the Italian laws

and guidelines concerning the informed consent of patients (Dir. 2001/20/CE).

The following molecules were investigated: nerve growth factor (NGF), brain -

derived neurotrophic factor (BDNF), NT-3, NT-4, TrKA, TrKB, TrKC, p75NTR and

MIB– 1.

Immunohistochemical analysis

For light microscope immunohistochemical analysis, small fragments of human

GH – secreting adenomas were washed in PBS, fixed in 10% formalin and

embedded in paraffin according to a standard procedure. Serial 4 μm thick

sections were cut using a rotatory microtome, mounted on gelatine-coated

slides and processed for immunohistochemistry. To study the

immunolocalization of neurotrophins and their receptors, the antibodies we

used were: i) rabbit anti-NGF polyclonal antibody (Santa Cruz Biotechnology,

CA, USA), which display <1% cross-reactivity against recombinant human NT-3,

NT-4 and BDNF; ii) rabbit anti-BDNF polyclonal antibody (Santa Cruz), which

recognizes the amino-terminus of mouse BDNF and does not cross-react with

NT-3 or NGF; iii) rabbit anti- NT3 polyclonal antibody (Santa Cruz

73

Biotechnology), raised against the amino-terminus of mouse NT-3, which does

not cross-react with NGF or BDNF; iv) rabbit anti-NT4 polyclonal antibody

(Santa Cruz Biotechnology); v) rabbit anti- TrKA polyclonal antibody (Santa

Cruz Biotechnology), which recognizes an epitope corresponding to amino acids

763 to 777, mapping adjacent to the carboxy-terminus of human TrKA p140

and is not cross-reactive with TrKB or TrKC; vi) rabbit anti-TrKB polyclonal

antibody (Santa Cruz Biotechnology), which recognizes an epitope

corresponding to amino acids 794 to 808 of mouse TrKB p145 and is not cross-

reactive with TrKA or TrKC; and vii) rabbit anti-TrKC polyclonal antibody (Santa

Cruz Biotechnology), which recognizes an epitope corresponding to amino acids

798 to 812 of porcine TrKC p140 and is not cross-reactive with TrKA or TrKB;

viii) goat polyclonal antibody to human NGF receptor p75 (Santa Cruz

Biotechnology), which recognizes the amino acid sequence mapping the

carboxy-terminus of the NGF receptor p75 precursor of human origin and is not

cross-reactive with other growth factor receptors; viiii) MIB-1, a rabbit

polyclonal antibody raised against amino acids 2641-2940 mapping at the C-

terminus of Ki-67 of human origin (Santa Cruz, CA, USA). Incubation with

primary antibodies was performed overnight at 4˚C at a final concentration of

2-5 μg/ml. Optimal antisera dilutions and incubation times were assessed in a

series of preliminary experiments. After exposure to the primary antibodies,

slides were rinsed twice in phosphate-buffer and incubated (1h and 30 min at

room temperature) with the appropriate secondary antibody conjugated to

horseradish peroxidase (HRP) (final dilution 1:100). The secondary antibody-

HRP linked against rabbit immunoglobulins was purchased from Boehringer

(Boehringer Mannheim GmbH, Mannheim, Germany), while secondary

antibodies-HRP linked against mouse and goat immunoglobulins were from

Sigma (Sigma Chemicals Co, St. Louis, MO, USA). After a further wash with

phosphatebuffer, slides were treated with 0.05% 3,3-diaminobenzidine and

0.1% H2O2. Finally, sections were counterstained with Mayer's hematoxylin and

observed by using a light microscope. To block endogenous peroxidase activity,

slides were pre-treated with 3% H2O2, whereas the non-specific binding of

immunoglobulins was prevented by adding 3% fetal calf serum to the

74

incubation medium. The intensity of the immune reaction was assessed

microdensitometrically using an IAS 2000 image analyzer (Delta Sistemi, Rome,

Italy) connected via a TV camera to the microscope. The system was calibrated

taking as zero the background obtained in sections exposed to nonimmune

serum. Ten 100 μm2 areas were delineated in each section by a measuring

diaphragm. Quantitative data regarding the intensity of the immune staining

were analyzed statistically by analysis of variance (ANOVA) followed by

Duncan's multiple range test as a post hoc test.

Results


Sections of GH – secreting adenomas samples exposed to the

primary/secondary antibodies developed a dark-brown (intense), yellow-brown

(slight) or no appreciable immunostaining. Immunoreactivity was specific since

no immunostaining was obtained in positive control sections incubated with

each primary antibody adsorbed with the specific peptide or with pre-immune

serum (data not shown). Immunolabeling was located in the epithelial glands

(described as epithelial neoplastic cells), extracellular matrix (ECM) and vessel

endothelium (see the Table). Immunoreaction for NGF was moderate on

epithelial glands (ep) and also appeared weak in the ECM (em), but was totally

absent on the endothelium of the vessels (en) (Fig. 1A). Similarly TrkA

immunoreactivity was moderate on epithelial glands (ep) and less appreciable

in the ECM (em), but absent on the vessel endothelium (en) (Fig. 1B). A weak

immunoreactivity for the p75NTR was described on epithelial glands (ep) and in

the ECM (em), while it was absent on the endothelium of vessels (en) (Fig. 1C).

BDNF immunoreactivity was highly appreciable in the ECM (em) and on

epithelial glands (ep), but it resulted moderate on the vessel endothelium (en)

(Fig. 2A). A strong immunoreactivity for TrKB was observed in the ECM (em),

appreciable in the vessel endothelium (en) and weak on epithelial glands (ep)

of the neoplastic area (Fig. 2B). A very strong immunoreactivity was revealed

by NT-3 and TrKC in the ECM (em), an appreciable expression also on the

75

vessel endothelium (en) and a weak immunoreactivity on epithelial glands (ep)

for these factors (Fig. 3A - 3B). Finally MIB – 1 immunoreactivity was weakly

expressed on epithelial glands (ep) and on the vessel endothelium (en) (Fig. 4A

- 4B). Illustrations regarding autoptic findings (2 cases) are not provided

because they were not significant.

Discussion

Pituitary adenomas account for 10-15% of all primary brain tumors and benign

tumors and are usually slow growing (1 – 4). In particular, growth hormone-

secreting adenomas account for about 20 % of all pituitary adenomas. GH-

producing adenomas have been histology classified into densely and sparsely

granulated adenomas (32). They derive from the acidophil cell line. This

lineage, comprising somatotroph, mammotroph and thyrotroph cells, is

controlled by a common transcription factor named PIT-1. Previous studies

suggest that neurotrophins, especially NGF, may be involved in pituitary

endocrine cell proliferation, growth and differentiation (13 – 14). NGF is a

particularly interesting neurotrophin in pituitary function and physiology (15 –

18). Immunohistochemical studies have also shown that NGF is selectively

expressed by somatotroph, mammotroph and thyrotroph cells, stored in

secretory granules. Moreover, neurotrophins and their receptors have been

shown to play a role in cancer, promoting tumor progression. In particular, NGF

cooperates with EGF and bFGF in directing differentiation of lactotrophs cells

stimulating PRL synthesis and D-2 dopaminergic receptor expression (21), via

binding to p75NTR and activation of NF – kB in a TrkA – independent way. In

fact, short – term treatment of patients with bromocriptine – resistant

prolactinomas, with NGF resulted in differentiation of the tumors into less

aggressive, lactotrope – like cells, re – expressing D-2 receptors, thus restoring

the molecular target for conventional therapy with D-2 agonists (21). TrkA as

well as TrkB expression has been found in tumor and non – tumoral

adenohypophyseal cells from human pituitary adenomas by Aguado et al (14).

However the localization of the neurotrophin receptors in human normal

76

pituitary gland and their expression in human pituitary adenomas is still

unclear. In our observations we described a moderate immunoreaction for NGF,

and its relative receptor TrKA and p75NTR, on epithelial glands and less

appreciable in the ECM, similarly to the experimental observations of

Assimakopoulou et al (13) but different to the Aguado's et al findings (14), thus

suggesting the role of NGF and its signaling in the development of normal

pituitary gland but not in the progression and proliferation of the pituitary

adenomas. BDNF and its receptor TrKB resulted highly appreciable in the ECM

and moderate on the vessel endothelium, suggesting their role in the

proliferation of a neoplastic microenvironment, involving the extracellular matrix

components and the angiogenetic network, given that vascular endothelial cells

synthesize and secrete BDNF (32). On the other hand a very strong

immunoreactivity was revealed by NT-3 and TrKC in the ECM, and an

appreciable expression also on the vessel endothelium, differently from the

Aguado's et al findings (14), leading us to describe this neurotrophin as the

principal neurotrophic factor involved in the progression of pituitary adenomas.

This discrepancy may be due to different immunohistochemical experimental

protocols. Considering the efficiency of the antibodies used for this

investigation, the expression revealed by these molecules in human pituitary

adenomas (GH – secreting) suggests a functional direct role of BDNF and NT-3

on this tumors. Finally MIB – 1 resulted weakly detectable in epithelial glands,

but totally absent on the vessel endothelium, confirming the low proliferation

rate of Gh-producing adenomas which generally show a label index less than 3

%. However the distribution and localization of all these factors in human

pituitary adenomas (GH – secreting) still remains unclear. Additional studies

would be necessary to better explain the biological role of these molecules in

the development and progression of this type of tumors.

77

References

1. Ezzat S, Asa SL, Couldwell WT, Barr CE, Dodge WE, Vance ML,

McCutcheon IE. The prevalence of pituitary adenomas: a systematic review.

Cancer 2004; 101(3): 613 – 619

2. Asa SL. Tumors of the pituitary gland. In: Rosai J, editor. Atlas of tumor

pathology. 3rd series Fascicle 22. Washington DC: Armed Forces Institute of

Pathology, 1998: 1 – 214

3. Asa SL, Ezzat S. The pathogenesis of pituitary tumors. Nat Rev Cancer

2002; 2: 836 – 849

4. Nammour GM, Ybarra J, Naheedy MH, Romeo JH, Aron DC. Incidental

pituitary macroadenoma: a population – based study. Am J Med Sci 1997; 314:

287 – 291

5. Burrow GN, Wortzman G, Rewcastle NB et al. Microadenomas of the

pituitary and abnormal sellar tomograms in an unselected autopsy series. N

Engl J Med 1981; 304: 156 – 158

6. Ezzat S. Editorial: Pituitary Tumor Pathogenesis – The Hunt for novel

candidate genes continues. Journ Clin Endocr Metabol 2003; 88(11): 5116 –

5118

7. Asa SL, Ezzat S. The Pathogenesis of pituitary tumors. Annual Review of

Pathology: Mechanisms of Disease 2009; 4: 97 – 126

8. Lewin GR and Bardle YA. Physiology of neurotrophins. Ann Rev Neurosci

1996; 9: 217 – 289

9. Barbacid M. The TrK family of neurotrophin receptors. J Neuroimmunol

1994; 25: 1386 – 1403

10. Kaplan DR and Miller FD. Signal transduction by the neurotrophin

receptors. Curr Opin Cell Biol 1997; 9: 213 – 221

11. Snider WD. Functions of the neurotrophins during nervous system

development: what the knockouts are teaching us. Cell 1994; 77: 627 – 638

12. Tessarollo L. Pleiotropic functions of neurotrophins in development.

Cytokine Growth Factor Rev 1998; 9: 125 – 137

78

13. Assimakopoulou M, Vassiliki Z, Chondrogianni C, Gatzouins G, Varakis J.

p75NTR and TrkC Neurotrophin receptors demonstrate a different

immunoreactivity profile in comparison to TrkA and TrkB receptors in human

normal pituitary gland and adenomas. Neuroendocrinology 2008; 88: 127 – 134

14. Aguado F, Majò G, Aranda G, Ferrer I. Trk neurotrophin receptor family

immunoreactivity in rat and human pituitary tissues. Neuroscience Letters 1998;

243: 13 – 16

15. Missale C, Boroni F, Sigala S, Zanellato A, Dal Toso R, Balsari A and

Spano P. Nerve growth factor directs differentiation of the bipotential cell line

GH-3 into the mammotroph phenotype. Endocrinology 1994; 135 (1): 290 –

298

16. Missale C, Boroni F, Sigala S, Buriani A, Fabris M, Leon A, Dal Toso R and

Spano F. Nerve growth factor in the anterior pituitary: localization in

mammotroph cells and cosecretion with prolactin by a dopamine-regulated

mechanism. Proc Natl Acad Sci 1996; 93: 4240 – 4245

17. Patterson J and Childs G. Nerve growth factor and its receptor in the

anterior pituitary. Endocrinology 1994; 135(4): 1689 – 1696

18. Patterson J and Childs G. Nerve growth factor in the anterior pituitary:

regulation of secretion. Endocrinology 1994; 135(4): 1697 – 1704

19. Taglialatela G, Angelucci L, Scaccianoce S, Foreman PJ, Perez-Polo JR.

Nerve growth factor modulates the activation of the hypothalamo – pituitary –

adrenocortical axis during the stress response. Endocrinology 1991; 129: 2212

– 2218

20. Missale C, Fiorentini C, Finardi A, Spano PF. Growth factors in human

pituitary tumors. Pituitary 1999; 1: 153 – 158

21. Missale C, Boroni F, Losa M, Giovanelli M, Zanellato A, Dal Toso R, Balsari

A and Spano PF. Nerve growth factor suppresses the transforming phenotype of

human prolactinomas. Proc Natl Acad Sci , Pharmacology 1993; 90: 7961 –

7965

22. Kramer B ,Cruijsen P, Ouwens D, Coolen M, Martens G, Roubos E and

Jenks B. Evidence that Brain – derived neurotrophic factor acts as an autocrine

79

factor on pituitary melanotrope cells of Xenopus laevis. Endocrinology 2002;

143(4): 1337 – 1345

23. Kononen J, Soinila S, Persson H, Honkaniemi J, Hokfelt T, Pelto-Huikko

M. Neurotrophins and their receptors in the rat pituitary gland: regulation of

BDNF and trkB mRNA levels by adrenal hormones. Brain Res Mol Brain Res

1994; 27(2): 347 – 354

24. Ekramullah SM, Saitoh Y, Arita N, Ohnishi T, Hayakawa T. The

correlation of Ki – 67 staining indices with tumor doubling times in regrowing

non – functioning pituitary adenomas. Acta Neurochir (Wien) 1996; 138: 1449 –

1455

25. McCormick D, Chong H, Hobbs C, Datta C, Hall PA. Detection of the Ki –

67 antigen in fixed and wax – embedded sections with the monoclonal antibody

MIB-1. Histopathology 1993; 22: 355 – 360

26. Kim SY, Chung SH, Kim HJ, Whang K, Han YP, Hong SK. Bcl-2 and Bax

expression and Ki-67 proliferative index in astrocytic tumors: in relation to

prognosis. J Korean Neurosurg Soc 2004; 35: 465 – 471

27. Parkins CS, Darling JL, Gill SS, Revesz T, Thomas DG. Cell proliferation in

serial biopsies through malignant brain tumors: measurement using Ki-67

antibody labeling.Br J Neurosurg 1991; 5: 289 – 298

28. Kitz K, Knosp E, Koos WT, Korn A. Proliferation of pituitary adenomas.

Measurement by MAb Ki-67. Acta Neurochir (Wien) 1991; 53: 60 – 64

29. Paek KI, Kim SH, Song SH, Choi SW, Koh HS, Youm JY, Kim Y. Clinical

significance of Ki-67 labeling index in pituitary macroadenoma. J Korean Med

Sci 2005; 20: 489 – 494

30. Kim JH, Seo JS, Lee BW, Lee SY, Jeon SH, Lee KB. The Characteristics of

incidental pituitary microadenomas in 120 korean forensic autopsy cases. J

Korean Med Sci 2007; 22: 61 – 65

31. Nakahashi T, Fujimura H, Altar A, Li J, Kambayashi J-I, Tandon NN, Sun

B. Vascular endothelial cells synthesize and secrete brain-derived neurotrophic

factor. FEBS Lett 2000; 470: 113 – 117

32. Kontogeorgos G, Watson Jr RE, Lindell EP. Growth hormone producing

adenoma. In: DeLellis RA, Lioyd RV, Heitz PU, Eng C eds. World Health

80

Organization Classification of Tumors: Pathology and Genetics of Tumors of

Endocrine Organs. Lyon, France: International Agency for Research on Cancer

Press 2004; 14-19

81

Fig. 1. Micrographs of NGF-TrKA-P75 immunostaining in GH-secreting pituitary

adenomas. NGF immunoreactivity was moderate in the epithelial compartment of the

neoplastic area, weak in the extracellular matrix (em) and totally absent in the vessel

endothelium (en) (not shown)(A: 20X). Immunoreaction for TrKA was moderate in the

nucleus of the neoplastic cells, weak in the extracellular matrix (not shown) and totally

absent in the vessel endothelium (en) (not shown) (B: 40X). P75NTR immunoreactivity

was weak in the epithelial neoplastic cells and in the extracellular matrix (em), but

totally absent in the vessel endothelium (en) (C: 20X).

82

Fig. 2. Micrographs of BDNF-TrKB immunostaining in GH-secreting pituitary adenomas.

BDNF showed a significantly high expression in the extracellular matrix (em) and on

epithelial glands, but moderate on the vessel endothelium (en) (A: 20X). TrKB

Immunoreactivity was strong in the extracellular matrix (em), appreciable in the vessel

endothelium (en) and weak on epithelial glands of the neoplastic area (B: 20X).

83

Fig. 3. Micrographs of NT3-TrKC immunostaining in GH-secreting pituitary adenomas.

NT-3 was strongly expressed in the extracellular matrix (em) and on the vessel

endothelium (en), but it was moderate expressed in the epithelial neoplastic cells. (A:

20X). A strong immunoreactivity for TrKC was observed in the extracellular matrix (em)

and a weak expression on the vessel endothelium (en) and on epithelial glands (ep)

(B: 20X).

84

Fig. 4. Micrographs of Ki-67 immunostaining in GH-secreting pituitary adenomas. Ki-67

immunoreactivity was weak on epithelial neoplastic cells and on the vessel endothelium

(en), but it was relevant in the extracellular matrix (em) (A, B: 20X).

85

Table I. Results of the immunohistochemical analysis for NTs and NT receptors

in human GH-secreting pituitary adenomas.

Epithelial glands Extracellular

matrix

Vessel

endothelium

NGF + +/- -

BDNF ++ +++ +

NT3 + +++ ++

MIB-1 +/- ++ -

TrkA + +/- -

TrkB +/- ++ +

TrkC +/- +++ ++

P75NTR +/- +/- -

+++: strong immunoreactivity; ++: relevant immunoreactivity; +: moderate

immunoreactivity; +/-: weak immunoreactivity; -: absence of immunoreactivity

Table II. Results of the immunohistochemical analysis in percentages.

Epithelial glands Extracellular

matrix

Vessel

endothelium

NGF ±50% ±25% ±0%

BDNF ±75% ±100% ±50%

NT3 ±50% ±100% ±75%

MIB-1 ±25% ±75% ±0%

TrkA ±50% ±25% ±0%

TrkB ±25% ±75% ±50%

TrkC ±25% ±100% ±75%

P75NTR ±25% ±25% ±0%

+++: strong immunoreactivity; ++: relevant immunoreactivity; +: moderate

immunoreactivity; +/-: weak immunoreactivity; -: absence of immunoreactivity

86

Chapter 4

Immunohistochemical profile of VEGF,

TGF- and PGE2 in human pterygium and

normal conjunctiva: experimental study

and review of the literature

E. Bianchi1, F. Scarinci2, C. Grande1, R. Plateroti1,

P. Plateroti1, A. M. plateroti1, L. Fumagalli3,

P. Capozzi4 , J. Feher1* and M. Artico1

1Department of Sensory Organs, *Ophthalmic Neuroscience Program

2G.B. Bietti Eye Foundation-IRCCS, Rome

3Department of Anatomical, Histological, Medico-legal and Locomotor System

Sciences, University of Rome ‘Sapienza’,

4Bambino Gesù Children’s Hospital IRCCS, Ophthalmic Department , Rome,

Italy.


Pharmacology 2012; 25 (3): 607-615

Key words: immunohistochemistry - pterygium - conjunctiva - VEGF - TGF-

beta - PGE2

87

Abstract

Human pterygium is made up of chronic proliferative fibro-vascular tissue

growing on the ocular surface. This disease exhibits both degenerative and

hyperplastic properties. Some fibroangiogenic factors have recently been shown

to play a potential role in fibrovascular diseases via the angiogenesis process.

The aim of this study is to evaluate VEGF, TGF- and PGE2 expression in the

epithelial, endothelial and stromal cells of human pterygium and normal

conjunctiva in order to determine whether these factors participate in the

development of pterygium. Ten specimens from patients with pterygium and

two normal conjunctivas (cadavers) were analyzed by immunohistochemistry

using specific antibodies against these growth factors. The technique used was

ABC/HRP (Avidin complexed with biotinylated peroxidase). Immunoreactivity of

VEGF was significantly increased in the epithelium, vascular endothelium and

stromal cells in primary pterygium as compared with normal conjunctiva. A

moderate expression of TGF- in the pterygium was observed in the epithelial

and stromal layers. On the contrary, immunolabeling of this growth factor in

the human normal conjunctiva was weak. PGE2 was strongly expressed in the

epithelium of patients with pterygium, as in control conjunctival tissues and the

immunolabeling was moderate in the stroma from the same patients. Our

results suggest that these growth factors may contribute to the progression of

primary pterygium by increasing angiogenesis, thus leading to the formation of

new blood vessels from the pre-existing vasculature. We conclude that VEGF,

TGF- and PGE2 may be potential therapeutic targets in the treatment of this

disease although proof of this evidence requires further studies.

88

Introduction

Pterygium is a lesion of the ocular surface that begins to grow from limbal

epithelium and invades the cornea by conjunctival epithelium, leading to visual

impairment (1,2). Recently, published data have shown that this pathological

condition is an active process of cellular proliferation, ongoing connective tissue

remodeling, angiogenesis and inflammation. Histologically, actively growing

pterygia exhibit both degenerative and hyperplastic changes as well as

proliferative and infiammatory disorders (3,4). This disease consists of an

overlying conjunctival epithelium, which may appear normal or mildly

hyperplastic. The underlying fibrovascular tissue usually presents a chronic

inflammatory cellular infiltrate and rich vasculature (4). It causes discomfort,

lachrymation and photophobia. After surgical intervention, relapses are

frequent. Many therapies, including antimitotics and corticosteroids, have been

proposed for the prevention of recurrence, but no really effective therapy has

been established (5). When pterygium takes a more aggressive course,

although considered a relatively benign process, it may be come locally invasive

with various degrees of abnormalities, ranging from mild dysplasia to carcinoma

in situ (6). The pathogenesis of pterygium is still controversial, although

epidemiological studies have firmly established that ultraviolet radiation is an

etiologic agent for this disease (7). In addition, many fibroangiogenic growth

factors have been implicated in pterygium pathogenesis, such as tumor necrosis

factor- (TNF-), basic fibroblast growth factor (bFGF), platelet-derived growth

factor (PDGF), and transforming growth factor- (TGF-) (8). Angiogenesis is

defined as the formation of new blood vessels from pre-existing vasculature

and underlies a large number of physiological processes (9), such as growth

and differentiation, wound healing, and abnormal conditions, such as neoplasia

and eye diseases, which cause severe loss of vision (10). The process of

vascularization involves the activation of cell-derived angiogenic factors as well

as the appropriate synthesis of extracellular matrix components necessary for

anchorage of migrating endothelium. One of the most potent and specific

89

angiogenic factors is vascular endothelial growth factor (VEGF), also known as

vascular permeability factor and vasculotropin (11). VEGF is a heparin-binding

glycoprotein that has several important effects on vascular endothelial cells.

This growth factor may be produced in response to environmental stimuli,

mainly hypoxia, certain cytokines and estradiol (12). VEGF is considered to be

the most selective mitogen for endothelial cells (13): it increases vascular

permeability (14), induces alterations in ion flow, cell proliferation (15), and

migration and release of proteinases (16). Prostanoids are a group of lipid

mediators forming in response to various stimuli, including prostaglandin and

thromboxane A2. They are released extracellularly immediately after their

synthesis and they act by binding to a G-protein-coupled rhodopsin-type

receptor on the surface of target cells. There are 8 types of prostanoid

receptors that are conserved in mammals: the PGD receptor (DP), a subtypes

of the PGE receptor (EP1, EP2, EP3 and EP4), the PGF receptor (FP), the PGI

receptor (IP), and the TXA receptor (TP). The ocular surface, especially the

human conjunctival epithelium, showed EP2, EP3 and EP4 receptors, that may

down-regulate ocular surface inflammation (17). In the current study we

investigated the expression of VEGF, PGE2 and TGF- by immunohistochemical

techniques in some cases of primary pterygia and 2 normal conjunctiva

specimens as controls, to elucidate the etiopathogenesis of this disease, that

can have significant clinical consequences in terms of surgical treatment,

preventing the frequent post-surgery relapses. Also, it may play a role in

developing new non-surgical treatments to reduce relapses, severity of

inflammation, tissue invasion, proliferation and angiogenesis.


Ethical considerations

The study group included 10 cases of surgically excised pterygium from patients

(6 males and 4 females) aged 45-80 years, together with 2 autoptic specimens

harvested as control cases (normal nasal epibulbar conjunctiva segments that

showed the same features for immunohistochemical study; in fact, is it

90

impossible to use control specimens from normal conjunctiva of patients with

pterygium due to potential abnormalities in the conjunctiva adjacent to the

lesions). During excision, apart from topical anaesthesia, no other chemical or

pharmaceutical product was administered. Experiments were performed in

compliance with the Italian laws and guidelines concerning the patients

informed consent. The ethical committee of the Hospital approved our study

according to the European Community and Italian laws. Control morphological

sections were stained with hematoxylin-eosin. The following molecules were

investigated: vascular endothelial growth factor (VEGF), prostaglandin E2

(PGE2) and transforming growth factor- (TGF-).


Small fragments from pterygium and nasal epibulbar conjunctival tissues near

the limbus (autoptic specimens) samples were washed in PBS, fixed in 10%

formalin and embedded in paraffin according to a standard procedure. The

method employed for immunohistochemical tests was ABC/HRP technique

(avidin complexed with biotinylated peroxidase). Serial 3-μm thick sections

were cut using a rotative microtome, mounted on gelatin-coated slides and

processed for immunohistochemistry. These sections were deparaffinized in

xylene and dehydrated. They were immersed in citrate buffer (PH 6) and

subjected to microwave irradiation twice for 5 minutes. Subsequently, all

sections were treated for 30 minutes with 0.3% hydrogen peroxide in methanol

to quench endogenous peroxidase activity. To block non-specific binding, the

slides were incubated in 3% normal goat serum in PBS for 30 minutes at room

temperature. The slides were incubated overnight at 4°C with primary mouse

monoclonal antibodies against human VEGF diluted 1/100 (abcam Cambridge

Science Park, UK, ab1316), against human TGF- diluted 1/100 (abcam

Cambridge Science Park, UK, ab49574) and with primary rabbit polyclonal

antibody against human PGE2 diluted 1/500 (Abcam Cambridge Science Park,

UK, ab2318). Optimal antisera dilutions and incubation times were assessed in

a series of preliminary experiments. After exposure to the primary antibodies,

slides were rinsed twice in phosphate buffer and incubated for 1 h at room

91

temperature with the appropriate secondary biotinylated goat anti-mouse or

anti-rabbit IgG (vector laboratories Burlingame, CA, USA, BA9200 and BA1000)

and with peroxidase-conjugated avidin (Vector laboratories, Burlingame, CA,

USA, Vectastain Elite ABC Kit Standard* PK 6-100) for 30 minutes. After a

further wash with phosphate buffer, slides were treated with 0.05% 3,3-

diaminobenzidine (DAB) and 0.1% H2O2. Finally, sections were counterstained

with Mayer's hematoxylin and observed by using a light microscope. Negative

control experiments were done: i) by omitting the primary antibody; ii) by

substituting the primary antibody with an equivalent amount of non-specific


blocking peptide (antigen/antibody = 5 according to supplier's instructions).

The staining assessment was made by two experienced observers in light

microscopy. We assessed the immunoreactivity for VEGF, TGF- and PGE2 in

epithelial, endothelial and stromal cells of these tissues. The intensity of the

immune reaction was assessed microdensitometrically using an IAS 2000 image

analyzer (Delta Sistemi, Rome, Italy) connected via a TV camera to the

microscope. The system was calibrated taking the background obtained in

sections exposed to non-immune serum as zero. Ten 100 m2 areas were

delineated in each section by a measuring the diaphragm. Quantitative data of

the intensity of the immune staining were analyzed statistically by analysis of

the variance (ANOVA) followed by Duncan’s multiple range test as a post hoc

test.

Statistical analysis

The comparison of the expression levels of VEGF, TGF- and PGE2 in the

pterygium and normal conjunctiva was carried out by t-test. Statistical analyses

were performed using the SPSS statistical software package version 12.0. The

results were considered as statistically significant when P-value<0.05.

92

Results

Under light microscope fragments of primary pterygium from 10 patients

treated with surgical ablation were examined. These specimens are composed

of epithelium, endothelium and different kinds of stroma, in accordance with

the evolutive stage. Intense angiogenic activity was observed particulary in the

subepithelial region. Furthermore, pterygium tissues were more vascularized

than normal conjunctiva. The particular distribution of the blood vessels can be

explained by the need of the proliferating pterygium for increased nutritive

support. We noted the presence both of small vessels as well as elongated,

tortuous and ramified blood vessels: the morphology of these vessels is

suggestive for the presence of an active angiogenesis in subepithelial

connective tissue. The epithelium of the conjunctival tissues is stratified,

columnar towards the sclera and squamous non-keratinized towards the

cornea. In some areas, the epithelium invaginates into the stroma and an

increased number of goblet cells are present in this area (Fig 1A). The

epithelium is thick and often elevated by the proliferation of the underlying

connective tissue. In the pterygium, the stroma is made of connective tissue,

rich in fibroblasts, numerous connective fibrils and many blood vessels. In the

stationary phase, sclerosis is observed, the infiammatory process is reduced

and the connective fibrils are set in compact bundles (Fig 1B). Our study

showed relevant immunoreactivity of VEGF in epithelial cells, except goblet cells

(Fig. 1C); the normal conjunctiva demonstrated a statistically significant

difference in comparison with pterygium, that presented extremely high

expression level for VEGF in the epithelial layer. A strong reaction to VEGF was

observed in the vascular endothelium, and in fibroblastic and inflammatory

stromal cells of the pterygium tissue (Fig. 1D). In contrast to this pathologic

tissue, no VEGF immunoreactivity was observed in endothelial or stromal cells

of normal conjunctival tissues (Fig. 1C). The staining reaction was diffuse,

granular, cytoplasmic, with intensification at the superficial layers of the

epithelium. In the epithelium of pterygium we observed an increase of reaction

towards the superficial region (Fig. 1D). TGF- immunolabeling was very weak

93

in fibroblasts from normal conjunctiva, in contrast to the primary pterygium,

that appeared strong in some stromal cells (Fig. 2A-B). These findings

demostrated that this growth factor may interact directly or indirectly in the

pathogenesis of pterygium. Finally, we detected prostaglandin E2 (PGE2) in the

conjunctival epithelium of pterygium patients as we did in the control autoptic

conjunctival epithelium. Our study suggests that PGE2 is strongly expressed in

the conjunctival epithelium of patients with pterygium, as in control conjunctival

tissues. PGE2 immunolabeling was moderate in the stroma from patients with

pterygium, because vascular endothelium expressing the PGE2 protein

increased in the presence of inflammatory infiltrating cells in sub-conjunctival

tissues (Fig. 2C-D). The intensity of staining for VEGF, TGF-β and PGE2 in

human normal conjunctiva and pterygium is presented in Tables I and II

(Tables I-II). The percentage values of growth factors-positive cells and P-

values are shown in Table III (Table III).

Discussion

Pterygium represents a vascular, potentially invasive surface ocular lesion,

which originates from activated stem cells of the limbus (18).

Immunopathogenic mechanisms and overexpression of extracellular matrix

components seems to be implicated in its pathogenesis (19). Recent studies

show that pterygium may be the result of a defective wound healing process,

during which molecular events that lead to programmed cell death are modified

(20). Normal conjunctiva contains a local surface immune system called

conjunctiva-associated lymphoid tissue (CALT) that presents T cells, B cells, and

plasma cells as well as local secretions of immunoglobulins (IgA, IgM, IgG, IgG,

and IgE) and complement (21). Previous studies indicated that both immune

cells and immunoglobulins are pathologically increased in pterygium tissue,

suggesting that immunological process might be involved in its pathogenesis

(21). Although T cells are the most frequently encountered type of

inflammatory cell, CD68-positive macrophages are the most common cells

encountered in pterygium and they are distributed both in the epithelial and

94

stromal layers, suggesting that they are related to the pathogenesis of the

disease. Additionally, a previous study indicated that some of these

macrophages strongly expressed COX-2 and VEGF in pterygium (22). COX-2

protein can upregulate VEGF production via the protein kinase C pathway in

lung cancer cells (23). Prostaglandin E2 (PGE2), the product of COX-2 activity, is

also angiogenic by direct influence on endothelial cells or by inducing the

release of angiogenic growth factors, such as VEGF (24). In fact, the present

study revealed an intense expression of PGE2 in the columnar stratified

epithelium and moderate immunolabeling in endothelial and stromal cells,

indicating the importance of this factor in the pathogenesis of pterygium.

Although the pathogenicity of pterygium is not fully understood, it is generally

accepted that ultraviolet radiations are the most important etiological factor

involved in its onset. Ultraviolet radiations trigger a series of events that

ultimately lead to damage of DNA, RNA and extracellular matrix (25). Chronic

ultraviolet-B (UV-B) exposure contributes to the pathogenesis of primary

pterygium, which causes oxidative stress, leading to upregulation of many

potential mediators of pterygium growth, such as cytokines and growth factors.

Di Girolamo et al. (26) demostrated that UV may induce the VEGF expression in

the pterygium epithelial cells in a dose- and time-dependent manner (26).

Therefore, the expression of VEGF in the epithelium of primary pterygium might

be relevant due to UV-B exposure. The ingrowth of these vessels into the

epithelium might be interpreted as a reaction to hypoxia or some cytokines.

This process deserves further investigation and research. Angiogenesis is

characterized by growing new blood vessels from pre-existing vessels. VEGF is

one of the most potent and specific proangiogenic factors. It is also known to

be a vascular permeability factor or vasotropin. VEGF is considered the most

selective mitogen of endothelial cells (27); it increases vascular permeability

(28), induces alterations of ionic fluxes, cellular proliferation (15), migration and

release of proteases (16). Our study showed an increased expression of VEGF,

mainly in the epithelium, endothelial cells and fibroblasts of the pterygium.

Such reactivity is an argument for the pathogenic role played by this growth

factor in the development of pterygium. The relationship between VEGF signal

95

transduction and the modifications in the behavior of epithelial cells from

pterygium/conjunctiva has not been fully ascertained. Overexpression of VEGF

in epithelial cells is, on the other hand, not capable of inducing angiogenesis

and is seemingly consistent with allow level of vascular microdensity. This may

be the result of VEGF lacking in endothelial and stromal cells. On the contrary,

VEGF expression in the pterygium endothelial and stromal cell can induce

angiogenic activity, demostrated by increased vascular microdensity. Therefore,

it seems that VEGF buildup in the epithelial cells is only a reflection of their

secretory capacity, while buildup in the endothelial and stromal cells reflects its

angiogenic activity. In this respect, Aspiotis M et al. demostrated a higher

vascular microdensity in the fibrous subtype than in the vascular type, thus

confirming the assumption that stroma plays a role in the pathogenesis of

pterygium (29). Furthermore, the presence of pro-inflammatory cytokines

secreted from the surface epithelium or from lacrimal inflammatory cells

induces the fibroblastic production of proteins related to remodelling of

extracellular matrix and angiogenesis. Growth factors with potent angiogenic

activity, such as FGF, PDGF, TGF- and TNF, have been found to be secreted

from fibroblastic and inflammatory pterygium cells as well as in tissue cultures

from pterygium fibroblasts (8). Our study showed a moderate expression of

TGF-β in the epithelial and stromal cells of pterygium compared to normal

conjunctiva, which presented weak staining in the endothelial, epithelial and

stromal layers. From this and other studies, we can postulate that various

cytokines and growth factors, including VEGF, might be involved in cellular

proliferation, inflammatory reaction, remodelling of extracellular matrix and

angiogenesis of pterygium. These data suggests that VEGF, PGE2 and TGF-

can be therapeutic targets in the treatment of pterygium. Anti-angiogenesis

therapy using anti-VEGF has recently been reported to be effective both for

controlling primary pterygium and preventing recurrence after pterygium

excision (30). We conclude that the overexpression of angiogenic factors and

the concurrent decreased expression of angiogenesis inhibitors probably

represents a possible pathogenic mechanism in the formation of pterygium. The

development of synthetic inhibitors growth factors for therapeutic intervention

96

could bring about a reduction of relapse rate, inflammation intensity, tissue

invasiveness, proliferation and angiogenesis in pterygium. Additional clinical and

experimental investigations appear to be necessary to better clarify the

biological role of these molecules in the development and progression of this

type of disease.

97

References

1. Spencer WH. Ophthalmic Pathology: An Atlas and Textbook, 3rd edn. WB

Saunders Co: Philadelphia, 1985, pp 304.

2. Reese AB. Tumors of the Eye, 3rd edn. Harper & Row: New York, 1976,

pp 53-55

3. Cameron ME. Histology of pterygium: an electron microscopic study. Br J

Ophthalmol 1983; 67:604-608.

4. Hill JC, Maske R. Pathogenesis of pterygium. Eye 1989; 3:218-226.

5. Sodhi PK, Verma L, Pandey RM, Ratan S. Comparison between the role

of intraoperative mitomycin C and doxorubicin in preventing the recurrence of

primary pterygium.Ophthalmic Res 2005; 37:1-6.

6. Dushku N, Reid TW. Immunohistochemical evidence that human pterygia

originate from an invasion of vimentin-expressing altered limbar epithelial basal

cells. Curr Eye Res 1994; 13:473-481.

7. Taylor HR, West SK, Rosenthal FS, Munoz B, Newland HS, Emmett EA.

Corneal changes associated with chronic UV irradiation. Arch Ophthalmol 1989;

107:1481-1484.

8. Kria L, Ohira A, Amemiya T. Immunohistochemical localization of basic

fibroblast growth factor, platelet derived growth factor, transforming growth

factor-beta and tumor necrosis factor-alpha in the pterygium. Acta Histochem

1996; 98:195-201.

9. Folkman J, Klagsbrun M. Angiogenic factors. Science, 1987; 235:442-

447.

10. Tsanou E, Ioachim E, Stefaniotou M, Gorezis S, Charalabopoulos K, Bagli

H et al. Immunohistochemical study of angiogenesis and proliferative activity in

epiretinal membranes. Int J Clin Pract 2005; 59:1157-1161.

11. Ferrara N. Vascular endothelial growth factor. Eur J Cancer 1996;

32:2413-2422.

http://www.ncbi.nlm.nih.gov/pubmed/15604592



98

12. Dvorak HF, Brown LF, Detmar M, Dvorak AM. Vascular permeability

factor/vascular endothelial growth factor, microvascular hyperpermeability, and

angiogenesis.

Am J Pathol 1995; 146:1029-1039.

13. Leung DW, Cachianes G, Kuang WJ, Goeddel DV, Ferrara N. Vascular

endothelial growth factor is a secreted angiogenic mitogen. Science 1989;

246:1306-1309.

14. Senger DR, Galli SJ, Dvorak AM, Perruzzi CA, Harvey VS, Dvorak HF.

Tumor cells secrete a vascular permeability factor that promotes accumulation

of ascites fluid. Science 1983; 219:983-985.

15. Dvorak HF. Tumors: wounds that do not heal. Similarity between tumor

stroma generation and wound healing. N Engl J Med 1986; 315: 1650-1659.

16. Unemori EN, Ferrara N, Bauer EA, Amento EP. Vascular endothelial

growth factor induces interstitial collagenase expression in human endothelial

cells. J Cell Physiol 1992; 153:557-562.

17. Ueta M, Matsuoka T, Yokoi N, Kinoshita S. Prostaglandin E2 suppresses

polyinosine-polycytidylic acid (polyl:C)-stimulated cytokine production via

prostaglandin E2 receptor (EP) 2 and 3 in human conjunctival epithelial cells. Br

J Ophthalmol 2011; 95:859-863.

18. Dushku N, Reid TW. Immunohistochemical evidence that human pterygia

originate from an invasion of vimentin-expressing altered limbal epithelial basal

cells. Curr Eye Res 1994; 13: 473-481.

19. Karukonda SR, Thompson HW, Beuerman RW, Lam DS, Wilson R, Chew

SJ, Steinemann TL. Cell cycle kinetics in pterygium at three latitudes. Br J

Ophthalmol 1995; 79:313-317.

20. Tan DT, Tang WY, Liu YP, Goh HS, Smith DR. Apoptosis and apoptosis

related gene expression in normal conjunctiva and pterygium. Br J Ophthalmol

2000; 84:212-216.

21. Pinkerton OD, Hokama Y, Shigemura LA. Immunologic basis for the

pathogenesis of pterygium. Am J Ophthalmol 1984; 98:225-228.

22. Choul Yong Park, Jong Sun Choi, Sung Jun Lee, Sang Won Hwang, Eo-jin

Kim, Roy S. Chuck. Cyclooxygenase-2-expressing macrophages in human

99

pterygium co-express vascular endothelial growth factor. Molecular Vision 2011;

17:3468-3480.

23. Luo H, Chen Z, Jin H, Zhuang M, Wang T, Su C, Lei Y, Zou J, Zhong B.

Cyclooxygenase-2 up-regulates vascular endothelial growth factor via a protein

kinase C pathway in non-small cell lung cancer. J Exp Clin Cancer Res 2011;

30:6.

24. Rizzo MT. Cyclooxygenase-2 in oncogenesis. Clin Chim Acta 2011;

412:671-687.

25. Solomon A, Li DQ, Lee SB, Tseng SC. Regulation of collagenase,

stromelysin, and urokinase-type plasminogen activator in primary pterygium

body fibroblasts by inflammatory cytokines. Invest Ophthalmol Vis Sci 2000;

41:2154-2163.

26. Di Girolamo N, Wakefield D, Coroneo MT. UVB-mediated induction of

cytokines and growth factors in pterygium epithelial cells involves cell surface

receptors and intracellular signaling. Invest Ophthalmol Vis Sci 2006; 47:2430-

2437.

27. Leung DW, Cachianes G, Kuang WJ, Goeddel DV, Ferrara N. Vascular

endothelial growth factor is a secreted angiogenic mitogen. Science 1989;

246:1306-1309.

28. Senger DR, Galli SJ, Dvorak AM, Perruzzi CA, Harvey VS, Dvorak HF.

Tumor cells secrete a vascular permeability factor that promotes accumulation

of ascites fluid. Science 1983; 219:983-985.

29. Aspiotis M, Tsanou E, Gorezis S, Ioachim E, Skyrlas A, Stefaniotou M,

Malamou-Mitsi V. Angiogenesis in pterygium: study of microvessel density,

vascular endothelial growth factor, and thrombospondin-1. Eye 2007; 21:1095-

1101.

30. Fallah Tafti MR, Khosravifard K, Mohammadpour M, Hashemian MN,

Kiarudi MY. Efficacy of intralesional bevacizumab injection in decreasing

pterygium size. Cornea 2011; 30:127-129.

100

Table I. Results of the immunohistochemical analysis for

VEGF, TGF- and PGE2 in normal human conjunctiva.

EPITHELIAL

CELLS

VASCULAR

ENDOTHELIUM

STROMAL

CELLS

VEGF + - -

TGF-

PGE2 + - -

+++, strong immunoreactivity; ++ , relevant immunoreactivity; +, moderate

immunoreactivity; +/-, weak immunoreactivity; -, absence of

immunoreactivity.

Table II. Results of the immunohistochemical analysis for

VEGF, TGF-Β and PGE2 in pterygium.

EPITHELIAL

CELLS

VASCULAR

ENDOTHELIUM

STROMAL

CELLS

VEGF +++ ++ ++

TGF- + +

PGE2 ++ + +



immunoreactivity.

101

Table III. Levels of VEGF, TGF- and PGE2 examined in

pterygium and control specimens, and respective levels of

statistical significance (t-test)

PTERYGIUM CONTROLS p-VALUE

VEGF

Epithelial cells

Vascular endothelium

Stromal cells

72.92%

72.92%

87.80%

42.03%

0%

0%

p=0.0035

-

-

TGF-

Epithelial cells


Stromal cells

32.32%

22.16%

47.70%

22.30%

19.10%

19.36%

p=0.0294

p=0.0380

p=0.0209

PGE2

Epithelial cells


Stromal cells

62.03%

47.70%

49.90%

36.26%

0%

0%

p=0.0334

-

-

102

Figure legends: Fig. 1-A. Hematoxylin and eosin stain of human normal

conjunctival tissue. The epithelium of the conjunctival tissue is columnar

stratified and elevated numbers of goblet cells are present in this area (40X).

Fig. 1-B. Hematoxylin and eosin stain of human pterygium. Irregular

epithelium and richly vascularized stroma. The epithelium is adapted to

smoothen the stromal irregularities and in some areas becomes invaginated.

The stroma of the pterygium is made up of connective tissue, rich in new blood

vessels, in fibroblasts and connective fibrils (40X). Fig. 1-C.

Immunohistochemical analysis of normal conjunctiva for VEGF. A moderate

expression of VEGF is seen in the epithelial conjunctival cells while VEGF

expression was not found in the vascular endothelial and stromal cells (40X).

Fig. 1-D. Immunohistochemical analysis of human pterygium for VEGF. VEGF

immunoreactivity appears to be strongly positive in the endothelial cells of

blood vessels, epithelial cells and in the stromal inflammatory tissue (40X).

103

Figure legends: Fig.2-A. Immunohistochemical analysis of normal

conjunctiva for TGF-. TGF- immunolabeling was very weak in the epithelial,

endothelial and stromal layers. Fig. 2-B. Immunohistochemical analysis of

human pterygium for TGF-. Evident expression of TGF- in the epithelial cells

is visible. Immunoreactivity in the fibroblasts of the connectival tissue appeared

strong in some cells. Weak immunolabeling in the endothelial cells of blood

vessels is also visible (40X). Fig. 2-C. Immunohistochemical analysis of normal

conjunctiva for PGE2. PGE2 immunolabeling was moderate in the epithelial cells.

PGE2 expression was not found in the endothelial cells of the vessels (40X).

Fig. 2-D. Immunohistochemical analysis of human pterygium for PGE2. Intense

expression of PGE2 in the columnar stratified epithelium and moderate

immunolabeling in stromal cells are visible (100X).

104

Chapter 5

Growth factors, their receptor expression

and markers for proliferation of

endothelial and neoplastic cells in human

osteosarcoma

E. Bianchi1*, M. Artico1*, C. Di Cristofano2, M. Leopizzi2,

S. Taurone1, M. Pucci1, P. Gobbi3, F. Mignini4,V. Petrozza2,

I. Pindinello1, M.T. Conconi5 and C. Della Rocca2

* THESE AUTHORS CONTRIBUTE EQUALLY TO THIS ARTICLE

1Department of Sensory Organs, University of Rome “ Sapienza”,Rome, Italy

2Department of Medical-Surgical Sciences and Biotechnologies, University of

Rome “ Sapienza”,Rome, Italy

3Department of SteVA, University “Carlo Bo”, Urbino, Italy

4School of Drug and Health Products Sciences, University of Camerino,

Camerino, Italy

5Department of Pharmaceutical Sciences, University of Padua, Padua, Italy


Pharmacology 2013; 26 (3): 621-632

Key Words: neurotrophins - vascular endothelial growth factor (VEGF) -

prostaglandin E2 (PGE2) - transforming growth factor-β (TGF β) - Ki-67 –

osteosarcoma

105

Abstract

Osteosarcoma is the most common primary malignant tumour of the bone.

Although new therapies continue to be reported, osteosarcoma-related

morbidity and mortality remain high. Modern medicine has greatly increased

knowledge of the physiopathology of this neoplasm. Novel targets for drug

development may be identified through an understanding of the normal

molecular processes that are deeply modified in pathological conditions. The

aim of the present study was to investigate, by immunohistochemistry, the

localisation of different growth factors and of the proliferative marker Ki-67 in

order to determine if these factors are involved in the transformation of

osteogenic cells and in the development of human osteosarcoma. We observed

a general positivity for NGF – TrKA – NT3 – TrKC - VEGF in the cytoplasm of

neoplastic cells and a strong expression for NT4 in the nuclear compartment.

TGF-β was strongly expressed in the extracellular matrix and vascular

endothelium. BDNF and TrKB showed a strong immunolabeling in the

extracellular matrix. Ki-67/MIB-1 was moderately expressed in the nucleus of

neoplastic cells. We believe that these growth factors may be considered

potential therapeutic targets in the treatment of osteosarcoma although proof

of this evidence requires further investigations.

Introduction

Osteosarcoma is the most common primary malignant bone tumour in

adolescents and young adults. Osteosarcoma includes several different

pathological entities, differing in clinical, radiological, and histological features.

Clinical-pathological subtypes range from low-grade lesions with low malignant

potential, towards high-grade lesions that express a marked potentiality for

metastatic dissemination (1). Although the efficacy of the oncological treatment

of osteosarcoma, consisting of chemotherapy and a surgical excision of the

tumor, continues to improve, osteosarcoma-related morbidity and mortality

106

remain high. The survival of patients affected by osteosarcoma is conditioned

by metastasis. Metastatic tumours are often not responsive or only partially

responsive to current therapeutic strategies and are the primary cause of

cancer-related mortality. Little is known about the molecular mechanisms that

control the pathogenesis of osteosarcoma. There is evidence that the course

of this disease may be influenced by the presence of various proteins which

play a key-role in proliferation, chemo-resistance and angiogenesis (2).

Angiogenesis, the sprouting of new capillaries from pre-existing blood vessels,

is a regulated process essential in reproduction, development and tissue repair

(3). It is known that angiogenesis is an essential component in cancer

development, supplying the tumour with nutrients, oxygen and growth factors

as well as for metastatic spreading. A more extensive angiogenic response may

indicate a very aggressive tumour with a less favourable prognosis and

quantification of this characteristic could provide an indication of tumour

behaviour. Angiogenesis is induced by a variety of growth factors, but the most

important factor of angiogenesis is the vascular endothelial growth factor

(VEGF). VEGF, also known as vascular permeability factor, exists in different

isoforms which are generated by alternative splicing of a single gene (4).

Although the different isoforms seem to express identical biological activities,

only the two smaller forms (VEGF121 and VEGF165) are secreted in soluble form,

whereas the larger ones remain cell-associated (5). The expression of VEGF is a

signal of the tyrosine kinase cascate activation initiated by binding VEGF to the

VEGF receptor (VEGFR). As a result of this process, new vessel formation

around the tumor is initiated (6). Prostaglandins (PGE1 and PGE2), potent

stimulators of bone formation, and other growth factors rapidly induce VEGF

expression in osteoblasts (7). The transforming growth factor βs (TGF-βs) are a

family of multifunctional cell peptides that regulate cell growth, differentiation,

and extracellular matrix production. Three TGF-β isoforms have been identified

in human tissues and bone matrix. Previous studies showed that TGF-β was

localized in osteoblasts and osteoclasts of fetal bones from different species (8).

TGF-β1 is released by the osteoblasts in the extracellular matrix in a latent form

and may be activated by the osteoclasts during the resorptive phase (9). The

107

active molecule may also influence bone resorption by inhibiting the formation

of new osteoclasts from their precursors and decreasing the activity of mature

osteoclasts (10). In a previous study, employing osteosarcoma cell lines, Kloen

et al. (11) were able to demonstrate that these neoplastic cells produce TGF-β

that stimulates their own proliferation, suggesting that an autocrine loop

involving TGF-β may contribute to the growth of human osteosarcomas.

Another study showed that high-grade osteosarcomas had a significantly higher

expression of TGF-β1 than low-grade osteosarcomas, while levels of TGF-β2 and

TGF-β3 were comparable in the two groups (12). There are no data in the

literature on the expression of neurotrophins in osteosarcoma cell lines.

Neurotrophins (NTs), also known as neurotrophic factors, constitute a family of

dimeric proteins working as polypeptidic growth factors, which include nerve

growth factor (NGF), brain derived growth factor (BDNF), neurotrophin-3 (NT-

3), NT-4/5 and NT-6, the last being apparently specific for fish (13). Biological

actions of NTs are mediated by the binding with two families of membrane

receptors, the high-affinity tyrosine kinase (Trk) and the low-affinity p75

(p75NT receptor) receptors (14). The Trk family includes TrkA, TrkB and TrkC

receptors, whereas p75NT receptor belongs to the trans-membrane molecules

serving as receptor for tumor necrosis factor and cytokines (15). TrkA is

specifically activated by NGF, whereas TrkB and TrkC are primarily receptors for

BDNF and NT-3 respectively (16, 17). NTs are involved in vertebrate neuronal

cell development, differentiation, survival and functional activities. NTs are also

involved in the modulation of adult central nervous system functions and

organization, as well as in the vegetative innervation of several organs (16).

Moreover, detailed studies have revealed significant actions of neurotrophins in

a wide variety of tissues outside the nervous system, especially in the immune

system (18). All these findings prompted us to investigate the localization and

intracellular distribution of the above mentioned growth factors and their

relative receptors, to determine whether these growth factors are involved in

the insorgence and development of the human osteosarcoma. In the present

study we also investigated the expression of VEGF, PGE2, TGF-β and

neurotrophins by immunohistochemical and immunofluorescence techniques in

108

some tissue samples of osteosarcoma not otherwise specified (NOS) and

osteosarcoma cell lines: the aim of this investigation was to elucidate the role

of these proteins in osteosarcoma carcinogenesis. Ki-67, a nuclear antigen that

has proved to be useful in assessing several tumors, provides informations

about cell proliferation and, consequently, long – term prognosis (19). Hence,

we decided to investigate, together with the analysis of the growth factors

pattern, the expression level of Ki67 to define its possible role as a prognostic

factor in osteosarcoma. The identification of these growth factors is crucial for

understanding tumor dissemination and for the development of novel therapies.


Population Study

The population of this study included 50 formalin-fixed, paraffin-embedded

blocks of surgical osteosarcoma specimens obtained from the files of the

Department of Medical Surgical Sciences and Biotechnologies, Sapienza

University of Rome, Polo Pontino, I.C.O.T, Latina, Italy. The osteosarcoma

specimens were harvested from 50 patients with osteosarcoma not otherwise

specified (NOS) aged 10-38 years. During excision, apart from anaesthesia, no

other chemical product or pharmaceutical drug had been administered. Core

tissue biopsies of 1 mm in diameter were taken from representative regions of

each paraffin-embedded tumor (donor block) and arrayed into a new recipient

paraffin block (45 mm x 20 mm) using the ATA-100 chemicon International

System. To minimize the influence of tumor and tissue hetero-geneity, three

different core biopsies for each donor block were harvested. Each array

contained 50 tissue cylinders. Experiments were performed in compliance with

the Italian laws and guidelines concerning the patients written informed

consent. The ethical committee of the Hospital Policlinico Umberto I approved

our study according to the European Community and Italian laws.

109

Cell Culture

Human osteosarcoma cell lines (SaOS-2, MG-63, 143 PML BK TK and HS888.T)

were grown under subconfluent or confluent conditions in medium, at 37°C

with 5% of CO2. Saos-2 is a non-transformed cell line derived from the primary

osteosarcoma of a 11 year old Caucasian female (osteogenic sarcoma). MG-63

is a cell line derived from an osteosarcoma of a 14 year old Caucasian male

(high yields of interferon). 143 PML BK TK is a cell line derived from primary

osteosarcoma of a 13 year old Caucasian female (adherent cells with

fibroblastic morphology). Hs888.T is a cell line derived from osteosarcoma of a

20 year old Caucasian male (adherent cells with mixed morphology). Cells were

cultured in Dulbecco's minimum essential medium (Sigma) supplemented with

10% fetal bovine serum (GIBCO) with penicillin (100μg/ml), streptomycin

(100U/ml) and sodium pyruvate. Cells were cultured on cover glass for

immunofluorescence analysis and were fixed with 3%

paraformaldehyde/phosphatase-buffered saline.


The method employed for immunohistochemical tests was ABC/HRP technique

(avidin complexed with biotinylated peroxidase). Serial 3-μm thick sections

were cut using a rotative microtome, mounted on gelatin-coated slides and

processed for immunohistochemistry. These sections were deparaffinized in

xylene and dehydrated. They were immersed in citrate buffer (pH 6) and

subjected to microwave irradiation twice for 5 minutes eachtime.

Subsequently, all sections were treated for 30 minutes with 0.3% hydrogen

peroxide in methanol to quench endogenous peroxidase activity. To block non-

specific binding, the slides were incubated in 3% normal goat serum in PBS for

30 minutes at room temperature. In order to study the immunolocalization of

neurotrophins and their own receptors, the following antibodies were used: i)

rabbit anti-NGF polyclonal antibody (Santa Cruz Biotechnology, CA, USA; ii)

rabbit anti-BDNF polyclonal antibody (Santa Cruz Biotechnology, CA, USA; iii)

rabbit anti-NT3 polyclonal antibody (Santa Cruz Biotechnology; iv) rabbit anti-

NT4 polyclonal antibody (Santa Cruz Biotechnology); v) rabbit anti-TrKA

110

polyclonal antibody (Santa Cruz Biotechnology); vi) rabbit anti-TrKB polyclonal

antibody (Santa Cruz Biotechnology); vii) rabbit anti-TrKC polyclonal antibody

(Santa Cruz Biotechnology); viii) mouse anti-VEGF monoclonal antibody (abcam

Cambridge Science Park, UK); ix) mouse anti-TGF-β1 monoclonal antibody

(abcam Cambridge Science Park, UK); x) rabbit anti-PGE2 polyclonal antibody

(abcam Cambridge Science Park, UK); xi) rabbit anti-ki-67 polyclonal antibody

(Santa Cruz Biotechnology). Incubation with primary antibodies was performed

overnight at 4˚C at a final concentration of 2-5 μg/ml. Optimal antisera

dilutions and incubation times were assessed in a series of preliminary


in phosphate buffer and incubated for 1 h at room temperature with the

appropriate secondary biotinylated goat anti-mouse or anti-rabbit Ig-G (vector

laboratories Burlingame, CA, USA, BA9200 and BA1000) and with peroxidase-

conjugated avidin (Vector laboratories, Burlingame, CA, USA, Vectastain Elite

ABC Kit Standard* PK 6-100) for 30 minutes. After a further wash with

phosphate buffer, slides were treated with 0.05% 3,3-diaminobenzidine (DAB)

and 0.1% H2O2. Finally, sections were counterstained with Mayer's hematoxylin

and observed using a light microscope. Negative control experiments were

done: i) by omitting the primary antibody; ii) by substituting the primary

antibody with an equivalent amount of non-specific immunoglobulins; iii) by

pre-incubating the primary antibody with the specific blocking peptide

(antigen/antibody = 5 according to supplier's instructions). The staining

assessment was made by two experienced observers in light microscopy. The

intensity of the immune reaction was assessed microdensitometrically using an

IAS 2000 image analyzer (Delta Sistemi, Rome, Italy) connected via a TV

camera to the microscope. The system was calibrated taking the background

obtained in sections exposed to non-immune serum as zero. Ten 100 μm2 areas

were delineated in each section by a measuring the diaphragm. Quantitative

data of the intensity of the immune staining were analyzed statistically by

analysis of the variance (ANOVA) followed by Duncan’s multiple range test as a

post hoc test.

111

Immunofluorescence in osteosarcoma cell lines

Cellular cultures (SaOS, MG-63, 143 PML BK TK and HS888.T) were incubated

with primary antibody and then with fluoresceinated secondary antibody. The

anti-mouse Alexa Fluor 488 antibody or anti-rabbit Alexa Fluor 488 antibody

(1:300) was applied for 2h at 37°C after three washes in 0.1% Tween in PBS

for 10min each. Slides were counterstained with DAPI (Vectashield Mounting

Medium with DAPI) after extensive washing with PBS. The reaction was

examined by confocal laser microscope (Nikon TE2000) for immunofluorescence

analysis. Membranous, cytoplasmic, and nuclear expressions were

independently assessed.

Results


Sections of bone tissues taken from patients suffering from not otherwise

specified osteosarcoma (NOS) exposed to the primary/secondary antibodies,

developed a dark-brown (intense), yellow-brown (slight) or no appreciable

immunostaining. Immunoreactivity was specific since no immunostaining was

obtained in positive control sections incubated with each primary antibody

adsorbed with the specific peptide or with pre-immune serum (data not shown).

Osteosarcoma is a heterogeneous group of malignant spindle cell tumors whose

common feature is the production of immature bone which, if non calcified, is

also known as osteoid. The sections harvested from osteogenic tissues showed,

in the neoplastic cells, a relevant immunoreactivity for NGF in the cytoplasmic

compartment while it was absent in the nuclear compartment (Fig. 1A). TrKA

immunoreactivity was significantly high in the cytoplasmic compartments of the

neoplastic cells, but moderate in the extracellular space (Fig. 1B). BDNF showed

a high expression in the extracellular compartment and was moderate in the

cytoplasmic compartment of neoplastic cells (Fig. 2A). TrKB was moderately

expressed in the cytoplasmic compartment of the neoplastic cells and

extracellular matrix (Fig. 2B). NT-3 was appreciable in the cytoplasmic

112

compartment of osteogenic tissue and weakly expressed in the extracellular

space (Fig. 3A). NT-4 showed a strong expression in the nuclear compartment

of the neoplastic cells in the osteogenic tissue and weak in the extracellular

matrix (Fig. 3B). Immunoreactivity for TrKC was strongly present in cytoplasmic

compartment of the neoplastic cells and moderate in the extracellular space.

These results showed a direct proportionality between the profiles of the

expression of neurotrophins and their target receptors. Positive

immunoreactivity for Ki67 was found only in the nuclear compartment of the

neoplastic cells (Fig. 4). VEGF expression was observed not only in tumor cells

but also throughout the extracellular matrix and endothelial cells of the

surrounding vessels (Fig. 5). TGF-β was not observed in the cytoplasmic and

nuclear compartments of tumor cells but was strongly expressed in the

extracellular matrix and vascular endothelium (Fig. 6). VEGF was expressed

more strongly within the vascular endothelial cells of the extracellular matrix

than within the tumor cells (insert here figures 4-6). The presence of VEGF-A in

osteosarcoma biopsy samples was observed with variable intensity within the

cytoplasm and/or membrane of osteosarcoma cells. These data are specified in

detail in Table I. The percentage values of growth factor-positive cells and P-

values are shown in Table II (t-test).

Immunofluorescence protein expression in cell culture

The immunofluorescence was performed on osteosarcoma cell lines as

described above (SaOS, MG-63, 143 PML BK TK and HS888.T) to evaluate the

level of expression and localization of VEGF, TGF-β and PGE2. All of these cell

lines were positive for VEGF and PGE2 proteins (Table III). In osteosarcoma cell

lines no signal for TGF-β was observed (Fig. 8). VEGF and PGE2 showed a high

intensity of fluorescence, whereas only a diffuse signal was appreciable in the

cytoplasmic compartment (Fig. 7A-B) (insert here figures 7-8).

Immunofluorescence on osteosarcoma cell lines confirmed the localization of

VEGF in cytoplasmic area of neoplastic cells and the total absence of TGF-β in

these cells as shown by immunohistochemical studies. Results concerning the

immunoreactivity for VEGF, TGF-β and PGE2 are summarized in Table III.

113

Discussion

Osteosarcoma is the most common primary malignant bone tumour in pediatric-

age patients in which the osteoid or bone is produced directly by tumor cells

(20). The prognosis of osteosarcoma patients resulted in a significant

improvement after the introduction of neoadjuvant chemotherapy.

Notwithstanding the advances made in the therapeutic approach to these

lesions, approximately 20-30% of patients with an osteosarcoma will eventually

develop a metastasis, which may cause death (21). The treatment of

osteosarcoma is based on a combined approach of primary antiblastic

chemotherapy and tumour surgery, followed by adjuvant chemotherapy (22).

The identification of molecular events related to tumour biology and growth is

crucial for understanding tumor dissemination and for the development of a

novel therapy. The course of the disease may be modified by the contribution

of various proteins which play a key role in proliferation, chemoresistance and

angiogenesis. Angiogenesis, which is defined as the formation of new blood

vessels from existing capillaries, is a normal and vital process in the growth and

development of both normal tissues and tumours. One of the most potent and

specific angiogenic factors is vascular endothelial growth factor (VEGF), also

known as vascular permeability factor and vasculotropin. Recent reports

showed that patients with VEGF-positive osteosarcoma have lower survival

rates than VEGF-negative ones (23). Other studies failed to show a correlation

between the levels of VEGF or microvascular density and survival of patients

with osteosarcoma (24). The purpose of this study was to demonstrate the

strong association between a high expression of VEGF and development of the

bone tumour. Our data showed that the expression of immunoreactivity for the

VEGF growth factor was higher within the vascular endothelial cells, rather than

inside osteoblastic tumour cells, thus demonstrating the involvement of this

vascular growth factor in the induction and regulation of pathological

angiogenesis. In the future, the assessment of VEGF may be helpful both for

predicting the prognosis of patients with osteosarcoma and also for indicating a

114

particular target therapy. Prostaglandins E1-E2 (PGE1-PGE2), strong stimulators

of bone formation, rapidly induced VEGF expression in osteoblastic cells (7).

Our data showed strong cytoplasmic expression of PGE2 in human osteoblastic

osteosarcoma cell lines (SaOS, MG-63, 143 PML BK TK and HS888.T) similarly

to VEGF, confirming a close correlation between the expression of PGE2 and

VEGF in osteosarcoma. Transforming growth factor-β (TGF-β) is a polypeptide

with multiple physiological functions. This growth factor plays an important role

in the control of the cell cycle and in the regulation of cell-cell interactions

(25). Local production of large amounts of TGF-β in the skeletal tissue

combined with its pivotal role in osteoblast behaviour suggest the presence of a

well-balanced autocrine control in normal bone (26). A deregulation of TGF-β

autocrine control in the bone could lead to the disease states characterized by

decreased bone formation, such as osteoporosis, or malignant transformation

such as that which occurs in osteosarcoma (27). The production of endogenous

TGF-β may induce a direct positive autocrine growth effect in fibroblasts and

osteoblasts. Our studies showed that TGF-β was not present in tumour cells,

but only in the extracellular matrix and in the endothelial cells of the

surrounding vessels. These results suggest that TGF-β operates not only on the

growth of tumour cells, but also on the changes in local micro-environment.

These data also suggest that TGF-β isoform alone is not sufficient to explain the

entire aspect of metastasization and requires further studies. In view of the

importance of TGF-β for controlling the growth of osteosarcoma, elucidation of

the mechanisms involved in the regulation of its expression could improve our

understanding of the biological behaviour of these neoplasms and plays a role

in the development of new therapeutic strategies. Ki-67, a nuclear antigen

recognized by the monoclonal antibody MIB-1, was statistically elevated in

higher-grade tumors and metastatic lesions, but was not influenced by tumour

type or patient's sex. Significant differences in Ki-67 expression were noted

among primary tumours, treated tumours and metastatic lesions: treatment

resulted in a reduction of tumor proliferative activity, while tumour progression

was associated with increased proliferative activity. In addition, proliferative

activity was noted to be associated with tumour grade and aggressiveness (28).

115

In our studies Ki-67 resulted mildly detectable in tumoural cells, but totally

absent in the vascular endothelium. However, the distribution and localization

of this factor in human neoplastic bone cells is confirmed to be nuclear. These

findings could be of clinical significance for monitoring disease progression and

response to treatment with chemotherapy and radiotherapy. Neurotrophic

growth factors (NGF, BDNF, NT-3 and NT-4) binding TrK receptors (TrKA, TrKB

and TrKC) cause neuronal cell differentiation, proliferation and survival, thus

regulating neuronal development and maintenance of neuronal networks (29).

In addition to their involvement in the nervous system, TrK receptors and

neurotrophins appear to participate in homeostatic and reparative bone

morphogenesis (30) as well as to play a role in some pathological processes,

including tumourigenesis. Previous studies have suggested that TrkA signalling

exerts antiapoptotic effects in murine and human immortalized bone-forming

cells. In the MC3T3-E1 murine osteoblast cell line, activation of TrKA with NGF

reduces apoptotic DNA breakdown in osteoblasts secondary to cytotoxic

treatments (31). In the human osteoblast cell line hFOB, the antiapoptotic

effects of TrKA signalling appear to be cell-cycle dependent (32). NGF-mediated

signalling through the TrKA receptor appears to protect proliferating osteoblast

cells from programmed cell death. In our observations we found a relevant

immunoreactivity for neurotrophins in the cytoplasmic compartment of the

human neoplastic cells similarly to their receptors, whereas a weak level was

observed in the extracellular matrix. On the other hand, NT-4 showed a

moderate expression in the nuclear compartment of bone neoplastic cells,

suggesting the direct role of this neurotrophin in increasing the proliferation

rate of the neoplastic cells. To sum up, we observed a generally relevant

positive immunoreaction for NGF – TrKA – NT3 – TrKC in the cytoplasmic

compartment and for NT-4 in the nucleus of tumoural bone cells, suggesting a

direct role of these molecules in increasing the cell proliferation rate in the

neoplastic tissue. Moreover, we found a strong expression for BDNF in the

extracellular space, suggesting that this factor directly influences spreading of

neoplastic cells, attributable to an increase in tumor size, also due to a high

vascularization network. Neurotrophins and their receptors may finally be used

116

all together as a panel of possible diagnostic factors, to monitor the histological

transformation and development of osteosarcomas. The current antiproliferative

chemotherapies used to treat patients with osteosarcoma may induce

debilitating side effects, including hematological, liver, renal, cardiac,

neurological and gonadal toxicity. These agents are also mutagenic and can

cause secondary malignancies, most commonly leukemia, brain cancer, soft

tissue sarcomas and breast cancer (32). In conclusion, treatment regimens

against specific targets such as growth factors (neurotrophins, tyrosine kinases,

VEGF, PGE2 and TGF-β) are likely to produce less toxic side effects.

Consequently, such targeted therapies may offer patients the hope of an

improved quality of life as well as increased survival. Additional studies are,

however, necessary to better explain the biological role of these molecules in

the development and progression of this type of tumours.

117

References

1. Yonemoto T, Tatezaki S, Ishii T, Satoh T, Kimura H, Iwai N. Prognosis of

osteosarcoma with pulmonary metastases at initial presentation is not dismal.

Clin Orthop Relat Res 1998; 349: 194-199.

2. Kaya M, Wada T, Akatsuka T, Kawaguchi S, Nagoya S, Shindoh M, Higashino

F, Mezawa F, Okada F, Ishii S. Vascular endothelial growth factor expression in

untreated osteosarcoma is predictive of pulmonary metastasis and poor

prognosis. Clin Cancer Res 2000; 6:572-577.

3. Folkman J, Shing Y. Angiogenesis. J Biol Chem 1992; 267: 10931-10934.

4. Tischer E, Mitchell R, Hartman T, Silva M, Gospodarowicz D, Fiddes JC,

Abraham JA. The human gene for vascular endothelial growth factor. Multiple

protein forms are encoded through alternative exon splicing. J Biol Chem 1991;

266:11947-11954.

5. Houck KA, Leung DW, Rowland AM Winer J, Ferrara N. Dual regulation of

vascular endothelial growth factor bioavailability by genetic and proteolytic

mechanisms. J Biol Chem 1992; 267: 26031-26037.

6. Prior BM, Yang HT, Terjung RL. What makes vessels grow with exercise

training? J App Physiol 2004; 97: 1119-1128.

7. Harada S-I, Nagy JA, Sullivan KA, Thomas KA, Endo N, Rodan GA, Rodan SB.

Induction of vascular endothelial growth factor expression by prostaglandin E2

and E1 in osteoblasts. J Clin Invest 1994; 93:2409-2496.

8. Sandberg M, Autio-Harmainen H, Vuorio E. Localization of the expression of

types I, III and IV collagen, TGF-β1 and c-fos genes in developing human

calvarial bones. Dev Biol 1988; 130: 324-334.

9. Oreffo RO, Mundy GR, Seyedin SM, Bonewald LF. Activation of the bone-

derived latent TGF beta complex by isolated osteoclasts. Biochem Biophys Res

Commun 1989; 158: 817-823.

10. Hattersley G, Chambers TJ. Effects of transforming growth factor β1 on the

regulation of osteoclastic development and function. J Bone Miner Res 1991; 6:

165-172.

118

11. Kloen P, Jennings CL, Gebhardt MC, Springfield DS, Mankin HJ. Expression

of transforming growth factor-beta (TGF-β) receptors, TGF-β1 and TGF-β-2

production and autocrine growth control in osteosarcoma cells. Int J Cancer

1994; 58: 440-445.

12. Franchi A, Arganini L, Baroni G, Calzolari A, Capanna R, Campanacci D,

Caldora P, Masi L, Brandi ML, Zampi G. Expression of transforming growth

factor beta isoforms in osteosarcoma variants: association of TGF-β1 with high-

grade osteosarcomas. J Pathol 1998; 185: 284-289.

13. Lewin GR, Barde YA. Physiology of neurotrophins. Annu Rev Neurosci 1996;

9: 289-317.

14. Barbacid M. The Trk family of neurotrophin receptors. J Neurobiol 1994; 25:

1386-1403.

15. Serra M, Picci P, Ferrari S, Bacci G. Prognostic value of P-glycoprotein in

high-grade osteosarcoma. J Clin Oncol 2007; 25:4858-4860.

16. Lomen-Hoerth C, Shooter EM. Widespread neurotrophin receptor expression

in the immune system and other non-neuronal rat tissue. J Neurochem 1995;

64: 1780-1789.

17. Lommatzsch M, Braun A, Mannsfeldt A, Botchkarev VA, Botchkareva NV,

Paus R, Fischer A, Lewin GR, Renz H. Abundant production of brain-derived

neurotrophic factor by adult visceral epithelia. Implications for paracrine and

target-derived neurotrophic functions. Am J Pathol 1999; 155: 1183-1193.

18. Otten U, Gadient RA. Neurotrophins and cytokines--intermediaries between

the immune and nervous systems. Int J Dev Neurosci 1995; 13: 147-151.

19. Kim SY, Chung SH, Kim HJ, Whang K, Han YP, Hong SK. Bcl-2 and Bax

expression and Ki-67 proliferative index in astrocytic tumors: in relation to

prognosis. J Korean Neurosurg Soc 2004; 35: 465 – 471.

20. Campanacci M, editor. Bone and soft tissue tumors. Ed. Springer-Verlag:

Wien-New York 1999.

21. Bacci G, Ferrari S, Bertoni F, Picci P, Bacchini P, Longhi A, Donati D, Forni C,

Campanacci L, Campanacci M. Histologic response of high-grade nonmetastatic

osteosarcoma of the extremity to chemotherapy. Clin Orthop Relat Res 2001;

386:186-196.

119

22. Ferrari S, Zanella L, Alberghini M, Palmerini E, Staals E, Bacchini P.

Prognostic significance of immunohistochemical expression of ezrin in non-

metastatic high-grade osteosarcoma. Pediatr Blood Cancer 2008; 50:752-756.

23. Qu JT, Wang M, He HL, Tang Y, Ye XJ. The prognostic value of elevated

vascular endothelial growth factor in patients with osteosarcoma: a meta-

analysis and systemic review. J Cancer Res Clin Oncol, 2012; 138:819-825.

24. Ek ET, Ojaimi J, Kitagawa Y, Choong PF. Does the degree of intratumoral

microvessel density and VEGF expression have prognostic significance in

osteosarcoma? Oncol Rep 2006; 16:17-23.

25. Chang HL, Gillett N, Figari I, Lopez AR, Palladino MA, Derynck R. Increased

transforming growth factor beta expression inhibits cell proliferation in vitro, yet

increases tumorigenicity and tumor growth of Meth A sarcoma cells. Cancer

Res 1993; 53:4391-4398.

26. Arrick BA, Lopez AR, Elfman F, Ebner R, Damsky CH, Derynck R. Altered

metabolic and adhesive properties and increased tumorigenesis associated

with increased expression of transforming growth factor beta 1. J Cell Biol

1992; 118: 715-726.

27. Kloen P, Jennings CL, Gebhardt MC, Springfield DS, Mankin HJ. Expression

of transforming growth factor-beta (TGF-beta) receptors, TGF-beta 1 and TGF-

beta 2 production and autocrine growth control in osteosarcoma cells. Int J

Cancer 1994; 58:440-445.

28. Hernandez-Rodriguez NA, Correa E, Sotelo R, Contreras-Paredes A, Gomez-

Ruiz C, Green L, Mohar A. Ki-67: a proliferative marker that may predict

pulmonary metastases and mortality of primary osteosarcoma. Cancer Detect

Prev 2001; 25:210-215.

29. Hennigan A, O’Callaghan RM, Kelly AM. Neurotrophins and their receptors:

Roles in plasticity, neurodegeneration and neuroprotection. Biochem. Soc Trans

2007; 35:424-427.

30. Asaumi K, Nakanishi T, Asahara H, Inoue H, Takigawa M. Expression of

neurotrophins and their receptors (TrK) during fracture healing. Bone 2000;

26:625-633.

http://www.ncbi.nlm.nih.gov/pubmed?term=Contreras-Paredes%20A%5BAuthor%5D&cauthor=true&cauthor_uid=11341357

http://www.ncbi.nlm.nih.gov/pubmed?term=Gomez-Ruiz%20C%5BAuthor%5D&cauthor=true&cauthor_uid=11341357

http://www.ncbi.nlm.nih.gov/pubmed?term=Gomez-Ruiz%20C%5BAuthor%5D&cauthor=true&cauthor_uid=11341357

http://www.ncbi.nlm.nih.gov/pubmed?term=Green%20L%5BAuthor%5D&cauthor=true&cauthor_uid=11341357

http://www.ncbi.nlm.nih.gov/pubmed?term=Mohar%20A%5BAuthor%5D&cauthor=true&cauthor_uid=11341357

120

31. Mogi M, Kondo A, Kinpara K, Togari A. Anti-apoptotic action of nerve

growth factor in mouse osteoblastic cell line. Life Sci 2000; 67:1197-1206.

32. Pinski J, Weeraratna A, Uzgare AR, Arnold JT, Denmeade SR, Isaacs JT. TrK

receptor inhibition induces apoptosis of proliferating but not quiescent human

osteoblasts. Cancer Res 2002; 62:986-989.

http://www.ncbi.nlm.nih.gov/pubmed?term=Arnold%20JT%5BAuthor%5D&cauthor=true&cauthor_uid=11861369

http://www.ncbi.nlm.nih.gov/pubmed?term=Denmeade%20SR%5BAuthor%5D&cauthor=true&cauthor_uid=11861369

http://www.ncbi.nlm.nih.gov/pubmed?term=Isaacs%20JT%5BAuthor%5D&cauthor=true&cauthor_uid=11861369

121

Figure 1. Immunohistochemical analysis of specimens of human osteosarcoma

not otherwise specified for NGF (A) and TrKA (B). (A) NGF immunoreactivity

appears to be positive in the cytoplasmic compartment of neoplastic cells and

absent in extracellular matrix and endothelial cells of vessels. (B) TrKA

immunoreactivity was significantly high in the cytoplasmic area of the neoplastic

cells, but moderate in the extracellular space (20X).


not otherwise specified for BDNF (A) and TrKB (B). (A) BDNF and (B) TrKB

immunoreactivity appears to be moderately expressed in the cytoplasmic

compartment of neoplastic cells and strongly expressed in extracellular matrix,

but totally absent in vascular endothelium (40X).

122


not otherwise specified for NT3 (A) and NT4 (B). (A) NT-3 immunoreactivity

appears to be appreciable in the cytoplasmic compartment of osteogenic tissue

and weak in the extracellular matrix. (B) NT-4 was strongly expressed in the

nuclear compartment of the neoplastic cells in the osteogenic tissue (40X).


not otherwise specified for Ki-67. Ki-67 immunoreactivity appears to be

moderately positive in the nuclear region of neoplastic cells (20X).

123


not otherwise specified for VEGF. VEGF immunoreactivity appears to be positive

in the cytoplasmic compartment of neoplastic cells and strongly expressed in

extracellular matrix and endothelial cells of vessels (10X).


not otherwise specified for TGF-β. TGF-β appears to be weakly expressed in

the cytoplasmic area of tumoral cells, moderately positive in endothelial cells of

blood vessels and in extracellular tissue (20X).

124

Figure 7. Immunofluorescent staining of VEGF (A) and PGE2 (B) in SaOS

osteosarcoma cell culture. VEGF and PGE2 were localized at cytoplasmic level of

these neoplastic cells (40X).

Figure 8. Immunofluorescent staining of TGF- β MG-63 osteosarcoma cell

culture. In osteosarcoma cell lines no signal for TGF-β was observed (40X)

125

Table I. Results of the immunohistochemical analysis for neurotrophins and

their receptors, VEGF, TGF-β and Ki-67 in osteosarcoma tissues.

NEOPLASTIC CELLS EXTRACELLULAR

MATRIX

VASCULAR

ENDOTHELIUM

NGF ++ (cytoplasmic) - -

TrKA ++(cytoplasmic) + -

BDNF +(cytoplasmic) ++ -

TrKB + (cytoplasmic) + -

NT3 ++ (cytoplasmic) +/- -

NT4 ++(nuclear) +/- -

TrKC ++ (cytoplasmic) + -

VEGF ++ (cytoplasmic) +++ +++

TGF-β -(cytoplasmic) ++ +

Ki-67 + (nuclear) - -

+++: strong immunoreactivity; ++ : relevant immunoreactivity; + : moderate

immunoreactivity; +/- : weak immunoreactivity; -: absence of

immunoreactivity.

126

Table II. Levels of neurotrophins, neurotrophin receptors, VEGF, TGF-β, PGE2

and Ki67 examined in neoplastic cells of osteosarcoma specimens, and

respective levels of statistical significance (t-test)

Age of patients N° of patients

(EXPRESSION 50)%

N° of patients

(EXPRESSION 50%)

NGF 14 years

14 years

30 (60%)

4 (8%)

p-value=0.0007

14 (28%)

2 (4%)

p-value=0.0041

TrKA 14 years

14 years

35 (70%)

4 (8%)

p-value=0.0006

8 (16%)

3 (6%)

p-value=0.0136

BDNF 14 years

14 years

23 (46%)

12 (24%)

p-value=0.0035

11 (22%)

4 (8%)

p-value=0.0136

TrKB 14 years

14 years

38 (76%)

3 (6%)

p-value=0.0004

8 (16%)

1 (2%)

p-value=0.0059

NT3 14 years

14 years

37 (74%)

5 (10%)

p-value=0.0002

6 (12%)

2 (4%)

p-value=0.0121

NT4 14 years

14 years

34 (68%)

6 (12%)

p-value=0.0006

8 (16%)

2 (4%)

p-value=0.0194

TrKC 14 years

14 years

33 (66%)

9 (18%)

p-value=0.0009

7 (14%)

1 (2%)

p-value=0.0082

VEGF 14 years

14 years

40 (80%)

5 (10%)

p-value=0.0030

4 (8%)

1 (2%)

p-value=0.0000

TGF-β 14 years

14 years

3 (6%)

0 (0%)

p-value=0.0377

39(78%)

8 (16%)

p-value=0.0003

Ki-67 14 years

14 years

30 (60%)

2 (4%)

p-value=0.0003

3 (6%)

15 (30%)

p-value=0.0019

127

Table III. Results of the immunofluorescence analysis for VEGF, TGF-β and

PGE2 in human osteoblastic osteosarcoma cell lines (SaOS, MG-63, 143 PML BK

TK and HS888.T).

VEGF

++ (cytoplasmic)

PGE2

++ (cytoplasmic)

TGF-β

+/- (cytoplasmic)



immunoreactivity.

128

Chapter 6

Immunohistochemical profile of cytokines

and growth factors expressed in

vestibular schwannoma and in normal

vestibular nerve tissue

S. Taurone1*, E. Bianchi1*, G. Attanasio1, C. Di Gioia2,

R. Ierinó2, C. Carubbi3, D. Galli3, F.S. Pastore4,

F. Giangaspero2,5, R. Filipo1, C. Zanza1 and M. Artico1

Departments of 1Sensory Organs and 2Radiology, Oncology and Human

Pathology, Sapienza University of Rome, Rome; 3Department of Biomedical,

Biotechnological and Translational Sciences, University of Parma, Parma,

Emilia-Romagna; 4Division of Neurosurgery, Tor Vergata University of Rome,

Rome; 5Neuromed Institute, Pozzilli, Isernia, Italy

Molecular Medicine Reports 2015; 12: 737-745

Key words: Schwann cells - acoustic neuromas - transforming growth

factor-β1 - interleukin-1β - tumor necrosis factor-α - interleukin-6 - vascular

endothelial growth factor - intracellular adhesion molecule-1

129

Abstract

Vestibular schwannomas, also known as acoustic neuromas, are benign tumors,

which originate from myelin-forming Schwann cells. They develop in the

vestibular branch of the eighth cranial nerve in the internal auditory canal or

cerebellopontine angle. The clinical progression of the condition involves slow

and progressive growth, eventually resulting in brainstem compression. The

objective of the present study was to investigate the expression level and the

localization of the pro-inflammatory cytokines, transforming growth factor-β1

(TGF-β1) interleukin (IL)-1β, IL-6 and tumor necrosis factor-α (TNF-α), as well

as the adhesion molecules, intracellular adhesion molecule-1 and vascular

endothelial growth factor (VEGF), in order to determine whether these factors

are involved in the transformation and development of human vestibular

schwannoma. The present study investigated whether changes in inflammation

are involved in tumor growth and if so, the mechanisms underlying this

process. The results of the current study demonstrated that pro-inflammatory

cytokines, including TGF-β1, IL-1β and IL-6 exhibited increased expression in

human vestibular schwannoma tissue compared with normal vestibular nerve

samples. TNF-α was weakly expressed in Schwann cells, confirming that a lower

level of this cytokine is involved in the proliferation of Schwann cells. Neoplastic

Schwann cells produce pro-inflammatory cytokines that may act in an autocrine

manner, stimulating cellular proliferation. In addition, the increased expression

of VEGF in vestibular schwannoma compared with that in normal vestibular

nerve tissue, suggests that this factor may induce neoplastic growth via the

promotion of angiogenesis. The present findings suggest that inflammation may

promote angiogenesis and consequently contribute to tumor progression. In

conclusion, the results of the present study indicated that VEGF and

pro-inflammatory cytokines may be potential therapeutic targets in vestibular

schwannoma. Further studies are necessary to confirm the involvement of

these factors in the growth of neoplasms and to develop inhibitors of

pro-inflammatory cytokines as a potential treatment option in the future.

130

Introduction

Vestibular schwannomas (VS), also known as acoustic neuromas, are the most

frequent benign tumor of the lateral skull base, and originate from Schwann

cells of the vestibular branch of the eighth cranial nerve. VSs are neoplasms

that occur as a result of the increased proliferation of Schwann cells and are

diagnosed histopathologically by the presence of singular architectural patterns

called AntoniA and AntoniB areas. VS represents 8% of all primary intracranial

tumors(1). Individuals between 30and 60years old are the most frequently

affected, and there is no gender prevalence(2,3). The majority of VSs are

sporadic and, in general, are benign slow-growing neoplasms. They exhibit a

wide variability in growth rate and size. If growth continues it may result in

complex pathological conditions, including brainstem compression and

hydrocephalus. Magnetic resonance imaging has a central role in the diagnosis

of this condition, and complete surgical resection remains the preferred

treatment. The growth of VS is not directly correlated with tumor size,

symptoms, duration of symptoms or the patient's age(4). The growth rate of VS

is heterogeneous, at 0.3-1.42mm/year. VS evolves from an abnormal growth

and proliferation of Schwann cells, at their junction with glial cells surrounding

the vestibular nerve. This neoplasm is exclusively formed from the hyperpro-

liferation of Schwann cells and associated neovasculature(5,6). Schwann cells

are principal glial cells of the peripheral nervous system. During embryogenesis,

they migrate along axons and synthesize a basal lamina, consisting

predominantly of laminin, collagen and proteoglycans. Schwann cells have an

important role in nerve regeneration following laceration, when they replace

damaged Schwann cells and synthesize a new basal lamina and myelin sheath.

Following nerve injury, successful remyelination of damaged axons by Schwann

cells relies upon a combination of signals that Schwann cells receive from

demyelinated axons during in the inflammatory response. These signals initially

prompt Schwann cells to re-enter the cell cycle and subsequently to

differentiate into myelinating cells(6). Axonal myelination is important for the

131

functional recovery of injured peripheral nerves. In particular, it facilitates rapid

saltatory impulse conduction by producing a faster conduction velocity of action

potentials(7,8). In order to better understand the molecular mechanisms of

Schwann cells, including cell proliferation, migration, survival and apoptosis

during peripheral nerve injury, the present study aimed to invetigate the

involvement of certain inflammatory cytokines and growth factors in VS. The

majority of the pathogenetic mechanisms regulating neoplastic growth in

vestibular nerve cells, remain to be elucidated. A number of studies have

demonstrated that neurotrophins and growth factors have a role in governing

the development of homeostasis, cell survival and regeneration processes

within Schwann cells(9,10). Although further neoplastic growth appears to

depend on cytokines with angiogenic and mitogenic properties, data concerning

the involvement of growth factors in VS growth are not currently available.

Trophic factors, including transforming growth factor-β1 (TGF-β1) and vascular

endothelial growth factor (VEGF), have been designated as possible key

mediators of VS growth. TGFs are a family of polypeptides involved in wound

healing and tumorigenesis invivo. TGF-β1 may act as either an inhibitor or

stimulator of cell proliferation, depending on the cell type and growth

conditions. TGF-β1 may be involved in the development of VS, stimulating the

proliferation of Schwann cells. The signalling pathway of TGF-β1 is activated by

two transmembrane serine/threonine kinases, TGF-βR1 and TGF-βR2. The

type2 receptor (TGF-βR2) is involved in the antiproliferative activity of TGF-β,

whereas the type1 receptor (TGF-βR1) appears to cause cellular proliferation

following cell-matrix interactions(11). Interactions between cytokines and

Schwann cells are involved in the development of disorders of the peripheral

nervous system. Tumor necrosis factor-α (TNF-α) is a pro-inflammatory

cytokines produced by activated macrophages in response to pathogens and

other noxious stimuli. TNF-α is released by Schwann cells as well as by

macrophages(12). TNF-α, one of the major initiators of the inflammatory

cascade, activates pleiotropic functions in physiological and pathological

conditions by binding to its receptors, typeI (TNFRI) and typeII (TNFRII). Wang

et al. (13) described the involvement of TNF-α-associated signalling molecules,

132

including a baculoviral inhibitor of apoptosis repeat-containing protein (BIRC) 2,

BIRC3 and TNFRI, in the anti-apoptotic process of injured peripheral nerves,

indicating that a higher level of TNF-α may induce apoptosis in Schwann cells

invitro, while a lower level of TNF-α may not act in the same way. Wagner and

Myers(12) confirmed that the production of TNF-α by peripheral nerve glial cells

has a pathogenic role in nerve injury. A number of studies have investigated

the possible role of interleukin (IL)-6 in peripheral nerve regeneration(14,15).

However, the molecular mechanisms underlying the involvement of IL-6 in the

development of Schwann cells remain to be fully elucidated. The induction of

pro-inflammatory genes by IL-6 in Schwann cells may indicate that IL-6 is

involved in the degeneration of injured neurons, in cooperation with other

inflammatory cytokines, such as TNF-α. Certain pro-inflammatory cytokines,

including TNF-α, IL-1β and IL-6 are known to induce the expression of adhesion

molecules. Adhesion molecule expression, including that of intracellular

adhesion molecule-1 (ICAM-1), is tightly-regulated by cytokines generated

during an inflammatory response(16). ICAM-1 is able to facilitate leukocyte

attachment and interactions with cells from the target tissue(17). The

expansion of any solid tumor with a volume >2-3mm is reliant upon

angiogenesis to provide oxygen and nutrients to the enlarging tumor. VEGF

induces angiogenesis through endothelial cell proliferation and migration. It is

considered to be one of the most potent pro-angiogenic factors, causing

vasodilatation, vascular permeability and angiogenesis. Angiogenesis is defined

as the process of new blood vessel formation from pre-existing vasculature and

involves a cascade of processes, during which the vessel's basal membrane and

the surrounding extracellular matrix are modified by endothelial cell

proliferation and migration(18). The binding of VEGF to high-affinity receptors,

VEGFR-1 and VEGFR-2, promotes extravasation of plasma proteins from tumor

vessels, thereby forming a temporary extravascular matrix which favors the

migration and proliferation of endothelial cells, resulting in new blood vessel

formation(19). The aim of the present study was to investigate the expression

of pro-inflammatory cytokines in VS compared with normal vestibular nerve

tissue, using immunohistochemistry, in order to improve understanding of the

133

pathogenesis of this disease. An increased knowledge of this subject may have

significant clinical consequences in terms of improvement in clinical treatment,

prevention of the postsurgical relapse, and a reduction in the severity of

inflammation, tissue invasion, tumor proliferation and angiogenesis.

Materials and methods

Ethical considerations and VS samples

In accordance with approval of the ethical committee of Policlinico Umberto,

Sapienza University of Rome (Rome, Italy), tissues were harvested from ten

randomly selected patients, four females and six males, with unilateral, sporadic

VS that had been removed surgically, and ten healthy control samples, which

consisted of three females and seven males with Ménière's syndrome following

vestibular neurectomy. The patients, aged between 45 and 69years, consisted

of four females and six males. Routine histopathological examination confirmed

the diagnosis of benign VS in the samples, which included one patient with a

tumor recurrence. Prior to signing the consent form, patients were informed

about the study in detail and were given sufficient time to ask questions. The

study was conducted in accordance with the Declaration of Helsinki. Each

clinical unit selected specimens and assigned a number to each sample,

followed by a letter indicating the participating unit. For each case, a report was

prepared, indicating the age and gender of the patient, as well as their clinical

signs and symptoms. Control morphological sections were stained with

hematoxylin and eosin(H&E), or processed for immunohistochemistry. The

following molecules were investigated in the tumoral samples and in normal

vestibular nerve specimens: VEGF, TGF-β1, IL-1β, IL-6, ICAM-1 and TNF-α.


For light microscopic immunohistochemical analysis, small fragments of VS were

processed according to the avidin-biotin complex/horseradish peroxidase

134

technique. These samples were washed in phosphate-buffered saline (PBS),

fixed in 10% formalin and embedded in paraffin according to a standard

procedure(20). Serial 3-μm sections were cut using a rotative

microtome(RM2265; Leica Biosystems, Wetzlar, Germany), mounted on gelatin-

coated slides and processed for immunohistochemistry. These sections were

deparaffinized in xylene and dehydrated. They were immersed in citrate buffer

(pH6.0; 15M103; BioOptica Milano, S.p.A, Milan, Italy) and subjected to

microwave irradiation twice for 5min. Subsequently, all sections were treated

for 30min with 0.3% hydrogen peroxide in methanol in order to quench

endogenous peroxidase activity. To block non-specific binding, the slides were

incubated in 3% normal goat serum(S-100; Vector Laboratories Burlingame,

CA, USA) in PBS(15M108; BioOptica Milano, S.p.A.) for 30min at room

temperature. The slides were incubated overnight at 4˚C with the following

antibodies all purchased from Santa Cruz Biotechnology, Inc. (Dallas, TX, USA):

Rabbit anti-IL-1β polyclonal antibody(1:50; sc-7884); rabbit anti-IL-6 polyclonal

antibody(1:200; sc-7920); mouse anti-TNF-α monoclonal antibody(1:100; sc-

52791); mouse anti-VEGF monoclonal antibody(1:200; sc-152); mouse anti-

ICAM-1 monoclonal antibody(1:50; sc-107); and rabbit anti-TGF-β1 polyclonal

antibody(1:200; sc-146). Optimal antisera dilutions and incubation times were

assessed in a series of preliminary experiments. Following exposure to the

primary antibodies, slides were rinsed twice in PBS and incubated for 1h at

room temperature with the appropriate secondary biotinylated goat anti-mouse

or anti-rabbit immunoglobulinG (1:200; cat. nos. BA9200 and BA1000; Vector

Laboratories) and with peroxidase-conjugated avidin (Vectastain Elite ABC kit

standard* PK 6-100; Vector Laboratories) for 35min. Following a further wash

with PBS, slides were treated with 0,05% 3,3-diaminobenzidine (DAB) and

0,1% H2O2 (DAB substrate kit for peroxidase, Vector Laboratories; SK-4100).

Finally, sections were counter-stained with Mayer's hematoxylin and observed

using a light microscope (Axio Lab.A1; Zeiss, Oberkochen, Germany). Negative

control experiments were performed by omitting the primary antibody,

substituting the primary antibody with an equivalent quantity of non-specific

immunoglobulins or pre-incubating the primary antibody with the specific

135

blocking peptide (antigen/antibody=5 according to the manufacturer's

instructions). The staining assessment was made by two observers experienced

in light microscopy. Immunoreactivity was assessed for IL-1β, IL-6, TNF-α,

VEGF, ICAM-1 and TGF-β1 in Schwann cells, vascular endothelium and dense

connective tissue of neoplastic vestibular nerve samples, and compared with

that of the healthy samples. The intensity of the immune reaction was assessed

microdensitometrically using an IAS2000 image analyzer (Delta Sistemi, Rome,


using zero as the background obtained in sections exposed to non-immune

serum. A total of ten 100-μm2

areas were delineated in each section using a

measuring diaphragm. The quantitative data regarding the intensity of immune

staining were analyzed statistically using an analysis of variance followed by

Duncan's multiple range test as a posthoctest.

Statistical analysis

The comparison of the expression levels of TNF-α, TGF-β1, IL-1β, IL-6 and

VEGF between the VS and normal vestibular nerve samples was performed

using a t-test. Statistical analyses were performed using the SPSS statistical

software package version 12.0 (SPSS, Inc., Chicago, IL, USA). P<0.001 was

considered to indicate a statistically significant difference.

Results

Morphological analysis of vestibular nerves using H&E

staining

A total of 10 patients, ranging in age between 45 and 69years, with a diagnosis

of VS were investigated. A total of 10 samples of healthy vestibular nerves were

obtained via vestibular neurectomy to serve as controls. The control peripheral

nerve samples consisted of a single fascicle surrounded by a dense

perineurium, containing small vessels(Fig. 1). The greatest number of nuclei

136

within the fascicle were attributed to Schwann cells. The shape and the

arrangement of these nuclei reflected the course of individual axons. The

fibroblasts of the endoneurium were dispersed amongst numerous Schwann

cells, and exhibited thinner nuclei and increased cellular condensation

compared with the Schwann cells. The nuclei of Schwann cells were elongated

along the major axis of the nerve(Fig. 1A). Sections of VS samples exhibited

compact spindle cell areas, which were densely populated, and formed a

fascicular, storiform and whorled-growth pattern. Histologically, schwannomas

are composed of spindle cells arranged in bundles with elongated nuclei that

form Verocay's bodies(Fig. 1B). Phenomena associated with cystic degeneration

are common. Thickening and hyalinization of the vessel walls are associated

with microhemorrhagic phenomena. The sections were exposed to primary and

secondary antibodies, resulting in the development of dark-brown (intense),

yellow-brown (slight) or no immune staining. Immunoreactivity was deemed to

be specific as no immunostaining was observed in control sections incubated

with primary antibodies absorbed with the specific peptide or with the

pre-immune serum.

Immunohistochemical analysis of human healthy vestibular

nerve and schwannoma samples

All VS samples examined in the present study exhibited a marked

immunoreactivity for TGF-β1. TGF-β1 immunoreactivity was detected primarily

in the cytoplasm of Schwann cells and revealed differences in the number of

immunopositive cells between AntoniA and AntoniB tissue types. AntoniA and

AntoniB tissue types represent distinct histologic architectural patterns that aid

in the histopathologic diagnosis of schwannoma(21). Type A tissue is highly

cellular and demonstrates nuclear palisading as well as associated Verocay

bodies, which reflects their prominent extracellular matrix and secretion of

laminin. Type B tissue is loosely organized with myxomatous and cystic change

and may represent degenerated Antoni A tissue. AntoniA cellular areas

expressed more prominent TGF-β1 immunoreactivity than AntoniB areas. The

AntoniB regions exhibited less dense cellular areas than AntoniA regions, in

137

which there were compactly arranged spindle cells with long and oval nuclei

(Fig. 2A). TGF-β1 reactivity was also demonstrated in the blood vessel walls

distributed in the neoplastic dense connective tissue. No immunoreactivity for

TGF-β1 was observed in vascular endothelial cells, or Antoni A and Antoni B

areas in the control specimens (Fig. 2B). TNF-α was weakly expressed by the

majority of human VS specimens in the endothelial cells of vessels, and AntoniA

and AntoniB regions. Numerous immunopositive nuclei were detected in the

AntoniA regions compared with the Antoni B regions (Fig. 3A). No

immunoreactivity for TNF-α was detected in the healthy control vestibular nerve

samples (Fig. 3B). There was increased expression of IL-1β within the VS

tissues (Fig. 4A), which was localized to the cytoplasm of Schwann cells.

Antoni A and B regions exhibited approximately the same number of

immunopositive nuclei for IL-1β. A moderate expression for IL-1β was also

observed in the blood vessels. No staining was observed in control tissues (Fig.

4B). Immunohistochemistry for IL-6 was positive in the VS cells, with weak

expression in the cytoplasm (Fig. 5A), while in the control nerves samples it

was undetectable (Fig. 5B). The findings confirmed that these cytokines are

involved in the development and progression of VS via stimulation of Schwann

cell proliferation. Pro-inflammatory cytokines, including TGF-β1, TNF-α, IL-1β

and IL-6, may be secreted by activated leukocytes, fibroblasts and Schwann

cells. These cytokines are known to induce the expression of adhesion

molecules, such us ICAM-1 and VCAM-1, and are able to facilitate leucocyte

attachment and interactions with cells from the trigger tissue, an area of the

neuron that contains a high membrane concentration of voltage-gated Na+

channels. A significantly higher ICAM-1 expression was observed in the

cytoplasm of Schwann cells (Fig. 6A), compared with the control nerve samples,

in which no staining was identified (Fig. 6B). Immunohistochemical staining for

VEGF was positive in 9/10 of the VS cases(Fig. 7A). A positive expression of

VEGF was observed in the tumor samples. VEGF exhibited finely granular

cytoplasmic staining in the Schwann cells with intensified focal staining in the

perinuclear region. There was only a small variation of staining within the

tissues of individual tumors. Staining for VEGF also occurred in the cytoplasm of

138

endothelial cells and in polymorphonuclear leukocytes within vessels. These

data confirm that VEGF may have a significant impact on the growth VSs,

stimulating the mitogenic activity of Schwann cells and angiogenesis in these

tumors. VEGF immunoreactivity was absent in the control nerve samples (Fig.

7B).

Statistical analysis of growth factors and cytokines expres-

sion

The intensity of staining for TGF-β1, TNF-α, IL-1β, IL-6 and VEGF in human VS

and control nerve samples is shown in Table I. The percentage values of

pro-inflammatory cytokine-positive cells and P-values are also shown in Fig. 8.

Discussion

VSs are rare and slow-growing neoplasms, which occur as a result of increased

proliferation of Schwann cells of the vestibular branch of the eighth cranial

nerve. The tumors generally originate near the myelin-glial junction, close to

the internal auditory canal (22). Neoplastic growth appears to rely upon

cytokines, which possess angiogenic and mitogenic properties. Limited data

concerning the expression of growth factors and its implication on VS growth

are available. The aim of the present study was to investigate the role of

certain pro-inflammatory cytokines in sporadic VS, associated with angiogenesis

and tumor growth. The mechanisms underlying schwannoma development,

growth and growth arrest remain to be elucidated. In order to develop an

improved understanding of the mechanisms responsible for the growth of these

neoplasms, associations between an abnormal proliferation of Schwann cells

and the expression of certain inflammatory cytokines were investigated.

Although VSs are relatively slow-growing neoplasms, their continued growth

depends on a functional vascular system, as with any other tumor (23). The

positive expression of VEGF in VS specimens suggests that angiogenesis is

involved in facilitating the growth of this tumor. Indeed, angiogenesis is a

139

prerequisite for the proliferation and progression of a number of neoplasms

(23). Despite the evidence suggesting that VS are generally slow-growing

tumors, and therefore do not require excessive vascularization, the presence of

a functional vascular system remains paramount for tumor development. The

results of the present study have revealed a marked expression of VEGF in the

cytoplasm of Schwann cells and in vascular endothelial cells from neoplastic

peripheral nerves. The present findings confirm that VEGF expression may be

involved in the development and expansion of benign tumors as well as

malignant ones. In addition to its role as an angiogenic factor, VEGF also

possesses neurotrophic and neuroprotective properties in the peripheral and

central nervous system, which exert a direct action not only on neurons, but

also on Schwann cells (24). The mechanisms responsible for an inflammatory

reaction in VS required further elucidation. Inflammation contributes to tumor

progression by stimulating the angiogenic process and providing neoplastic cells

with growth factors. VEGF and TGF-β1 have are putative key mediators of VS

growth (25). Overexpression of TGF-β1 increases the invasiveness of neoplastic

cells by increasing their proteolytic activity and promoting their binding to cell-

adhesion molecules (26). Previous animal studies have identified TGF-β1 as a

potent mitogen for Schwann cells. It has also previously been reported that

Schwann cells secrete and activate the latent form of TGF-β1 (27), thereby

stimulating the proliferation of Schwann cells. TGF-β1 has been hypothesized to

be involved in the regulation of peripheral nerve tumors by modulating cell

proliferation and differentiation, by different mechanisms from those of glial

growth factors and fibroblast growth factor, which are responsible for the

mitogenic activity of Schwann cells (28,29). The results of the present study

suggested that TGF-β1 may be affect tumor progression by indirectly

stimulating angiogenesis through the upregulation of VEGF expression in VS.

Cytokines are the primary mediators of communication between cells in the

inflammatory tumor micro-environment. It has been established that neoplastic

cells express pro-inflammatory mediators, including cytokines, such as TGF-β1,

IL-6, IL-1β and TNF-α (30). TNF-α is known to be a major mediators of

inflammation; in addition, TNF-α was reported to be produced by tumors and to

140

function as an endogenous tumor promoter. TNF-α has been associated with

numerous processes involved in tumorigenesis, including cellular trans-

formation, promotion, survival, proliferation, invasion, angiogenesis and

metastasis (31). TNF-α upregulates ICAM-1 on the Schwann cell surface,

suggesting that these cells also carry functional TNF-α receptors (32). While

TNF-α is toxic to numerous types of cell, it is not injurious to cultured Schwann

cells (33). However, it does inhibit unstimulated cell proliferation and

connexin46 expression (34). In the present study, it was identified that

moderate expression of TNF-α in the cytoplasm of Schwann cells was

predominantly localization in AntoniA regions, while this cytokine was

completely absent in normal vestibular nerve samples. The cytotoxic or

protective effects of TNF-α depend on its receptor, cell type and the presence

of other factors. To date, two types of cell surface receptors for TNF-α have

been identified: TNFRI (p55) and TNFRII (p75) (35). Activation of TNFRII

receptor results in a complex signalling pathway involving numerous other TNF-

receptor-activated proteins (36,37). Receptor signaling, via this pathway,

triggers the proteolysis of cytoplasmic protein IκB, which, in turn, allows

translocation of the nuclear transcription factor nuclear factor-κB (38). This has

been observed to lead to apoptosis in specific cell types, whilst it is protective in

others (39). In the present study, TNF-α appeared to induce a protective effect

in Schwann cells, possibly as a result of the presence on the cellular surface of

TNFRII. IL-1β, secreted by neoplastic cells or infiltrating leukocytes, is involved

in increasing tumor adhesion, invasion, angiogenesis and immune suppression

(40). The results of the present study demonstrated that VS is associated with

elevated expression of IL-6 and VEGF, indicating that IL-6 is a possible

mediator of the association between VS and systemic inflammatory responses

in patients with this disease. Interleukin-6 is involved in peripheral nerve

regeneration (41). However, the molecular mechanisms underlying IL-6

function in Schwann cell physiology are yet to be elucidated. The induction of

proinflammatory genes by IL-6 in Schwann cells may indicate that IL-6 is

involved in the degeneration of the injured nerve, in association with other

inflammatory cytokines, including TNF-α. IL-6 may facilitate the demyelination

141

of peripheral nerves following nerve injury, and appears to induce degenerative

changes in Schwann cells following nerve injury and to activate

proinflammatory signals in Schwann cells (42). The majority of IL-6 target

genes are involved in cell cycle progression and in the suppression of apoptosis,

which emphasizes the importance of IL-6 in tumorigenesis (43). Accordingly,

cytokines, including TNF-α and IL-1β, are emerging as putative targets for

anticancer therapies (44). Specific inhibition of pro-inflammatory mediators,

including TNF-α, IL-6, TGF-β1 and IL-1β, may lead to a reduction in tumor

development and inhibition of transcription associated with the inflamma-

toryprocess. TNF-α, IL-6, TGF-β1 and IL-1β have been shown to upregulate

adhesion molecules, such as ICAM-1, in human Schwann cells. In the present

study, ICAM-1 was observed to be highly expressed in VS samples and its

expression was associated with tumor size and the inflammatory process.

Cellular immunity against tumor cells requires the presence of adhesion

molecules, such as ICAM-1 on the endothelial surface, which mediate the arrest

of leukocytes (16). The induction of the expression of ICAM-1 in Schwann cells

by pro-inflammatory cytokines suggests a possible role for adhesion molecules

in the pathogenesis of inflammation in the peripheral nerve. The absence of

immunoreactivity observed in the control specimens indicates that the

hyperexpression of growth factors and cytokines is associated with tumor devel-

opment or inflammatory conditions. The current findings suggested that chronic

inflammation, through its promotion of angiogenesis, is involved in tumor

progression. Angiogenesis appears to be important for the induction of growth

of VS as well as the growth of other neoplasms, including glioblastoma in

children (45) and primary or metastatic breast cancer (46). Numerous previous

studies have reported a significant correlation between the concentration of

VEGF and VEGFR-1 expression in VS, and tumor growth rate, but did not

describe symptom duration or tumor size (47-49). The present findings

confirmed the expression of VEGF, with cytoplasmic localization, in VS samples.

Previous experiments in nude mice injected with malignant tumor cells have

demonstrated that intravenous infusion of anti-VEGF monoclonal antibodies

reduces the growth of tumors by up to 96% (50). The anti-VEGF therapy was

142

directed toward the suppression of VEGF or its receptors. This treatment, based

on the inhibition of VEGF and its receptors, may be a potential option with

which to counteract the development of VS. Additional studies on the

involvement of chronic inflammatory processes in the development of VS are

required. The first stage may be to further identify the inflammatory cells

present in VS. Furthermore, their activation and association with angiogenic

growth factors should be examined. VS cells produce and secrete

pro-inflammatory cytokines, which may act in an autocrine manner, stimulating

cellular proliferation. The potential use of novel therapeutic approaches based

on the combined administration of inhibitors of proinflammatory cytokines and

VEGF may hold promise for the development of therapies for neoplastic

diseases involving the peripheral nervous system. In conclusion, the present

study demonstrated that the development of synthetic inhibitors of growth

factors may potentially reduce the recurrence rate of VS and enable non-

surgical management of this disease. Additional clinical and experimental

investigations are necessary to clarify the biological role of these molecules in

the development and progression of this type of neoplasm.

143

References

1. McDonaldR: Acoustic neuroma: what the evidence says about evaluation

and treatment. J Fam Pract60: E1-E4, 2011.

2. Celis-AguilarE, LassallettaL, Torres MartinM, RodriguesFY, NistalM,

CastresanaJS, etal: The molecular biology of vestibular schwannomas and its

association with hearing loss: a review. Genet Res Int2012: 856157, 2012.

3. BondiS, LimardoP, TomaS and BussiM: Non-vestibular head and neck

schwannomas: a 10-year experience. EurArch Otorhinolaryngol270: 2365-2369,

2013.

4. van LeeuwenJP, CremersCW, ThewissenNP, HarhangiBS and MeijerE:

Acoustic neuroma: correlation among tumor size, symptoms, and patient age.

Laryngoscope105: 701-707, 1995.

5. CarrollSL: Molecular mechanisms promoting the pathogenesis of Schwann

cell neoplasms. Acta Neuropathol123: 321-348, 2012.

6. KlenkeC, WideraD, SepehrniaA, MoffatDA, KaltschmidtC, KaltschmidtB,

EbmeyerJ and SudhoffH: Clinical and biological behaviour of vestibular

schwannomas: signalling cascades involved in vestibular Schwannoma resemble

molecular and cellular mechanisms of injury-induced Schwann cell dedifferen-

tiation. Head Neck Oncol16: 20, 2013.

7. MirskyR, ParmantierE, McMahonAP and JessenKR: Schwann cell-derived

desert Hedgehog signals nerve sheath formation. Ann NY Acad Sci883: 196-

202, 1999.

8. ChenZL and StricklandS: Laminin gamma1 is critical for Schwann cell

differentiation, axon myelination, and regeneration in the peripheral nerve. JCell

Biol163: 889-899, 2003.

9. WeerdaH, GambergerTI, SiegnerA, GjuricM and TammER: Effects of

transforming growth factor-β1 and basic fibroblast growth factor on

proliferation of cell cultures derived from human vestibular nerve schwannoma.

ActaOtolaryngol118: 337-343, 1998.

144

10. DiensthuberM, BrandisA, LenarzT and StoverT: Co-expression of

transforming growth factor-β1 and glial cell line-derived neurotrophic factor in

vestibular schwannoma, OtolNeurotol25: 359-365, 2004.

11. LöttrichM, MawrinC, ChamaonK, KirchesE, DietzmannK, and FreigangB:

Expression of transforming growth factor-beta receptor type 1 and type 2 in

human sporadic vestibular Schwannoma. Pathol Res Pract203: 245-249, 2007.

12. WagnerR and MyersRR: Schwann cells produce tumor necrosis factor

alpha: expression in injured and non-injured nerves. Neuroscience73: 625-629,

1996.

13. WangY, TangX, YuB, GuY, YuanY, YaoD, DingF and GuX: Gene network

revealed involvements of Birc2, Birc3 and Tnfrsf1a in anti-apoptosis of injured

peripheral nerves. PloS One7: e43436, 2012.

14. LeeHK, SeoIA, SuhDJ, HongJI, YooYH and ParkHT: Interleukin-6 is

required for the early induction of glial fibrillary acidic protein in Schwann cells

during Wallerian degeneration. JNeurochem108: 776-786, 2009.

15. BolinLM, VerityAN, SilverJE, ShooterEM and AbramsJS: Interleukin-6

production by Schwann cells and induction in sciatic nerve injury.

JNeurochem64: 850-858, 1995.

16. ConstantinG, PiccioL, BussiniS, PizzutiA, ScarpiniE, BaronP, ContiG, PizzulS

and ScarlatoG: Induction of adhesion molecules on human Schwann cells by

proinflammatory cytokines, an immunofluorescence study. JNeurol Sci170: 124-

130, 1999.

17. BevilacquaMP: Endothelial-leukocyte adhesion molecules. Annu Rev

Immunol11: 767-804, 1993.

18. MøllerMN, WertherK, NallaA, StangerupSE, ThomsenJ, Bøg-HansenTC,

NielsenHJ and Cayé-ThomasenP: Angiogenesis in vestibular schwannomas:

expression of extracellular matrix factors MMP-2, MMP-9 and TIMP-1.

Laryngoscope120: 657-662, 2010.

19. FerraraN, GerberHP and LeCouterJ: The biology of VEGF and its receptors.

Nat Med9: 669-676, 2003.

20. Bancroft JD and Gamble M(eds): Theory and Practice of Histological

Techniques. 6th edition. Churchill Livingstone Elsevier, London, 2008.

145

21. Joshi R: Learning from eponyms: Jose Verocay and Verocay bodies, Antoni

A and B areas, Nils Antoni and Schwannomas. Indian Dermatol Online J. 3:

215-219, 2012.

22. CharabiS: Acoustic neuroma/vestibular schwannoma invivo and invitro

growth models. A clinical and experimental study. Acta Otolaryngol Suppl530:

1-27, 1997.

23. FolkmanJ: Tumor angiogenesis: therapeutic implications. NEngl J Med285:

1182-1186, 1971.

24. NamiecińskaM, MarciniakK and NowakJZ: VEGF as an angiogenic

neurotrophic, and neuroprotective factor. Postepy Hig Med Dosw (Online) 59:

573-583, 2005 (InPolish).

25. KramerF, StöverT, WameckeA, DiensthuberM, LenarzT and WisselK: BDNF

mRNA expression is significantly upregulated in vestibular schwannomas and

correlates with proliferative activity. J Neurooncol98: 31-39, 2010.

26. MaeharaY, KakejiY, KabashimaA, EmiY, WatanabeA, AlkazawaK, BabaH,

KohnoeS and SugimachiK: Role of transforming growth factor-beta 1 in invasion

and metastasis ingastric carcinoma. J Clin Oncol17: 607-614, 1999.

27. RidleyAJ, DavisJB, StroobantP and LandH: Transforming growth factors-

beta 1 and beta 2 are mitogens for rat Schwann cells. J Cell Biol109: 3419-

3424, 1989.

28. LemkeGE and BrockesJP: Identification and purification of glial growth

factor. J Neurosci4: 74-83, 1984.

29. RatnerN, BungeRP and GlaserL: Schwann cell proliferation invitro. An

overview. Ann NY Acad Sci486: 170-181, 1986.

30. CandidoJ and HagemannT: Cancer-related inflammation. JClin Immunol33:

S79-S84, 2013.

31. Sethi G, Sung B and Aggaewal BB: TNF: a master switch for inflammation

to cancer. Front Biosci13: 5094-5107, 2008.

32. LisakRP and BealmearB: Upregulation of intercellular adhesion molecule-1

(ICAM-1) on rat Schwann cells invitro: comparison of interferon-gamma, tumor

necrosis factor-alpha and interleukin-1. J Peripher Nerv Syst2: 233-243, 1997.

146

33. MithenF, ColburnS and BirchemR: Human alpha tumor necrosis factor does

not damage cultures containing rat Schwann cells and sensory neurons.

Neurosci Res9: 59-63, 1990.

34. ChandrossKJ, SprayDC, CohenRI, KumarNM, KremerM, DermietzelR and

KesslerJA: TNF-alpha inhibits Schwann cell proliferation, connexin46 expression

and gap junctional communication. Mol Cell Neurosci7: 479-500, 1996.

35. UrenAG and VauxDL: Molecular and clinical aspects of apoptosis.

Pharmacol Ther72: 37-50, 1996.

36. Nagano K, Alles N, Mian AH, etal: The tumor necrosis factor type 2

receptor plays a protective role in tumor necrosis factor-α-induced bone

resorption lacunae on mouse calvariae. JBone Miner Metab29: 671-681, 2011.

37. Tracey D, Klareskog L, Sasso EH, Salfeld JG and Tak PP: Tumor necrosis

factor antagonist mechanism of action: a comprehensive review. Pharmacol

Ther117: 244-279, 2008.

38. BakerSJ and ReddyEP: Transducers of life and death: TNF receptor

superfamily and associated proteins. Oncogene12: 1-9, 1996.

39. BegAA and BaltimoreD: An essential role for NF-kappaB in preventing TNF-

alpha-induced cell death. Science274: 782-784, 1996.

40. ColottaF, AllavenaP, SicaA, GarlandaC and MantovaniA: Cancer-related

inflammation, the seventh hallmark of cancer: links to genetic instability.

Carcinogenesis30: 1073-1081, 2009.

41. ZhongJ, DietzelID, WahleP, KopfM and HeumannR: Sensory impairments

and delayed regeneration of sensory axons in interleukin-6-deficient mice. J

Neurosci19: 4305-4313, 1999.

42. LeeHK, WangL, ShinYK, LeeKY, SuhDJ and ParkHT: Interleukin-6 induces

proinflammatory signaling in Schwann cells: a high-throughput analysis.

Biochem Biophy Res Commun382: 410-414, 2009.

43. HauraEB, TurksonJ and JoveR: Mechanisms of disease: insights into the

emerging role of signal transducers and activators of transcription in cancer.

Nat Clin Pract Oncol2: 315-324, 2005.

44. KlampferL: Cytokines, inflammation and colon cancer. Curr Cancer Drug

Targets11: 451-464, 2011.

147

45. Artico M, Cervoni L, Celli P, Salvati M and Palma L: Supratentorial

glioblastoma in children a series of 27 surgically treated cases. Childs Nerv

Syst9: 7-9, 1993.

46. Gobbi G, Mirandola P, Micheloni C, etal: Expression of HLA class I antigen

and proteasome subunits LMP-2 and LMP-10 in primary vs. metastatic breast

carcinoma lesions. Int J Oncol25: 1625-1629, 2004.

47. Cayé-ThomasenP, WertherK, NallaA, etal: VEGF and VEGF receptor-1

concentration in vestibular schwannoma homogenates correlates to tumor

growth rate. Otol Neurotol26: 98-101, 2005.

48. Brieger J, Bedavanija A, Lehr HA, Maurer J and Mann WJ: Expression of

angiogenic growth factors in acoustic neurinoma. Acta Otolaryngol123: 1040-

1045, 2003.

49. Koutsimpelas D, Bjelopavlovic M, Yetis R, etal: The VEGF/VEGFR axis in

sporadic vestibular schwannoma correlates with irradiation and disease

recurrence. ORL J Otorinilaryngol Relat Spec74: 330-338, 2012.

50. KimKJ, LiB, WinerJ, etal: Inhibition of vascular endothelial growth factor-

induced angiogenesis suppresses tumour growth invivo. Nature362: 841-844,

1993.

148

Figure 1. H&E staining of human healthy vestibular nerve and schwannoma

samples. (A) H&E staining of a control nerve section revealed nuclei of Schwann

cells in the endoneurium, which also contained several fibroblasts. (B) H&E

staining of vestibular schwannoma section that exhibited Verocay Bodies

(AntoniA regions), consisting of spindle cells arranged in bundles with elongated

nuclei (indicated by *). Magnification, x20. H&E, hematoxylin and eosin.

Figure 2. Immunohistochemical analysis of human healthy vestibular nerve

and schwannoma samples for TGF-β1. (A) TGF-β1 expression in vestibular

schwannoma tissue section revealed a cytoplasmic localization in Schwann cells.

Immunoreactivity was increased in AntoniA areas (*) compared with AntoniB

regions (◄). TGF-β1 reactivity was also observed in the endothelial cells of the

blood vessels distributed in the endoneurium ( ). (B) Immunoreactivity for

TGF-β1 was not detected in the control samples. Magnification, x40. TGF-β1,

transforming growth factor-β1.

149


and schwannoma samples for TNF-α. (A) TNF-α immunoreactivity in vestibular

schwannoma tissue section revealed a weak expression in the blood vessel wall

and in AntoniA andB regions. In addition, AntoniA regions exhibited the same

immunoreactivity as that in the nuclei of Schwann cells ( ). (B) Absence of TNF-

α expression in the control samples was observed. Magnification, x20. TNF-α,

tumor necrosis factor-α.


and schwannoma samples for IL-1β. (A) IL-1β immunoreactivity in vestibular

schwannoma tissue section revealed marked expression in the AntoniA andB

regions. This expression was localized in the cytoplasm of Schwann cells.

Moderate immunoreactivity was observed in vascular endothelium. (B) No

immunoreactivity for IL-1β in Schwann cells and blood vessels was detected in

the control samples. Magnification, x40. IL-1β, interleukin-1β.

150


and schwannoma samples for IL-6. (A) IL-6 immunoreactivity in vestibular

schwannoma tissue section revealed weak cytoplasmic expression in Schwann

cells. (B) No immunoreactivity for IL-6 in the cytoplasm of Schwann cells was

detected in the control samples. Magnification, x40. IL-6, interleukin-6.


and schwannoma samples for ICAM-1. (A) Immunoreactivity for ICAM-1 in

vestibular schwannoma tissue sections revealed marked expression in the

cytoplasm of Schwann cells. (B) No immunoreactivity for ICAM-1 was observed

in the control samples. Magnification, x40. ICAM-1, intracellular adhesion

molecule-1.

151

Figure 7. Immunohistochemical analysis for VEGF in human normal vestibular

nerve and schwannoma samples. (A) VEGF immunoreactivity was observed as a

marked granulated cytoplasmic stain in Schwann cells obtained from the

vestibular schwannoma tissue sections. Positive staining was also detected in

vascular endothelium of neoplastic tissue. (B) VEGF immunoreactivity was

absent in the control samples. Magnification, x40. VEGF, vascular endothelial

growth factor.

Table I. Levels of cytokines and growth factors in vestibular schwannoma

tissue samples and in healthy vestibular nerve samples, and corresponding

statistical significance (t-test).

152

Figure 8. Histogram indicating the percentage of growth factor expression in

the vestibular schwannoma cells compared with control tissue. The data

underline the differences between the expression of these factors in the two

different specimens: Black=schwannoma samples; white=control samples. All

differences between the vestibular schwannoma and control samples were

statistically significantly(P<0.001). TGF-1, transforming growth factor-1; TNF-α,

tumor necrosis factor-α; IL, interleukin; ICAM-1, intracellular adhesion

molecule-1; VEGF, vascular endothelial growth factor.

153

Chapter 7

Involvement of pro-inflammatory

cytokines and growth factors in the

pathogenesis of the Dupuytren’s

contracture: a novel target for a possible

future therapeutic strategy?

E. Bianchi1, S. Taurone1, L. Bardella2, A. Signore3,

E. Pompili4, V. Sessa5, C. Chiappetta6, L. Fumagalli4,

C. Di Gioia7, F.S. Pastore8, S. Scarpa9, and M. Artico1

1Dept. of Sensory Organs, “Sapienza” University of Rome, Rome. 2Dept. of

Neurology and Psychiatry, “Sapienza” University of Rome. 3Dept. of Oncological

Sciences, S. Andrea Hospital, “Sapienza” Univ. of Rome. 4Dept. of Anatomical,

Histological, Forensic and Locomotor System Sciences, “Sapienza” Univ. of

Rome. 5Division of Orthopedics, S. Giovanni Calibita Fatebenefratelli Hospital,

Rome. 6Dept. of Medical-Surgical Sciences and Biotecnologies,“Sapienza”

University of Rome. 7Dept. of Radiology, Oncology and Pathology, “Sapienza”

University of Rome. 8Dept. of Systems Medicine, “Tor Vergata” University of

Rome. 9Dept. of Experimental Medicine, “Sapienza” University of Rome.

Clinical Science 2015; 129 (8): 711-720

Key words: IHC - Dupuytren’s contracture – myofibroblasts – cytokines -

growth factors

154

Abstract

Dupuytren’s contracture (DC) is a benign fibroproliferative disease of the hand

causing fibrotic nodules and fascial cords which determine debilitating

contracture and deformities of fingers and hands. The present study was

designed to characterize pro-inflammatory cytokines and growth factors

involved in the pathogenesis, progression and recurrence of this disease, in

order to find novel targets for alternative therapies and strategies in controlling

DC. The expression of pro-inflammatory cytokines and of growth factors was

detected by immunohistochemistry in fibrotic nodules and normal palmar fascia

resected respectively from patients affected by Dupuytren's contracture and

Carpal Tunnel Syndrome (as negative controls). RT-PCR analysis and

immunofluorescence were performed to quantify the expression of TGF-β1, IL-

1β and VEGFa by primary cultures of myofibroblasts and fibroblasts isolated

from Dupuytren's nodules. Histological analysis showed high cellularity and high

proliferation rate in Dupuytren’s tissue, together to the presence of

myofibroblastic isotypes; immunohistochemical staining for macrophages was

completely negative. In addition, a strong expression of TGF-β1, IL-1β and

VEGFa was evident in the extracellular matrix and in the cytoplasm of

fibroblasts and myofibroblasts in Dupuytren’s nodular tissues, as compared to

control tissues..These results were confirmed by RT-PCR and by

immunofluorescence in pathological and normal primary cell cultures. These

preliminary observations suggest that TGF-β1, IL-1β and VEGFa may be

considered potential therapeutic targets in the treatment of Dupuytren's

disease.

Introduction

Dupuytren’s disease (DD) has been defined as a benign progressive

proliferative fibroplasia of the fascia palmaris of the hand, which results in

contracture of the fingers leading to reduction in the movement and inability to

155

extend them [1]. The pathogenesis of DD still remains unclear; the stages of

the fibrotic disease are classified as proliferative, involutional, and residual on

the basis of the histological appearance of the affected fascia palmaris [2]. The

proliferative phase is characterized by proliferation and differentiation of

fibroblasts into myofibroblasts under the influence of several different factors,

causing formation of the nodules [3, 4]. In the second phase, the involutional

stage, myofibroblasts proliferate and align along the long axis of surrounding

collagens bundles thus giving way to the formation of fibrotic cords [5]. Finally,

in the residual phase, the myofibroblasts are replaced by fibrocytes that

progressively decrease in number causing the formation of the avascular

collagen cord [2]. Myofibroblasts seem to play a central role in the

pathogenesis of the fibrotic disease. These cells show an intermediate

phenotype between fibroblasts and smooth muscle cells and generate the

forces responsible for palmar fascia contracture [6]. Myofibroblasts are

responsible for matrix deposition and consequent contraction in Dupuytren’s

disease. Many growth factors and cytokines seem to be implicated in the

etiology of Dupuytren’s contracture, among all transforming growth factor beta

(TGF-β) has been suggested to play a predominant role [7]. TGF-β is

responsible for the up-regulation of collagens and also of other extracellular

matrix components, all fundamental for connective tissue remodeling [8]. TGF-

β transduces a signal through an heteromeric complex for formation of related

type I and type II transmembrane serine/threonine kinase receptors [9]; the

signal of the activated type I receptor induces SMAD signaling cascade and the

heteromeric SMAD complexes (SMAD2/3-SMAD4) accumulated in the nucleus

regulate the expression of a large array of target genes involved in

myofibroblast proliferation, differentiation and extracellular matrix synthesis

[10-11]. Several studies have identified pro-inflammatory cytokines in

Dupuytren’s tissues, but the molecular mechanisms by which inflammatory

mediators activate myofibroblast differentiation are still unknown [12]. Il-6 is

involved in the modulation of TGF-β and its receptor TGF-βRII, inducing then

fibroblasts proliferation [13]. TNF-α is another central mediator of the fibrotic

process, similar to TGF-β [14]: it has been identified as a mediator involved in

156

the differentiation of fibroblasts into myofibroblasts in the palm of patients

affected by Dupuytren’s disease, via activation of Wnt signaling pathway [15].

TNF-α may directly regulate TGF-β1 expression, as shown in lung fibroblasts

[16]. Yet, hypoxia and subsequent angiogenesis seem to play a role in the

pathophysiology of this disease [17]. Angiogenesis is induced by several growth

factors, but the most important molecule is vascular endothelial growth factor

(VEGF), also known as vascular permeability factor [18]. Hypoxia activates the

transcription of hypoxia-inducible factor alpha (HIF-1α), which itself positively

regulates VEGF synthesis [19]. All these findings prompted us to investigate

the structural alterations of the fibromatous palmar fascia in patients affected

by Dupuytren’s contracture and to analyze expression and localization of the

previously described growth factors in surgical samples of palmar aponeurosis.

In parallel, immunofluorescence and RT-PCR analysis were conducted on

primary cultures of fibroblasts and myofibroblasts explanted from Dupuytren’s

nodules in the proliferative or involutional phases.


Tissue samples were obtained from 26 patients (22 males and 4 females, mean

age 58 years, mean duration of clinical history 2,5 years) undergoing surgical

dermo-fasciectomy for Dupuytren’s contracture (n=18) and Carpal Tunnel

Syndrome (n=8, as negative controls). Pathological tissues were sampled from

areas of Dupuytren's nodules (4 specimens for each nodule). Control samples

(2 specimens for each tissue fragment), characterized by normal palmar fascia

tissues, were collected from patients undergoing hand surgery for Carpal

Tunnel Syndrome (CTS). During excision, apart from anesthesia, no other

chemical products or pharmaceutical drugs have been administered. All samples

were collected with the informed consent of the patient and the study protocol

conformed to the ethical guidelines of the 1975 Declaration of Helsinki.

Experiments were performed in compliance with the Italian laws and guidelines

concerning the patients’ written informed consent. The Ethics Committee of the

Policlinico Umberto I Hospital approved our study according to European

157

Community and Italian laws.

Samples (72 from DD and 16 from control patients) were fixed in formalin and

embedded in paraffin to be processed for histological staining and

immunohistochemistry. The sections were subjected to Hematoxylin & Eosin

and Masson’s Trichrome staining. In parallel, other tissue samples were used to

obtain primary cultures of pathological and normal fibroblasts.


The immunohistochemical analysis was conducted using the ABC/HRP

technique (avidin complexed with biotinylated peroxidase) on 4 µm thick

paraffin sections that were cut using a rotative microtome. These sections were

deparaffinized and hydrated through decreasing ethanol series to distilled

water, then subjected to microwave irradiation and immersed in citrate buffer

(pH = 6) twice for 5 minutes each time. Subsequently, endogenous peroxidase

activity was quenched using 0.3% hydrogenous peroxide in methanol for 30

minutes. To evaluate the immunolocalization of pro-inflammatory factors, VEGF,

marker of myofibroblasts and proliferating cell nuclear antigen (PNCA), the

following antibodies were employed: mouse anti-αSMA monoclonal antibody

(Leica, USA 1:100); rabbit anti-TGF-β1 polyclonal antibody (Santa Cruz, CA,

USA 1:200); rabbit anti-IL1β polyclonal antibody (Santa Cruz, CA, USA 1:100);

rabbit anti-IL6 polyclonal antibody (Santa Cruz, CA, USA 1:50); mouse anti-

VEGFa monoclonal antibody (Santa Cruz, CA, USA 1:100); mouse anti-TNF-

alpha monoclonal antibody (Santa Cruz, CA, USA 1:200); mouse anti-ICAM-1

monoclonal antibody (Santa Cruz, CA, USA 1:25) and mouse anti-PNCA

monoclonal antibody (Santa Cruz, CA. USA 1:100).

Incubation with the primary antibodies was performed overnight at 4ºC.

Optimal antibody dilution and incubation times were assessed in preliminary

experiments. As negative control, the primary antibodies were omitted. After

exposure to the primary antibodies all slides were rinsed twice in phosphate

buffer (pH=7.4) and incubated for 1 hour with the appropriate secondary

biotinylated antibody at the final dilution of 1:200. The secondary biotinylated

antibodies against rabbit and mouse immunoglobulins were purchased from

158

Abcam (biotinylated goat anti-mouse antibody and biotinylated goat anti-rabbit

antibody). The slides were then incubated with peroxidase-conjugated avidin

(Vector laboratories, Burlingame, CA, USA, Vectastain Elite ABC kit Standard*PK

6-100) for 30 min. Slides were washed in phosphate buffer (pH=7.4) and

treated with 0.05% 3,3-diaminobenzidine (DAB) and 0.1% H2O2. Finally,

sections were counterstained with Mayer’s hematoxylin and dehydrated rapidly.

The staining assessment was made by three experts. The intensity of the

immune reaction was assessed microdensitometrically using an IAS 2000 image

analyzer (Delta Sistemi, Rome, Italy) connected via a TV camera to the

microscope. Twelve 100 µm2 areas were delineated in each section by

measuring the diaphragm. The system was calibrated taking the background

obtained in sections exposed to non-immune serum as zero. Quantitative data

of the intensity of immune staining were analyzed statistically by analysis of

variance (ANOVA) followed by Dunca’s multiple range test as a post hoc test.

The comparison of the expression levels of each antigen between the palmar

fascia from Dupuytren’s disease and CTS patients was carried out by Student’s

t-test. Statistical analysis was performed using the GraphPad Prism (La Jolla,

CA). The results were considered statistically significant with p-value <0.05.

Cells Cultures

Dupuytren’s nodule tissues and normal palmar fascia tissues from CTS patients

were obtained by surgery. All samples were minced using a sterile technique

and placed in sterile 30 mm single well culture dishes. The wells were then

flooded with 2.0 ml of Dulbecco’s essential medium (DMEM, Gibco, Grand

Island, NY) containing 4% penicillin/streptomycin (PS, Gibco, Grand Island, NY)

and 10% fetal bovine serum (FBS, Gibco, Grand island, NY). The media was

renewed three times weekly. Cells were observed adhering to the bottom of the

wells and were allowed to grow to confluence. The cells were lifted from the

wells using Trypsin/EDTA, pelleted, washed and re-suspended in DMEM with

10% FBS and 4% penicillin/streptomycin. Four cell strains were used in these

experiments (4 from DD patients and 4 from control patients) and sub-cultured

by less than 10 passages. These primary cultures of pathological and normal

159

cells were used for establishing protein and mRNA expression of specific pro-

inflammatory factors and VEGF by immunofluorescence and RT-PCR.

Immunofluorescence

For immunofluorescence fibroblast primary cultures were grown directly on

Labteck chamber slides (Nunc) for at least 24 h, the cells were then washed

with PBS with Ca/Mg, and fixed with 4 % buffered paraformaldehyde for 20 min

at 4 °C. Fixed cells were incubated overnight at 4°C with the primary antibody

for α-SMA, TGFβ1, IL1β, IL6, TNF-α and VEGFa. After three washes in 0.1%

Tween in PBS for 10 min each, the cells were incubated with the secondary

antibody, anti-mouse-fluorescein antibody (Abcam USA (MA) 1:200) or anti-

rabbit– rhodamine antibody (Abcam USA (MA), 1:200) for 2 hours at room

temperature. The nuclei were stained with DAPI (Vectashield Mounting Medium

with DAPI, Vector Laboratories, Burlingame, CA, USA). The

immunofluorescence was examined by confocal laser microscope (Nikon

TE2000). Student’s t-test was used to evaluate the expression of each

analyzed antigen in DD and control cells. The data were considered statistically

significant with p-value <0.05.

RT-PCR

Cultured cells were suspended in TRIzol reagent (Invitrogen Corporation, CA)

and total RNA was isolated using RNeasy Micro Kit (Qiagen, CA, USA). Real time

PCR was conducted to determine the differences in mRNA expression levels of

TGF-β1, IL-1β and VEGFa between normal and pathological fibroblasts in

culture. The purity of the RNA was assessed using a UV/visible spectophotomer

(SmartSpec 3000, Bio-Rad Laboratories, CA, USA). 1 µg total RNA was reverse

transcribed using a High Capacity cDNA Reverse Transcription (RT) kit (Applied

Byosystems, CA, USA) according to the manufacturer’s instructions. RNA

samples, RT buffer, dNTP mix, RT random primers, multiscribe reverse

transcriptase, RNase inhibitor and DEPC-treated distilled water were added in

RNase-free tubes on ice at the final volume of 20 µl. The thermal cycler was

programmed as follows: 25ºC for 10 min, 37ºC for 120 min and the reaction

160

was stopped at 85ºC for 5 min. For the RNA reactions we used the follow

primer pairs (Bio Basic In, NY, USA): for TGF-β1 primer forward 5’-

GCTGGACAGGAAGCTGGG-3 and primer reverse 5’-GGACACAACACGAGCAGAGA-

3’, for IL-1β primer forward 5’-GCTTCTGGTGATTCCCGCAA-3’ and primer

reverse 5’- GGGCTGTGAGAGTTCTTGGG-3’, for VEGFa primer forward 5’-

AACCCCTAGGCCAGGTTGTA-3’ and primer reverse 5’-

CGGGATATGGAAGGGAAGCC-3. For glyceraldehyde 3 phosphate dehydrogenase

(GAPDH) we used primer forward 5’-GAGCAGTCCGGTGTCACTAC-3' and primer

reverse 5’-TAGTAGCCGGGCCCTACTTT-3’. The specificity of the primers was

verified by searching in the NCBI database for possible homology to the cDNA

of unrelated proteins. Each PCR tube contained the following reagents at the

final volume of 50 µl: 0.2 µM of forward and reverse primers, 1 µg template

cDNA, 0.2 mM dNTP mix, 2.5 U RedTaq Genomic DNA polymerase (Sigma-

Aldrich), MgCl2 and reaction buffer 1X. The amplification was started with an

initial denaturation step at 94°C (2 minutes) and was followed by 35 cycles

consisting of denaturation (30 seconds) at 94°C, annealing (30 seconds) at the

appropriate temperature for each primer pair and extension at 72 °C (1

minute). Using the comparative critical cycle methods, the expression levels of

the target genes were normalized to the GAPDH endogenous control. Data

were analyzed using the 7900 HT SDS software version 2.1 provided by applied

Biosystems. Statistical analysis was performed using Student’s t-test (GraphPad

Prism). The results were considered statistically significant when the p-value

was <0.05.

On the basis of these experiments we observed that TGF-β1 mRNA expression

was the most significant among the examined molecules, so we performed Real

Time PCR on paraffinized tissue in order to confirm mRNA expression data

obtained from cell cultures. For this last procedure we used the same number

of specimens as before (4 from DD patients and 4 from control patients). Real

Time PCR was performed with the same protocol employed in previously

described PCR.

161

Results

The rate of cell proliferation was first evaluated in Dupuytren’s tissues, by

analyzing the cellular proliferation marker known as Proliferating Cell Nuclear

Antigen (PCNA). Fibroblasts and myofibroblasts of Dupuytren's nodules had a

strong nuclear staining of PCNA (Fig. 1A), in contrast with the normal palmar

fascia tissue, in which cell staining was completely absent (Fig. 1B). We

quantified the number of positive cells on the total number of cells in 10

different areas for each experimental group and we expressed the ratio

between PCNA-positive cells and total cells as percentages (Fig 1C). The

incidence of PCNA-positive nuclei in the fibromatosis nodules (87,65 % ± 4,98

%) was significantly (P<0.0001) higher than that in the normal palmar fascia

tissues (18,43 % ± 7,15 %). Our data demonstrate that these pathological

samples are in the same proliferative stage of the disease that causes

thickening and contracture of the palmar fascia. CD68 immunostaining was

performed and it was completely negative in Dupuytren's nodules (Fig 2A)

similarly to normal tissues (Fig. 2B), thus confirming the absence of

macrophages and monocytes in the proliferative phase of the disease. Spindle-

shaped cells in Dupuytren's nodule resulted alpha-SMA-positive (Fig. 2C), this is

a reliable marker of the myofibroblastic phenotype; α-SMA staining was weak or

absent in the control tissues (Fig. 2D). The α-SMA high expression in

Dupuytren’s tissues confirmed the trans-differentiation from fibroblasts to

contractile myofibroblastic phenotype.

Then TGF-β1 was highly expressed in the extracellular matrix and by fibroblasts

and myofibroblasts of Dupuytren’s proliferative nodules (Fig. 3A); at the same

time, a weak expression of TGF-β1 was evidenced in the fibroblasts and

vascular endothelial cells of normal tissues, while it was completely negative in

the extracellular matrix of normal palmar fascia (Fig. 3B). IL-1β was then

evaluated, showing positive immunoreaction in the cytoplasm of fibroblasts and

myofibroblasts, extracellular matrix and vascular endothelial cells of the fibro-

proliferative nodules (Fig. 3C). This pro-inflammatory cytokine was completely

162

absent in the extracellular matrix of control samples, but weakly present in the

cytoplasm of capillary endothelial cells and fibroblasts (Fig. 3D).

Il-6 was strongly expressed in the extracellular matrix in its soluble form, and

moderately present in the proliferative myofibroblasts and fibroblasts of the

Dupuytren’s nodules (Fig. 3E). In the controls, IL-6 was completely absent at

level of the loose connective tissue but moderately expressed in the vascular

endothelial cells and in the fibroblasts (Fig. 3F), confirming that this cytokine is

involved in the inflammatory process that activate the fibrotic process of

Dupuytren’s disease.

TNF-α was then analyzed and it resulted moderately positive in the extracellular

matrix, fibroblasts and vascular endothelial cells of the Dupuytren’s proliferative

site (Fig. 4A) similarly to the control tissue (Fig. 4B). Finally, VEGFa was

strongly positive in vascular endothelium, fibroblasts and myofibroblasts of

Dupuytren’s nodules (Fig. 4C); differently, VEGF-a was completely absent in the

control tissues (Fig.4D). All these data were supported by immunofluorescence

of the cultured fibroblasts and myofibroblasts isolated from Dupuytren’s

nodules, in which α-SMA was expressed by 50% of the cells, with uniform

cytoplasmic distribution (Fig. 5A), confirming the presence of myofibroblasts;

while α-SMA was completely absent in the cells isolated from normal palmar

fascia (Fig. 5B). Pathological cultured fibroblasts and myofibroblasts were also

strongly positive for TGF-β1 expression, as compared to normal fibroblasts,

showing a granular cytoplasmic distribution (Fig. 5 C-D). Also IL-1beta was

strongly present in Dupuytren's cell cultures (Fig. 5E), but weakly present in

normal fibroblasts. Finally, IL-6 was weak and moderately present in

pathological (Fig. 5G) and normal (Fig. 5H) cultured cells. TNF alpha was

moderately expressed by pathological cells (fig 6A), similarly to control

fibroblasts (fig 6B). VEGFa was found to be strongly expressed in the cytoplasm

of fibroblasts and myofibroblasts isolated from Dupuytren's tissue (fig 6C),

while was totally absent in normal fibroblasts (Fig 6D). Our study confirmed

that there was no difference in the intensity of the expression of this pro-

inflammatory cytokine and in the percentage of TNF-α-positive cells between

control cells and pathological fibroblasts (Fig. 7). The difference in the number

163

of IL-6-positive cells between the pathological and the normal cell lines of

fibroblasts was significant for p<0.05 (Fig. 7). On the basis of the

immunohistochemical and immunofluorescence results that showed a stronger

expression of TGF-β, IL-1β and VEGFa in pathological tissue, respect to normal

tissues, we then quantified their differences in mRNA expression between

normal and pathological tissues by RT-PCR (Fig. 8). An upregulation of TGF-β1

(2.30 ± 0.05), IL-1β (2.02 ± 0.07) and VEGFa (1.97 ± 0.04) was demonstrated

in fibroblasts from Dupuytren’s nodules compared to normal fibroblasts (Fig.

9A). RT-PCR data were demonstrated either on cultured cells or in de-

paraffinized tissue samples with p-value <0.05.

Discussion

Dupuytren’s disease is a condition in which the formation of nodules in the palm

of the hand precedes eventual contracture of the fingers due to fibrosis [20].

Clusters of macrophages and T-lymphocytes have been observed, in addition to

myofibroblasts, in the pathological tissue [6, 21-24]. Several growth factors and

inflammatory cytokines have been reported in the literature as molecules

probably involved in the modulation of the pathogenesis of Dupuytren’s disease

[25-27]. TGF-β is undoubtedly one of the cytokines most involved in the

process of fibrosis and is present at high amounts in sites of chronic

inflammation [28-32]. Moreover, some studies have also demonstrated in vitro

that cultured Dupuytren’s cells produce TGF-β and that TGF-β stimulates the

growth of Dupuytren’s fibroblasts [33]. As demonstrated by Kulkarni and

Karlsson [34] TGF-β plays other important roles in the modulation of fibrosis

and inflammation. Our data confirm that TGF beta is more strongly present in

DD extracellular matrix and cells, than in the correspondent normal tissue and

cells. A new finding, not described in the previous available literature on this

topic, is the presence of a cytoplasmic granular fluorescent staining for TGF-β1,

whose characteristic appearance represents an interesting typical finding

observed in DD myofibroblasts. A recent study performed by Iqbal et al. [35]

confirmed the importance of myofibroblasts in the pathogenesis of DD also

164

introducing the possibility of alternative sources of DD myofibroblasts

originating from skin overlying nodule (SON) and perinodular fat (PNF). Verjee

et al. [15] have recently identified another possible therapeutic target in the

TNF, whose role may be hopefully relevant in the better future knowledge of

pathogenesis and therapy of DD. Nowadays, there are different therapeutic

options for the treatment of DD [36], but the real question remains still: what is

the primary cause in its pathogenesis? An important recent study [37]

postulates diverse origins of the myofibroblasts responsible for kidney fibrosis.

Notwithstanding the differences in comparison with DD a possible general

“common control” of the mechanisms of fibrosis may be activated even in

different areas of the body in response to appropriate stimuli. This “common

control” has to be elucidated in further studies, but it probably constitutes the

central problem in DD and in other fibrosis-related pathologies. Some authors

recently underline the possible role of Wnt signaling [38] in the pathogenesis of

DD, but this study implicates even nine different loci involved in genetic

susceptibility to Dupuytren's disease. The fact that six of these nine loci harbor

genes encoding proteins in the Wnt-signaling pathway suggests that

aberrations in this pathway may be key to the process of fibromatosis in

Dupuytren's disease. However further genome studies should be performed in

order to elucidate this interesting hypothesis.

Our results demonstrated that TGF-β, IL-1β and VEGFa are markedly expressed

in Dupuytren’s tissue and cultured myofibroblasts. This finding led us to

postulate a pivotal role for these molecules in the development of Dupuytren’s

contracture. The obtained informations may provide a basis for the research of

non-surgical treatment regimens to reduce the recurrence and the progression

of this disease, ultimately attenuating hospitalization and post-surgical

rehabilitation for patients.

Acknowledgments

This work was supported by a grant of the “Enrico ed Enrica Sovena”

Foundation, Italy. The authors are grateful to Mrs. Sharon Hobby for her kind

and careful revision of the English language of the manuscript.

165

References

1. Calandruccio, J.H. (1998) Dupuytren contracture. S. Terry Canale (Ed.)

Campbell’s Operative Orthopaedic. ninth ed. Mosby, pp. 4274-4276, St. Louis,

MN, USA.

2. Luck JV. (1959) Dupuytren's contracture: a new concept of the pathogenesis

correlated with surgical management. J Bone Joint Surg Am .41, 635-664.

3. Desai SS, Hentz VR. (2011) The treatment of Dupuytren disease. J Hand

Surg Am. 36, 936-42.

4. Shih B, Bayat A. (2010) Scientific understanding and clinical management of

Dupuytren disease. Nat Rev Rheumatol. 6, 715-726.

5. Schurch W, Skali I, Gabbiania G. Cellular biology. (1990) McFarlane RM,

McGrouther DA, Flint MH, eds. Dupuytren’s Disease, pp. 31-4, New York:

Churchill Livingstone.

6. Gabbiani G, Majno G. (1972) Dupuytren’s contracture: fibroblast contraction?

An ultrastructural study. Am J Pathol. 66, 131-138.

7. Kloen P. (1999) New insights in the development of Dupuytren’s contracture:

a review. Br J Plast Surg. 52, 629-635.

8. Badalamenti MA, Sampson SP, Hurst LC, Dowd A, Miyasaka K. (1996) The

role of TGF-beta in Dupuytren’s disease. J Hand Surg. 21A, 210-215.

9. Heldin CH, Miyazono K, Ten Dijke P. (1997) TGF-beta signaling from cell

membrane to nucleus through SMAD proteins. Nature. 390, 465-471.

10. Schmierer B, Hill CS. (2007) TGFβ-SMAD signal transduction: molecular

specificity and functional flexibility. Nat Rev Mol Cell Biol. 8, 970-982.

11. Tomasek JJ, Gabbiani G, Hinz B, Chaponnier C, Brown RA. (2002)

Myofibroblasts and mechano-regulation of connective tissue remodeling. Nat

Rev Mol Cell Biol. 3, 349-363.

12. AndrewJG, Andrew SM, Ash A, Turner B (1991). An investigation into the

role of inflammatory cells in Dupuytren’s disease. J Hand Surg (Br). 16, 267-271

13. Ito H. (2003) IL-6 and Crohn’s disease. Curr Drug Targets Inflamm Allergy.

2, 125-130.

166

14. Sanchez-Muñoz F, Dominguez-lopez A, Yamamoto-Furusho JK. (2008) Role

of cytokines in inflammatory bowel disease. World J Gastroenterol. 14, 4280-

4288.

15. LS Verjee, JSN Verhoekx, JKK Chan, T Krausgruber, V Nicolaidou, D Izadi, D

Davison, M Feldmann, KS Midwood, and J Nanchahal. (2013) Unraveling the

signaling pathway promoting fibrosis in Dupuytren’s disease revels TNF as a

therapeutic targer. PNAS; 110, 928-937.

16. Sullivan DE, Ferris M,Pociask D, Brody AR. (2005) Tumor necrosis factor-

alpha induces transforming growth factor-beta 1expression in lung fibroblasts

through the extracellular signal-regulated kinase pathway. Am J Respir Cell Mol

Biol. 32, 342-349.

17. LA Holzer, A Cor, G Pfandlsteiner, G Holzer. (2013) Expression of VEGF, its

receptors, and HIF-1a in Dupuytren disease. Acta Orthopaedica. 84, 420-425.

18. Tischer E, Michell R, Hartman T, Silva M, Gospodarowicz D, Fiddes JC,

Abraham JA. (1991) The human gene for vascular endothelial growth factor.

Multiple protein forms are encoded through alternative exon splicing. J Biol

Chem. 266, 11947-54.

19. Ke Q, Costa M. (2006) Hypoxia-inducible factor-1 (HIF-1). Mol Pharmacol.

70, 1469-1480.

20. Meek R M , McLellan S, Crossan J F. (1999) Dupuytren’s disease: a model

for the mechanism of fibrosis and its modulation by steroids. Bone and Joint

Surgery. 81, 732-738.

21. Iwasaki H, Muller H, Stutte HJ, Brennscheidt U. (1984) Palmar fibromatosis

(Dupuytren’s contracture): ultrastructural and enzyme histochemical studies of

43 cases. Virch Arch A. 405, 41-53.

22. Scurch W, Seemayer TA, Gabbiani G. (1992) Myofibroblast. In: Sternberg

SS, ed. Histology for pathologists. New York, Raven Press. pp. 118-25.

23. Azzarone B, Failly-Crepin C, Daya-Grosjean L, Chaponnier C, Gabbiani G

(1983) Abnormal behaviour of cultured fibroblasts from nodule and non-

affected aponeurosis of Dupuytren’s disease. J Cell Physiol. 117, 353-61.

24. Baird KS, Alwan WH, Crossan JF, Wojciak B. (1993) T-cell mediated

response in Dupuytren’s disease. Lancet. 341, 1622-3.

167

25. Baird KS, Crossan JF, Ralston SH. (1993) Abnormal growth factor and

cytokine expression in Dupuytren’s contracture. J Clin Pathol. 46, 425-8.

26. Meek RMD, Wojciak B, Crossan JF. (1996) Dupuytren’s fibroblasts secrete

interleukin-8, a powerful lymphocyte chemoattractant. British Society for

Surgery of the Hand Birmingham.

27. Baird KS. (1994) Aetiopathogenesis of Dupuytren’s contracture. Rheumatol

Rev. 3, 111-23.

28. Roberts AB, Sporn MB, Assoain RK, et al. (1986) Transforming growth

factor type beta: rapid induction of fibrosis and angiogenesis in vivo and

stimulation of collagen formation in vitro. Proc Natl Acad Sci USA. 83, 4167-71.

29. Raghow R, Postlethwaite AE, Keski-Oja J, Moses HL, Kang AH. (1987)

Transforming growth factor-beta increases steady state levels of type I

procollagen and fibronectin messenger RNAs posttranscriptionally incultured

human dermal fibroblasts. J Clin Invest. 79, 1285-8.

30. Massague J, Heino J, Laiho M. (1991) Mechanisms in TGF-beta action. Ciba

Found Sym, 157, 51-9.

31 Ignotz RA, Massague J. (1986) Transforming growth factor beta stimulates

the expression of fibronectin and collagen and their incorporation into the

extracellular matrix. J Biol Chem. 261, 4337-45.

32. Wahl SM, Costa GL, Mizel DE, et al. (1993) Role of transforming growth

factor beta in the pathophysiology of chronic inflammation. J Peridontol. 64,

450-5.

33. Kloen P, Jennings CL, Gebhardt MC, Springfield DS, Mankin HJ. (1995)

Transforming growth factor-beta: possible roles in Dupuytren’s contracture. J

Hand Surg Am. 20, 101-8.

34. Kulkarni AB, Karlsson S. (1993) Transforming growth factor-beta knockout

mice: a mutation in one cytokine gene causes a dramatic inflammatory disease.

Am J Pathol. 143, 3-9.

35. Iqbal SA, Manning C, Syed F, Kolluru V, Hayton M, Watson S, Bayat A.

(2012) Identification of mesenchymal stem cells in perinodular fat and skin in

Dupuytren’s disease: a potential source of myofibroblasts with implications for

pathogenesis and therapy. Stem Cells Dev. 21, 609-622.

168

36. Eaton C. (2014) Evidence-based medicine: Dupuytren contracture. Plast

Reconstr Surg. 133, 1241-51.

37. Falke LL, Gholizadeh S, Goldschmeding R, Kok RJ, Nguyen TQ. (2015)

Diverse origins of the myofibroblasts: implications for kidney fibrosis. Nat Rev

Nephrol. 11, 233-44.

38. Dolmans GH, Werker PM, Hennies HC, Furniss D, Festen EA, Franke L,

Becker K, Van Der Vlies P, Wolffenbuttel BH, Tinschert S, Toliat MR, Nothnagel

M, Franke A, Klopp N, Wichmann HE, Nürnberg P, Giele H, Ophoff RA,

Wijmenga C, Dutch Dupuytren Study Group, German Dupuytren Study Group,

the LifeLines Cohort Study, and the BSSH–GODD Consortium. (2011) Wnt

signaling and Dupuytren disease. N Engl J Med. 365, 307-317.

169

Figure 1. Immunohistochemical analysis of PCNA, CD68 and α-SMA markers in

Dupuytren’s nodules and control tissues. The photomicrographs of Dupuytren’s

nodular tissues showed an increasing number of PCNA (A) and α-SMA-positive

cells (C) compared to the control tissues in which these markers resulted

completely negative (D, F). Immunohistochemistry for CD-68 showed that the

macrophages and monocytes were completely absent in the pathological nodule

(B) similarly to the normal tissue (E). (magnification 40X).

170

Figure 2. Cell proliferation index in Dupuytren’s nodules and normal fascia

palmar tissues. PCNA proliferative index is represented as a percentage of

PCNA-positive nuclei on the total number of cells in Dupuytren’s nodules (87.65

% ± 4.98) and normal fascia palmar tissues (18% ± 7,15). The bar graph

indicates the mean percentage of PCNA positive cells ± SD. Statistical analysis

is performed using Student's t-test. *p-value < 0.05.

171

Figure 3. Immunohistochemical analysis of pro-inflammatory markers TGF-β,

IL-1β and IL-6 in Dupuytren’s nodules and controls. TGF-β was strongly

expressed in the extracellular matrix and cytoplasm of proliferative

myofibroblasts and fibroblasts in the pathological tissue (A). TGF-β was

moderately present in the cytoplasm of fibroblasts scattered in the loose

connective tissue of normal fascia palmar (D). Il-1β was strongly positive in

Dupuytren's myofibroblasts - rich nodules showing cytoplasmic localization (B).

IL-1beta was completely absent in the extracellular matrix and weakly present

in the vascular endothelium and fibroblasts of normal palmar fascia (E). IL-6

was moderately expressed in the extracellular matrix and fibroblasts of

Dupuytren’s tissues (C) similarly to the control tissue (F). (magnification 40X).

172

Figure 4. Immunohistochemical analysis of TNF-α and VEGF in Dupuytren’s

nodules and control tissues. A moderate expression of TNF-α is seen in the

extracellular matrix and fibroblasts of Dupuytren’s nodules (A) and control

tissues (C) (magnification 40X). VEGF immunoreactivity appears to be strongly

positive in the extracellular matrix, fibroblasts and myofibroblasts of

Dupuytren’s nodules (B) (magnification 40X). compared to controls in which the

staining was completely absent in the amorphous substance and weakly

expressed in the cytoplasm of normal fibroblasts (D) (magnification 20X).

173

Figure 5. Immunofluorescence for α-SMA and pro-inflammatory factors TGF-β,

IL-β, IL-6 in fibroblast cultures isolated from Dupuytren’s nodules and normal

palmar fascia. The pathological fibroblasts isolated from Dupuytren’s nodules

(A) showed a strong expression of α-SMA demonstrating that 50% of

fibroblasts differ in myofibroblasts. In the normal fibroblasts, α-SMA expression

was completely absent (E). TGF-β and IL-β were strongly expressed in the

pathological fibroblasts isolated from Dupuytren’s tissues (B, C,) compared to

the normal fibroblasts (F, G,) that showed a weak expression of these pro-

inflammatory factors. IL-6 was moderately expressed in the cytoplasm of

pathological (D) and normal fibroblasts (H) (magnification 20X).

174

Figure 6. Immunofluorescence for TNF-α and VEGF in fibroblast cells isolated

from Dupuytren’s nodules and normal palmar fascia. TNF-α was moderately

expressed in the pathological fibroblast cultures (A) similarly to the control

fibroblasts (C).A strong VEGF expression was found in the cytoplasm of

Dupuytren’s fibroblasts (B) differently from fibroblasts isolated from normal

palmar fascia in which this factor was completely absent (D). (magnification

20X).

175

Figure 7. Pro-inflammatory cytokines and VEGF positive cell index in the

fibroblasts isolated from Dupuytren's contracture and normal palmar fascia

tissue. The bar graph indicates the mean % growth factors-positive cells ± SD.

Statistical analysis is performed using Student's t-test. * p<0.0001 or **

p<0.05.

176

Figure 8. Quantitative PCR analysis in Dupuytren’s nodules-derived cells, in

control tissue and in paraffinized tissue samples. A (upper): PCR analysis of

mRNA expression for TGF-β1, IL-1β and VEGF-A in nodules-derived cells and in

control normal tissue. Data are presented as mean ± SEM . Statistical analysis

is performed using Student’s t-test. * p-value <0.05.

B (down): PCR analysis of mRNA expression for TGF-β1 in paraffinized tissue

samples from DD patients and control ones.

177

Chapter 8

Radiolabeling VEGF165 with 99mTc to

evaluate VEGFR expression in tumor

angiogenesis

*F. Galli1,2, *M. Artico3, S. Taurone3, I. Manni4,

E. Bianchi3, G. Piaggio4, B.D. Weintraub5,

M. Szkudlinski5, E. Agostinelli6, R.A.J.O. Dierckx2,

A. Signore1,2

*AUTHORS EQUALLY CONTRIBUTED

1Nuclear Medicine Unit, Department of Medical-Surgical Sciences and of

Translational Medicine, Faculty of Medicine and Psychology, “Sapienza”

University of Rome, Italy. 2Department of Nuclear Medicine and

Molecular Imaging, University Medical Centre Groningen, University of

Groningen, Groningen, The Netherlands. 3Department Sensory Organs,

“Sapienza” University of Rome, Italy. 4Molecular Oncogenesis Laboratory,

Experimental Oncology Department, Regina Elena National Cancer

Institute, Rome, Italy 5Trophogen Inc., Rockville, MD, USA. 6Department

of Biochemical Sciences "A. Rossi Fanelli", “Sapienza” University of

Rome, Rome, Italy.

Submitted to Intern. Journal of Oncology 2016

Key words: VEGF - nuclear medicine – angiogenesis - tumor imaging

178

Abstract

Introduction: Angiogenesis is the main process responsible for tumor growth

and metastatization. The principal effector of such mechanism is the vascular

endothelial growth factor (VEGF) secreted by cancer cells and other

components of tumor microenvironment, under specific stimuli. Radiolabelled

VEGF analogues may provide a useful tool to noninvasively imaging tumor

lesions and evaluate the efficacy of anti-angiogenic drugs, aimed at blocking

the VEGFR pathway. Aim of the present study was to radiolabel the human

VEGF165 analogue with 99mTechnetium (99mTc) and evaluate the expression

of VEGFR in both cancer and endothelial cells in the tumor microenvironment.

Material and Methods: The human VEGF-A165 analogue was successfully

labelled with 99mTc using an indirect method via succinimidyl-6-

hydrazinonicotinate hydrochloride conjugation. Several in vitro quality controls

(QC) including SDS-PAGE, cysteine challenge and cell binding assay on HUVEC

cells were performed. In vivo studies included biodistribution studies and tumor

targeting experiments in athymic nude CD-1 mice xenografted with different

cell lines (ARO, K1 and HT29). Immunohistochemistry was performed on

excised tumors to confirm VEGF receptor (VEFR) expression in the lesion and

endothelial cells.

Results: Human VEGF-A165 analogue was labelled with high labelling

efficiency (>95%) and high specific activity. The radiolabelled molecule

retained its biological activity and structural integrity as confirmed by in vitro

QC. In tumor targeting experiments, a focal uptake of radiolabelled VEGF165

was observed in every xenografted tumor with different tumor-to-background

ratios. Immunohistochemical analysis of excised tumors revealed an inverse

correlation between VEGF and uptake of the radioactive hormone. On the other

hand a positive correlation between radioactive VEGF165 and VEGFR1 was

observed.

Conclusion: Human VEGF-A165 was successfully radiolabelled with 99mTc.

When used for in vivo imaging of VEGFR expression in tumors, endogenous

179

VEGF produced by cancer and other cells of tumor microenvironment should be

taken in consideration because of possible saturation of VEGFRs.

Introduction

Angiogenesis is the vital physiological process involving the growth and

remodelling of new blood vessels from pre-existing one and is implicated in a

number of diseases including cancer. Indeed, neoangiogenesis is essential for

tumor growth as well as crucial for local and distant metastatization through

both blood and lymphatic vessels (1, 2). Therefore, many new targeted

therapies have been developed and they are based on drugs able to bind

vascular endothelial growth factor (VEGF) and its receptor (VEGFR), which have

been shown to be up-regulated in tumor and highly proliferating endothelial

cells. Such overexpression has been associated with progression,

metastatization and poor outcome in particularly aggressive cancers (4). Some

of these drugs have been approved for human use and proved to be effective in

many solid tumors (7). The most widely used in clinical practice is the anti-

VEGF monoclonal antibody (mAb) bevacizumab that binds the free VEGF.

Others, like the tyrosine kinase inhibitors (TKIs) sorafenib and sunitinib, are

able to target the VEGFR2 blocking the signalling cascade (8). It has been

reported that the majority of patients benefits from targeted therapies, but a

small fraction fails to show even initial benefits. The reasons may range from

the involvement of parallel angiogenic pathways to the absence of the targets

(9). Therefore, it would be important to predict which patients would benefit

from a specific targeted therapy and several studies indicated the possibility to

image angiogenic markers with the use of radiopharmaceuticals targeting VEGF

or VEGFR (10). In particular, since VEGFR is expressed also in some cancer

cells, this technique will be useful in both early detection and cancer treatment

monitoring (11-13). Radiopharmaceuticals to image tumor angiogenesis have

been described in the literature, but many of them showed limitations that

slowed or blocked the shift from preclinical to clinical trials. Among them the

most common were poor or variable binding affinity and exaggerated liver

180

uptake (14-15). In the present study we optimized the radiolabelling of

VEGF165 with 99m-technetium (99mTc) using HYNIC as bifunctional chelator,

obtaining a highly stable radiopharmaceutical with high in vitro receptor binding

affinity. In vivo we used 99mTc-HYNIC-VEGF165 to image VEGFR expression in

different tumor xenografts and correlated in vivo data with histological findings.


Labelling of VEGF-A165 with 99mTc

The human hVEGF-A165 analogue with a molecular weight of 19 KDa was

provided by Trophogen Inc. and radiolabelled with 99mTc through an indirect

method after conjugation with the bifunctional chelator 6-hydrazinonicotinamide

(HyNic). Radiolabelling was optimized by testing several labelling conditions

including different HYNIC:VEGF ratios (1:1, 4:1 and 8:1) and different amounts

of tricine (from 0.9 mg/ml to 200 mg/ml PBS) or SnCl2 (from 2 mg/ml to 20

mg/ml 0.1 M HCl). Briefly, VEGF165 (0.5 mg) was incubated with an excess of

succinimidyl-6-hydrazinonicotinate hydrochloride (SHNH, SoluLink, USA) for 2 h

at room temperature in the dark. At the end of the incubation free SHNH was

removed by size exclusion chromatography using a G-25 Sephadex PD10

column (GE Healthcare, UK) and nitrogen-purged phosphate buffer saline (pH

7.4) as eluent. The number of HYNIC groups bound per molecule of VEGF165

was determined by a molar substitution ratio (MSR) assay. Briefly, conjugated

VEGF165 (2 µl) was added to a 0.5 mM solution (18 µl) of 2-sulfobenzaldehyde

in 0.1 M 2-(N-morpholino) ethanesulfonic acid (MES) buffer (pH 5.0) and

incubated at room temperature for 2 hours. Phosphate buffer saline (PBS)

alone was used as blank and duplicates were prepared. After 2 hours the

absorbance at 345 nm of each reaction was measured with a

spectrophotometer and the number of HYNIC groups per molecule was

calculated as indicated in the SoluLink data sheet. Radiolabelling was performed

incubating 30 µg of VEGF165 (in 100 µl PBS) with 300 MBq of freshly eluted

99mTcO4- (100 µl), 100 µl of tricine (Sigma-Aldrich Chemicals, UK) and 5 µl

SnCl2 (Sigma-Aldrich Chemicals, UK). Labelling efficiency (LE) and colloids

181

percentage were measured up to 30 minutes of incubation. After labelling, an

additional purification by size exclusion chromatography was performed using a

Zeba Spin Column (Thermo Scientific, USA) to remove any free 99mTcO4-,

tricine and SnCl2.

In vitro quality controls

Quality controls were performed using instant thin layer chromatography-silica

gel (ITLC-SG) strip (Pall Life Sciences, USA). Results were analysed by a radio-

scanner (Bioscan Inc., USA) to calculate the LE of 99mTc-HYNIC-VEGF165. The

mobile phase for LE determination was a 0.9% NaCl solution, whereas the

amount of colloids was determined using a NH3:H2O:EtOH (1:5:3) solution.

Quality controls were performed before and after the purification with a Zeba

Spin column. Additionally, reverse phase HPLC was carried out using a C8

Kinetex 4.6 x 250 mm column and a gradient of H2O (A) and acetonitrile (B)

with 0.1 % TFA. The following gradient was used: 0-5 min 0-5% B, 5-20 min 5-

95% B, 20-25 min 95% B and 25-30 min 95-5%B. Stability assays were

performed adding 100 l of 99mTc-HYNIC-VEGF165 to a vial containing 900 l

of fresh human blood serum and to another containing 900 l of 0.9% NaCl

solution. Both vials were incubated up to 24 hours at 37°C. The radiochemical

purity was measured at 1, 3, 6 and 24 hours by ITLC analysis. In addition, a

cysteine challenge assay was performed incubating the labelled VEGF165 at

37°C for 60 min with different cysteine concentration, ranging from 1000:1

(cysteine:VEGF165) to 0.1:1 molar ratio. For each time point, radiochemical

purity was evaluated by ITLC as described above. All known chemical forms of

99mTc-cysteine have Rf values between 0.5 and 1, when normal saline was

used as mobile phase. Integrity of the labelled VEGF165 molecule was also

checked by sodium dodecyl sulphate–polyacrylamide gel electrophoresis under

non-reducing conditions, according to the method of Laemmli (16). Proteins

were visualized by staining the gels with Coomassie Brilliant Blue (Thermo

Scientific, USA). Radioactivity associated with each band was determined

scanning the gel with a radio-scanner.

182

Cell lines

VEGFR+ cell line, human umbilical veins endothelial cells (HUVEC) were

cultured in F-12K medium supplemented with 10% FCS, 100 IU/ml penicillin,

100 µg/ml streptomycin, 2 mM L-glutamine and EGM®-2 Bulletkit (Lonza, USA)

(17). The human anaplastic thyroid cancer cell line (ARO), the human colorectal

cancer cell line (HT29) and the human poorly differentiated thyroid cancer cell

line (K1) were grown in DMEM high glucose (Gibco, USA) supplemented with

10% FCS, 100 IU/ml penicillin, 100 µg/ml streptomycin and 2 mM L-glutamine

(18-20).

In vitro binding studies

Measurements of cell uptake and retention of labelled VEGF-A165, was

performed in vitro using the semi automatic system LigandTracerTM that allows

to follow binding over time (Ridgeview Instruments AB, Sweden) (21). Briefly,

106 HUVEC cells were seeded in a tilted Petri dish and incubated in a humified

incubator at 37°C and 5% CO2 for 24 hours. The dish was then placed in the

LigandTracer and allowed to rotate continuously for 15 minutes to allow release

of weakly attached cells. After one gentle wash, 2 ml of PBS containing

radiolabelled VEGF165 (30 nM) were added to the dish and it started to rotate

until reaching maximal binding. The device was then stopped, the liquid

removed and replaced with culture medium without labelled VEGF165 for

calculating release of radioactivity from cells. Association and dissociation

curves were obtained analysing data by non-linear regression analysis with

GraphPad Prism (GraphPad Software Inc, USA) to calculate the kon, koff and

Kd values.

In vivo studies

Biodistribution and imaging studies

For animal experiments, the institutional and national guide for the care and

use of laboratory animals was followed. Imaging studies were performed with a

previously described high-resolution portable mini-gamma camera (HRC), IP-

Guardian (Li-Tech S.r.l., Italy) (22). For in vivo biodistribution studies, 5.5 MBq

183

(190 MBq/nmol, 100 µl) of labelled VEGF165 were injected in the tail vein of 12

nude CD-1 mice and static planar posterior images were acquired using the

HRC at 1, 3, 6 and 24 hours, under light ether anaesthesia. At the end of each

imaging point three mice were euthanized and major organs were collected and

counted in a single well gamma-counter. In vivo cell-targeting experiments

were performed in 36 nude CD-1 mice that were divided in three groups. Each

group was injected subcutaneously in the right thigh with respectively 106 ARO,

HT29 and K1 cells mixed with BD Matrigel (BD Biosciences, USA) (1:1) After

tumor growth (approximately 0.6-1 cm3, in 20 days), 5.5 MBq of labelled

VEGF165 were administered i.v. in the tail vein and static planar posterior HRC

images were acquired at 1, 3, 6 and 24 hours, under light ether anaesthesia. At

each time point 3 mice were euthanized for ex-vivo counting. Major organs and

tumors were collected, weighted and counted for radioactivity with a single well

gamma-counter (Gammatom, Italy).

Blocking studies

Blocking studies were performed in four mice injected with 1 million HT29 cells

mixed with Matrigel® in the right thigh. After tumor growth, 5.5 MBq of

99mTc-VEGF165 were injected in the tail vein and images were acquired with a

portable mini-gamma camera at 1 h and 3 h post-injection. After 3 days,

99mTc-HYNIC-VEGF165 was pre-incubated for 1 h with 3.5 fold molar excess of

recombinant human VEGFR2-Fc chimera (BioLegend Inc., USA) that act as a

soluble decoy receptor (TRAP) that has been proved to prevent the binding of

VEGF to endothelial cells. After the incubation, a dose of 5.5 MBq was injected

in the tail vein of 3 of the 4 mice previously imaged and images were acquired

with a portable mini-gamma camera at 1 h and 3 h post-injection. After 3 more

days, a 100 fold molar excess of unlabelled VEGF165 (COLD) was injected in

the tail vein of the same 3 mice and after 10 minutes 5.5 MBq of 99mTc-

HYNIC-VEGF165 were injected. Images were acquired with a portable mini-

gamma camera at 1 h and 3 h post-injection. Region of interest were drawn on

the tumor and on the contralateral leg in each image and target-to-background

(T/B) ratios were calculated.

184


For light microscope immunohistochemical analysis, small fragments of each

excised tumor (ARO, HT29 and K1) were processed according to ABC/HRP

technique (avidin complexed with biotinylated peroxidase). These samples were

washed in PBS, fixed in 10% formalin and embedded in paraffin according to a

standard procedure. Serial 3-µm thick sections were cut using a rotative

microtome, mounted on gelatin-coated slides and processed for

immunohistochemistry. These sections were de-paraffinized in xylene and

dehydrated. They were immersed in citrate buffer (pH 6) and subjected to

microwave irradiation twice for 5 minutes. Subsequently, all sections were

treated for 30 minutes with 0.3% hydrogen peroxide in methanol to quench

endogenous peroxidase activity. To block non-specific binding, the slides were

incubated with M.O.M. Mouse Ig Blocking Reagent (Vector Laboratories

Burlingame, CA, USA) for 1 h at room temperature. The slides were incubated

overnight at 4°C with the following antibodies: i) mouse anti-VEGF monoclonal

antibody (Santa Cruz Biotechnology, CA, USA); ii) mouse anti-VEGF Receptor 1

[Flt-1/EWC] monoclonal antibody (Abcam, ab9540, UK); iii) mouse anti-VEGF

Receptor 2 [KDR/EIC] monoclonal antibody (Abcam, ab9530, UK). Optimal

antisera dilutions and incubation times were assessed in a series of preliminary


in phosphate buffer and incubated for 1h at room temperature with the

appropriate secondary biotinylated goat anti-mouse IgG (Vector Laboratories

Burlingame, CA, USA, BA9200 and BA1000) and with peroxidase- conjugated

avidin (Vectastain Elite ABC Kit Standard* PK 6-100) for 35 minutes. After a

further wash with phosphate buffer, slides were treated with 0.05% 3,3-

diaminobenzidine (DAB) and 0.1% H2O2 (DAB substrate kit for peroxidase,

Vector Laboratories SK-4100). Finally, sections were counterstained with

Mayer’s haematoxylin and observed using a light microscope. Negative control

experiments were carried out: i) by omitting the primary antibody; ii) by

substituting the primary antibody with an equivalent amount of non-specific


185

blocking peptide (antigen/antibody = 5 according to supplier’s instructions).

The staining assessment was made by two experienced observers in light

microscopy. Immunoreactivity of VEGF, VEGFR1, and VEGFR2 was assessed in

all samples. The intensity of the immune reaction was assessed

microdensitometrically using an IAS 2000 image analyser (Delta Sistemi, Rome,


taking as zero the background obtained in sections exposed to non-immune

serum. Ten 100 μm2 areas were delineated in each section using a measuring

diaphragm. The quantitative data regarding the intensity of immune staining

were analysed statistically using analysis of variance (ANOVA) followed by

Duncan’s multiple range test as a post hoc test.

Results

Labelling with 99mTc and quality controls

Highest labelling efficiency was obtained when the analogue was conjugated

with a ratio HYNIC:VEGF165 of 8:1. Determination of molar substitution ratio of

HYNIC-conjugated VEGF165 demonstrated that an average of 4.3 molecules of

HYNIC groups were bound per molecule of analogue. Higher ratios were not

selected to avoid over-conjugation of the hormone and possible structural

modification. Optimization of the labelling procedure of the HYNIC-VEGF165

conjugate (30 µg) with 99mTc showed that, after 10 minutes of incubation, the

use of 100 l of tricine (0.5 mM) and 5 l of SnCl2 (50 nM) allowed to obtain

the highest LE (65 %) and the lowest amount of colloids (<5%). After Zeba

spin purification we were able to obtain a radiochemical purity of > 95 % as

confirmed by both ITLC and HPLC analysis (Figure 1). Specific activity of

resulting 99mTc-HYNIC-VEGF165 was 190 MBq/nmol. Radiolabelled VEGF165

was stable up to 24 h in both in human serum and in a 0.9% NaCl solution at

37 °C, as well as in solutions containing increasing cysteine concentrations. A

slight decrease in the radiochemical purity was observed only at high cysteine

concentrations (>500:1) (Figure 2). Gel electrophoresis of radiolabelled,

conjugated and unconjugated analogue showed no significant differences and

186

the absence of significant degradation or aggregation resulting from

conjugation and/or labelling (Figure 3).

In vitro binding studies

Kinetic biding assay with LigandTracer showed an increasing uptake of labelled

VEGF165 from HUVEC cells that reached a plateau after 50 minutes (Figure 4).

Retention studies revealed a slow dissociation rate from membrane bound

receptors in the following 2 hours, with a Kd of 192 pM.

In vivo studies

Biodistribution and imaging in mice

Biodistribution studies with 99mTc-HYNIC-VEGF165 matched qualitative

imaging (Figure 5) in mice showed a high and persistent uptake by the liver

and a moderate uptake by the kidneys with almost no signal from other organs

and blood pool. Single organ counting revealed a high %ID/g also in the lungs

and spleen. In vivo targeting experiments showed a focal uptake in the right

thigh of each group bearing tumor xenografts with a T/B ratio of 4.5 at 1 h p.i

in mice bearing a HT29 xenograft. Animals bearing ARO and K1 cells showed a

T/B of 3.5 and 2.3 respectively that decreased over time (Figure 6).

Blocking studies

Blocking studies with 99mTc-HYNIC-VEGF165 confirmed the results of previous

targeting experiments. After pre-incubation of the radiopharmaceutical with

recombinant VEGFR2-Fc, a main liver and spleen uptake, with reduced signal

from kidneys, was detected, resembling the typical biodistribution of a non-

specific radiolabelled antibody (Figure 7). The overall uptake in tissues was

lower and the uptake in the tumor was consistently reduced. Similar findings

were obtained after the pre-injection of a 100 fold molar excess of unlabelled

VEGF165 with the exception of the signal from kidneys, which looks similar to

the signal obtained with labelled VEGF only. Calculated T/B ratios for the “HOT”

group reflected the data obtained with the previous experiments with a

maximum uptake reached at 1 h that slowly decreases with time. The T/B ratio

187

in the TRAP group was reduced by 70% due to the co-incubation with VEGFR2-

Fc at 1 h and the T/B ratio in the “COLD” group was reduced by 60% at 1 h.

Minor blocking was evident at 3 h in both TRAP and “COLD” group mainly due

to the decreased activity in tumors of the control group.


IHC analysis on excised tumor showed the presence of VEGF, VEGFR1 and

VEGFR2 on both the lesion and the surrounding vessels at different extents

(Figure 8). After semi-quantitative analysis of expression levels, a higher

amount of free VEGF was present in lesions derived from K1 cell lines (33.2%),

followed by HT29 (15.7%) and ARO cells (10.6%). VEGFR1 and 2 were present

heterogeneously between tumor cells and blood vessels, revealing that even

cancer may express VEGF receptors on the plasma membrane. IHC data were

compared with the uptake of radioactive VEGF165 and an inverse correlation

was observed between endogenous VEGF and T/B ratio (r2=0.63; p=0.03,

Figure 9). On the other hand, a positive correlation was observed between

radioactive VEGF165 uptake and VEGFR1 (r2=0.64; p=0.03, Figure 9). In

addition, tumor weight positively correlates with VEGF production (r2=0.65;

p=0.03) and shows a trend to inversely correlate with radiolabelled VEGF

uptake (r2=0.31; p=0.35).

Discussion

Imaging of tumor microenvironment has been described as a promising

approach for non-invasive diagnosis of cancer metastases and to monitor the

efficacy of new anti-angiogenic drugs (23). Given their role in metastatization

and tumor growth VEGF and its receptors are optimal diagnostic and

therapeutic targets. As an example, in undifferentiated thyroid cancer, the use

of TKIs blocking the VEGF/VEGFR pathway showed its potential as a promising

therapeutic approach (24). Unfortunately, severe side effects have been

188

reported in some patients after long time treatment. Therefore, a non-invasive

diagnostic tool to predict the response to therapy and evaluate drug efficacy is

vitally needed. In the past many attempts have been done to develop

radiopharmaceuticals to image angiogenesis with promising results. Among

them, 111In, 89Zr or 64Cu radiolabelled bevacizumab was able to efficiently

image xenograft from ovarian cancer, but the high radiation burden to the

patient and the low availability of 89Zr and 64Cu were some of the drawbacks

of its use (25). Other groups tried to use recombinant human VEGF to

overcome the long half-life of mAbs and used radioiodine, 99mTc, 64Cu or

68Ga as the isotopes of choice (10, 14). In the present study, we followed the

same approach to strengthen the hypothesis that the use of recombinant

human VEGF to target angiogenesis is a promising methodology to develop

non-invasive diagnostic tools and monitor novel targeted drugs development. In

addition we improved the labelling method to produce a high specific activity

and highly stable radiopharmaceutical to bind VEGFR with high binding affinity

and avoid misinterpretation of in vivo studies. Furthermore, the use of

picomolar amounts of radiolabelled VEGF for a scintigraphic study should not

raise any concern about a potential biologic effect of such radiopharmaceuticals

and in particular on the pro-angiogenic effect that VEGF analogues may have

on existing blood vessels. Thus, in vivo results allowed us to image tumor

angiogenesis in xenografts from three different human cell lines with high T/B

ratio between 1 and 3 h post-injection (max T/B at 1 h for HT29 was 4.5).

Nevertheless a high liver uptake was observed in all mice till late time points,

confirming previous findings from other groups (26). Backer et al. raised the

problem that VEGF-based probes uptake in the tumor area is highly

heterogeneous, probably because of the combination of several mechanisms

like non-uniform perfusion of tumor vasculature, differential receptor occupancy

by host VEGF or differential accessibility of VEGF receptors on luminal and

subluminal surfaces of the endothelium (27). Moreover, it has been reported by

Chen et al. (28) that tumor size negatively influence the uptake of radiolabelled

VEGF by the tumor, probably because of the presence of necrotic areas. To

address, in particular, the role of necrosis and endogenous VEGF production,

189

we performed histological and immunohistochemical analysis of each tumor

imaged with 99mTc-VEGF165. Results confirmed variability in VEGFR1 and

VEGFR2 receptor expression and ligand occupancy in both host endothelium

and cancer cells. Moreover, we confirm that bigger tumors show lower uptake

of radiolabelled VEGF, despite we did not observe the presence of significant

necrotic areas in any tumor. On the other hand, we observed a positive

correlation between tumor size and production of endogenous VEGF (p=0.03),

suggesting that the reduced tumor uptake of the radiopharmaceutical could

depend on saturation of VEGFRs rather that size or necrosis, as previously

suggested (27, 28). Therefore, this study highlights an important aspect that

has not been considered before: the role of both endogenous VEGF production

and VEGFR expression on imaging strategies. While for other ligand receptor

system, the endogenous production of the ligand may not be highly relevant for

imaging the receptor ligand (i.e. IL-2 and IL-2 receptor), (29, 30), here we

show that the high production of endogenous VEGF by tumor cells hampers the

possibility to image its receptors. In the light of our results we can better

interpret previously published studies with radiolabelled VEGF (both VEGF121

and VEGF165) (26, 31) that showed very poor tumor uptake, in contrast with

studies with radiolabelled anti-VEGF mAb that showed high tumor uptake (32).

All together, these data confirm that the presence of high VEGF levels in

tumors, particularly those advanced with highly hypoxic tumor

microenvironment and aggressive phenotypes, may saturate VEGF receptors,

thus limiting the possibility to image receptors. Overexpression of soluble

VEGFR in some tumors and significant sequestration of VEGF on cell surface

heparin-sulfate proteoglycans may also contribute to highly variable imaging

results in different tumors. One possible limitation of our study is the limited

number of animals used. However, in mice bearing K1 tumors, or ARO or HT29,

we found highly consistent data supporting the very low variability within the

same cell line. Nevertheless, different tumors showed different levels of

VEGF/VEGFR. Another possible limitation could be that the semi-quantitative

evaluation of VEGF189 that we performed by immunohistochemistry may not

represent the real production of VEGF121 and VEGF165. However, these forms

190

are splicing variants of the same molecule and usually expressed in similar

quantities (33). Overall we believe that the above considerations may have a

limited impact on the final conclusion that VEGFR imaging in tumors by using

radiolabelled VEGF is extremely variable, influenced by the presence of

endogenous VEGF and unrelated to VEGFR receptor expression. It can be

extrapolated that an accurate in vivo evaluation of tumor angiogenesis should

include both VEGF and VEGFR imaging, unless it will be demonstrated the

predominant clinical relevance of one over the other. Finally, the development

of a VEGF superantagonist may be important either for its ability to bind the

receptor without inducing internalization (downmodulation), either to block the

VEGFR signalling.

Conclusions

Imaging of angiogenesis by targeting VEGFR with radiolabelled VEGF analogues

may be a complementary approach to evaluate angiogenic status of tumors.

This approach may allow the evaluation of anti-angiogenic drugs at both

preclinical and clinical stages in combination with VEGF imaging. Our results

indicate that VEGFR expression is variable in both tumors and its imaging is

hampered by endogenous VEGF production. Therefore, additional studies are

required to fully understand the VEGF/VEGFR relationships in different cancers

and establish a more accurate and angiogenic phenotype-determined imaging

protocols.

Acknowledgments

This STUDY was funded by grants from the Italian Association for Cancer

Research (AIRC IG-2013 14151) and by “Sapienza” University research projects.

We also wish to acknowledge the no-profit association Nuclear Medicine

Discovery for support.

Disclosure

Authors have no competing financial interests except for BW and MS that are

personnel of Trophogen Inc. and therefore have potential financial interests.

191

REFERENCES

1) Folkman J. Angiogenesis in cancer, vascular, rheumatoid and other

disease. Nat Med 1995;1:27-31.

2) Carmeliet P, Jain RK. Angiogenesis in cancer and other diseases. Nature

(Lond) 2000;407:249-257.

3) Neufeld G, Cohen T, Gengrinovitch S, Poltorak Z. Vascular endothelial

growth factor (VEGF) and its receptors. FASEB J 1999;13:9-22.

4) De Araujo-Filho VJ, Alves VA, de Castro IV et al. Vascular endothelial

growth factor expression in invasive papillary thyroid carcinoma. Thyroid

2009;19:1233-1237.

5) Weidner N, Carrol PR, Flax J, Blumenfeld W, Folkman J. Tumor

angiogenesis correlates with metastasis in invasive prostate carcinoma. Am J

Pathol 1993;143:401-409.

6) Joseph IB, Nelson JB, Denmeade SR, Isaacs JT. Androgens regulate

vascular endothelial growth factor content in normal and malignant prostatic

tissue. Clin Cancer Res 1997;3:2507-2511.

7) Hurwitz H, Fehrenbacher L, Cartwright T et al. Bevacizumab (a

monoclonal antibody to vascular endothelial growth factor) prolongs survival in

first-line colorectal cancer (CRC): results of a phase III trial of bevacizumab in

combination with bolus IFL (irinotecan, 5-fluorouracil, leucovorin) as first-line

therapy in subjects with metastatic CRC, in Proceedings of the Annual Meeting

of the American Society of Clinical Oncology; 2003 May 31; Chicago, IL. Vol 22,

pp 3646, American Society of Clinical Oncology, Chestnut Hill, MA.

8) Gruber JJ, Colevas AD. Differentiated Thyroid Cancer: Focus on Emerging

Treatments for Radioactive Iodine-Refractory Patients. Oncologist. 2015

Feb;20:113-26.

9) Gotink KJ, Verheul HMW. Anti-angiogenic tyrosine kinase inhibitors: what

is their mechanism of action? Angiogenesis. 2010;13: 1–14.

192

10) Blankenberg FG, Levashova Z, Sarkar SK, Pizzonia J, Backer MV, Backer

JM. Noninvasive assessment of tumor VEGF receptors in response to treatment

with pazopanib: a molecular imaging study. Transl Oncol. 2010 Feb;3:56-64.

11) Toi M, Inada K, Suzuki H, Tominaga T. Tumor angiogenesis in breast

cancer: its importance as a prognostic indicator and the association with

vascular endothelial growth factor expression. Breast Cancer Res Treat

1995;36:193-204.

12) Folkman J. Angiogenesis: an organizing principle for drug discovery? Nat

Rev Drg Discov. 2007;6:273-286.

13) Cai W, Rao J, Gambhir SS. How molecular imaging is speeding up anti-

angiogenic drug development and testing. Nat Clin Pract Oncol. 2007;4:556-

557.

14) Dijkgraaf I, Boerman OC. Molecular imaging of angiogenesis with SPECT.

Eur J Nucl Med Mol Imaging. 2010;37 Suppl 1:S104-13.

15) Cai W, Chen X. Multimodality molecular imaging of tumor angiogenesis. J

Nucl Med. 2008;49:113S–128S.

16) Laemmli UK. Cleavage of structural proteins during the assembly of the

head of bacteriophage T4. Nature 1970;227:680-685.

17) Zenner HL, Collinson LM, Michaux G, Cutler DF. High-pressure freezing

provides insights into Weibel-Palade body biogenesis. J Cell Sci 2007;120(Pt

12):2117-25.

18) Ke CC, Liu RS, Yang AH et al. CD133-expressing thyroid cancer cells are

undifferentiated, radioresistant and survive radioiodide therapy. Eur K Nucl Med

Mol Imaging. 2013;40:61-71.

19) Paudyal B, Paudyal P, Shah D, Tominaga H, Tsushima Y, Endo K.

Detection of vascular endothelial growth factor in colon cancer xenografts using

bevacizumab based near infrared fluorophore conjugate. J Biomed Sci

2014;21:35.

20) Galli F, Manni I, Piaggio G, et al. (99m)Tc-labeled-rhTSH analogue

(TR1401) for imaging poorly differentiated metastatic thyroid cancer. Thyroid

2014;24:1297-308.

193

21) Bjorke H, Andersson K. Automated, high-resolution cellular retention and

uptake studies in vitro. Appl Radiat Isot 2006;64:901-905.

22) Soluri A, Massari R, Trotta C et al. New imaging probe with crystals

integrated in the collimator’s square holes. Nucl Instrum Methods Phys Res A

2005;554:331-339.

23) Stacy MR, Maxfield MW, Sinusas AJ. Targeted Molecular Imaging of

Angiogenesis in PET and SPECT: A Review. Yale J Biol Med. 2012 Mar;85:75-86.

24) Schneider TC, Abdulrahman RM, Corssmit EP, Morreau H, Smit JW,

Kapiteijn E. Long-term analysis of the efficacy and tolerability of sorafenib in

advanced radio-iodine refractory differentiated thyroid carcinoma: final results

of a phase II trial.Eur J Endocrinol. 2012;167:643-50.

25) Stollman TH, Scheer MG, Franssen GM, Verrijp KN, Oyen WJ, Ruers TJ,

Leenders WP, Boerman OC. Tumor accumulation of radiolabeled bevacizumab

due to targeting of cell- and matrix-associated VEGF-A isoforms. Cancer Biother

Radiopharm. 2009;24:195-200.

26) Blankenberg FG, Backer MV, Levashova Z, Patel V, Backer JM. In vivo

tumor angiogenesis imaging with site-specific labeled (99m)Tc-HYNIC-VEGF.

Eur J Nucl Med Mol Imaging 2006;33:841-8.

27) Backer MV, Levashova Z, Patel V et al. Molecular imaging of VEGF

receptors in angiogenic vasculature with single chain VEGF-based probes. Nat

Med 2007;13:504-9.

28) Chen K, Cai W, Li ZB, Wang H, Chen X. Quantitative PET imaging of

VEGF receptor expression. Mol Imaging Biol. 2009;11:15-22.

29) Signore A, Chianelli M, Annovazzi A et al. 123I-interleukin-2 scintigraphy

for in vivo assessment of intestinal mononuclear cell infiltration in Crohn’s

disease. J Nucl Med 2000;41:242-9.

30) Signore A, Capriotti G, Chianelli M, Bonanno E, Galli F, Catalano C,

Quintero AM, De Toma G, Manfrini S, Pozzilli P; Action LADA Group. Detection

of insulitis by pancreatic scintigraphy with 99mTc-labeled IL-2 and MRI in

patients with LADA (Action LADA 10). Diabetes Care. 2015;38:652-8.

31) Kang CM, Koo HJ, Choe YS, Choi JY. 68Ga-NODAGA-VEGF121 for in vivo

imaging of VEGF receptor expression. Nucl Med Biol 2014;41:51-7.

194

32) Gaykema SB, Browers AH, Lub-de Hooge MN et al. 89Zr-bevacizumab

PET imaging in primary breast cancer. J Nucl Med 2013;54:1014-8.

33) Cai C, Bottcher MC, Werner JA, Mandic R. Differential expression of

VEGF121, VEGF165 and VEGF189 in angiomas and squamous cell carcinoma

cell lines of the head and neck. Anticancer Res 2010;30:805-10.

195

Figure. 1. HPLC profile showing UV (black) and radioactive (grey)

chromatograms of 99mTc-HYNIC-VEGF165.

Figure 2. Stability assay in saline and human serum (left panel) and cysteine

challenge (right panel) of 99mTc-HYNIC-VEGF165.

196

Figure 3. SDS-Page electrophoresis in non-reducing conditions showing native

(1), conjugated (2) and radiolabelled VEGF165 (4). Lanes 3 and 5 represents

the molecular weight marker and scan of well 4 with a linear radioactivity

scanner.

Figure 4. Kinetic binding assay of radiolabelled VEGF165 on HUVEC cells.

Fitting was obtained by nonlinear regression analysis determining kon (1.45 x

108), koff (0.0279) and kD (192 pM).

197

Figure 5. Single organ counts at 1 h (white bar), 3 h (black bar), 6 h (dotted

bar), and 24 h (lined bar). Data are shown as %ID/g (a) and %ID/organ (b)

over time. Each point is the mean of three mice. Error bars represent standard

deviation.

198

Figure 6. T/B ratios calculated at 1h, 3h and 6h in mice bearing a ARO (black

bar), HT29 (squared bar) or K1 (white) xenograft. Each point is the mean of

three mice. Error bars represent standard deviation.

199

Figure 7. a) Body images (top) and particulars of the back (bottom) of the

same mouse injected with 5.5 MBq of 99mTc-VEGF (left), 5.5 MBq of 99mTc-

VEGF following pre-incubation with a 3.5 fold molar excess of VEGFR2-Fc

(middle) and 5.5 MBq of 99mTc-VEGF following pre-injection of a 100 fold

molar excess of unlabelled VEGF (right). b) T/B ratios at 1 h and 3 h calculated

on the images obtained from the HOT (99mTc-VEGF), COLD (99mTc-

VEGF+unlabelled VEGF) and TRAP (99mTc-VEGF+VEGFR2-Fc) groups. Values

are the mean of 3 mice per each group and images were acquired at 1 h p.i.

Error bars represent standard deviation.

200

Figure 8. IHC analysis of VEGF and VEGFRs expression on HT29, K1 and ARO

excised tumors.

Figure 9. Correlation between 99mTc-VEGF165 uptake and VEGFR1 positive

cells (%) (a) and between 99mTc-VEGF165 uptake and VEGF positive cells (%)

(b) in ARO (grey), HT29 (white) and K1 (black) cell lines.

201

Chapter 9

Conclusions and future perspectives

Biomarkers, Growth Factors and Cytokines represent, owing to their complex

interactions within human normal and pathological tissues, the last frontier in

biological and medical research. Many progresses have been made in the last

20 years in the knowledge of different biomarkers and growth factors (such as

VEGF, Neurotrophins, TGF , and many others) as well as inflammatory

cytokines whose involvement in neoplastic, infectious and degenerative human

pathologies is now well ascertained. The real and hard challenge of modern

clinical research is represented by the discovery of new biological tissue targets

useful to modulate the activity of biomarkers, growth factors and cytokines and

to suppress or to downregulate their effects in humans with different diseases.

With regard to the clinical setting, the most important techniques for molecular

imaging are certainly PET and MRI. For preclinical studies specialized imaging

devices, that include small-animal PET, SPECT instrumentation, small-animal

MRI, and optical imaging devices for fluorescence and bioluminescence, are

currently available for studies of rodents and other animal species. In addition

to molecular imaging probes, these devices enable pharmacokinetic and

pharmacodynamic studies in animal models of cancer and in humans (1). The

knowledge of real distribution and localization of the above mentioned

biological molecules within human tissues represents an effective possibility to

address efforts and resources toward the identification of new therapeutic

strategies. Also immunohistochemistry may reveal tissue targets useful to reach

and to destroy tumour cells and metastases. Some experimental studies of our

team demonstrated interesting perspectives in the detection of VEGF and its

receptors immunoreactivity in an experimental mouse model transplanted with

202

neoplastic cultured cells. A visible target is a target that may be more easily

destroyed. The main difficulty remains still the possibility of tumor targeting

thus allowng the cure avoiding damage and destruction of normal tissues. In

this perspective, 89Zr-labelled radiopharmaceuticals may be useful bullets to

target angiogenesis and VEGF/VEGFR expression in tissues. PET imaging with

89Zr-bevacizumab may have a useful role in patient selection for bevacizumab-

related therapy as it would indicate accessibility of the antibody to VEGF-A

targets. 89Zr-bevacizumab might be potentially valuable for biologic

characterization of tumors and for prediction and evaluation of the effect of

VEGF-A–targeting therapeutics. VEGF-A is reported in several studies to be

overexpressed in malignant breast tumors and in ductal carcinoma “in situ”,

thus covering the full spectrum from early-stage breast cancer to more

advanced stages. Frequently VEGF-A staining was found to be related to

aggressiveness as assessed by VEGF-A staining in studies with breast tumors.

89Zr-bevacizumab PET proved to be able to detect a broad range of VEGF-A

expression levels. Quantitative tumor analyses showed a more than 10-fold

difference between individual SUVmax measurements, suggesting large

differences in VEGF-A tumor levels between patients. For these reasons 89Zr-

bevacizumab might be potentially valuable for biologic characterization of

tumors and for prediction and evaluation of the effect of VEGF-A–targeting

therapeutics. More and more deeped clinical studies are necessary to

ameliorate our knowledge of targeting of radiolabelled antibodies to tumor

tissues, but the encouraging results reported in the literature lead us to hope in

a not too distant future for a better management of primitive neoplastic and

metastatic lesions in nuclear medicine. However, imaging of VEGF and VEGFR

has not furnished exceptional results up to date and this finding may depend on

different factors whose relevance is probably based on three fundamental

conditions that are discussed as follows:

1) Scarcity and/or variable expression of the tissue target

2) Low affinity of the radiolabeled drug to the target

3) “In vivo” saturation of VEGFR binding sites by soluble VEGF

203

Scarcity and/or variable expression of the tissue target

Some experimental animal studies has demonstrated an important variability of

the expression of VEGF and VEGFR in canine tumor models and even in the

previously published literature on this topic there are different evidences about

this finding. In fact, the identification of VEGF and VEGFR-2 in most canine

simple mammary gland adenocarcinomas (SMGAs), and the presence of a

moderate correlation between VEGF expression and PI (Proliferation Index)

may indicate that VEGF promotes tumor growth and development by an

autocrine loop (2). These finding in dogs are similar to the ones described for

human breast cancer cells, which have been shown to have an autocrine VEGF

activity (3). This behaviour modality allows a survival signal for tumor cells

through the activation of the PI3/Akt pathway (4). Breast carcinoma cell line

coltures reveal also the reduction of VEGF expression with a significant

decrease in the basal activity of PI3-kinase possibly inducing apoptosis (5).

Vascular endothelial growth factor autocrine signaling may also ensure an

increased expression of the chemokine receptor CXCR4 on tumor cells surface

(5). Moreover, the binding of this receptor to its ligand, stromal-derived factor-

1, stimulates tumor cell migration (6). In the literature has been reported a

moderate correlation between VEGF and histologic grade. In agreement with

this observation, a previous study found a significant difference in the number

of VEGF positive cells among the different histologic grade groups of malignant

canine mammary tumors (7). The absence of correlation between VEGFR-2 and

histologic grade in SMGAs in this study may be related to sample size, or may

indicate that VEGFR-2 is not related to histologic grade. On the contrary, in

some human tumours (such as the urothelial ones), experimental evidences

appear to be different in comparison to those found in canine neoplastic

models. In fact, according to Xia et al. (8), an increased VEGFR2 expression

correlates with several features that predict progression of urothelial cancer,

including disease stage and invasive phenotype. It is reasonable to assume that

the individual variability of size, development, vascularization, invasivity and

http://www.ncbi.nlm.nih.gov/pmc/articles/PMC2942048/#b46-cvj_10_1109





204

other different parameters may influence expression and detection of VEGF and

VEGF receptors in different species and models, as well as in a single patient.

Low affinity of the radiolabeled drug to the target

The right approach to a nuclear medicine treatment for a neoplastic malignant

pathology cannot disregard some fundamental parameters: 1) to identify the

'correct', biologically active concentration and dose schedule; 2) to select the

patients likely to benefit from treatment; 3) the monitoring of the inhibition of

the target protein or pathway; 4) the assessment of the response of the tumor

to therapy (1). All the above mentioned parameters are important for the

planning of the therapy, but they cannot prescind from the real affinity of

radiolabelled drugs to the target. In fact, this is the crucial problem in more

clinical conditions in which failure of the therapy may be related to an

unsatisfactory binding of the drug to the target. A possible mechanism involves

the low affinity of a radiolabelled drug to its target. Substantial differences in

the rates of drug clearance from the tumor have been observed among

different patients and tumor types. This heterogeneous pharmacokinetic

response might explain the lack of effectiveness of treatment in some patients.

Discrepancies between the plasma pharmacokinetics of the drug and the rate of

drug clearance from tumors have been determined by PET. In patients with

multiple lesions, intratumoral drug concentrations varied up to 3.4-fold. This

variance indicates that plasma pharmacokinetics cannot be used to predict

intratumoral drug concentrations. Radiolabeling of drugs frequently cannot

provide useful imaging probes for monitoring target inhibition because uptake

of the drug in the tumor may be characterized by a nonspecific binding to the

cell membrane or other cellular components. Moreover, notwithstanding the

drug concentration does not need to be higher at the target relative to the

surrounding tissues, this is a necessary condition for imaging probes (1).

205

“In vivo” saturation of VEGFR binding sites by soluble VEGF

Vempati et al. (9) in a complex and very nice study demonstrated that the

computational model predicts that the steady-state distribution of soluble VEGF

is isoform-independent when considering only diffusion and matrix binding.

They demonstrated also that differences in VEGF gradients can arise from

differences in VEGF degradation. VEGF degradation depends on two main

mechanisms: 1) a soluble VEGF degradation model; 2) a matrix-sequestered

VEGF degradation model. In any case VEGF degradation is related also to

various causes, including VEGF inactivation by isoform-selective VEGF inhibitors,

e.g. connective tissue growth factor, sVEGFR1, thrombospondin-1, or by

proteases that can cleave VEGF to fragments that are not recognized by

commonly employed antibodies (9). In any case, the mechanism of protease-

mediated redistribution of VEGF activity is very complex and is influenced by

multiple parameters. For instance proteases increase the functional soluble

VEGF concentration by inhibiting the process of VEGF degradation. Different

modes of VEGF redistribution, such as through MMP9, heparinases, or VEGF

inhibitor cleavage are implicated as pro-tumorigenic, mediating an angiogenic

switch. However, there are several notable exceptions where protease activity

instead leads to diminished tumor growth , an effect similar to the plasmin-

mediated loss of wound healing due to a loss of angiogenesis. According to

Vempati et al. (9), sprout formation and the subsequent patterning may be the

result of a complex, temporal orchestration of multiple extracellular VEGF

fractions, receptor signaling states, and cell types. VEGF and VEGFR “in vivo”

dynamics are also more complex than those observed in different “in vitro”

systems, even for a more rapid degradation and catabolism of biological

molecules in the “in vivo” systems. The possibility that an “in vivo” saturation of

VEGFR binding sites by soluble VEGF might therefore explain certain inefficacies

occurring during nuclear medicine treatment in animals and humans affected by

tumoral pathologies. In the near future might be important to elucidate these

hypotheses by further experimental studies addressed to answer to these

questions by combined nuclear medicine and immunohistochemistry

206

techniques. The contemporary use of radiolabelled anti-VEGF ed anti-VEGFR

drugs might be useful for a more accurate “in vivo” quantification of neoplastic

and non neoplastic angiogenesis.

207

References

1) Weber W.A, Czernin J., Phelps M.E. and Herschman H.R. Technology Insight:

novel imaging of molecular targets is an emerging area crucial to the development of

targeted drugs.Nature Clinical Practice Oncology(2008) 5,44-54.

2) Al-Dissi A.N., Haines D.M, Singh B. and Kidney B.A. Immunohistochemical

expression of vascular endothelial growth factor and vascular endothelial growth factor

receptor-2 in canine simple mammary gland adenocarcinomas Can Vet J. 2010 Oct;

51(10): 1109–1114.

3) Weigand M., Hantel P., Kreienberg R., Waltenberger J. Autocrine vascular

endothelial growth factor signalling in breast cancer. Evidence from cell lines and

primary breast cancer cultures in vitro. Angiogenesis. 2005; 8(3):197-204.

4) Bachelder R.E., Crago A., Chung J., Wendt M.A., Shaw L.M., Robinson

G., Mercurio A.M. Vascular endothelial growth factor is an autocrine survival factor for

neuropilin-expressing breast carcinoma cells. Cancer Res. 2001; 61:5736–540.

5) Bachelder R.E., Wendt M.A., Mercurio A.M. Vascular endothelial growth factor

promotes breast carcinoma invasion in an autocrine manner by regulating the

chemokine receptor CXCR4. Cancer Res. 2002;62:7203–7206.

6) Muller A., Homey B., Soto H., Ge N., Catron D., Buchanan M.E., McClanahan

T., Murphy E., Yuan W., Wagner S.N., Barrera J.L., Mohar A.,Verástegui E., Zlotnik A.

Involvement of chemokine receptors in breast cancer

metastasis. Nature. 2001;410:50–56.

7) Restucci B., Papparella S., Maiolino P., De Vico G. Expression of vascular

endothelial growth factor in canine mammary tumors. Vet Pathol. 2002;39:488–493.

8) Xia G., Kumar S.R., Hawes D., Cai J., Hassanieh L., Groshen S., Zhu S., Masood

R., Quinn D.I., Broek D., Stein J.P., Gill P.S. Expression and significance of vascular

endothelial growth factor receptor 2 in bladder cancer. J Urol. 2006 Apr;175(4):1245-

52.

9) Vempati P, Popel AS, Mac Gabhann F. Formation of VEGF isoform-specific

spatial distributions governing angiogenesis: computational analysis. BMC Syst Biol.

2011 May 2;5:59.

http://www.ncbi.nlm.nih.gov/pubmed/?term=Al-Dissi%20AN%5Bauth%5D

http://www.ncbi.nlm.nih.gov/pubmed/?term=Haines%20DM%5Bauth%5D

http://www.ncbi.nlm.nih.gov/pubmed/?term=Singh%20B%5Bauth%5D

http://www.ncbi.nlm.nih.gov/pubmed/?term=Kidney%20BA%5Bauth%5D

http://www.ncbi.nlm.nih.gov/pubmed/?term=Wendt%20MA%5BAuthor%5D&cauthor=true&cauthor_uid=11479209

http://www.ncbi.nlm.nih.gov/pubmed/?term=Shaw%20LM%5BAuthor%5D&cauthor=true&cauthor_uid=11479209

http://www.ncbi.nlm.nih.gov/pubmed/?term=Robinson%20G%5BAuthor%5D&cauthor=true&cauthor_uid=11479209

http://www.ncbi.nlm.nih.gov/pubmed/?term=Robinson%20G%5BAuthor%5D&cauthor=true&cauthor_uid=11479209

http://www.ncbi.nlm.nih.gov/pubmed/?term=Mercurio%20AM%5BAuthor%5D&cauthor=true&cauthor_uid=11479209

http://www.ncbi.nlm.nih.gov/pubmed/?term=Ge%20N%5BAuthor%5D&cauthor=true&cauthor_uid=11242036

http://www.ncbi.nlm.nih.gov/pubmed/?term=Catron%20D%5BAuthor%5D&cauthor=true&cauthor_uid=11242036

http://www.ncbi.nlm.nih.gov/pubmed/?term=Buchanan%20ME%5BAuthor%5D&cauthor=true&cauthor_uid=11242036

http://www.ncbi.nlm.nih.gov/pubmed/?term=McClanahan%20T%5BAuthor%5D&cauthor=true&cauthor_uid=11242036

http://www.ncbi.nlm.nih.gov/pubmed/?term=McClanahan%20T%5BAuthor%5D&cauthor=true&cauthor_uid=11242036

http://www.ncbi.nlm.nih.gov/pubmed/?term=Murphy%20E%5BAuthor%5D&cauthor=true&cauthor_uid=11242036

http://www.ncbi.nlm.nih.gov/pubmed/?term=Yuan%20W%5BAuthor%5D&cauthor=true&cauthor_uid=11242036

http://www.ncbi.nlm.nih.gov/pubmed/?term=Wagner%20SN%5BAuthor%5D&cauthor=true&cauthor_uid=11242036

http://www.ncbi.nlm.nih.gov/pubmed/?term=Barrera%20JL%5BAuthor%5D&cauthor=true&cauthor_uid=11242036

http://www.ncbi.nlm.nih.gov/pubmed/?term=Mohar%20A%5BAuthor%5D&cauthor=true&cauthor_uid=11242036

http://www.ncbi.nlm.nih.gov/pubmed/?term=Ver%C3%A1stegui%20E%5BAuthor%5D&cauthor=true&cauthor_uid=11242036

http://www.ncbi.nlm.nih.gov/pubmed/?term=Zlotnik%20A%5BAuthor%5D&cauthor=true&cauthor_uid=11242036

http://www.ncbi.nlm.nih.gov/pubmed/?term=Xia%20G%5BAuthor%5D&cauthor=true&cauthor_uid=16515971

http://www.ncbi.nlm.nih.gov/pubmed/?term=Kumar%20SR%5BAuthor%5D&cauthor=true&cauthor_uid=16515971

http://www.ncbi.nlm.nih.gov/pubmed/?term=Hawes%20D%5BAuthor%5D&cauthor=true&cauthor_uid=16515971

http://www.ncbi.nlm.nih.gov/pubmed/?term=Cai%20J%5BAuthor%5D&cauthor=true&cauthor_uid=16515971

http://www.ncbi.nlm.nih.gov/pubmed/?term=Hassanieh%20L%5BAuthor%5D&cauthor=true&cauthor_uid=16515971

http://www.ncbi.nlm.nih.gov/pubmed/?term=Groshen%20S%5BAuthor%5D&cauthor=true&cauthor_uid=16515971

http://www.ncbi.nlm.nih.gov/pubmed/?term=Zhu%20S%5BAuthor%5D&cauthor=true&cauthor_uid=16515971

http://www.ncbi.nlm.nih.gov/pubmed/?term=Masood%20R%5BAuthor%5D&cauthor=true&cauthor_uid=16515971

http://www.ncbi.nlm.nih.gov/pubmed/?term=Masood%20R%5BAuthor%5D&cauthor=true&cauthor_uid=16515971

http://www.ncbi.nlm.nih.gov/pubmed/?term=Quinn%20DI%5BAuthor%5D&cauthor=true&cauthor_uid=16515971

http://www.ncbi.nlm.nih.gov/pubmed/?term=Broek%20D%5BAuthor%5D&cauthor=true&cauthor_uid=16515971

http://www.ncbi.nlm.nih.gov/pubmed/?term=Stein%20JP%5BAuthor%5D&cauthor=true&cauthor_uid=16515971

http://www.ncbi.nlm.nih.gov/pubmed/?term=Gill%20PS%5BAuthor%5D&cauthor=true&cauthor_uid=16515971




208

Chapter 10

Summary

Despite the success of antiangiogenic therapy, a large percentage of patients

does not benefit from this targeted therapy. Currently, it is impossible to predict

which patient will benefit from antiangiogenic therapy. Reasons for treatment

failure may be that the target for the drug is not present or that the drug may

not reach the target. Tumor cells produce VEGF, which can lead to paracrine

effects in the microenvironment. VEGF121 is freely soluble, whereas VEGF165 is

secreted, though a significant fraction remains localized to the extracellular

matrix, such as VEGF189 and VEGF206. This will most likely lead to locally high

VEGF levels. It is currently impossible to evaluate these local VEGF levels .

Noninvasive measurement of VEGF in the tumor (IHC, PCR, Western blotting)

might give insight to the available target for VEGF-dependent antiangiogenic

therapy and thus assist in tumor response prediction. Moreover, growth factors

and cytokines expression in normal and pathological tissues substantially

changes in different clinical and physiological conditions. These variations

(whose different tissue expressions may be effectively studied by

immunohistochemistry) are important and constitute the biological basis for a

correct tissue analysis. The last one may represent a previous modality

screening and a precious therapeutical support in order to ameliorate the

knowledge of nuclear medicine targets in oncological patients. Given these

assumptions reported in the 1st chapter of the thesis, in the 2nd chapter has

been studied the expression of neurotrophins in human meningiomas

confirming a potential role of NGF, BDNF and TrKB in the control of

development and proliferation of meningiomas; in the 3rd chapter of the thesis

have been studied neurotrophins, their receptors and Ki-67 in GH-secreting

human pituitary adenomas showing a very strong expression of NT-3 and its

receptor TrKC was observed in the extracellular matrix (ECM) and vessel

endothelium, together with a clear/marked presence of BDNF and its receptor

209

TrKB, thus confirming their direct involvement in the progression of pituitary

adenomas; in the 4th chapter of the thesis has been proved the increased

expression of immunoreactivity for VEGF, TGF-β and PGE2 in pteryigium tissue

and this finding has a relevant importance in the knowledge of inflammatory

mechanism which accompanies and promote this pathological condition; in the

5th chapter, in the study performed on cell cultures and neoplastic tissue

harvested from human osteosarcomas, we observed a generally relevant

positive immunoreaction for NGF – TrKA – NT3 – TrKC in the cytoplasmic

compartment and for NT-4 in the nucleus of tumoural bone cells, suggesting a

direct role of these molecules in increasing the cell proliferation rate in the

neoplastic tissue. Moreover, we found a strong expression for BDNF in the

extracellular space, suggesting that this factor directly influences spreading of

neoplastic cells, attributable to an increase in tumor size, also due to a high

vascularization network; in the 6th chapter of this thesis the

immunohistochemical study performed on vestibular schwannomas has proven

that VEGF and TGF-β1 have are putative key mediators of vestibular

schwannoma growth and this finding appears to be of relevance in the growth

and development of these tumors; in the 7th chapter the important role TGF-β,

IL-1β and VEGF-A in the modulation of the growth and proliferation of

Dupuytren’s tissue and cultured myofibroblasts is demonstrated and this finding

led us to postulate a pivotal role for these molecules in the development of

Dupuytren’s contracture; in the 8th chapter our study demonstrates that the

presence of high VEGF levels in tumors, particularly those advanced with highly

hypoxic tumor microenvironment and aggressive phenotypes, may saturate

VEGF receptors, thus limiting the possibility to image receptors; moreover,

overexpression of soluble VEGFR in some tumors and significant sequestration

of VEGF on cell surface heparin-sulfate proteoglycans may also contribute to

highly variable imaging results in different tumors; in the 9th chapter of this

thesis conclusions and future perspectives are also elucidated underlining the

importance of the investigated growth factors and cytokines in the development

and in the control of development of analyzed inflammatory and neoplastic

pathologies.

210

Chapter 11

Samenvatting

Therapie gericht op anti-angiogenese is vaak succesvol, maar desondanks zal

een deel van de patiënten geen voordeel ondervinden van deze behandeling.

Op dit moment is het niet mogelijk te voorspellen welke patiënt wel en welke

patiënt niet zal reageren op de ingestelde therapie. Er zijn verschillende

oorzaken voor het falen van de therapie: het kan zijn dat het target voor het

medicijn niet aanwezig is of dat het medicijn het target niet kan bereiken.

Veel tumorcellen produceren VEGF, wat paracriene (hormonale) effecten tot

gevolg kan hebben voor de cellen in de omgeving. Er zijn verschillende

isoformen van VEGF’s die zich ook nog eens verschillend gedragen. Zo is

VEGF121 vrij oplosbaar, terwijl VEGF165 wordt uitgescheiden. Er blijft echter

ook een belangrijk deel in de extracellulaire matrix, zoals VEGF189 en VEGF206.

Dit zorgt waarschijnlijk tot lokaal hoge concentraties van VEGF. Op dit moment

is het niet mogelijk om deze lokale concentraties te bepalen. Een niet-invasieve

bepaling van VEGF in de tumor (via immunohistochemie, PCR of Western

blotting) zou mogelijk inzicht kunnen geven over de hoeveelheid beschikbare

target voor VEGF afhankelijke therapie en zodoende kunnen bijdragen in het

voorspellen van tumor respons. Bovendien is het zo dat expressie van

groeifactoren en cytokines in normaal en pathologisch weefsel substantieel

verandert bij verschillende condities. Deze variaties in expressielevel (dat via

immunohistochemie bepaald kan worden) zijn belangrijk en vormen de

biologische basis voor een goede weefselanalyse, wat uiteindelijk de kennis van

targets voor medicijnen in oncologische patiënten kan vergroten en kan helpen

in therapiebeslissingen.

Op basis van deze veronderstellingen, die worden weergeven in hoofdstuk 1

van dit proefschrift, is in hoofdstuk 2 de expressie van neurotrophins in humane

211

meningeomen bestudeerd. De potentiele rol voor NGF, BDNF en TrKB in de

ontwikkeling en proliferatie van meningeomen werd hierbij bevestigd.

In hoofdstuk 3 van dit proefschrift werd het level van diezelfde neutrotrophins,

de receptoren hiervan en het level van Ki-67 bepaald in groeihormoon

uitscheidende humane hypofyse-adenomen. Een sterke expressie van NT-3 en

haar receptor TrKC werd gevonden in de extracellulaire matrix en in het

endotheel van bloedvaten, samen met een duidelijke aanwezigheid van BDNF

en haar receptor TrKB. Ook dit bevestigt de directe betrokkenheid van deze

neutrotrophins bij de progressie van hypofyse-adenomen.

In hoofdstuk 4 wordt aangetoond dat er een verhoogde expressie en

immuunreactie is voor VEGD, TGF-β en PGE2 in pterygium. Deze bevinding is

belangrijk voor de kennis van inflammatie die bij deze pathologische conditie

vaak gevonden wordt en mogelijk zelfs veroorzaakt.

In hoofdstuk 5 wordt een studie beschreven die werd uitgevoerd op celkweken

en neoplastisch weefsel van humane osteosarcomen. Een algemene positieve

immuunreactie voor NGF, TrKA, NT3 en TrKC werd gevonden in het cytoplasma

en voor NT-4 in de kernen van de tumorcellen. Dit suggereert dat deze

moleculen een directe rol spelen bij de celproliferatie bij deze tumoren. Verder

werd er een sterke expressie voor BDNF gevonden in de extracellulaire ruimte.

Mogelijk beïnvloedt deze factor direct de verspreiding van neoplastische cellen,

wat kan leiden tot een toename in tumorgrootte en een toename in

vascularisatie rondom.

In hoofdstuk 6 wordt een immunohistochemische studie beschreven in

vestibulaire schwannomen. VEGF en TGF-β1 blijken duidelijke sleutelspelers te

zijn voor groei van deze tumoren. Hoofdstuk 7 beschrijft een belangrijke rol

voor TGF-β, IL-1β en VEGFa bij groei en proliferatie van de ziekte van

Dupuytren en in gekweekte myofibroblasten. Ook hier blijken deze moleculen

een belangrijke rol te spelen in de contracturen die optreden bij Dupuytren.

Hoofdstuk 8 beschrijft de aanwezigheid van hoge concentraties VEGF in

tumoren. Vooral bij die tumoren die veel gebieden met hypoxie hebben en die

212

een agressief fenotype vertonen, kunnen de VEGF receptors verzadigd raken,

waardoor het moeilijk wordt de receptoren af te beelden. Verder kan ook

overexpressie van oplosbaar VEGFR bij sommige tumoren en een significante

sequestratie van VEGF op het celoppervlak van proteoglycanen bijdragen aan

grote variaties in resultaten van afbeeldende modaliteiten in verschillende

tumorsoorten.

In hoofdstuk 9 van dit proefschrift worden conclusies en toekomstperspectieven

beschreven. Het belang van de onderzochte groeifactoren en cytokines in de

controle en ontwikkeling bij de geanalyseerde inflammatoire en neoplastische

aandoeningen wordt nogmaals uiteengezet en verduidelijkt.

213

Chapter 12

CURRICULUM VITAE

Marco Artico, M.D., Pharm. D.

Education and Training

Marco Artico was born in Rome, Italy, on February 24th, 1962.

He graduated magna cum laude in Medicine and Surgery on July 9th, 1986 at

the School of Medicine, “Sapienza” University of Rome.

From 1986 to 1991 he undertook the postgraduate training in Neurosurgery at

“Sapienza” University of Rome (Program Director: Prof. A. Fortuna) and

graduated as Neurosurgeon on July 12th 1991, magna cum laude.

He graduated magna cum laude in Pharmacy on March 21th, 1995 at the School

of Pharmacy, “Sapienza” University of Rome.

From 2009 to 2014 he undertook postgraduate training in Clinical Pathology at

“Sapienza” University of Rome (Program Director: Prof. A. Santoni) and

graduated as Clinical Pathologist on June 25th 2014, magna cum laude.

Appointments and Positions

16/4/1988: Graduate technician at the Chair of Human Anatomy of the School

of Pharmacy, “Sapienza” University of Rome.

12/2/1992: Assistant Professor of Human Anatomy at the School of Pharmacy,

“Sapienza” University of Rome.

1/3/2001-20/09/2010: Associate Professor of Human Anatomy at the School of

Pharmacy, “Sapienza” University of Rome.

214

1/6/2010: Winner of a public selection for Full Professorship in Human

Anatomy, School of Medicine and Surgery, Modena and Reggio Emilia

University, Italy.

21/09/2010-present: Full Professor in Human Anatomy - Faculty of Medicine

and Dentistry, Department of Sensory Organs, “Sapienza” University of Rome.

2/2/2015: ASN (National Scientific Enabling 2013) for Full Professorship in

Human Anatomy.

2001-2013: Member of the Ph.D. Board in Pharmacology and Toxicology,

“Sapienza” University of Rome.

2014-present: Member of the Ph.D. Board in Innovative Technologies in the

Diseases of Bone, Skin and Craniofacial-Oral Compartment, “Sapienza”

University of Rome.

Membership in Professional and Scientific Societies

From 1990 Società Italiana di Anatomia

From 1990 International Congress for Vertebrate Morphology

Grants

PRIN (MIUR – ITALY) Research Grants: 1997, 2006, 2009

2001-2015: University “Sapienza” Research Grants

2009: Alpha-Wassermann research grant

2011-2014: Sovena Foundation (4 different scholarship grants for his PhD

students)

2014: Nobile s.p.a. industry research grant

2015: Nobile s.p.a. industry research grant

Honors and Prizes

1996: “Cesare Frugoni” Prize as the best microsurgeon of the II Corso Teorico-

Pratico di Microchirurgia (Padova, 25-27/1/1996)

1997: Prize as winner of the selection for the best POSTER PRESENTATION in

the XXXVII Congresso Nazionale S.N.O. (Como, 29/5/1997).

215

Publications

1 2016

Di Liddo R, Valente S, Taurone S, Zwergel C, Marrocco B, Turchetta R, Conconi

MT, Scarpa C, Bertalot T, Schrenk S, Mai A, Artico M (2016). Histone

deacetylase inhibitors restore IL-10 expression in lipopolysaccharide-induced

cell inflammation and reduce IL-1β and IL-6 production in breast silicone

implant in C57BL/6J wild-type murine model. Autoimmunity 20:1-11.

2 2016

Bianchi E, Ripandelli G, Taurone S, Feher J, Plateroti R, Kovacs I, Magliulo G,

Orlando MP, Micera A, Battaglione E, Artico M (2016). Age and diabetes related

changes of the retinal capillaries: An ultrastructural and immunohistochemical

study. Int J Immunopathol Pharmacol 29(1):40-53. doi:

10.1177/0394632015615592.

3 2015

D'Andrea Vito, Panarese Alessandra, Taurone Samanta, Cavallotti Carlo, Artico

Marco (2015). Human Lymphatic Mesenteric Vessels: Morphology and Possible

Function of Aminergic and NPY-ergic Nerve Fibers. LYMPHATIC RESEARCH AND

BIOLOGY, vol. 13, p. 170-175, ISSN: 1539-6851, doi: 10.1089/lrb.2015.0018

4 2015

Taurone S, Bianchi E, Attanasio G, di Gioia C, Ierinò R, Carubbi C, Galli D,

Pastore FS, Giangaspero F, Filipo R, Zanza C, Artico M. (2015).

Immunohistochemical profile of cytokines and growth factors expressed in

vestibular schwannoma and in normal vestibular nerve tissue. MOLECULAR

MEDICINE REPORTS, vol. 1, p. 737-745, ISSN: 1791-2997, doi:

10.3892/mmr.2015.3415

5 2015

Bianchi E, Taurone S, Bardella L, Signore A, Pompili E, Chiappetta C, Fumagalli

L, Di Gioia C, Scarpa S, Artico M (2015). Involvement of pro-inflammatory

cytokines and growth factors in the pathogenesis of Dupuytren's contracture: a

novel target for a possible future therapeutic strategy? Bianchi E, Taurone S,

Bardella L, Signore A, Pompili E, Sessa V, Chiappetta C, Fumagalli L, Gioia CD,

Pastore FS, Scarpa S, Artico M. Clin Sci (Lond). 2015 Oct 1;129(8):711-20. doi:








216

10.1042/CS20150088. Epub 2015 Jun 11. PMID: 26201022. CLINICAL

SCIENCE, vol. 8, p. 711-720, ISSN: 0143-5221, doi: 10.1042/CS20150088

6 2015

Bianchi E, Ripandelli G, Feher J, Plateroti A M, Plateroti R, Kovacs I, Plateroti P,

Taurone S, Artico M (2015). Occlusion of retinal capillaries caused by glial cell

proliferation in chronic ocular inflammation. FOLIA MORPHOLOGICA, vol. 74, p.

33-41, ISSN: 0015-5659, doi: 10.5603/FM.2015.0006

7 2015

Taurone Samanta, Ripandelli Guido, Pacella Elena, Bianchi Enrica, Plateroti

Andrea Maria, De Vito Stefania, Plateroti Pasquale, Grippaudo Francesca

Romana, Cavallotti Carlo, Artico Marco (2015). Potential regulatory molecules in

the human trabecular meshwork of patients with glaucoma:

immunohistochemical profile of a number of inflammatory cytokines.

MOLECULAR MEDICINE REPORTS, vol. 11, p. 1384-1390, ISSN: 1791-2997,

doi: 10.3892/mmr.2014.2772

8 2014

Di Liddo R, Grandi C, Dalzoppo D, Villani V, Venturini M, Negro A, Sartore L,

Artico M, Conconi MT, Parnigotto PP (2014). In vitro evaluation of TAT-OP1

osteogenic properties and prospects for in vivo applications. JOURNAL OF

TISSUE ENGINEERING AND REGENERATIVE MEDICINE, vol. 8, p. 694-705,

ISSN: 1932-7005, doi: 10.1002/term.1568

9 2014

F Mignini, M Sabbatini, L Mattioli, M Cosenza, M Artico, C Cavallotti (2014).

Neuro-immune modulation of the thymus microenvironment. INTERNATIONAL

JOURNAL OF MOLECULAR MEDICINE, vol. 6, p. 1392-1400, ISSN: 1107-3756,

doi: doi: 10.3892/ijmm.2014.1709

10 2014

Mignini F, Sabbatini M, Mattioli L, Cosenza M, Artico M, Cavallotti C (2014).

Neuro-immune modulation of the thymus microenvironment (Review).

INTERNATIONAL JOURNAL OF MOLECULAR MEDICINE, vol. 33, p. 1392-1400,

ISSN: 1107-3756

217

11 2014

Di Liddo R, Paganin P, Lora S, Dalzoppo D, Giraudo C, Miotto D, Tasso A,

Barbon S, Artico M, Bianchi E, Parnigotto PP, Conconi MT, Grandi C (2014). Poli-

ε-caprolactone composite scaffolds for bone repair. INTERNATIONAL JOURNAL

OF MOLECULAR MEDICINE, vol. 34, p. 1537-1546, ISSN: 1107-3756, doi:

10.3892/ijmm.2014.1954

12 2013

V D'Andrea, E Bianchi, S Taurone, F Mignini, C Cavallotti, M Artico (2013).

Cholinergic innervation of human mesenteric lymphatic vessels. FOLIA

MORPHOLOGICA, vol. 4, p. 322-327, ISSN: 0015-5659

13 2013

Enrica Bianchi, Paola Mancini, Stefania De Vito, Elena Pompili, Samanta

Taurone, Isabella Guerrisi, Antonino Guerrisi, Vito D'Andrea, Vito Cantisani,

Marco Artico (2013). Congenital asymptomatic diaphragmatic hernias in adults:

a case series. JOURNAL OF MEDICAL CASE REPORTS, vol. 7, p. 125-133, ISSN:

1752-1947, doi: 10.1186/1752-1947-7-125

14 2013

Enrica Bianchi, Marco Artico, Claudio Di Cristofano, Martina Leopizzi, Samanta

Taurone, Marcella Pucci, Pietro Gobbi, Fiorenzo Mignini, Vincenzo Petrozza,

Ivano Pindinello, Maria Teresa Conconi, Carlo Della Rocca (2013). Growth

factors, their receptor expression and markers for proliferation of endothelial

and neoplastic cells in human osteosarcoma. INTERNATIONAL JOURNAL OF

IMMUNOPATHOLOGY AND PHARMACOLOGY, vol. 26, p. 621-632, ISSN: 0394-

6320

15 2013

Mirandola P, Gobbi G, Malinverno C, Carubbi C, Ferné FM, Artico M, Vitale M,

Vaccarezza M (2013). Impact of sulphurous water politzer inhalation on

audiometric parameters in children with otitis media with effusion. CLINICAL

AND EXPERIMENTAL OTORHINOLARYNGOLOGY, p. 7-11, ISSN: 1976-8710,

doi: 10.3342/ceo.2013.6.1.7

218

16 2013

Enrica Bianchi, Giuseppe Magliulo, Dario Marcotullio, Samanta Taurone, R.

Ierino, Elena Pompili, Lorenzo Fumagalli, P.p. Parnigotto, R. Di Liddo, Marco

Artico (2013). Inflammatory profile of neurotrophins, IL-6, IL1-β, TNF-α, VEGF,

ICAM-1 and TGF-β in the human Waldeyer's ring. EUROPEAN JOURNAL OF

INFLAMMATION, vol. 11, p. 763-775, ISSN: 1721-727X

17 2013

F Mignini, C Nasuti, D Fedeli, L Mattioli, M Cosenza, M Artico, R Gabbianelli

(2013). Protective effect of alpha-lipoic acid on cypermethrin-induced oxidative

stress in Wistar rats. INTERNATIONAL JOURNAL OF IMMUNOPATHOLOGY AND

PHARMACOLOGY, vol. 26, p. 871-881, ISSN: 0394-6320

18 2013

Bianchi E, Scarinci F, Ripandelli G, Feher J, Pacella E, Magliulo G, Gabrieli CB,

Plateroti R, Plateroti P, Mignini F, Artico M. (2013). Retinal pigment epithelium,

age-related macular degeneration and neurotrophic keratouveitis.


ISSN: 1107-3756, doi: 10.3892/ijmm.2012.1164

19 2013

Riccardo Caruso, Marco Artico, Claudio Colonnese, Luigi Marrocco, Venceslao

Wierzbicki (2013). Supratentorial Endodermal Cysts: Review of Literature and

Case Report. JOURNAL OF NEUROLOGICAL SURGERY. PART A, CENTRAL

EUROPEAN NEUROSURGERY, vol. 74, p. 378-387, ISSN: 2193-6315, doi:

10.1055/s-0032-1304812

20 2013

F Mignini, M Sabbatini, M Capacchietti, C Amantini, E Bianchi, M Artico, A

Tammaro (2013). T-cell subpopulations express a different pattern of

dopaminergic markers in intra-and extra-thymic compartments. JOURNAL OF

BIOLOGICAL REGULATORS & HOMEOSTATIC AGENTS, vol. 27, p. 463-475,

ISSN: 0393-974X

219

21 2012

F. Mignini, C. Nasuti, M. Artico, F. Giovannetti, C. Fabrizi, L. Fumagalli, G.

Iannetti, E- Pompili (2012). Effects of trimethyltin on hippocampal dopaminergic

markers and cognitive behaviour. INTERNATIONAL JOURNAL OF

IMMUNOPATHOLOGY AND PHARMACOLOGY, vol. 25, p. 1107-1119, ISSN:

0394-6320

22 2012

Marco Artico, Marco De Vincentiis, Brunella Ionta, Enrica Bianchi, Sandro Bosco,

M. Monteleone, Lorenzo Fumagalli, Giuseppe Magliulo (2012).

Immunohistochemical profile of neurotrophins and mib-1 in jugulotympanic

paragangliomas: prognostic value and review of the literature. INTERNATIONAL

JOURNAL OF IMMUNOPATHOLOGY AND PHARMACOLOGY, vol. 25, p. 183-191,

ISSN: 0394-6320

23 2012

E. Bianchi, S. Taurone, M. Leopizzi, L. Bardella, R. Di Liddo, F. Nucci, F.S.

Pastore, M. Vitale, A. Mazzotti, M Artico (2012). Immunohistochemical profile of

VEGF, PGE2 and TGF-beta in inflammatory tenosynovitis of carpal tunnel

syndrome. EUROPEAN JOURNAL OF INFLAMMATION, vol. 10, p. 491-499,

ISSN: 1721-727X

24 2012

Bianchi E, Scarinci F, Grande C, Plateroti R, Plateroti P, Plateroti AM, Fumagalli

L, Capozzi P, Feher J, Artico M. (2012). Immunohistochemical profile of VEGF,

TGF-beta and PGE2 in human pterygium and normal conjunctiva: experimental

study and review of the literature. INTERNATIONAL JOURNAL OF


6320

25 2012

R. Di Liddo, C. Grandi, D. Dalzoppo, V. Villani, M. Venturini, A. Negro, L.

Sartore, M. Artico, M.T. Conconi, P.P. Parnigotto (2012). In vitro evaluation of

TAT-OP1 osteogenic properties and prospects for in vivo applications. JOURNAL

OF TISSUE ENGINEERING AND REGENERATIVE MEDICINE, ISSN: 1932-6254,

doi: 10.1002/term.1568

220

26 2012

Marco Artico, Enrica Bianchi, Giuseppe Magliulo, Marco De Vincentiis, Elena De

Santis, A. Orlandi, Antonio Santoro, F.S. Pastore, F.S. Pasture, Felice

Giangaspero, Riccardo Caruso, M. Re, Lorenzo Fumagalli (2012). Neurotrophins,

their receptors and ki-67 in human gh-secreting pituitary adenomas: an

immunohistochemical analysis. INTERNATIONAL JOURNAL OF


6320

27 2012

Magliulo G, Appiani MC, Iannella G, Artico M. (2012). Petrous Bone Fractures

Violating Otic Capsule. OTOLOGY & NEUROTOLOGY, 33(9):1558-61, ISSN:

1531-7129, doi: 10.1097/MAO.0b013e31826bf135

28 2012

Marco Artico, G. Stevanato, Brunella Ionta, A. Cesaroni, Enrica Bianchi, C.

Morselli, Francesca Romana Grippaudo (2012). Venous compressions of the

nerves in the lower limbs. BRITISH JOURNAL OF NEUROSURGERY, vol. 26, p.

386-391, ISSN: 0268-8697, doi: 10.3109/02688697.2011.631616

29 2011

Marco Artico, R. Rigano, B. Buttari, E. Profumo, Brunella Ionta, Sandro Bosco,

M. Rasile, Enrica Bianchi, M. Bruno, Lorenzo Fumagalli (2011). Protective role of

parnaparin in reducing systemic inflammation and atherosclerotic plaque

formation in ApoE-/- mice. INTERNATIONAL JOURNAL OF MOLECULAR

MEDICINE, vol. 27, p. 561-565, ISSN: 1107-3756, doi: 10.3892/ijmm.2011.606

30 2010

Marco Artico, Elena Bronzetti, Valentina Alicino, Brunella Ionta, Sandro Bosco,

C. Grande, Bruno M. Tranquilli Leali Fm, G. Ionta, Lorenzo Fumagalli (2010).

Human gallbladder carcinoma: Role of neurotrophins, MIB-1, CD34 and CA15-3.

EUROPEAN JOURNAL OF HISTOCHEMISTRY, vol. 54, p. 50-55, ISSN: 1121-

760X, doi: 10.4081/ejh.2010.e10

31 2010

Artico M, Bronzetti E, Ionta B, Bruno M, Greco A, Ruoppolo G, De Virgilio A,

Longo L, De Vincentiis M. (2010). Reinke's edema: investigations on the role of

221

MIB-1 and hepatocyte growth factor. EUROPEAN JOURNAL OF

HISTOCHEMISTRY, vol. 54, p. 133-136, ISSN: 1121-760X, doi:

10.4081/ejh.2010.e30

32 2009

Marco Artico, Elena Bronzetti, Elena Pompili, Brunella Ionta, V. Alicino, A.

D'Ambrosio, Antonio Santoro, F.S. Pastore, I. Elenkov, Lorenzo Fumagalli

(2009). Immunohistochemical profile of neurotrophins in human cranial dura

mater and meningiomas. ONCOLOGY REPORTS, vol. 21, p. 1373-1380, ISSN:

1021-335X, doi: 10.3892/or_00000363

33 2009

Marco Artico, S. Telera, C. Tiengo, C. Stecco, V. Macchi, A. Porzionato, E.

Vigato, A. Parenti, R. De Caro (2009). Surgical anatomy of the radial nerve at

the elbow. SURGICAL AND RADIOLOGIC ANATOMY, vol. 31, p. 101-106, ISSN:

1279-8517, doi: 10.1007/s00276-008-0412-8

34 2008

Elena Bronzetti, Marco Artico, F. Forte, G. Pagliarella, Laura Maria Felici, A.

D'Ambrosio, G. Vespasiani, B. Bronzetti (2008). A possible role of BDNF in

prostate cancer detection. ONCOLOGY REPORTS, vol. 19, p. 969-974, ISSN:

1021-335X, doi: 10.3892/or_

35 2008

Marco Artico, Elena Bronzetti, Vincenza Rita Lo Vasco, Brunella Ionta, Valentina

Alicino, A. D'Ambrosio, Giuseppe Magliulo (2008). Immunohistochemical profile

of various neurotransmitters, neurotrophins and MIB-1 in cholesteatomas of the

petrous bone. MOLECULAR MEDICINE REPORTS, vol. 1, p. 347-353, ISSN:

1791-2997

36 2008

Marco Artico, Elena Bronzetti, Laura Maria Felici, V. Alicino, Brunella Ionta, B.

Bronzetti, Giuseppe Magliulo, C. Grande, L. Zamai, G. Pasquantonio, Marco De

Vincentiis (2008). Neurotrophins and their receptors in human lingual tonsil: An

immunohistochemical analysis. ONCOLOGY REPORTS, vol. 20, p. 1201-1206,

ISSN: 1021-335X, doi: 10.3892/or_00000130

222

37 2008

J. SERRA MORENO, S. PANERO, M. ARTICO, P. FILIPPINI (2008). Synthesis and

charcterization of new electroactive polypyrrole-chondroitin sulphate A

substrates. BIOELECTROCHEMISTRY, vol. 72, p. 3-9, ISSN: 1567-5394, doi:

10.1016/j.bioelechem.2007.11.002

38 2008

A. Bellelli, P. Mancini, Marco Artico, C. Miglietta (2008). Technical note: MRI

device for active stress of the knee. The practical approach and preliminary

data. LA RADIOLOGIA MEDICA, vol. 113, p. 905-914, ISSN: 0033-8362, doi:

10.1007/s11547-008-0305-2

39 2007

Federica Vitali, Antonella Saija, F. Bonina, S. Franchitto, Marco Artico, Beatrice

Tita (2007). Antiulcer potential of a standardized extract of red orange juice in

the rat. INTERNATIONAL JOURNAL OF FOOD PROPERTIES, vol. 10, p. 331-344,

ISSN: 1094-2912, doi: 10.1080/10942910601113319

40 2007

E. BRONZETTI, M. ARTICO, I.KOVACS, L. FELICI, G. MAGLIULO, D. VIGNONE,

A. D'AMBROSIO, F. FORTE, R. DI LIDDO, J. FEHER (2007). Expression of

neurotransmitters and neurotrophins in neurogenic inflammation of the rat

retina. EUROPEAN JOURNAL OF HISTOCHEMISTRY, vol. 51(4), p. 251-260,

ISSN: 1121-760X, doi: 10.4081/1149

41 2007

Vincenza Rita Lo Vasco, Cinzia Fabrizi, Marco Artico, Lucio Cocco, Anna Maria

Billi, Lorenzo Fumagalli, Francesco Antonio Manzoli (2007). Expression of

phosphoinositide-specific phospholipase C isoenzymes in cultured astrocytes.

JOURNAL OF CELLULAR BIOCHEMISTRY, vol. 100, p. 952-959, ISSN: 0730-

2312, doi: 10.1002/jcb.21048

42 2007

M.ARTICO, E.BRONZETTI, L.SASO, L.M.FELICI, A. D'AMBROSIO, F.FORTE,

C.GRANDE, F.ORTOLANI (2007). Immunohistochemical profile of some

neurotrasmitters and neurotrophins in the seminiferous tubules of rats treated

223

by lonidamine. EUROPEAN JOURNAL OF HISTOCHEMISTRY, vol. 51(1), p. 19-

24, ISSN: 1121-760X, doi: 10.4081/1007

43 2006

ARTICO M, CARLOIA S, PIACENTINI M, FERRETTI G, M. DAZZI, FRANCHITTO

S, BRONZETTI E (2006). Conjoined lumbosacral nerve roots: observation on

three cases and review of the literature. NEUROCIRUGIA, vol. Feb; 17 ( 1), p.

54-59, ISSN: 1130-1473, doi: 10.4321/S1130-14732006000100007

44 2006

Domenico Ribatti, Beatrice Nico, Enrico Crivellato, Marco Artico (2006).

Development of the blood-brain barrier: A historical point of view. THE

ANATOMICAL RECORD. PART B, NEW ANATOMIST, vol. 289, p. 3-8, ISSN:

1552-4906, doi: 10.1002/ar.b.20087

45 2006

FEHER J, KOVACS I, M. ARTICO, CAVALLOTTI C, PAPALE A, BALACCO

GABRIELI C (2006). Mitocondrial alterations of retinal pigment epithelium in

age-related macular degeneration. NEUROBIOLOGY OF AGING, vol. 27 , p. 983-

993, ISSN: 0197-4580, doi: 10.1016/j.neurobiolaging.2005.05.012

46 2006

Bronzetti E, Artico M, Pompili E, Felici LM, Stringaro A, Bosco S, Magliulo G,

Colone M, Arancia G, Vitale M, Fumagalli L (2006). Neurotrophins and

neurotransmitters in human palatine tonsils: An immunohistochemical and RT-

PCR analysis. INTERNATIONAL JOURNAL OF MOLECULAR MEDICINE, vol. 18,

p. 49-58, ISSN: 1107-3756

47 2005

C. Cavallotti, Marco Artico, S. Franchitto, F.M. Tranquilli Leali (2005). Dopamine

nerve fibres and related receptors in bronchus-associated lymphoid tissue

(BALT). ITALIAN JOURNAL OF ANATOMY AND EMBRYOLOGY, vol. 110, p. 25-

30, ISSN: 1122-6714

48 2005

Elena Bronzetti, Marco Artico, Vincenza Rita Lo Vasco, Laura Maria Felici,

Sandro Bosco, G. Magliulo, Elena Pompili, Lorenzo Fumagalli (2005). Expression

of neurotransmitters and neurotrophins in human adenoid tissue.

224


ISSN: 1107-3756, doi: 10.3892/ijmm.2005.

49 2004

Carlo Cavallotti, Marco Artico, Nicola Pescosolido, Francesca Maria Tranquilli

Leali, J. Feher (2004). Age-related changes in the human retina. CANADIAN

JOURNAL OF OPHTHALMOLOGY-JOURNAL CANADIEN D OPHTALMOLOGIE, vol.

39, p. 61-68, ISSN: 0008-4182

50 2004

ARTICO M., DE SANTIS S., TRANQUILLI LEALI F.M., CAVALLOTTI D.,

CELESTINI A., C. CAVALLOTTI (2004). Diabetic rats treated by low molecular

weight heparin OP 2123/parnaparin. Morphological changes in the kidney and

heart. JOURNAL OF DIABETES AND ITS COMPLICATIONS, vol. 18, p. 119-125,

ISSN: 1056-8727, doi: 10.1016/S1056-8727(02)00250-7

51 2004

M. ARTICO, G. BALLATI, S. BOSCO, D. CANTARELLI, G. NAGAR, A. GROSSO,

F.M. TRANQUILLI LEALI, C. CAVALLOTTI (2004). Direct demonstration of iron

in a term placenta in two cases of beta thalassemia. AMERICAN JOURNAL OF

HEMATOLOGY, vol. 75, p. 241-242, ISSN: 0361-8609, doi: 10.1002/ajh.20005

52 2004

C. Cavallotti, Francesca Maria Tranquilli Leali, Marco Artico, Vito D'Andrea, V.

Malinovska (2004). Experimental calcification of the aorta in rabbits: Effects of

chelating agents and glucagon. SCANDINAVIAN JOURNAL OF LABORATORY

ANIMAL SCIENCE, vol. 31, p. 215-219, ISSN: 0901-3393

53 2004

G. Gobbi, P. Mirandola, C. Micheloni, E. Solenghi, I. Sponzilli, Marco Artico,

Giuseppe Soda, G. Zanelli, G. Pelusi, T. Fiorini, L. Cocco, M. Vitale (2004).

Expression of HLA class I antigen and proteasome subunits LMP-2 and LMP-10

in primary vs. metastatic breast carcinoma lesions. INTERNATIONAL JOURNAL

OF ONCOLOGY, vol. 25, p. 1625-1629, ISSN: 1019-6439

54 2004

G. Arancia, A. Calcabrini, M. Marra, P. Crateri, Marco Artico, A. Martone, F.

Martelli, Enzo Agostinelli (2004). Mitochondrial alterations induced by serum

225

amine oxidase and spermine on human multidrug resistant tumor cells. AMINO

ACIDS, vol. 26, p. 273-282, ISSN: 0939-4451, doi: 10.1007/s00726-003-0055-3

55 2004

Marco Artico, Sandro Bosco, Elena Bronzetti, Laura Maria Felici, G. Pelusi,

Vincenza Rita Lo Vasco, M. Vitale (2004). Peribronchial innervation of the rat

lung. INTERNATIONAL JOURNAL OF MOLECULAR MEDICINE, vol. 14, p. 615-

620, ISSN: 1107-3756, doi: 10.3892/ijmm.2004.

56 2004

Marco Artico, D. Lorenzini, P. Mancini, P. Gobbi, S. Carloia, V. David (2004).

Radiological evidence of anatomical variation of the inferior vena cava: Report

of two cases. SURGICAL AND RADIOLOGIC ANATOMY, vol. 26, p. 153-156,

ISSN: 1279-8517, doi: 10.1007/s00276-003-0192-0

57 2003

F.M. TRANQUILLI LEALI, M. ARTICO, S. POTENZA, C. CAVALLOTTI (2003). Age

related changes of monoaminoxidases in rat cerebellar cortex. EUROPEAN

JOURNAL OF HISTOCHEMISTRY, vol. 47, p. 81-86, ISSN: 1121-760X, doi:

10.4081/810

58 2003

Marco Artico, Luigi Ferrante, F.S. Pastore, E. Orlando Ramundo, D. Cantarelli,

D. Scopelliti, Giorgio Iannetti (2003). Bone autografting of the calvaria and

craniofacial skeleton: Historical background, surgical results in a series of 15

patients, and review of the literature. SURGICAL NEUROLOGY, vol. 60, p. 71-

79, ISSN: 0090-3019, doi: 10.1016/s0090-3019(03)00031-4

59 2003

Marco Artico, Carlo Cavallotti, Francesca Maria Tranquilli Leali, M. Falconi, D.

Cavallotti (2003). Effect of interferon on human thymus microenvironment.

IMMUNOLOGY LETTERS, vol. 85, p. 19-27, ISSN: 0165-2478, doi:

10.1016/s0165-2478(02)00180-3

60 2002

Marco Artico, Carlo Cavallotti, D. Cavallotti (2002). Adrenergic nerve fibres and

mast cells: Correlation in rat thymus. IMMUNOLOGY LETTERS, vol. 84, p. 69-

76, ISSN: 0165-2478, doi: 10.1016/s0165-2478(02)00145-1

226

61 2002

CAVALLOTTI C, MANCONE C, M. ARTICO, CAVALLOTTI D (2002). Age-related

changes of the monoamine oxidases in rat heart. BIOMEDICAL RESEARCH, vol.

23, p. 109-113, ISSN: 0388-6107

62 2002

M. ARTICO, MASSA R., CAVALLOTTI D., FRANCHITTO S., CAVALLOTTI C.

(2002). Morphological changes in the sciatic nerve of diabetic rats treated with

low molecular weight heparin OP2123/Parnaparin. ANATOMIA HISTOLOGIA

EMBRYOLOGIA, vol. 34, p. 1-5, ISSN: 0340-2096, doi: 10.1046/j.1439-

0264.2002.00373.x

63 2002

Marco Artico, Sandro Bosco, Carlo Cavallotti, Enzo Agostinelli, G. Giuliani-

Piccari, S. Sciorio, L. Cocco, M. Vitale (2002). Noradrenergic and cholinergic

innervation of the bone marrow. INTERNATIONAL JOURNAL OF MOLECULAR

MEDICINE, vol. 10, p. 77-80, ISSN: 1107-3756

64 2002

C. CAVALLOTTI, N. PESCOSOLIDO, M. ARTICO, E. PACELLA, D. CAVALLOTTI

(2002). OCCURRENCE OF CATECHOLAMINERGIC NERVE FIBERS IN THE

HUMAN UVEOSCLERAL TISSUE IN CONDITIONS OF NORMAL AND RAISED

INTRACULAR PRESSURE. INTERNATIONAL OPHTHALMOLOGY, vol. 24(3), p.

133-139, ISSN: 0165-5701, doi: 10.1023/A:1021173115883

65 2002

CAVALLOTTI D., M. ARTICO, IANNETTI G., CAVALLOTTI C. (2002). Occurrence

of adrenergic nerve fibers in human thymus during immuneresponse.

NEUROCHEMISTRY INTERNATIONAL, vol. 40, p. 211-221, ISSN: 0197-0186,

doi: 10.1016/S0197-0186(01)00074-2

66 2002

GATTO MT, B. TITA, ARTICO M, SASO L (2002). Recent studies on lonidamine,

the lead compound of the antispermatogenic indazolcarboxylic acids.

CONTRACEPTION, vol. 65(4), p. 277-278, ISSN: 0010-7824, doi:

10.1016/S0010-7824(02)00289-5

227

67 2001

Carlo Cavallotti, Marco Artico, Nicola Pescosolido, J. Feher (2001). Age-related

changes in rat retina. JAPANESE JOURNAL OF OPHTHALMOLOGY, vol. 45, p.

68-75, ISSN: 0021-5155, doi: 10.1016/s0021-5155(00)00294-x

68 2001

M. ARTICO, CAVALLOTTI C. (2001). Catecholaminergic and Acetyl choline

esterase containing nerve of cranial and spinal Dura mater in humans and

rodents. MICROSCOPY RESEARCH AND TECHNIQUE, vol. 53, p. 212-220, ISSN:

1059-910X, doi: 10.1002/jemt.1085

69 2001

M. ARTICO, CAVALLOTTI C., IANNETTI G., CAVALLOTTI D. (2001). Effect of

interleukin 1 beta on rat thymus microenvironment. EUROPEAN JOURNAL OF

HISTOCHEMISTRY, vol. 45, p. 357-366, ISSN: 1121-760X, doi: 10.4081/1644

70 2001

M. ARTICO, CAVALLOTTI C., CAMERONI M., CAVALLOTTI D. (2001). Interleukin

1 beta as stimulator of the rat thymus. CYTOKINE, vol. 15(5), p. 261-265,

ISSN: 1043-4666, doi: 10.1006/cyto.2001.0924

71 2001

Luigi Rodella, Loris Zamai, Rita Rezzani, Marco Artico, Giovanni Peri, Mirella

Falconi, Andrea Facchini, Giuseppe Pelusi, Marco Vitale (2001). Interleukin 2

and interleukin 15 differentially predispose natural killer cells to apoptosis

mediated by endothelial and tumour cells. BRITISH JOURNAL OF

HAEMATOLOGY, vol. 115, p. 442-450, ISSN: 0007-1048, doi: 10.1046/j.1365-

2141.2001.03055.x

72 2001

C. Cavallotti, N. Pescosolido, M. Artico, E. Pacella, D. Cavallotti (2001).

Occurrence of catecholaminergic nerve fibers in the human uveoscleral tissue in

conditions of normal and raised intraocular pressure. INTERNATIONAL

OPHTHALMOLOGY, vol. 24, p. 133-139, ISSN: 0165-5701, doi:

10.1023/A:1021173115883

228

73 2000

M. ARTICO, PASTORE, NUCCI, GIUFFRÉ (2000). 290 surgical procedures for

ulnar nerve entrapment at elbow: physiopathology, clinical experience and

results. ACTA NEUROCHIRURGICA, vol. 142, p. 303-308, ISSN: 0001-6268, doi:

10.1007/s007010050039

74 2000

D. Cavallotti, Marco Artico, Carlo Cavallotti, G. Iannetti, Alessandro Frati (2000).

Acetylcholinesterase activity in rat thymus after immunostimulation with

interleukin beta. ANNALS OF ANATOMY, vol. 182, p. 243-248, ISSN: 0940-

9602, doi: 10.1016/s0940-9602(00)80029-1

75 2000

C. CAVALLOTTI, M.ARTICO, N.PESCOSOLIDO, F.M.TRANQUILLI, E.PACELLA

(2000). DISTRIBUTION OF PEPTIDERGIC NERVE FIBERS IN THE GUINEA PIG

TRABECULAR MESHWORK. ANATOMIA HISTOLOGIA EMBRYOLOGIA, vol. 29, p.

387-391, ISSN: 0340-2096, doi: 10.1046/j.1439-0264.2000.00290.x

76 2000

N. Pescosolido, C. Cavallotti, M. Artico, D. Cavallotti, E. Pacella, F: Gherardi

(2000). Distribution of catecholaminergic nerve fibers in normal and alkali

injured rabbit corneas. ANNALS OF OPHTHALMOLOGY, vol. 32, p. 307-312,

ISSN: 1530-4086, doi: 10.1007/s12009-000-0069-3

77 2000

CAVALLOTTI D., M. ARTICO, D'ANDREA V., CAVALLOTTI C. (2000). Gamma-

amino-butyric Acid-transaminase activity in the human thymus after

administration of interferons. HUMAN IMMUNOLOGY, vol. 61 (7), p. 697-704,

ISSN: 0198-8859, doi: 10.1016/S0198-8859(00)00130-0

78 2000

CAVALLOTTI D., M. ARTICO, CAVALLOTTI C., DE SANTIS S., TRANQUILLI

LEALI F.M. (2000). Interleukin 1beta and GABA-transaminase activity in rat

thymus. INTERNATIONAL JOURNAL OF IMMUNOPHARMACOLOGY, vol. 22, p.

719-728, ISSN: 0192-0561, doi: 10.1016/S0192-0561(00)00035-7

229

79 2000

N. PESCOSOLIDO, D. CAVALLOTTI, M. ARTICO, J. FEHER, S. DE SANTIS, C.

CAVALLOTTI (2000). Microfilaments in regenerating cells of rabbit

cornea:immunological and ultrastructural observations. EUROPEAN JOURNAL

OF MORPHOLOGY, vol. 38, p. 186-194, ISSN: 0924-3860, doi: 10.1076/0924-

3860(200007)

80 2000

C. CAVALLOTTI, D.CAVALLOTTI, M.ARTICO, G.D.IANNETTI (2000).

Quantification of acetylcholinesterase positive structures in human thymus

during development and aging. NEUROCHEMISTRY INTERNATIONAL, vol. 36,

p. 75-82, ISSN: 0197-0186, doi: 10.1016/S0197-0186(99)00090-X

81 2000

CAVALLOTTI D, M. ARTICO, CAVALLOTTI C (2000). Quantification of adrenergic

nerve fibers in human thymus at various ages. BIOMEDICAL RESEARCH, vol.

21, p. 73-83, ISSN: 0388-6107

82 2000

Marco Artico, G.M. De Caro, Maurizio Salvati, S. Carloia, E. Rastelli, V.

Wierzbicki, M. Manni (2000). Solitary metastases to the cranial vault. Report of

ten cases. JOURNAL OF NEUROSURGICAL SCIENCES, vol. 44, p. 33-38, ISSN:

0390-5616

83 1999

CAVALLOTTI D, M. ARTICO, CAVALLOTTI C (1999). Acetylcholinesterase

activity in the human thymus during immune response. BIOMEDICAL

RESEARCH, vol. 20, p. 187-195, ISSN: 0388-6107

84 1999

M. ARTICO, DE CARO, CARLOIA, SALVATI, D'AMBROSIO, DELFINI (1999).

Advances in diagnosis, treatment and prognosis of intracerebral tuberculomas

in the last 50 years.. NEUROCHIRURGIE, vol. 45, p. 129-133, ISSN: 0028-3770

85 1999

CAVALLOTTI C., ARTICO M., CAVALLOTTI D., F. TRANQUILLI LEALI, FRATI A.

(1999). Distribution of acetylcholinesterase activity in thymus of juvenile and

aged rats. BIOMEDICAL RESEARCH, vol. 20, p. 73-80, ISSN: 0388-6107

230

86 1999

COCCO L., RUBBINI S., MANZOLI L., BILLI A.M., FAENZA I., PERUZZI D.,

MATTEUCCI A., M. ARTICO, STEWART GILMOUR R., RHEE S.G. (1999).

Inositides in the nucleus: presence and characterisation of the isozymes of

phospholipase beta family in NIH 3T3 cells. BIOCHIMICA ET BIOPHYSICA ACTA,

vol. 1438, p. 295-299, ISSN: 0006-3002

87 1999

C. CAVALLOTTI, PESCOSOLIDO N., ARTICO M., FEHER J. (1999). Localization

of Dopamine receptors in rabbit cornea. CORNEA, vol. 18, p. 721-728, ISSN:

0277-3740, doi: 10.1097/00003226-199911000-00016

88 1999

CAVALLOTTI D., M. ARTICO, FEHER J., PESCOSOLIDO N., DE SANTIS S.,

CAVALLOTTI C. (1999). Microfilaments in regenerating cells of rabbit cornea:

immunological and ultrastructural observations. EUROPEAN JOURNAL OF

MORPHOLOGY, vol. 37, p. 1-9, ISSN: 0924-3860

89 1999

C. CAVALLOTTI, M.ARTICO, S.DE SANTIS (1999). Occurrence of GABA-

transaminase in the Thymus gland of juvenile and aged rats. EUROPEAN

JOURNAL OF HISTOCHEMISTRY, vol. 43, p. 293-299, ISSN: 1121-760X

90 1999

CAVALLOTTI C, M. ARTICO, CAVALLOTTI D. (1999). Occurrence of adrenergic

nerve fibers and of noradrenaline in thymus gland of juvenile and aged rats.

IMMUNOLOGY LETTERS, vol. 70, p. 53-62, ISSN: 0165-2478

91 1999

CAVALLOTTI D., M. ARTICO, DE SANTIS S., CAVALLOTTI C. (1999). Occurrence

of gamma -Amminobutyric acid-transaminase activity in nerve fibers of human

thymus. HUMAN IMMUNOLOGY, vol. 60, p. 1072-1079, ISSN: 0198-8859

92 1999

GOBBI P., FALCONI M., VITALE M., GALANZI A., M. ARTICO, MARTELLI A.M.,

MAZZOTTI G. (1999). Scanning electron microscopic detection of nuclear

structures involved in DNA replication. ARCHIVES OF HISTOLOGY AND

CYTOLOGY, vol. 62, p. 111-120, ISSN: 0914-9465

231

93 1998

CAVALLOTTI D., M. ARTICO, DE SANTIS S., IANNETTI G., CAVALLOTTI C.

(1998). Catecholaminergic innervation of human dura mater involved in

headache. HEADACHE, vol. 38, p. 352-355, ISSN: 0017-8748

94 1998

Carlo Cavallotti, F. Gherardi, Marco Artico, Nicola Pescosolido, J. Feher, Corrado

Balacco Gabrieli (1998). Catecholaminergic nerve fibres in normal and alkali-

burned rabbit cornea. CANADIAN JOURNAL OF OPHTHALMOLOGY-JOURNAL

CANADIEN D OPHTALMOLOGIE, vol. 33, p. 259-263, ISSN: 0008-4182

95 1998

M. Artico, S. De Santis, C. Cavallotti (1998). Cerebral dura mater and

cephalalgia: relationships between mast cells and catecholaminergic nerve

fibers in the rat. CEPHALALGIA, p. 183-191, ISSN: 0333-1024

96 1998

SALVATI M, CERVONI L, ARTICO M, R. CARUSO, GAGLIARDI F.M: (1998). Long

term survival in patients with supratentorial glioblastoma. JOURNAL OF NEURO-

ONCOLOGY, vol. 36, p. 61-64, ISSN: 0167-594X

97 1998

M. ARTICO, NERONI, PASTORE, CAVALLOTTI, FRAIOLI (1998). Metastatic

bronchogenic adenocarcinoma into a pituitary adenoma: case report and

literature review. EUROPEAN JOURNAL OF ONCOLOGY, vol. 3, p. 69-74, ISSN:

1128-6598

98 1998

Artico M, Iannetti G, Tranquilli Leali FM, Malinovsky L, Cavallotti C. (1998).

Nerve fibers-mast cells correlation in the rat parietal pleura. RESPIRATION

PHYSIOLOGY, vol. 113- 2, p. 181-188, ISSN: 0034-5687

99 1998

M. ARTICO, PASTORE, FRAIOLI, GIUFFRÉ (1998). The contribution of Davide

Giordano (1864-1954) to pituitary surgery: the transglabellar-nasal approach.

NEUROSURGERY, vol. 42, p. 909-912, ISSN: 0148-396X

232

100 1998

ARTICO M., MALINOVSKY L, CAVALLOTTI C, E. DE ANTONI, BIANCARI F,

D'ANDREA V, COLAIUDA S (1998). Venous drainage of the stomach in the

domestic rabbit (Oryctolagus cuniculus f. domestica,breed large Chinchilla) and

the domestic cat (felis catus L.F. domestica). ANNALS OF ANATOMY, vol.

180(6), p. 565-568, ISSN: 0940-9602

101 1998

TRANQUILLI LEALI F.M., M. ARTICO, CAVALLOTTI C., MALINOVSKA V.,

D'ANDREA V., DE SANTIS S., MALINOVSKY L. (1998). Venous drainage of the

stomach in the golden hamster (Mesocricetus auratus) and the Guinea pig

(Cavia aperea f. porcellus). ANNALS OF ANATOMY, vol. 180(6), p. 561-564,

ISSN: 0940-9602

102 1997

M. Artico, G.M.F. De Caro, B. Fraioli, R. Giuffrè: (1997). 1897 - Celebrating the

centennial - Hermann Moritz Gocht and the radiation therapy in the treatment

of trigeminal neuralgia. ACTA NEUROCHIRURGICA, ISSN: 0001-6268

103 1997

M. ARTICO, CERVONI, WIERZBICKI, D'ANDREA, NUCCI (1997). Benign Neural

Sheath Tumours of Major Nerves: Characteristics in119 Surgical Cases. ACTA

NEUROCHIRURGICA, vol. 139(12), p. 1108-1116, ISSN: 0001-6268, doi:

10.1007/BF01410969

104 1997

M. Artico, F.S. Pastore, M. Polosa, S. Sherkat, M. Neroni (1997). Intracerebral

aspergillus abscess: case report and review of the literature. NEUROSURGICAL

REVIEW, 20(2):135-8, ISSN: 0344-5607

105 1997

L. Cervoni, M. Artico, M. Salvati, S. Carloia (1997). Rathke's cleft cyst: a clinical

and radiographic review. ITALIAN JOURNAL OF NEUROLOGICAL SCIENCES, vol.

18, p. 37-40, ISSN: 0392-0461

233

106 1997

M. ARTICO, CERVONI, CARLOIA, STEVANATO, MASTANTUONO, NUCCI (1997).

Synovial cysts: clinical and neuroradiological aspects. ACTA

NEUROCHIRURGICA, vol. 139, p. 176-181, ISSN: 0001-6268

107 1996

M. Artico, Cervoni L, Nucci F, Giuffre R. (1996). Birthday of peripheral nervous

system surgery:the contribution of Gabriele Ferrara (1543-1627).

NEUROSURGERY, ISSN: 0148-396X

108 1996

L.Malinovsky, R.Umlauf, V.Malinovksa, M.Artico, V.D'Andrea (1996). Einige

Bemerkungen zur neuromorphologischen Grundlage der Vaginalakupunctur.

DEUTSCHE ZEITSCHRIFT FÜR AKUPUNKTUR, vol. 39(3), p. 61-66, ISSN: 0415-

6412

109 1996

M. Salvati, L. Cervoni, M. Artico (1996). High-dose radiation-induced

meningiomas following acute lymphoblastic leukemia in children. CHILDS

NERVOUS SYSTEM, vol. 12, p. 266-269, ISSN: 0256-7040

110 1996

M. Salvati, L. Cervoni, M. Artico, A. Raco, P. Ciappetta, R. Delfini (1996).

Primary spinal epidural non-Hodgkin's lymphomas: a clinical study. SURGICAL

NEUROLOGY, vol. 46, p. 339-343, ISSN: 0090-3019

111 1996

M. Artico, L. Cervoni, P. Celli, F. Nucci: (1996). Purely epithelioid schwannoma:

two case reports and a review of the literature. NEUROCHIRURGIE, 42(1):61-5,

ISSN: 0028-3770

112 1995

L.Malinovsky, V.Malinovska, C.Cavallotti, M.Artico, V.D'Andrea (1995). A

contribution to the problem of thermosensors in skeletal muscles. ISRAELI

JOURNAL OF MEDICAL ACUPUNCTURE, vol. 1, p. 4-7, ISSN: 0793-3142

234

113 1995

Marco Artico, L. Cervoni, G. Stevanato, Vito D'Andrea, F. Nucci (1995). Bifid

median nerve: report of two cases. ACTA NEUROCHIRURGICA, vol. 136, p. 160-

162, ISSN: 0001-6268, doi: 10.1007/bf01410619

114 1995

M. Artico, L. Cervoni, S. Carloia, E. Palatinsky, R. Delfini (1995). Development of

intracranial meningioma at the site of cranial fractures. Remarks on 15 cases.

ACTA NEUROCHIRURGICA, ISSN: 0001-6268

115 1995

L. FERRANTE, M. ARTICO, B. NARDACCI, B. FRAIOLI, F. COSENTINO, A.

FORTUNA (1995). GLOSSOPHARYNGEAL NEURALGIA WITH CARDIAC

SYNCOPE. NEUROSURGERY, ISSN: 0148-396X

116 1995

L. Cervoni, M. Artico, R. Delfini (1995). Intraosseous cavernous hemangioma of

the skull. NEUROSURGICAL REVIEW, ISSN: 0344-5607

117 1995

ARTICO M, FERRANTE L, CERVONI L, C. COLONNESE, FORTUNA A (1995).

PEDIATRIC CYSTYC MENINGIOMA: report of three cases. CHILDS NERVOUS

SYSTEM, vol. 11(3), p. 137-140, ISSN: 0256-7040, doi: 10.1007/BF00570253

118 1995

M. Scarpinati, M. Artico, S. Artizzu (1995). Spinal cord compression by

eosinophilic granuloma of the cervical spine. Case report and review of the

literature. NEUROSURGICAL REVIEW, ISSN: 0344-5607

119 1995

M Artico, L Cervoni, M Salvati, F Fiorenza, R Caruso (1995). Supratentorial

arachnoid cysts: clinical and therapeutic remarks on 46 cases. ACTA

NEUROCHIRURGICA, vol. 132, p. 75-78, ISSN: 0001-6268, doi:

10.1007/BF01404851

120 1995

L. Malinovsky, Vito D'Andrea, Marco Artico (1995). Vascular anatomy of the

spleen. CLINICAL ANATOMY, vol. 8, ISSN: 0897-3806, doi:

10.1002/ca.980080511

235

121 1994

L. Cervoni, M. Artico, M. Salvati, R. Bristot, C. Franco, R. Delfini (1994).

Epileptic seizures in intracerebral hemorrhage: a clinical and prognostic study of

55 cases. NEUROSURGICAL REVIEW, vol. 17, p. 185-188, ISSN: 0344-5607

122 1994

R. Giuffré, F.S. Pastore, S. De Santis, M. Artico: (1994). Lesioni dell'emisfero

"dominante". Patologia vascolare nell'infanzia. MINERVA MEDICA, ISSN: 0026-

4806

123 1994

L.Malinovsky, C.Cavallotti, V.Malinovska, M.Artico, V.D'Andrea (1994).

Morphological basis of peripheral cold-action (cooling) in acupuncture..

DEUTSCHE ZEITSCHRIFT FÜR AKUPUNKTUR, vol. 37(4), p. 91-93, ISSN: 0415-

6412

124 1994

M. Artico, L. Cervoni, M. Salvati, A. Raco, P. Ciappetta (1994). Ossifying fibroma

of the skull: clinical and therapeutic study. TUMORI, vol. 80, p. 64-67, ISSN:

0300-8916

125 1994

L.Malinovsky, V.Malinovska, C.Cavallotti, M.Artico, V.D'Andrea (1994).

Peripheral pain percepting structures in relation to the system of sensory nerve

formations (SNF). INTERNATIONAL JOURNAL OF AURICULAR MEDICINE, vol.

2, p. 17-23, ISSN: 0793-3150

126 1993

Massa S, Di Santo R, Costi R, Simonetti G, Retico A, Apuzzo G, Artico M. (1993).

Antifungal agents. III. Naphthyl and thienyl derivatives of 1H-imidazol-1-yl-4-

phenyl-1H-pyrrol-3-ylmethane. IL FARMACO, vol. 48, p. 725-736, ISSN: 0014-

827X

127 1993

A. Pierallini, S. Bastianello, G. Antonini, S. Giuliani, M. Artico, F. Nucci, M.

Millefiorini, L.M. Fantozzi, L. Bozzao (1993). CT findings in peripheral

mononeuropathies. ZENTRALBLATT FUR NEUROCHIRURGIE, ISSN: 0044-4251

236

128 1993

Luigi Cervoni, Marco Artico, Maurizio Salvati, R. Bristot, V. Wierzbicki, Franco

Maria Gagliardi (1993). Haemangiopericytoma and meningioma presenting

clinically with intracranial haemorrhage: report of three cases and review of the

literature. ZENTRALBLATT FUR NEUROCHIRURGIE, vol. 54, p. 20-23, ISSN:

0044-4251

129 1993

L.Malinovsky, V.D'Andrea, V.Malinovska, M.Artico (1993). Modulating cells in

sensory nerve formations (endings). INTERNATIONAL JOURNAL OF AURICULAR

MEDICINE, vol. 1, p. 5-12, ISSN: 0793-3150

130 1993

L.Malinovsky, M.Artico, I.Malinovska, V.D'Andrea (1993). Some comments to

histomorphology of acupuncture points.. DEUTSCHE ZEITSCHRIFT FÜR

AKUPUNKTUR, vol. 6, p. 129-130, ISSN: 0415-6412

131 1993

M. Artico, L. Cervoni, P. Celli, M. Salvati, L. Palma (1993). Supratentorial

glioblastoma in children: a series of 27 surgically treated cases. CHILD’S

NERVOUS SYSTEM, vol. 9, p. 7-9, ISSN: 0256-7040

132 1993

D'ANDREA V, MALINOVSKY L, AMBROGI V, ARTICO M, CAPUANO LG,

BUCCOLINI F, E. DE ANTONI (1993). Thymectomy as treatment of autoimmune

diseases other than myasthenia gravis. THYMUS, vol. 21(1), p. 1-10, ISSN:

0165-6090

133 1993

L. Malinovsky, M.Artico, V.D'Andrea (1993). Zur Diskussion. DEUTSCHE

ZEITSCHRIFT FÜR AKUPUNKTUR, vol. 38(5), p. 118-119, ISSN: 0415-6412

134 1992

Giorgio Stefancich, Marco Artico, Giorgio Ortar, Romano Silvestri, Giovanna

Simonetti, Germana Apuzzo, Marino Artico (1992). Antibacterial and antifungal

agents. XV. Synthesis and antifungal activity of structural analogues of

bifonazole and ketoconazole. ARCHIV DER PHARMAZIE, vol. 325, p. 687-694,

ISSN: 0365-6233, doi: 10.1002/ardp.19923251102

237

135 1992

M. Salvati, F. Cosentino, M. Artico, M. Ferrari, D. Franchi, M. Domenicucci, E.

Ramundo Orlando, L. Tacconi, F. Cosentino Jr. (1992). Electrocardiographic

changes in subarachnoid hemorrhage secondary to cerebral aneurysm. Report

of 70 cases. ITALIAN JOURNAL OF NEUROLOGICAL SCIENCES, vol. 13, p. 409-

413, ISSN: 0392-0461

136 1992

M. Salvati, M. Artico, P. Lunardi, F. Gagliardi (1992). Intramedullary

meningioma: case report and review of the literature. SURGICAL NEUROLOGY,

vol. 37, p. 42-45, ISSN: 0090-3019

137 1992

M Artico, G Stefancich, R Silvestri, S Massa, G Apuzzo, M Artico, G Simonetti

(1992). Research on antibacterial and antifungal agents. 16. Synthesis and

antifungal activities of 1-[α-(1-naphthyl)benzyl]imidazole derivatives and related

2-naphthyl isomers. EUROPEAN JOURNAL OF MEDICINAL CHEMISTRY, vol. 27,

p. 693-699, ISSN: 0223-5234, doi: 10.1016/0223-5234(92)90089-J

138 1992

Giorgio Stefancich, Romano Silvestri, Augusta Retico, Marco Artico, Giovanna

Simonetti (1992). Researches on antibacterial and antifungal agents, XIV:

Thiophene analogues of bifonazole. ARCHIV DER PHARMAZIE, vol. 325, p. 199-

204, ISSN: 0365-6233, doi: 10.1002/ardp.19923250403

139 1992

Marco Artico, Maurizio Salvati, Antonino Raco, G. Innocenzi, Roberto Delfini

(1992). Primary Meckel's cave lymphoma. A case and review of the literature.

NEURO-CHIRURGIE, vol. 38, p. 368-371, ISSN: 0028-3770

140 1991

G. Rocchi, M. Artico, P. Lunardi, F.M. Gagliardi (1991). Intracranial schwannoma

of the facial nerve: report of two cases and review of the literature.

NEUROCHIRURGIA, ISSN: 0028-3819

141 1991

M. Salvati, M. Artico, R. Caruso, G. Rocchi, E.Ramundo Orlando, F. Nucci

(1991). A Report on Radiation-Induced Glioma. CANCER, p. 392-397, ISSN:

238

1045-7410, doi: 10.1002/1097-0142(19910115)67:2<392::AID-

CNCR2820670213>3.0.CO;2-V

142 1991

P. Ciappetta, M. Salvati, A. Raco, M. Artico, FM. Gagliardi (1991). Benign

osteoblastoma of the sphenoid bone. NEUROCHIRURGIA, vol. 34, p. 97-100,

ISSN: 0028-3819

143 1991

G. ANTONINI, BASTIANELLO S, NUCCI F, ARTICO M, BOZZAO L, MILLEFIORINI

M (1991). Ganglion of deep peroneal nerve: electrophysiology and CT scan in

the diagnosis. ELECTROMYOGRAPHY AND CLINICAL NEUROPHYSIOLOGY, vol.

31, p. 9-13, ISSN: 0301-150X

144 1991

M. Salvati, P. Ciappetta, M. Artico, A. Raco, A. Fortuna (1991). Intraspinal

hemangiopericytoma: case report and review of the literature.

NEUROSURGICAL REVIEW, vol. 14, p. 309-313, ISSN: 0344-5607

145 1991

ARTICO M, SALVATI M, V. D'ANDREA, RAMUNDO EO, NUCCI F (1991). Isolated

lesion of the axillary nerve:surgical treatment and outcome in 12 cases.

NEUROSURGERY, vol. 29(5), p. 697-700, ISSN: 0148-396X, doi:

10.1227/00006123-199111000-00009

146 1991

M. Artico, M. Scarpinati, M. Salvati, F. Nucci (1991). Late intraneural metastasis

of the brachial plexus from mammary carcinoma. Report of a case. JOURNAL

OF NEUROSURGICAL SCIENCES, vol. 35, p. 51-53, ISSN: 0390-5616

147 1991

P. Lunardi, P. Missori, M. Artico, A. Fortuna (1991). Posttraumatic intradiploic

leptomeningeal cyst in an adult: case report. SURGICAL NEUROLOGY, vol. 35,

p. 475-477, ISSN: 0090-3019, doi: 10.1016/0090-3019(91)90183-A

148 1991

Maurizio Salvati, Pasqualino Ciappetta, Antonino Raco, Marco Artico, Spartaco

Artizzu (1991). Primary intracranial actinomycosis. Report of a case and review

239

of the literature. ZENTRALBLATT FUR NEUROCHIRURGIE, vol. 51, p. 95-98,

ISSN: 0044-4251

149 1991

M. Salvati, M. Artico, S. Carloia, E. Ramundo Orlando, F. M. Gagliardi (1991).

Solitary cerebral metastasis from lung cancer with very long survival: report of

two cases and review of the literature. SURGICAL NEUROLOGY, vol. 36, p. 458-

461, ISSN: 0090-3019

150 1991

P. Ciappetta, M. Salvati, G. Capoccia, M. Artico, A. Raco, A. Fortuna (1991).

Spinal glioblastomas: report of seven cases and review of the literature.

NEUROSURGERY, vol. 28, p. 302-306, ISSN: 0148-396X

151 1990

L. Palma, M. Artico, P. Celli, M. Salvati, A. Cesaroni, N. Di Lorenzo (1990).

Glioblastomi sopratentoriali in età pediatrica: considerazioni su una serie di 18

casi trattati chirurgicamente nel periodo 1959-1988. MINERVA MEDICA, ISSN:

0026-4806

152 1990

L. Bardella, M. Artico, A. Maleci, S. Bastianello, A. Pierallini, F. Nucci (1990).

Considerazioni su una serie di 116 interventi per neuropatia del nervo ulnare al

gomito. MINERVA MEDICA, ISSN: 0026-4806

153 1990

P. Ciappetta, M. Artico, M. Salvati, A. Raco, F. M. Gagliardi (1990). Intradiploic

epidermoid cysts of the skull: report of 10 cases and review of the literature..

ACTA NEUROCHIRURGICA, vol. 102, p. 33-37, ISSN: 0001-6268

154 1990

Nucci F, Artico M, Santoro A., Bardella L, Delfini R, Bosco L, Palma L (1990).

Intraneural synovial cyst of the peroneal nerve : report of two cases and review

of the literature. NEUROSURGERY, vol. 26, p. 339-344, ISSN: 0148-396X

155 1990

M. Artico, L. Bardella, A. Maleci, F. Nucci (1990). Lesione isolata del nervo

ascellare: considerazioni su 74 casi, 10 dei quali trattati chirurgicamente. .

MINERVA MEDICA, ISSN: 0026-4806

240

156 1990

M. Domenicucci, M. Artico, F. Nucci, M. Salvati, L. Ferrante (1990). Meningioma

following high-dose radiation therapy. Case report and review of the literature..

CLINICAL NEUROLOGY AND NEUROSURGERY, vol. 92, p. 349-352, ISSN: 0303-

8467

157 1990

M. Artico, S. Massa, S. Panico, G. Simonetti, G. Stefancich (1990). Pirfloxacin

(Irloxacin) Activity Related to Other Antimicrobial Agents. FARMACI & TERAPIA,

vol. 7, p. 24-29, ISSN: 0393-9693

158 1990

A. Raco, M. Artico, P. Ciappetta, M. Salvati, L. Bardella, G. Cantore (1990).

Primary intracranial lymphomas.. CLINICAL NEUROLOGY AND NEUROSURGERY,

vol. 92, p. 125-130, ISSN: 0303-8467

159 1990

Silvio Massa, Roberto Di Santo, Antonello Mai, M. Botta, Marco Artico, S. Panico,

Giovanna Simonetti (1990). Research on antibacterial and antifungal agents.

XIII. Synthesis and antimicrobial activity of 1-arylmethyl-4-aryl-1H-pyrrole-3-

carboxylic acids. IL FARMACO, vol. 45, p. 833-846, ISSN: 0014-827X

160 1990

A. Pierallini, S. Bastianello, S. Giuliani, M. Artico, G. Antonini, F. Nucci, L. Bozzao

(1990). Studio con immagini del tunnel carpale in soggetti normali e sintomatici.


161 1990

M. Salvati, E. Ramundo Orlando, M. Artico, S. Martini, R. Caruso, A. Fortuna

(1990). The tethered cord syndrome in the adult. Report of three cases and

review of the literature. ZENTRALBLATT FUR NEUROCHIRURGIE, vol. 51, p. 91-

93, ISSN: 0044-4251

162 1990

A. Raco, P. Ciappetta, M. Artico, M. Salvati, G. Guidetti, G. Guglielmi (1990).

Vertebral hemangiomas with cord compression: the role of embolization in five

cases. SURGICAL NEUROLOGY, vol. 34, p. 164-168, ISSN: 0090-3019

241

163 1989

L. Ferrante, M. Acqui, M. Artico, L. Mastronardi, G. Rocchi, A. Fortuna (1989).

Cerebral meningiomas in children. CHILDS NERVOUS SYSTEM, ISSN: 0256-

7040

164 1989

N. Di Lorenzo, L. Palma, M. Artico, A. Fortuna (1989). Cisti aracnoidee

malformative della fossa posteriore: trattamento chirurgico e risultati a distanza.


165 1989

F. Nucci, M. Artico, G. Antonini, M. Millefiorini, S. Bastianello, L. Bozzao (1989).

Compression of the ulnar nerve in Guyon's canal by a giant cell tumor.

ZENTRALBLATT FUR NEUROCHIRURGIE, ISSN: 0044-4251

166 1989

M. Salvati, M. Ferrari, F. Fiorenza, E. Ramundo Orlando, M. Artico, F. Cosentino

Jr, F. Cosentino (1989). Differential diagnosis of multiple gliomas, multicentric

gliomas and the other main endocranial multifocal lesions. Presentation of a

case. GIORNALE ITALIANO DI ONCOLOGIA, vol. 9, p. 135-140, ISSN: 0392-

128X

167 1989

N. Di Lorenzo, E. Palatinsky, M. Artico, L. Palma (1989). Dural mesenchymal

chondrosarcoma of the lumbar spine. Case report. SURGICAL NEUROLOGY,

ISSN: 0090-3019

168 1989

M. Salvati, F. Cosentino, M. Ferrari, M. Artico, F. Fiorenza, F. M. Gagliardi

(1989). Familial cerebral aneurysms: case report and review of the literature.

RIVISTA DI NEUROLOGIA, vol. 59, p. 66-70, ISSN: 0035-6344

169 1989

Vito D'Andrea, Marco Artico, L. Capuano, Livio Gallottini, V. Ambrogi (1989).

IMMUNOHISTOCHEMICAL DEMONSTRATION OF NEUROPEPTIDE-Y IN NORMAL

HUMAN THYMUS AND IN THYMOMA. MEDICINA, vol. 9, p. 299-301, ISSN:

0392-6516

242

170 1989

G. P. Cantore, A. Raco, M. Artico, P. Ciappetta, R. Delfini (1989). Primary

chiasmatic lymphoma. CLINICAL NEUROLOGY AND NEUROSURGERY 91(1):71-

4. ISSN: 0303-8467

171 1989

M. Artico, L. Bardella, P. Ciappetta, A. Raco (1989). Surgical treatment of

subependymomas of the central nervous system. Report of 8 cases and review

of the literature. ACTA NEUROCHIRURGICA 98(1-2): 25-31 ISSN: 0942-0940

172 1988

F. Nucci, L. Mastronardi, M. Artico, L. Ferrante, M. Acqui (1988). Tuberculoma

of the ulnar nerve: case report. NEUROSURGERY 22(5):906-7 ISSN: 0148-396

173 1988

L. Bardella, M. Artico, F. Nucci (1988). Intramedullary subependimoma of the

cervical spinal cord. SURGICAL NEUROLOGY 29(4):326-9. ISSN: 0090-3019

174 1987

S. BIAGIONI, F. MANNELLO, F. STELLA, S. BATTISTELLI, F. MARCHEGGIANI, L.

CERRONI, M. ARTICO, C.TERZANO, R. TROCCOLI (1987). Lactate

dehydrogenase, isoenzyme patterns ande cation levels in human breast gross

cyst fluid. CLINICA CHIMICA ACTA 169(1):91-7. ISSN: 0009-8981

175 1987

Troccoli R, Stella F, Stella C, Battistelli S, Antonioni M, Marcheggiani F, Mannello

F, Biagioni S, Artico M, Terzano C. (1987) Carcinoembryonic antigen in a review

of cases in the literature. Quad Sclavo Diagn 23(3): 233-45.

Books and book chapters

2005 Marco Artico (2005). Appunti di Anatomia Microscopica. In: Appunti di

Anatomia Microscopica. p. 1-130

Proveniente dall'Archivio Istituzionale di UNIROMA1 con codice 509986

2005 Artico M, Castano P, Cataldi A, Falconi M, Milintenda F, Formigli L, Onori

P, Papa S, Pellegrini A, Pirino AS (2005). Anatomia Umana – Principi.

MILANO:Edi.Ermes, ISBN: 9788870512502


243

1996 Luigi Cervoni, Marco Artico, Paolo Celli, Riccardo Caruso, Franco M.

Gagliardi (1996). Gli Ependimomi Spinali: aspetti clinici e prognostici. p. 1-50,

Roma:CISU


1993 MALINOVSKY L, CAVALLOTTI C, TROCCOLI R, ARTICO M, MALINOVSKA V, V. D'ANDREA

(1993). MORPHOLOGY OF GLOMERULAR (KRAUSE) SENSORY CORPUSCLES:THEIR

VARIABILITY,DEFINITION AND RELATION TO BLOOD VESSELS. IN: CAVALLOTTI CARLO. ATTI DEL

DIPARTIMENTO DI SCIENZE CARDIOVASCOLARI E RESPIRATORIE. VOL. 3, P. 160-174,

ROMA:EDIZIONI UNIVERSITARIE ROMANE

Proveniente dall'archivio Istituzionale di Uniroma1 Con Codice 156188

244

Chapter 13

Acknowledgements

This thesis is the final work of my path towards Ph.D. This work has been made

possible through the precious advices and support of friends, colleagues of

different institutions. I would like to express my gratitude and deep thanks to

all those colleagues who made possible to complete this study in its present

form and who contributed to render this work interesting and unforgettable in

my personal experience. First and foremost my warmest and deep gratitude

goes to my first supervisor Prof. Alberto Signore, whose encouragement,

precious advices, patience and outstanding experience have been fundamental

in my own work during the drawing up and completion of this PhD thesis.

Special thanks should also be given to Prof. R.A.J.O. Dierckx for the wonderful

opportunities, the support and the guidance that he, with his marvelous

sympathy, had provided to me in my stimulating and amazing “Dutch

adventure”. Other special thanks should to be expressed to Dr. Sharon Poort

and Dr. Filippo Galli for being a paranimph in this ceremony. I am also

particularly grateful to the wonderful, ancient and prestigious University of

Groningen, which has made possible for me to reach this ultimate goal of PhD.

Finally, I would thank my fiancee Marialuisa for her sweet and patient capability

of supporting me during these years and for her participation to the ceremony

of my final dissertation.

university of groningen growth factors, cytokines and vegf ... · 7 chapter 1 introduction vegf in...

Documents