understanding intestinal lipopolysaccharide permeability
TRANSCRIPT
Graduate Theses and Dissertations Iowa State University Capstones, Theses andDissertations
2012
Understanding intestinal lipopolysaccharidepermeability and associated inflammationVenkatesh ManiIowa State University
Follow this and additional works at: https://lib.dr.iastate.edu/etd
Part of the Human and Clinical Nutrition Commons, Physiology Commons, and the ToxicologyCommons
This Dissertation is brought to you for free and open access by the Iowa State University Capstones, Theses and Dissertations at Iowa State UniversityDigital Repository. It has been accepted for inclusion in Graduate Theses and Dissertations by an authorized administrator of Iowa State UniversityDigital Repository. For more information, please contact [email protected].
Recommended CitationMani, Venkatesh, "Understanding intestinal lipopolysaccharide permeability and associated inflammation" (2012). Graduate Thesesand Dissertations. 12788.https://lib.dr.iastate.edu/etd/12788
Understanding intestinal lipopolysaccharide permeability and associated
inflammation
by
Venkatesh Mani
A dissertation submitted to the graduate faculty
in partial fulfillment of the requirements for the degree of
DOCTOR OF PHILOSOPHY
Major: Toxicology
Program of Study Committee: Nicholas K. Gabler, Major Professor
Anumantha G. Kanthasamy Gary D. Osweiler
Michael J. Wannemuehler Thomas E. Weber
Iowa State University
Ames, Iowa
2012
Copyright © Venkatesh Mani, 2012. All rights reserved.
ii
DEDICATION
To all the animals who we have sacrificed their
innocent lives for the betterment of human beings
and to my family who sacrificed so many things
for my research endeavors.
iii
TABLE OF CONTENTS ACKNOWLEDGEMENTS ...................................................................................................... v
ABSTRACT ............................................................................................................................ vii
CHAPTER 1. GENERAL INTRODUCTION ........................................................................ 1
Introduction ........................................................................................................................... 1
Dissertation organization ....................................................................................................... 3
Literature Cited ..................................................................................................................... 4
CHAPTER 2. REVIEW OF LITERATURE: LIPOPOLYSACCHARIDE, INFLAMMATION AND INTESTINAL FUNCTION ............................................................ 6
Abstract: ................................................................................................................................ 6
Introduction ........................................................................................................................... 7
Lipopolysaccharide ............................................................................................................. 10
Innate Immune Response .................................................................................................... 11
Lipopolysaccharide Signaling and Permeability ................................................................. 16
MicroRNA Regulation of LPS Signaling............................................................................ 18
Gastrointestinal Tract Function ........................................................................................... 20
Intestinal LPS Permeability ................................................................................................. 22
Lipopolysaccharide Detoxification ..................................................................................... 26
Dietary Fat and Inflammation ............................................................................................. 30
Implications of Intestinal LPS and Inflammation ............................................................... 32
Summary and Conclusion ................................................................................................... 36
Literature Cited ................................................................................................................... 37
CHAPTER 3: DIETARY OIL COMPOSITION DIFFERENTIALLY MODULATES INTESTINAL ENDOTOXIN TRANSPORT AND POSTPRANDIAL ENDOTOXEMIA . 62
Abstract ............................................................................................................................... 62
Background ......................................................................................................................... 63
Methods ............................................................................................................................... 66
Results ................................................................................................................................. 70
Discussion ........................................................................................................................... 72
Acknowledgements ............................................................................................................. 77
References ........................................................................................................................... 79
iv
CHAPTER 4: DIETARY n-3 FATTY ACIDS REDUCE INTESTINAL LIPOPOLYSACCHARIDE PERMEABILITY AND ALTER MEMBRANE RAFT LIPID COMPOSITION AND FUNCTION ...................................................................................... 90
Abstract ............................................................................................................................... 90
Introduction ......................................................................................................................... 92
Materials and Methods ........................................................................................................ 94
Results ............................................................................................................................... 100
Discussion ......................................................................................................................... 105
Acknowledgments ............................................................................................................. 109
References ......................................................................................................................... 109
CHAPTER 5: MATERNAL n-3 PUFA SUPPLEMENTATION IN PIGS ATTENUATES AN INFLAMMATORY CHALLENGE LATER IN LIFE.................................................. 127
Abstract ............................................................................................................................. 127
Introduction ....................................................................................................................... 128
Materials and Methods ...................................................................................................... 131
Results ............................................................................................................................... 134
Discussion ......................................................................................................................... 137
Literature Cited ................................................................................................................. 141
CHAPTER 6: INTESTINAL INTEGRITY, ENDOTOXIN TRANSPORT AND DETOXIFICATION IN PIGS DIVERGENTLY SELECTED FOR RESIDUAL FEED INTAKE ................................................................................................................................ 153
Abstract ............................................................................................................................. 153
Introduction ....................................................................................................................... 155
Materials and Methods ...................................................................................................... 156
Results ............................................................................................................................... 163
Discussion ......................................................................................................................... 165
Literature Cited ................................................................................................................. 170
CHAPTER 7. GENERAL CONCLUSIONS ....................................................................... 186
APPENDIX: ABSTRACTS SUBMITTED .......................................................................... 195
v
ACKNOWLEDGEMENTS
My parents Mr. A. N. Mani and Ms. C. Pavayee, wife Shanthi Ganesan, daughters
Jyotsna and Joshitha Venkatesh, brother and sister in law M. Chandrakumar and P.
Manimegalai, sister in law and her husband Dr. G. Bhuvaneshwari and Dr. S. Palanivel, in
laws and brother in law Ms. S. Jayalakshmi, Mr. V.Ganesan, Mr. G. Manikandan, friends A.
Arunagiri and S. Thangamani are the people without whose support my ambition of doing
PhD studies in USA might have remained an unfulfilled dream forever.
I would like to express my sincere gratitude’s to my major professor, Dr. Gabler. He
was both a friend and a mentor while I was pursuing my research ambitions. He also
supported my family immensely within and outside the boundaries the academic world. He
allowed me to pursue my interests and motivated me to learn new techniques, think critically
and outside of the box. These things have provided me the ideal foundation to grow as a
scientist. I also learnt the importance of a great work ethic and balance with family from him.
I can assuredly and proudly say my Ph.D. experience is on the very best of Ph.D. experience
one can get. Thanks to Dr. Sara Cutler for directing me towards Dr. Gabler.
I am grateful for all the guidance and support I got from my committee members Drs.
Anumantha Kanthasamy, Gary Osweiler, Michael Wannemuehler and particularly to Tom
Weber, for all their input, discussions, technical expertise, cell lines and chemicals I used
from their labs. Special gratitude to other professors who helped me with my research
including Drs. Patience, Ross, Hollis, Lonergan, Kerr, Beitz, Persia, Baumgard, Keating,
Boddicker and Ghoshal. Special thanks to Ms. Martha Jeffrey and Ms. Julie Roberts whose
help was invaluable for my research.
vi
I am indebted to the Toxicology Graduate Program and Dr. Anumantha Kanthasamy,
Ms. Linda Wild, Ms. Linda Erickson, and Mr. Bill Richardson for their timely support when
I needed it most in the early period of my Ph.D. program.
Special thanks to all my current and past friends in the department who supported me
in every way possible way particularly Sarah Pearce, Amanda Harris, Dana Van Sambeek,
Dr. Anoosh Rakhshandeh, Katie Ruge, Richard Faris, Nick Boddicker, Ganapathy Raj,
Nestor Gutierrez, Brianna Adamic, Kyle Grubbs, Delphine Gardan, Anna Gabler, Cassie
Jones, Brandy Jacobs, Chad Pilcher, Amanda Chipman, James and Dawn Koltes, Neva
Nachtrieb, Soi Lei (Sam), Ben Hale, Victoria Fernandez, Jill Madden, Emily Kuntz, Allison
Flinn, Boris Jovanovic, Samuel Buxton, Afeseh Ngwa Hillary and James Delgado.
Sincere gratitude to my Indian friends in Ames and elsewhere, who supported me and
my family immensely without whose support my life would have been a day to day struggle,
particularly Vikram, Mridul and Usha, Najeeb, Sunitha and Pichu, Sreekanth and Devi,
Sivakumar, Sumathi Sivakumar and Praghul, Sukumar, Ponraj, Babu and Sulochana,
Narasimha and Anusha, Suneel and Shilaja, Dinesh and Smitha, Hari and Lavanya, Sumathi
Raj, Vidya, Ravi, Hari, Poulomi and Anamitra, Arun and Kabhilan.
Finally, special thanks go to Iowa State University for providing me a world class
education and to the staff at the Swine Nutrition farm; Dan, John, Robert, and Jacob, City of
Ames for letting me live a very peaceful life. Sincere thanks to my alma maters Madras
Veterinary College, Madurai Kamaraj University, Govt. higher secondary school, Anthiyur
and St. Sebastian School in Nagalur and all the teachers, friends, and relatives who provided
the strong foundation and mental support which helps me in moving forward.
vii
ABSTRACT
Lipopolysaccharide (LPS) and the inflammation associated with its stimulation of the
innate immune responses can have major implications for human and animal health and
production. This dissertation research goal was to further understand dietary modulation of
intestinal LPS permeability and LPS associated inflammation. Additionally, we sort to
examine LPS detoxification and the relationship LPS has with swine health and feed
efficiency.
High caloric and high dietary fat increases the risk of endotoxemia which can result in
a low grade inflammation, a predisposing factor for common metabolic diseases such as
Type II diabetes and atherosclerosis. However, little is known about the effect of dietary oil
fatty acid composition on intestinal LPS permeability and postprandial endotoxemia.
Therefore, we examined whether dietary oil composition differentially modulated intestinal
LPS permeability and postprandial endotoxemia. Our in vivo and ex vivo research using pigs
and isolated pig intestinal tissues indicated that a single administration of oils rich in long
chain n-3 polyunsaturated fatty acids (PUFA), such as fish oil and cod liver oil, decreases
LPS permeability and postprandial circulating LPS levels (P<0.05). Furthermore, oils rich in
saturated fatty acids, such as coconut oil, augmented LPS permeability and postprandial
endotoxemia (P<0.05). Mechanistically, this may be associated with the structure and
function of cell membrane lipid raft microdomain structures.
Dietary long chain n-3 PUFA such as eicosapentaenoic acid (EPA) and
docoasahexaenoic acid (DHA) have been shown to antagonize LPS signaling. Therefore, we
viii
examined the ability of dietary EPA and DHA to attenuate intestinal LPS permeability and
lipid raft localization of key LPS signaling proteins. Long term dietary EPA and DHA
supplementation to pigs enriched intestinal epithelial membrane with EPA and DHA
(P<0.05). Phospholipid fatty acid composition of the lipid raft fractions also revealed
enrichment of phosphatidyl ethanolamine and phosphatidyl serine with EPA and DHA.
Mechanistically, membrane EPA and DHA enrichment decreased localization of LPS
signaling proteins, TLR4 and CD14, into ileum and colon lipid raft microdomains.
Collectively, this decreased ex vivo LPS permeability and circulating LPS concentrations
(P<0.05). Interestingly, an acute systemic inflammatory challenge resulted in a decreased
localization of TLR4 and CD14 into lipid rafts, which has the potential to desensitize the pigs
to a subsequent immune challenge otherwise known as LPS tolerance.
The ability of the maternal diet and prenatal nutrition to impact postnatal growth,
development and health has received much attention in recent years. Knowing that DHA and
EPA can regulate the innate immune response to an LPS challenge, we wanted to study if
maternal n-3 PUFA supplementation of n-3 PUFA could modulate an acute inflammatory
challenge in the offspring later in life. Sows and piglets received nutrition devoid or enriched
with EPA and DHA during gestation and lactation or throughout life from gestation to ten
weeks of age. The offspring was then challenged with LPS or saline to initiate an
inflammatory response and buffy coats isolated 4 h post challenge. Interestingly, maternal n-
3 PUFA supplementation attenuated the LPS induced inflammatory response in the offspring
late in the nursery phase of growth (P<0.05). This was comparable to that of continuous n-3
PUFA supplementation. Both treatment groups exposed to DHA and EPA had a decreased
ix
febrile and serum TNF-α cytokine response to LPS, buffy coat mRNA abundance of TNF-α,
IL-1β and IL-10 and the mRNA abundance of the LPS signaling proteins, TLR4, CD14 and
Myd88, compared to control group (P<0.05).
Lastly, we used pig lines divergently selected for residual feed intake (RFI, with low
RFI being more efficient compared to high RFI) to understand the relationship between
intestinal barrier integrity, LPS and associated inflammation with pig feed efficiency. Our
research indicates that HRFI pigs seem to be undergoing a greater level of basal
inflammation contrary to pigs selected for LRFI. The LRFI pigs had a lower circulating
endotoxin concentration, more robust intestinal and liver LPS detoxification and higher
active anti-microbial enzymes including alkaline phosphatase and lysozyme (P<0.05).
Furthermore, LRFI pigs had a reduced activity of the inflammatory biomarker enzyme
myeloperoxidase (P<0.05). Altogether, LPS and low grade inflammation may partially
explain the divergence in feed efficiency and RFI in grow-finisher pigs.
1
CHAPTER 1. GENERAL INTRODUCTION
Introduction
Gram negative bacteria such as Salmonella and Escherichia contain
lipopolysaccharide (LPS) in their cell wall outer membrane which is a potential stimulator of
the innate immune system of humans and livestock species. Over the recent years, LPS has
received much attention due to its ability to stimulate a low grade inflammation.
Lipopolysaccharide is a glycolipid composed of a hydrophobic domain lipid A through
which it is attached to the outer membrane of the cell wall, a core and distal oligosaccharide
and two phosphate molecules. Even though the terms LPS and endotoxin are interchangeably
used in the literature, there are biochemical and molecular differences between these two
compounds. To reflect our original experimental nature we will be using lipopolysaccharide
more commonly throughout this dissertation. Lipopolysaccharide recognition and the
associated inflammation have been widely studied. It is first recognized by the innate
immune system, which is usually non-specific towards the foreign molecules. The innate
immune system depends on pattern recognition receptors (PRR) which recognize specific
patterns of molecular structures present in the microbes. Lipopolysaccharide is recognized by
Toll-like receptor 4 (TLR4), present on the cell membrane of immune cells, adipocytes,
myocytes, and epithelial cells (Abreu, 2010; Beutler, 2004; Gabler et al., 2008; Lenardo and
Baltimore, 1989). After recognition, the host cells initiate an inflammatory response via the
activation of the master transcription factor, nuclear factor- κB (NF-κB). The resulting
increase in pro-inflammatory cytokines helps in recruiting other immune cells, inducing
2
febrile response to remove the foreign agent, and communicating with the adaptive immune
system (McGettrick and O’Neill, 2010).
Gram-negative bacteria are present ubiquitously in the environment and also in the
respiratory and gastrointestinal tract. Thus, most mammals are constantly exposed to LPS. In
humans, low grade endotoxemia induced by persistent presence of LPS in the blood has been
shown to be a predisposing factor for the development of metabolic diseases including Type
II diabetes, obesity, and atherosclerosis (Delzenne and Cani, 2011; Vaarala et al., 2008).
Moreover, high fat, high caloric diet or high carbohydrate diets have been shown to increase
the serum lipopolysaccharide levels (Erridge et al., 2007; Ghanim et al., 2009). In production
animals such as pigs, LPS exposure antagonizes appetite, digestion, and skeletal muscle
protein synthesis that ultimately leads to diversion of nutrients and energy away from
important production orientated pathways and systems (skeletal muscle, reproductive tract
etc…) to support the immune system (Johnson, 1997). Although this is important for immune
system function and health of the animal, long term exposure to LPS and subsequent
activation of immune system and the development of metabolic syndrome affects growth and
production efficiencies.
Considering the significance of LPS and its effect on human and animal health and
metabolism, little is known or studied on the pathways through which LPS enters circulation
via the intestinal tract and also its detoxification. This is surprising considering the
gastrointestinal tract is a major source of gram negative bacteria and LPS. The mode of LPS
permeability across the intestinal epithelium and into systemic circulation may be through a
transcellular route or paracellular route between two epithelial cells through tight junctions.
3
Additionally, micelle facilitated LPS permeability also happens when the dietary fat
digestion occurs in the intestine (Kelly et al., 2012; Tomlinson and Blikslager, 2004).
Therefore, the overall goal of this dissertation research presented herein is to further
understand and characterize intestinal LPS permeability and LPS signaling. Furthermore, this
new knowledge gained could be used to develop dietary, genetic, or pharmacological
mitigation strategies to promote health, growth, and metabolic efficiencies in humans and
livestock. To address this goal, the specific objectives of this dissertation were:
1. To evaluate the composition of dietary fat to differentially modulate intestinal LPS
permeability and postprandial endotoxemia.
2. To identify whether dietary n-3 PUFA alter intestinal membrane composition and
function resulting in attenuated LPS permeability.
3. To examine whether maternal exposure to dietary n-3 PUFA would attenuate the febrile
response and inflammatory response to an exogenous LPS challenge later in the life.
4. To evaluate the contribution of intestinal endogenous LPS and its associated uptake and
detoxification to feed efficiency using pigs divergently selected for residual feed intake.
Dissertation organization
Based on the work to achieve the objectives of this dissertation, five manuscripts
were written for submission. Each of the manuscript is presented as a separate chapter in the
format prepared for the journal we submitted then for publication. A review of literature as
background for this research is outlined in Chapter 2. This chapter has, in part, been
published in the Journal of animal science as a symposium review paper pertaining to LPS,
4
gastrointestinal tract LPS permeability and LPS associated inflammation and detoxification.
In Chapter 3, the effect of dietary oil composition on intestinal LPS permeability and
postprandial endotoxemia was studied. This article was submitted to Nutrition & Metabolism
journal and is under review. Chapter 4 examines the effects of dietary n-3 PUFA
eicosapentaenoic acid and docosahexaenoic acid supplementation on intestinal epithelial cell
membrane composition and lipid raft associated LPS permeability in pigs. This research will
be submitted to the Journal of Lipid Research for review and publication. The evaluation of
maternal n-3 PUFA supplementation on LPS induced febrile response and inflammation is
presented in Chapter 5. This research will be submitted to the Journal of Nutrition. The final
research chapter uses pigs divergently selected for feed efficiency to examine the role of
endogenous LPS on finisher pig growth and performance (Chapter 6). This research is
submitted to the Journal of Animal Science and is under review. The final chapter (#7)
includes general conclusions and an overall discussion of the research.
Literature Cited
Abreu, M. T. 2010. Toll-like receptor signalling in the intestinal epithelium: how bacterial recognition shapes intestinal function. Nat Rev Immunol 10: 131-144.
Beutler, B. 2004. Innate immunity: an overview. Mol Immunol 40: 845-859. Delzenne, N., and P. Cani. 2011. Gut microbiota and the pathogenesis of insulin resistance.
Curr Diab Rep: 1-6. Erridge, C., T. Attina, C. M. Spickett, and D. J. Webb. 2007. A high-fat meal induces low-
grade endotoxemia: evidence of a novel mechanism of postprandial inflammation. Am J Clin Nutr 86: 1286-1292.
5
Gabler, N. K., J. D. Spencer, D. M. Webel, and M. E. Spurlock. 2008. n-3 PUFA attenuate lipopolysaccharide-induced down-regulation of toll-like receptor 4 expression in porcine adipose tissue but does not alter the expression of other immune modulators. J Nutr Biochem 19: 8-15.
Ghanim, H. et al. 2009. Increase in Plasma Endotoxin Concentrations and the Expression of
Toll-Like Receptors and Suppressor of Cytokine Signaling-3 in Mononuclear Cells After a High-Fat, High-Carbohydrate Meal. Diab Care 32: 2281-2287.
Johnson, R. W. 1997. Inhibition of growth by pro-inflammatory cytokines: an integrated
view. J Anim Sci 75: 1244-1255. Kelly, C. J., S. P. Colgan, and D. N. Frank. 2012. Of microbes and meals. Nutr in Clin Prac
27: 215-225. Lenardo, M. J., and D. Baltimore. 1989. NF-κB: A pleiotropic mediator of inducible and
tissue-specific gene control. Cell 58: 227-229. McGettrick, A. F., and L. A. J. O’Neill. 2010. Regulators of tlr4 signaling by endotoxins. in:
x. wang and p. j. quinn (eds.) Endotoxins: structure, function and recognition. Subcell Biochem No. 53. p 153-171. Springer Netherlands.
Tomlinson, J. E., and A. T. Blikslager. 2004. Interactions between lipopolysaccharide and the
intestinal epithelium. Journal of Amer Vet Med Assoc 224: 1446-1452. Vaarala, O., M. A. Atkinson, and J. Neu. 2008. The "perfect storm" for type 1 diabetes: the
complex interplay between intestinal microbiota, gut permeability, and mucosal immunity. Diabetes 57: 2555-2562.
6
CHAPTER 2. REVIEW OF LITERATURE: LIPOPOLYSACCHARIDE,
INFLAMMATION AND INTESTINAL FUNCTION1
V. Mani*,†
*Department of Animal Science, Iowa State University, Ames 50011;
†Interdepartmental Toxicology Graduate Program, Iowa State University, Ames 50011
Abstract: Lipopolysaccahride (LPS) often referred to as endotoxin, can stimulate localized
or systemic inflammation via the activation of pattern recognition receptors. Additionally,
LPS and associated inflammation can regulate intestinal epithelial function by altering
epithelial barrier integrity as well as nutrient transport and utilization. The gastrointestinal
tract is a large reservoir of both Gram positive and negative bacteria, of which the Gram
negative bacteria serve as a source of LPS. Luminal LPS can enter circulation via three major
routes: 1) nonspecific paracellular permeation through epithelial cell tight junctions and 2)
transcellular permeation through lipid raft membrane domains involving receptor mediated
1 Based on a presentation at the Growth and Development Symposium titled
“Understanding and Mitigating the Impacts of Inflammation on Animal Growth and
Development” at the Joint Annual animal science meeting, July 10-14, New Orleans, LA”.
A modified version of this Chapter was published in the Journal of Animal Science 90:
1452-65 (2012).
7
endocytosis, 3) through micellar assisted permeation while fat is consumed through diet.
Paracellular permeability of LPS occurs through dissociation of tight junction protein
complexes resulting in reduced intestinal barrier integrity, which can be a result of enteric
disease, inflammation, or environmental and metabolic stress. Transcellular permeability, via
specialized membrane regions rich in glycolipids, sphingolipids, cholesterol, and saturated
fatty acids, is a result of raft recruitment of LPS-related signaling proteins leading to
signaling and endocytosis. All permeability routes and sensitivity to LPS may be altered by
diet, environmental and metabolic stresses. Intestinal derived LPS and inflammation result in
suppressed appetite, activation of the immune system, and partitioning of energy and
nutrients away from growth towards supporting the immune system requirements. In
livestock, this leads to the suppression of growth, particularly, suppression of lean tissue
accretion. In this chapter, we summarize the evidence that intestinal permeability of LPS and
the subsequent inflammation leads to decrease in the production performance of agricultural
animals, and we present an overview about LPS detoxification mechanisms in livestock.
Key words: Lipopolysaccharide, Endotoxin, Intestine, Inflammation
Introduction
Growth performance of agricultural animals in commercial settings and human health
is affected by various physical, social, and microbial factors that may predispose animals to
physiological or immunological stresses (Holck et al., 1998). Among the stressors that can
attenuate the growth performance and alter metabolism are viruses, live bacteria, and dead
bacteria that contain cell wall compounds such as lipopolysaccharide (LPS) and
8
peptidoglycans (Schinckel et al., 1995; Smith, 1998). Additionally, recent biomedical
evidence suggests that low grade inflammation caused by intestinal derived LPS is linked to
metabolic diseases like Type II diabetes, atherosclerosis and cardiovascular diseases (Cani
and Delzenne, 2010). Importantly, the mucosal epithelium of the gastrointestinal tract serves
as a major barrier to the LPS whereas the bacteria present in the intestinal lumen acts as a
major source of LPS (Ravin et al., 1960; Schweinburg and Fine, 1960; Wiznitzer et al.,
1960). Specific to the focus of this review, we will discuss LPS, otherwise referred to as
endotoxin in the literature, the cell wall component of Gram negative bacteria which is a
potent immune stimulator in the context of livestock production and human health.
Lipopolysaccharide in mammals is recognized by various cells expressing the pattern
recognition receptor, Toll-like receptor (TLR)4, and other proteins including LPS binding
protein (LBP), cluster of differentiation 14 (CD14), and MD-2. These proteins and receptors
are also shown to be present in intestinal epithelial cells and have been associated with the
permeability of luminal LPS into circulation (Hornef et al., 2003; Neal et al., 2006). Once in
the systemic circulation, LPS can be deactivated or detoxified by immune cells, such as
macrophages, Kupffer cells present in the liver or splenic cells, or by binding with plasma
proteins (Buttenschoen et al., 2010; Rutenburg et al., 1967; Satoh et al., 2008). However, if
there is failure of systemic detection and deactivation because there is more permeability of
LPS from the intestinal tract the resulting increased circulating LPS can lead to systemic
inflammation which can lead to endotoxemia, multi organ failure and even death (Rice et al.,
2003; Zweifach and Janoff, 1965). The importance of LPS to livestock production is that
chronic activation of the immune system has been shown to antagonize the growth and
performance of animals, as nutrients are being partitioned towards production of cytokines,
9
acute phase proteins, and other immune modulators rather than towards the anabolic
processes that support milk and muscle synthesis (Johnson, 1997; Spurlock, 1997). Further,
LPS can lead to various diseases including laminitis in equines and also endotoxemia is the
leading cause of death in equine species (Sykes BW, 2005; Werners et al., 2005).
Lipopolysaccharide has also been shown to activate the heterophils and up-regulate the pro-
inflammatory cytokine and chemokine expression in poultry (Kogut et al., 2005). In human
health, presence of LPS in the circulation have been shown to contribute to the development
of chronic inflammatory processes which eventually promote the development of
dysregulated metabolism which results in many metabolic diseases like type II diabetes and
non-alcoholic fatty liver disease through the stimulation of TLR4 (Erridge, 2011).
Interestingly, permeability of LPS from the intestine has been shown to be modulated
by dietary factors, as well as by stressors including heat stress, systemic disease, and also by
feed restriction or malnutrition (Cani and Delzenne, 2010; Hall et al., 2001). The major
dietary factor that appears to modulate the permeability of luminal LPS is dietary fat. As
indicated in the biomedical and human health literature, as the percentage of dietary fat
increases, so does the concentration of circulating LPS (Amar et al., 2008; Erridge et al.,
2007). Further, the form of the lipid ingested may modulate the LPS permeability with
emulsified lipids increasing LPS permeability (Laugerette et al., 2011). In ruminants, feeding
easily-digestible carbohydrates and grains have been shown to increase the permeability of
LPS to the peripheral circulation, indicating that carbohydrates could also influence LPS
permeability (Khafipour et al., 2009; Zebeli et al., 2011). In addition to dietary nutrients,
systemic increases in intestinal-derived LPS can also be attributed to environmental and
immunological stressors. Hyperthermia increases intestinal permeability and, presumably,
10
intestinal LPS permeability too (Lambert, 2004, 2008; Pearce et al., 2011). Plasma
antibodies to LPS are inversely related to growth in malnourished young children and are
associated with increased intestinal permeability and systemic immune system activation
(Campbell et al., 2003). Further studies are warranted to investigate the relationship between
LPS, growth, and metabolic changes.
Lipopolysaccharide
Lipopolysaccharide is a glycolipid present in the outer membrane of Gram negative
bacterial cell wall. It consists of a hydrophobic domain, lipid A, through which it is inserted
into the outer leaflet of the outer membrane of the bacterial cell wall, a core oligosaccharide
and a distal oligosaccharide (Elin and Wolff, 1976; Raetz and Whitfield, 2002a). The
hydrophobic lipid A domain is the most biologically active portion of the LPS molecule and
it is synonymously known as ‘endotoxin’ because of its ability to stimulate the innate
immune cells (Erridge et al., 2002). In a wild type Escherichia coli, lipid A contains the
following structural properties: 1) the backbone of the lipid A contains di-glucosamine,
which is phosphorylated at positions 1 and 4'; 2) two 3-hydroxymyristate molecules are
directly attached to each glucosamine, and 3) at positions 2' and 3', the hydroxyl groups of
the fatty acids are substituted by laurate and myristate, and they form an acyloxyacyl bond
with the primary fatty acid chains (Figure 1). Diphosphorylated hexaacyl lipid A molecules
have been shown to be effective stimulators of the immune system because they have been
optimally recognized by the mammalian immune system. Mono-phosphorylated or
dephosphorylated LPS molecules have been shown to substantially lose their potency and
11
immune reactivity (Holst et al., 1996; Munford, 2005). However, monophosphorylated lipid
A is a potent adjuvant and is being formulated into vaccines being used for humans. Another
important characteristic of lipid A is that mostly all the fatty acyl chains are made up of
saturated fatty acids. If the saturated fatty acids are replaced with unsaturated fatty acids, the
resultant LPS molecule induces an attenuated immune response (Kitchens et al., 1992;
Munford and Hall, 1986).
Lipopolysaccharide can enter systemic circulation from live bacteria, or as cell wall
components of dead bacteria. Either way, if the amounts are too great, they can ultimately
antagonize anabolic growth (Kimball et al., 2003; Orellana et al., 2007) or lead to septic
shock and death (Moore and Morris, 1992). Lipopolysaccharide is released not only during
bacterial death but also during growth and division, making it a ubiquitous contaminant
(Petsch and Anspach, 2000; Yaron et al., 2000). The biological activity of the LPS is
measured in endotoxin units (EU). For example, 100 pg of LPS is considered to have 1 EU
of activity, or 10 EU is equivalent to 1 ng of LPS. A single Gram negative bacteria contains
approximately 1015 g of LPS and 105 bacteria can generate 1 EU. It has been shown that a
single E. coli contains approximately 106 lipid A residues (Raetz et al., 1991). Furthermore,
the size of the individual LPS molecules varies between 10 to 20 kDa in monomeric form
and because of the amphiphilic nature; they can arrange themselves into large micellar
structure achieving 1,000 kDa.
Innate Immune Response
The innate immune response is the first line of defense against infectious diseases and
foreign particles. Compared to adaptive immune system, innate immune response is
12
instantaneous, usually activated within minutes to hours of a stimulus, whereas the adaptive
immune response takes hours to days (Janeway and Medzhitov, 2002). The innate immune
response contains five key elements for protection: 1) physical barriers like skin, epithelial
layers, and mucus to prevent the entry of pathogens; 2) enzymes with antimicrobial
properties like lysozyme and muramidase in body fluids to kill the invading agents; 3) a
recognition system like germ line encoded pattern recognition receptors (PRRs) such as
TLRs) and NOD-like receptors allow for immediate detection and response; 4) anti-
microbial responses including the complement system; and 5) the recruitment of other
immune cells for an enhanced response (Aderem and Ulevitch, 2000; Beutler, 2004; Heeg,
2007; Hoffmann et al., 1999). Like the adaptive response, the innate immune system can also
be classified into cellular and humoral components. Hematopoietic cells like macrophages,
dendritic cells, mast cells, neutrophils, eosinophils, natural killer cells and non-hematopoietic
cells such as epithelial cells make up the cellular component. Complement proteins, LPS
binding proteins, C-reactive protein, collectins, and anti-microbial peptides like defensin’s
make up the humoral component (Turvey and Broide, 2010).
The innate immune system was thought to be non-specific; however, a series of
discoveries in the late-1990s proved that this theory was only partially true and that innate
receptors recognized a narrow range of compounds from particular organisms, e.g. TLR4 can
recognize LPS from many organisms (Medzhitov et al., 1997). There are specific receptors
present in immune cells, such as macrophages, dendritic cells, B cells, and certain types of T
cells, that could recognize a particular pattern in the invading microbes which came to be
known as PRRs (Janeway and Medzhitov, 2002; Medzhitov, 2001). Moreover, myocytes and
adipocytes also express these same PRRs (Gabler and Spurlock, 2008). These ‘patterns’
13
present in the different microbial species are essential for their survival and have come to be
known as pathogen associated molecular patterns (PAMP), later to be renamed microbe
associated molecular patterns (MAMP) to include all the microbes including pathogens and
non-pathogens (Akira et al., 2006; Ausubel, 2005). Collectively, the family of PRRs senses
the presence of a variety of molecules from the invading pathogens, as well as commensals,
and regulates the immune response by stimulating the secretion of various immune mediators
(Brikos and O'Neill, 2008). More recently, PRRs have been shown to recognize not only the
pathogenic patterns, but also commensals, as well as cellular degradation products from the
same organism, which are known as damage associated molecular patterns (Chen and Nuñez,
2010; Rosin and Okusa, 2011). The first Toll-like pattern recognition receptor to be
identified was TLR4, which recognizes bacterial LPS and other proteins including heat shock
proteins (Poltorak et al., 1998). At present, there are 11 human and 13 murine TLRs, which
recognize different pathogen components including flagella, peptidoglycan, double-stranded
RNA, and DNA (McGettrick and O’Neill, 2010; Moresco et al., 2011).
Recognition of inflammatory compounds by PRRs leads to the activation of the
master transcription factor nuclear factor-κB (NF-kB). After NF-kB activation, increased
transcription and secretion of a class of pleiotropic molecules, known as cytokines occurs.
Cytokines then act on other cells to induce specific cellular immune response (Lenardo and
Baltimore, 1989). Cytokines can exert autocrine, paracrine, and even endocrine functions.
The physiological actions of cytokines include development of cellular and humoral immune
response, induction of the inflammatory response, regulation of hematopoiesis, control of
cellular proliferation and differentiation, and healing of wounds (Arai et al., 1990; Kindt et
al., 2007). Cytokines can be pro- and anti-inflammatory and lead to the increase or decrease
14
in the magnitude of the inflammatory response. Tumor necrosis factor-α (TNF-α),
interleukin (IL)-6 and IL-8 are considered pro-inflammatory, whereas IL-10 and
transforming growth factor-β are considered anti-inflammatory. These classes of cytokines
are secreted by immune cells and many other cell types (Ashley et al., 2012). For example,
IL-1β secreted by monocytes, endothelial cells and epithelial cells, TNF-α secreted by
macrophages, IL-12 secreted by macrophages and dendritic cells, interferon-β secreted by
fibroblasts are some of the examples of cytokines of innate immune cells. Interleukin-2
secreted by T cells, interferon γ secreted by TH1 cells, and IL-4 secreted by TH2 cells and
mast cells, are some of the examples of cytokines of adaptive immunity. Overall, cytokines
exert their function through acting on five classes of receptors: 1) immunoglobulin
superfamily receptors, 2) class I and 3) class II cytokine receptor family, 4) TNF receptor
family and 5) chemokine receptor family (Borish and Steinke, 2003; Dinarello, 2000;
Miyajima et al., 1992). Chemokines are a sub-family of cytokines with approximately 90-130
amino acids and mainly helps in the leukocyte recruitment (Allen et al., 2007).
Classically, innate immune response is characterized by inflammation. Inflammation
is associated with clinical signs such as redness, pain, heat, swelling, and loss of function.
Inflammation can be acute or chronic depending on the duration it takes to remove the
immune stimuli. The inflammatory process is usually compartmentalized to the affected
tissue (Kindt et al., 2007). During acute inflammation, when the tissue damage occurs by the
immune stimulant, innate immune cells which encounter the invading agent secrete pro-
inflammatory mediators. This results in the classical signs of inflammation as well as
bringing together of leukocytes, antimicrobial mediators like defensins, cathelicidins and
interferons, complement system, kinins, clotting and fibrinolytic proteins, lipid mediators like
15
prostaglandins, leukotrienes, platelet-activating factor, peptides and amines like histamine,
serotonin, neuropeptides and pro-inflammatory peptides and cytokines such as IL-1α, IL-1β,
TNF-α and IL-6 which act to destroy the invading agent. Neutrophils are the first immune
cells to be recruited followed by macrophages, eosinophils, and platelets, and followed by
lymphocytes. If the invading agent is eliminated, the anti-inflammatory process mediated by
cytokines such as IL-10 and transforming growth factor-β takes over to limit the damage to
the surrounding tissues (Ballou, 2012; Dolgachev and Lukacs, 2010; Kindt et al., 2007;
Libby, 2002).
If the local inflammatory process is not contained within the affected tissue, it may
lead to a systemic response, otherwise known as acute-phase response. The cytokines
secreted during the initial response then enters systemic circulation and act on bone marrow,
hypothalamus and liver. Stimulation of bone marrow results in the increased production of
leukocytes needed to fight the infection. Activation of hypothalamus by the cytokines,
directly through cytokine receptors or indirectly through vagus nerve, stimulates the secretion
of prostaglandins which results in a fever response. This febrile response helps in preventing
the growth of the pathogen and increases the overall immune response (Johnson, 1997; Karin
et al., 2006; Wright et al., 2000). Fever is a regulated change in homeostasis of the body and
a complex acute phase response in which a temporary resetting of the body’s thermostatic set
point causing an increase in core body temperature (Hasday et al., 2000; Kluger et al., 1996).
Apart from preventing the pathogen growth and inducing immune response, fever also results
in uncoupling of electrons during oxidative phosphorylation resulting in decreased ATP
synthesis and decreased feed efficiency. Fever also reduces the appetite and, thus, acquisition
of iron from the diet which is required by most pathogens. Also, the acute phase response
16
results in an increase in the production of transferrin and lactoferrin which further restricts
the availability of iron for the pathogen (Kozak et al., 2000).
Further, hypothalamus activates the pituitary gland resulting in the release of
adrenocorticotropic hormone (ACTH) which stimulates the secretion of corticosteroids from
adrenal cortex. Together, the cytokines and hypothalamus-pituitary axis results in the
secretion of acute phase proteins (APP) primarily from the liver. C-reactive protein, serum
amyloid A, fibrinogen, haptoglobin, mannose-binding protein, and complement components
are the major APP secreted (Steel and Whitehead, 1994). Their concentration increases
dramatically, particularly C-reactive protein and serum amyloid A, after an acute phase
response. Acute phase proteins usually bind to the inflammatory agent which in turn helps
facilitates its neutralization through the complement system (Balaji et al., 2000; Eckersall and
Bell, 2010; Gabay and Kushner, 1999).
Lipopolysaccharide Signaling and Permeability
Lipopolysaccharide is recognized and signaled by the PRR, TLR4 (Poltorak et al.,
1998). However, the presence of LPS is not sensed by TLR4 alone. Lipopolysaccharide is
usually present as an aggregate bound to other LPS molecules on which LBP acts and
separates a monomer which is then presented to CD14 receptor. The CD14 receptor is
present in two forms, membrane-bound (mCD14) or soluble (sCD14). The CD14 protein
doesn’t have an intracellular domain so it associates with TLR4, which has a Toll-interleukin
1 receptor (TIR) intracellular domain through which it can transmit the intracellular signal
(Beutler, 2000; Triantafilou and Triantafilou, 2002). Toll-like receptor 4 then dimerizes and
17
binds with MD-2 which transmits the signal through the TIR intracellular domain through
two different pathways. One is a myeloid differentiation factor 88 (MyD88) dependent and
the other one is a MyD88 independent pathway. The first pathway leads to translocation of
nuclear factor kappa beta (NFB) to the nucleus and the initiation of transcription of
inflammatory mediators. Alternately, the independent pathway leads to the activation of
interferon regulatory factor 3 (IRF3) as well as NFB (Coll and O'Neill, 2010; Verstrepen et
al., 2008). Basically, both pathways lead to the secretion and stimulation of pro-inflammatory
cytokines and other immune mediators. The signaling is quenched by endocytosis of TLR4,
along with LPS, to an endosome where it is then degraded (Saitoh, 2009). Current research
indicates that apart from the signaling proteins, lipid rafts are essential for the TLR4
signaling (Figure 2) and permeability through the membrane to occur (Olsson and Sundler,
2006; Pfeiffer et al., 2001; Triantafilou et al., 2002; Triantafilou et al., 2004).
Lipid rafts are small (10-200 nm), heterogeneous, highly dynamic, sterol-and
sphingolipid-enriched domains that compartmentalize cellular signaling processes. Small
rafts can sometimes be stabilized to form larger platforms through protein-protein and
protein-lipid interaction (Pike, 2006). They are specialized membrane domains, which are
rich in saturated fatty acids, cholesterol, and glycosphingolipids (Brown and London, 1998;
Pike, 2003). Some proteins are thought to be preferentially localized in the raft region,
particularly GPI anchored proteins like CD14 (Brown and Rose, 1992). Lipid rafts have
been shown to act as a membrane signaling hub for many receptors and have been implicated
in forming the signaling complex in T cell signaling (He and Marguet, 2008; Janes et al.,
2000; Yaqoob, 2009). Lipid rafts have also been implicated in endocytosis of pathogens
(Manes et al., 2003). Interestingly, TLR4 has been shown to localize to these membrane raft
18
domains upon LPS stimulation and disruption of LPS signaling occurs if the lipid raft is
dissociated (Triantafilou et al., 2002). Further saturated and unsaturated fats have been
shown to reciprocally modulate the TLR4 localization into lipid raft and its signaling.
Saturated fatty acids stimulate the TLR4 to localize into rafts and start the inflammatory
signaling cascade whereas n-3 PUFA’s prevent the stimulation and localization into lipid raft
(Wong et al., 2009).
MicroRNA Regulation of LPS Signaling
MicroRNA (miRNA) are small non-coding RNA molecules of endogenous origin
measuring approximately 22-25 nucleotides that regulate gene expression at the post-
transcriptional level (Figure 3) (He and Hannon, 2004). They are encoded in the genome and
can be found in both introns and exons, and RNA polymerase II is the main enzyme
responsible for their transcription (Wahid et al., 2010). The majority of miRNA genes are
located in intergenic regions and oriented in either sense or antisense fashion to already
annotated genes (Zhou et al., 2011). MiRNA genes are transcribed into poly-cistronic
primary miRNAs (Pri-miRNA) which are processed into approximately 70 nucleotide
imperfect stem-loop structure precursors (Pre-miRNA) by the nuclear localized RNase-III
enzyme, Drosha. Pre-miRNA is exported into the cytoplasm through the Ran-GTP dependent
nucleo/cytoplasmic cargo transporter, exportin 5 (Lund et al., 2004). Here they are cleaved
by another RNase-III enzyme, Dicer, into a dsRNA duplex of approximately 21-25
nucleotide strands with only two complementary strands without the stem loop structure. One
strand of the duplex is loaded into argonaute proteins to produce the effector RNA induced
19
silencing complex which helps the miRNAs reach their target (Khvorova et al., 2003).
miRNA bind to the 3' untranslated region of the mRNA through imperfect complementarity
at multiple sites which leads to either decreased translational efficiency or decreased mRNA
expression. Of these two processes, decreased mRNA expression has been shown to account
for approximately 84 % of the decreased protein production (Guo et al., 2010). Further, very
highly conserved miRNA have been shown to bind to several hundred distinct mRNA
indicating the promiscuous nature of miRNA. Additionally, they have the potential to
regulate most of the transcribed mRNA in a mammalian cell (Baek et al., 2008). It is
predicted that approximately 30-50 % of all mammalian protein-coding genes are targeted by
miRNA and almost all the cellular processes have been shown to be miRNA regulated
(Filipowicz et al., 2008). Because miRNA cannot completely knockdown the function of a
target mRNA, it is assumed that miRNA fine tune gene expression rather than exerting
complete control over any specific target (Contreras and Rao, 2012).
With regard to the innate immune response, recent research indicates that miRNA are
expressed in immune cells and evidences have been published showing their ability to
regulate an inflammatory reaction (O'Neill et al., 2011). An inflammatory stimulant such as
LPS increases the expression of proteins which interact with miRNA and cytokines decrease
the expression of Dicer, which is necessary for processing miRNA (Ma et al., 2011). miRNA
expression could be affected through TLR signaling and could also be dependent on the
transcription factor NF-κB (O'Neill et al., 2011; Zhou et al., 2011). The major miRNAs
which are under the exclusive regulation of NF-κB and thus play significant role in the
inflammatory process include miR-146a, mir-155, and mir-21 (Boldin and Baltimore, 2012).
20
These act as both positive and negative regulators of inflammatory pathways resulting in
enhancing or decreasing an immune response (Lindsay, 2008). Further, the adaptive immune
response is also regulated by miRNA. Extensive miRNA regulation has been shown during
the selection and differentiation of T and B lymphocytes (O'Connell et al., 2012).
Recent evidences also indicate that diet could modify the expression of miRNA
associated with cancer (Saini et al., 2010). High saturated fats have been shown to up-
regulate mir-143, which plays a major role in the pathophysiology of obesity (Takanabe et
al., 2008). Nutritional amounts of polyphenols have also been shown to affect miRNA
expression in liver (Milenkovic et al., 2012). Further, n-3 PUFA supplementation in a rat
model of colon cancer can suppress the expression of miRNA (Davidson et al., 2009).
Therefore, dietary factors can be used to regulate miRNA expression which could modify
subsequent expression of genes involving various physiological pathways depending on the
nature of the dietary supplement.
Gastrointestinal Tract Function
The lumen of the gastrointestinal tract (GIT) is considered a space outside the body
because of its continuity with the external environment. Gastrointestinal track has the
arduous task of absorbing the nutrients that are essential for the organism while preventing
the absorption of substances that are not needed and harmful to the system. The GIT
primarily serves two important functions, absorbing nutrients from the lumen and forming a
barrier between the luminal contents and systemic circulation. Primarily, the intestinal tract
aids in the digestion and absorption of proteins, carbohydrates, lipids, vitamins, minerals, and
water. A single layer of intestinal epithelial cells (IECs), which line the intestine selectively
21
absorbs most of the nutrients needed through active and passive processes with the help of
specific transporters or carrier proteins. For example, glucose and fructose are absorbed
through Na-dependent glucose transporter 1 and glucose transporter 5, respectively. Water is
absorbed through aquaporin receptors, and amino acids and di- and tri-peptides are absorbed
through numerous transporter proteins located on the apical and basolateral membranes.
Additionally, the GIT serves as a major excretory organ which helps in waste products
including excessive nutrients and toxic substances secreted by the biliary system. All these
functions becomes more difficult given the fact that only a single layer of IEC acts as a
selective permeability barrier throughout the intestinal tract.
The epithelial or intestinal integrity is critical for maintaining a physical barrier
between the intestinal lumen and the body. This is dependent largely on the junctional
complexes connecting enterocytes together and is achieved via a well-organized intercellular
array of tight junctions, adhesion junctions, and desmosomes surrounding the apical region of
epithelial cells. Cell to cell adhesion and tight junctions are regulated by the membrane
spanning proteins claudin, occludin, zonula occudens (ZO) 1 and 2, and cingulin (Oswald,
2006; Turner, 2006). Additionally, adhesion junction proteins, such as E-cadherin, also
contribute to gut integrity. Tight junctions are the most apical junctions between two
epithelial cells that are formed by claudin and occludin family protein strands along with
other protein complexes (Chiba et al., 2008; Denker and Nigam, 1998). It is becoming clear
that there are different claudin isoforms that participate in intestinal barrier function.
Together, claudin and occludin proteins are attached to actin cytoskeleton through other
proteins, such as ZO-1 and junction adhesion molecules (Nusrat et al., 2000; Turner, 2006).
It was initially thought that tight junctions form a physical barrier without any cellular
22
regulation, but recent research indicates that tight junction proteins are dynamic and very
well regulated; intracellular translocation of tight junction proteins from the cell membrane
and back occurs regularly during normal cellular processes (Shen et al., 2011).
Intestinal LPS Permeability
Circulating LPS can be derived from the environment where the bacteria can be
ingested along with feed and water or through respiration (Spaan et al., 2006). The other
major source is the commensal bacteria in the GIT particularly members of the
Enterobacteriaceae such as E. coli and Salmonella., which is a rich source of Gram negative
organisms (Ley et al., 2006; Wiznitzer et al., 1960). The bacterial population is very scarce in
the stomach because of the acidic environment, but the numbers increase exponentially the
more distal the location along the intestinal tract from duodenum to colon (Magalhaes et al.,
2007; Tlaskalová-Hogenová et al., 2004). The main entry point for pathogenic bacteria, LPS,
mycotoxin, and other pathogens is via the digestive tract. Thus, the intestine forms a major
physical barrier to prevent pathogens and toxic compounds from entering the mucosa and
circulation and then activating the immune system.
The permeability of LPS from the GIT lumen to the systemic circulation is not fully
understood, but two primary routes exist. The first mode is through the paracellular route
where the LPS permeability occurs through tight junctions formed between two intestinal
epithelial cells (Drewe et al., 2001; Hietbrink et al., 2009). Various factors have been shown
to regulate the permeability properties of the intestinal tight junction barrier (Shen et al.,
2011). When animals are under stress or have intestinal inflammation, small quantities of
23
luminal contents including LPS, commensals, and pathogens may enter the epithelium and
circulation through the tight junctions. These pathogens and MAMPs can stimulate the
localized secretion of pro-inflammatory cytokines, including TNF-α and IL-1β from immune
and intestinal epithelial cells. Consequently, these inflammatory and stress responses may
cause the phosphorylation of myosin light chain by myosin light chain kinase, which results
in the contraction and opening of the intestinal epithelial tight junctions and increases
intestinal permeability (Chen et al., 2006; Moriez et al., 2005; Turner et al., 1997; Turner,
2009, 2011).
Disruption of tight junctions and increased paracellular permeability by oxidative
stress has also been demonstrated in IEC. Treating Caco-2 intestinal epithelial-like cells with
the oxidant hydrogen peroxide, increases barrier permeability and leads to a redistribution of
ZO-1 and occludin (Sheth et al., 2009). Interestingly, Caco-2 cell monolayers treated with
LPS increases lipid peroxidation and paracellular permeability (Courtois et al., 2003). The
increased permeability can be reversed by treatment with the antioxidant butylated
hydroxytoluene. This indicates that LPS itself can decrease intestinal barrier function by a
mechanism that is mediated by oxidative stress. Further indicating a link between redox
status and intestinal barrier function is the finding that treating Caco-2 cells with bile salts
(e.g., Cholic acid) increases paracellular permeability by increasing reactive oxygen species
(Araki et al., 2005). Blocking the increase in reactive oxygen species with the antioxidant, n-
acetyl cysteine, prevents the decrease in trans-epithelial electrical resistance (TER) in bile
acid treated IEC. Bile acid treatment leads to ZO-1 and occludin redistribution and the
increased permeability can be reversed by 1-(5-iodonaphthalene-1-sulfonyl)-1H-hexahydro-
1,4-diazepine hydrochloride, a myosin light chain kinase inhibitor, indicating a linkage
24
between cellular redox status and tight junctions.
Under normal physiological conditions, tight junction barrier integrity remains intact,
and luminal contents and transport of molecules across the tight junctions is very well
regulated (Edelblum and Turner, 2009). Nevertheless, metabolic stress and environmental
stresses, such as heat stress, have been reported to cause increased intestinal permeability or
‘leaky gut’ (Lambert et al., 2002; Lambert, 2004; Singleton and Wischmeyer, 2006).
However, the pathways through which tight junction proteins are regulated by these
conditions are not fully characterized.
Intestinal and systemic diseases are associated with leaky epithelial barrier and
increased intestinal permeability to LPS. The TER of cell monolayers or intestinal epithelial
membranes is a good indicator of the degree of tight junction organization and gut integrity.
Pigs challenged with LPS showed altered intestinal TER compared to their controls,
indicating changes have occurred in intestinal integrity and junctional organization (Albin et
al., 2007). Furthermore, treatment with the omega-3 fatty acids, eicosapentaenoic acid (EPA)
and docosahexaenoic acid (DHA), has effectively been shown to prevent reduced TER
induced by the pro-inflammatory cytokines, interferon-γ and TNF-α, and prevent the
redistribution of occludin and ZO-1 (Li et al., 2008). Also, DHA treatment of Caco-2
monolayers has been shown to increase paracellular permeability via the intracellular
redistribution of the tight junction proteins (Roig-Perez et al., 2004).
The second mode of intestinal LPS and bacteria permeability is via transcellular
permeability occurring through epithelial cells (Neal et al., 2006; Tomita et al., 2004).
Further, evidence indicates that lipid rafts are required for the recruitment of TLR4 and that
receptor-mediated endocytosis is a key mechanism of transcellular permeability of bacteria
25
and LPS in in many cell types (Ancuta et al., 2008; Chassin et al., 2008; Triantafilou et al.,
2002). Initially, it was thought that IEC did not have the necessary receptors to recognize the
innate immune ligands like MAMPs and damage associated molecular patterns. However,
research over the past 10 years has discovered that IEC do play a major role in the
recognition of pathogens and endotoxin, and IEC express specific receptors including TLRs,
nucleotide oligomerization domain receptors, and RIG-I-like receptors (Cario et al., 2000;
Cario, 2005; Santaolalla et al., 2011). The expression of mRNA for all of the TLRs, which
are expressed by immune cells, have been described in human IEC (Abreu, 2010b). The
confounding issue regarding the presence of TLR in IEC is that they are expressed on the
apical side of the membrane; however, they are not believed to be continually activated by
the presence of luminal LPS. Research with IEC has shown that TLR4 is present on the
apical and basolateral membranes, as well as within the golgi apparatus (Abreu, 2010a; Cario
and Podolsky, 2006; Hornef et al., 2003). However, the overall consensus regarding the
TLR4 location and expression indicates that IEC have a hypo-responsiveness towards LPS
and that the location of TLR4 within the cell may be a major contributing factor for the hypo-
responsiveness (Vamadevan, 2010).
Both paracellular and transcellular mode of LPS permeability are two important ways
through which most of the LPS enters systemic circulation from the gut. The gut is the first
line of defense against LPS and if compromised via nutrition, stress or metabolic state, LPS
permeability can increase (Clark et al., 2009; Liu et al., 2009; Suganuma et al., 2002). A
greater understanding of gut LPS permeability will allow for the development of nutritional
and pharmacological mitigation strategies to avert the negative effects of LPS.
26
Lipopolysaccharide Detoxification
After crossing the intestinal barrier, LPS is transported by both lymph and blood;
however, most of the LPS is transported to the liver through the portal vein where a major
portion of the LPS detoxification process occurs (Lemaire et al., 1999; Olofsson et al., 1986;
Van Leeuwen et al., 1994). If the amount of LPS entering the GIT overwhelms the barrier
function of IECs and the detoxification capacity of liver, endotoxemia ensues (Olofsson et
al., 1985). Mammals have developed an elaborate system to tolerate and detoxify LPS at
either the mucosal surface or in systemic circulation. Lipopolysaccharide tolerance can also
occur by the down-regulation of proteins that participate in LPS signaling and the innate
immune response (Fan and Cook, 2004). Bile plays an important role in detoxifying LPS
because of the detergent action of bile salts in the intestinal lumen. Furthermore, after LPS
detection by hepatocytes and Kupffer cells in liver, active and inactive forms of LPS may be
transferred to the bile and excreted into the lumen (Lóránd, 2004; Maitra et al., 1981).
Approximately 7 % of the absorbed LPS is excreted through bile. Munford (2005) describes
four mechanisms through which LPS may be neutralized. First, there are molecules that bind
LPS and prevent it from engaging TLR4. Second, there are enzymes that degrade lipid A to
decrease its activity. Third, LPS can be deactivated following its uptake by the liver. Lastly,
there are target cell adaptations that modify the response to LPS. Moreover, reports show
that incubation of LPS with plasma makes it less pyrogenic and less inflammatory (Rall et
al., 1957; Rudbach and Johnson, 1964; Ulevitch and Johnston, 1978). Specific plasma
proteins are able to bind LPS and this is speculated to aid in the inactivation and
detoxification of LPS (Brade and Brade, 1985; Johnson et al., 1977; Rudbach and Johnson,
1966). Serum amyloid A has been shown to increase during the acute phase response, and
27
also binds to LPS monomers and eliminates this toxin via the liver (Coetzee et al., 1986;
Emmanuel et al., 2008). Additionally, proteins such as collectins, along with bactericidal
permeability increasing protein and neutrophil granules, are also plasma proteins that bind
and neutralize LPS (Chaby, 2004; Munford, 2005).
Intestinal chylomicrons, which are involved in transporting the absorbed fatty acids,
have been shown to promote the absorption of LPS (Ghoshal et al., 2009). However,
chylomicrons have been reported to mitigate the toxic effects of LPS by binding the LPS and
promoting its inactivation via contact and the action of bile (Harris et al., 1993; Read et al.,
1993). Further, LBP can bind to the chylomicrons and enhance the binding of LPS to the
chylomicrons, which helps in reducing its bioactivity (Vreugdenhil et al., 2003). Binding of
LPS to the chylomicron helps in its recognition by low density lipoproteins (LDL) and LDL-
associated receptors present in hepatocytes, which promote the endocytosis of LPS into the
cell and its rapid clearance from circulation (Harris et al., 2002). Presence of apolipoprotein
E in the chylomicrons is also protective against LPS because it delivers the LPS directly to
hepatocytes, bypassing Kupffer cells and their pro-inflammatory cytokine production (Van
Oosten et al., 2001). Lipopolysaccharide is also found to bind with high density lipoprotein
(HDL) (Ulevitch et al., 1979). The role of HDL in detoxifying LPS seems to be
controversial. It is suggested that HDL aids in sequestering and detoxifying LPS, but also
makes it more difficult to clear from circulation (Birjmohun et al., 2007; Vreugdenhil et al.,
2003). Further, LPS may be transferred from HDL to LDL with the help of LBP and
phospholipid transfer proteins. The transfer of LPS to LDL results in dyslipidemia and the
loss of HDL’s capacity to bind cholesterol leading to metabolic diseases (Levels et al., 2005).
A major detoxification mechanism for LPS is by enzyme modification via
28
acyloxyacyl hydrolase (AOAH). This hydrolase enzyme is classified as a lipase and is
present in macrophages, dendritic cells, neutrophils, Kupffer cells in liver and renal cortical
tubule cells (Erwin and Munford, 1991). Interestingly, AOAH can be produced by the renal
cortical tubule cells where it is secreted into the urine and can deacylate and neutralize LPS
(Feulner et al., 2004). Acyloxyacyl hydrolase selectively removes the secondary fatty acyl
chains attached to the primary chains in the lipid A moiety producing a LPS structure that is
capable of binding MD2/TLR4 but doesn’t initiate the signal or only can be a partial agonist
(Lu et al., 2005). It is believed that AOAH plays a role in mediating macrophage tolerance to
LPS because AOAH mRNA levels are increased in LPS -primed and -tolerant macrophages
versus LPS-naïve macropahges (Mages et al., 2007). When compared with wild-type mice,
mice that lack AOAH and are challenged with LPS have enlarged livers and sustained
hepatic cytokine production, indicating that this enzyme prevents prolonged inflammatory
reaction to LPS (Shao et al., 2011). Regarding agriculturally relevant species, AOAH activity
is increased during localized inflammation in cattle, and its activity has been localized to
neutrophils (McDermott and Fenwick, 1992). The regulation of AOAH by stressors and diet,
together with its direct role in intestinal detoxification warrants further investigation in
livestock.
Further evidence that enzyme modification of LPS plays a role in LPS neutralization
and detoxification is supported by recent reports that intestinal alkaline phosphatase (AP)
directly deactivates LPS (Bates et al., 2007; Goldberg et al., 2008). Mechanistically, AP
deactivates LPS by dephosphorylating the diphosphoryl moiety of lipid A, rendering it
inactive (Koyama et al., 2002; Munford et al., 2009; Poelstra et al., 1997). Alkaline
phosphatase had been shown to inactivate LPS in zebra fish (Bates et al., 2007) and its
29
activity is increased in inflamed intestinal tissue (Sanchez de Medina et al., 2004). Also,
there is debate regarding how AP dephosphorylates LPS and evidence is limited in livestock
as to its role in detoxification. The expression and activity of intestinal AP can be modulated
by stress and dietary factors (Lalles, 2010). Dietary lipids regulate the activity of intestinal
AP. For example, jejunal AP activity was greater in pigs fed a diet high in saturated fat (i.e.,
15% beef tallow) versus pigs fed a diet high in unsaturated fat (i.e., 15% corn oil) (Dudley et
al., 1994). Another example indicating that AP is regulated by dietary lipids is that n-3 fatty
acid rich cod liver oil has been shown to increase the secretion of intestinal AP (Kaur et al.,
2007). Interestingly, this may be explained by the increased expression of resolvin-E1, an
anti-inflammatory n-3 fatty acid lipid mediator, which induces AP activity (Campbell et al.,
2010). Furthermore, high dietary fat consumption reduces intestinal AP activity in obesity-
prone rodents (de La Serre et al., 2010). Interestingly, the decrease in ileal AP activity is
associated with an increase in plasma LPS and increased inflammation as assessed by
myeloperoxidase activity (de La Serre et al., 2010).
Mechanistically, the alteration of intestinal AP by dietary lipids may be mediated by
pro-inflammatory cytokines, such as IL-1β and TNF-α, which inhibit the induction of AP
(Malo et al., 2006). Stress and disease in livestock may decrease intestinal AP via reductions
in feed intake (Goldberg et al., 2008; Lalles and David, 2011). It has been observed that
weaning pigs at a young age (i.e., 10 d) decrease both the expression and activity of AP in
the jejunum compared to pigs weaned at 28 days of age (Lackeyram et al., 2010). This same
age period near weaning is also associated with decreased feed intake and increased intestinal
pro-inflammatory cytokine expression (Pie et al., 2004), perhaps both of which are
responsible for decreased intestinal AP expression and activity that occurs with weaning in
30
pigs. Altogether, dietary factors and stressors likely impact intestinal and systemic
inflammation and LPS concentrations via alterations in mechanisms of detoxification and
neutralization.
Dietary Fat and Inflammation
Fatty acids (FA) are monocarboxylic acids usually having an aliphatic chain length
between C4 and C22 and consumed as individual fatty acids or part of larger lipid molecules
such as triacylglycerol, phospholipids, and sphingolipids. Fatty acids are concentrated in
energy (Mangold, 1995). Apart from their main function as energy storing molecules, FA are
an integral part of phospholipids which are part of the cell membrane and essential for
structural integrity, used as lubricants, and also used as signaling molecules (Mangold, 1995;
Tvrzicka et al., 2011). Based on the chain length FAs can be classified as short chain (6 or
less carbons), medium chain (6-12 carbons), long chain (13-21 carbons), and very long chain
(greater than 22 carbons) FA. Further, whether they have double bonds in their structure will
determine if they are classified as saturated, monounsaturated or polyunsaturated FA (Table
1). Polyunsaturated fatty acids (PUFA) are classified into n-3 and n-6 (more commonly
referred to as omega-3 and omega-6) FA depending on the carbon number of the first double
bond from the methyl end (Calder, 2008; Tvrzicka et al., 2011). Linoleic and α-linolenic acid
are the simplest members of n-6 and n-3 family, respectively. These two fatty acids are
considered essential fatty acids as they cannot be synthesized by mammals because they lack
the Δ5, Δ6, and Δ15 desaturase enzymes necessary for synthesizing these fatty acids
(Hornstra et al., 1995). So, both fatty acids need to be supplemented through dietary sources
31
either through plant foods or marine sources. After ingestion, mammals can metabolize
linoleic acid into long chain n-6 PUFA like arachidonic acid (AA; 20:4n-6) and α-linolenic
acid into n-3 PUFA like EPA (20:4n-3) and DHA (22:6n-3) (Calder, 2012).
Recent research indicates that short chain FA, particularly lauric (C:12) myristic
(C:14) and palmitic (C:16) are the ones which form the fatty acyl chains of lipid A or the
endotoxic component of LPS. Saturated FAs have been shown to activate the LPS receptor
TLR4 and consumption of high saturated fat diets have been postulated to lead to a chronic
inflammatory state and associated metabolic diseases (Erridge et al., 2002; Raetz and
Whitfield, 2002b; Schaeffler et al., 2009; Vaarala et al., 2008).
Eicosanoids are inflammatory mediators synthesized from n-3 and n-6 PUFA cleaved
from cell membrane phospholipids where these fatty acids play a structural role (Calder,
2012). Arachidonic acid is the major n-6 PUFA in the membrane phospholipids and is
cleaved by phospholipase A2, resulting in the release of free AA. Arachidonic acid acts as a
substrate for inflammatory mediator enzymes lipoxygenase (LOX) and cyclooxygenase
(COX) I and II. This results in the secretion of prostaglandins, thorombaxanes and
leukotrienes which play important roles in the inflammation signaling (Fetterman and
Zdanowicz, 2009; Kremmyda et al., 2011). Prolonged consumption of n-3 PUFA, such as
EPA and DHA, also leads to enrichment of cell membranes at the expense of arachidonic
acid which will have positive health consequences. Further, EPA and DHA also compete
with AA as substrates for both COX and LOX enzymes (Figure 4). This result in the
secretion of either eicosanoids which are 10-100 fold less pro-inflammatory properties or
anti-inflammatory mediators resolvins, ultimately resulting in reduced pro-inflammatory
reactions (Chapkin et al., 2008a; Kremmyda et al., 2011).
32
Interestingly, n-3 PUFA also have many other beneficial effects including
antagonizing the activation of pro-inflammatory transcription factor, NF-κB, and decreasing
the secretion of inflammatory cytokines such as TNF-α and IL-6 (McMurray et al., 2011).
Additionally, n-3 PUFA enhances the anti-inflammatory transcription factor PPAR-γ leading
to attenuated immune response (Sampath and Ntambi, 2005). Further, n-3 PUFA
incorporation into the cell membrane causes increased fluidity which will have positive
health consequences. Recent evidences indicate that n-3 PUFA supplementation leads to its
incorporation into cell membrane microdomains called lipid rafts which act as a signaling
hub for numerous important cellular activities (Ma et al., 2004). Incorporation of n-3 PUFA
in lipid rafts occurs at the cost of AA and saturated fatty acids, which has the potential to
reduce inflammation. The unsaturated fatty acids, particularly long chain PUFAs have a
“kink” in their structure because of the unsaturated bonds, which prevents the compact
structure formation needed for lipid raft. The intercalation of PUFAs into the cell membrane
results in the dissociation of lipid rafts and decreases the LPS signaling which might be
beneficial to the animals (Chapkin et al., 2008b; Shaikh et al., 2012; Wassall and Stillwell,
2008).
Implications of Intestinal LPS and Inflammation
The GIT is the major site of nutrient uptake. The nutrient transport function of the
GIT decreases when the intestine is under prolonged inflammatory or metabolic stress. A
study looking at small intestinal absorptive function during endotoxemia showed that Na and
Cl ions, as well as glucose absorption, was decreased even 24 h after the administration of
33
LPS (Kanno et al., 1996). Further, marked epithelial inflammation occurs around 6 h after
challenge and villous atrophy occurs at 24 h but there are signs of recovery after 7 d. It has
also been shown that LPS challenge results in decreased absorption of various sugars and
amino acids (Albin et al., 2007; Flinn et al., 2010; Meng et al., 2005). One mechanism for
this decreased transport might be through the inhibition of Na-dependent system of transport,
as well as a decrease in the Na+/K+ ATPase activity (Abad et al., 2001; Amador et al., 2007a;
García-Herrera et al., 2003). Further, the pro-inflammatory cytokine, TNF-α, has been shown
to decrease the absorption of galactose (Amador et al., 2007b).
Overall, LPS mediated inhibition of nutrient absorption seems to be manifested by
several interrelated signaling cascades including those involving protein kinase C, protein
kinase A, and mitogen activated protein kinases, as well as proteasomal degradation (Amador
et al., 2008; García-Herrera et al., 2008). While the animal itself is trying to fight the cause of
the stress, the intestine develops a reduced ability to transport nutrients and carry out other
functions. The end result is an increased catabolic cascade and degradation of muscle
proteins (Daiwen et al., 2008; Webel et al., 1998) to support gluconeogenesis and increased
whole body metabolic energy demands.
Because of its strategic position between the luminal microbes and essentially sterile
systemic circulation, the intestine needs to possess excellent immune capabilities to defend
against any pathogenic attack. Thus, evolutionarily, the intestine developed an extensive
immune system network. The GIT can be classified as the largest immune organ in the body
(Collins et al., 1998; Targan et al., 2003). There are specific lymph nodes that are part of gut-
associated lymphoid tissue placed in the submucosal layer to defend against any invading
pathogens. A variety of mononuclear phagocytes, such as monocytes, macrophages, and
34
dendritic cells, are present in the gut associated lymphoid tissue, as well as dispersed
throughout the sub-epithelial connective tissue, the lamina propria. Interestingly, these
immune cells, when isolated from inflamed tissue, display pro-inflammatory profiles and
secrete cytokines such as TNF-α (Bar-On et al., 2011). A typical intestinal inflammatory
response progresses through the following steps. A leaky intestinal epithelial barrier allows
luminal commensal organism components to enter the sub-mucosa and stimulate local
immune cells. Dendritic cells, through their PRRs, recognize commensal constituents as
pathogenic components and initiate the activation of T cells and natural killer cells. The
immune cells can also be activated by their own PRRs. This leads to the secretion of
regulatory cytokines by T cells, which in turn, stimulate the secretion of TNF-α, IL-1β, and
IL-6 by macrophages. Natural killer cells also play an active role by secreting cytokines, as
well as causing tissue damage (Baumgart and Carding, 2007). The interplay between immune
cells, LPS, and cytokines can augment the inflammatory state of the intestine.
During an inflammatory response, nutrient partitioning is redirected towards meeting
the metabolic requirements of the immune system. Inflammation is associated with increase
in body temperature and an increase in 1 °C equates to a 13 % increase in basal metabolism
(Kluger, 1978). The rise in the levels of pro-inflammatory cytokines, such as TNF-α and IL-
1β, have been shown to decrease feed consumption (Plata-Salamán et al., 1996), rates of
weight gain, and efficiency of feed utilization (Evock-Clover et al., 1997; Steiger et al.,
1999). Thus, LPS -associated inflammation results in an estimated 30 % increase in energetic
costs and leads to a significant negative nitrogen balance because of protein breakdown and
decreased weight gain (Lochmiller and Deerenberg, 2000). Further, multiple immune
challenges occurring simultaneously lead to a cumulative reduction in growth performance
35
too (Hanssen et al., 2004).
All the evidence indicates that a significant decrease in feed intake occurs during an
inflammatory challenge. Appetite regulation is a complex process and it occurs mainly
through the neuronal control through the vagus nerve or through hormonal control via the
secretion of leptin, ghrelin, cholecystokinin, and glucagon-like peptide 1. The hypothalamus
receives and integrates these signals and brings about the desired effect of altered appetite
control (Cummings, 2006; Sartin et al., 2011). The appetite regulation under an immune
challenge might occur through either one or both of these mechanisms. During most disease
conditions in livestock, there is a reduction in feed intake accompanied by an increase in
metabolic rate, which is significantly different than fasting because during fasting the
decrease in feed intake is accompanied by decreased metabolic rate (Sartin et al., 2011). The
inflammatory cytokines secreted upon an LPS challenge decrease feed intake and nutrient
transport by acting on the somatotrophic axis (Johnson, 1997, 1998). Tumor necrosis factor-α
has been shown to be present in the central nervous system after an immune challenge with
LPS which indicates that it could act on the appetite regulatory center directly (Sakumoto et
al., 2003). The appetite-stimulating neurotransmitters in the hypothalamus, such as
neuropeptide Y and Agouti-related protein, maybe reduced or unchanged, whereas appetite-
inhibiting neurotransmitters including proopiomelanocortin and cocaine- and amphetamine-
regulated transcript are increased during immune challenges. During disease stress, the latter
may promote α-melanocyte stimulating hormone suppression of appetite via the MC4
receptors to decrease appetite (Sartin et al., 2008; Sartin et al., 2011). This mechanism of
action results in typical sickness behavior such as decreased appetite and increased energy
expenditure (Grossberg et al., 2010).
36
The other plausible mechanism by which appetite is regulated under an LPS
challenge and inflammation is that LPS and other TLR4 ligands, such as saturated fatty acids,
have been shown to activate enteroendocrine cells that act as nutrient sensors in the intestine.
This leads to the secretion of appetite regulating peptides, such as cholecytokinin and
glucagon-like peptide 1, from the enteroendocrine cells which act on the satiety centers in the
hypothalamus and ultimately results in reduced feed intake and nutrient absorption from the
intestine (Bogunovic et al., 2007; de Lartigue et al., 2011). While this has been shown in the
cell lines, further research is needed to prove this theory in vivo.
Summary and Conclusion
The literature reviewed herein describes how luminal LPS enters the circulation and
its effects on gastrointestinal function and animal performance (Figure 5). Additionally, we
briefly describe plausible mechanisms of LPS detoxification and neutralization. Even at low
concentration, LPS is a potent stimulator of pro-inflammatory cytokine production from
various cell types within the body, not just immune competent cells. The resulting immune
activation and associated inflammation makes LPS an important factor that is commonly
overlooked in livestock production. However, more research is needed to understand how
LPS enters the circulation and its effect on metabolism and energetics. Additionally, research
describing how stress and nutrition modulate LPS permeability and clearance in agricultural
relevant species is warranted.
37
Literature Cited
Abad, B., J. E. Mesonero, M. T. Salvador, J. G. Herrera, and M. J. Rodríguez-Yoldi. 2001. The administration of lipopolysaccharide, in vivo, induces alteration in L-leucine intestinal absorption. Life Sci 70: 615-628.
Abreu, M. T. 2010a. The ying and yang of bacterial signaling in necrotizing enterocolitis.
Gastroenterology 138: 39-43. Abreu, M. T. 2010b. Toll-like receptor signalling in the intestinal epithelium: how bacterial
recognition shapes intestinal function. Nat Rev Immunol 10: 131-144. Aderem, A., and R. J. Ulevitch. 2000. Toll-like receptors in the induction of the innate
immune response. Nature 406: 782-787. Akira, S., S. Uematsu, and O. Takeuchi. 2006. Pathogen recognition and innate immunity.
Cell 124: 783-801. Albin, D. M., J. E. Wubben, J. M. Rowlett, K. A. Tappenden, and R. A. Nowak. 2007.
Changes in small intestinal nutrient transport and barrier function after lipopolysaccharide exposure in two pig breeds. J Anim Sci 85: 2517-2523.
Allen, S. J., S. E. Crown, and T. M. Handel. 2007. Chemokine:receptor structure,
interactions, and antagonism. Ann Rev of Immunol 25: 787-820. Amador, P. et al. 2007a. Intestinal D-galactose transport in an endotoxemia model in the
rabbit. J Mem Bio 215: 125-133. Amador, P. et al. 2007b. Inhibitory effect of TNF-α on the intestinal absorption of galactose.
J Cell Biochem 101: 99-111. Amador, P. et al. 2008. Lipopolysaccharide induces inhibition of galactose intestinal
transport in rabbits in vitro. Cell Physiol Biochem 22: 715-724. Amar, J. et al. 2008. Energy intake is associated with endotoxemia in apparently healthy
men. Am J Clin Nutr 87: 1219-1223. Ancuta, P. et al. 2008. Microbial translocation is associated with increased monocyte
activation and dementia in AIDS patients. PloS one 3: e2516. Arai, K. I. et al. 1990. Cytokines: coordinators of immune and inflammatory responses. Annu
Rev Biochem 59: 783-836. Araki, Y. et al. 2005. Bile acid modulates transepithelial permeability via the generation of
reactive oxygen species in the Caco-2 cell line. Free radi bio & med 39: 769-780.
38
Ashley, N. T., Z. M. Weil, and R. J. Nelson. 2012. Inflammation: mechanisms, costs, and
natural variation. Ann Rev of Eco, Evol, and Syst 43: 385-406. Ausubel, F. M. 2005. Are innate immune signaling pathways in plants and animals
conserved? Nat Immunol 6: 973-979. Baek, D. et al. 2008. The impact of microRNAs on protein output. Nature 455: 64-71. Balaji, R. et al. 2000. Acute phase responses of pigs challenged orally with Salmonella
typhimurium. J Anim Sci 78: 1885-1891. Ballou, M. A. 2012. Growth and development symposium: Inflammation: Role in the
etiology and pathophysiology of clinical mastitis in dairy cows. J Anim Sci 90: 1466-1478.
Bar-On, L., E. Zigmond, and S. Jung. 2011. Management of gut inflammation through the
manipulation of intestinal dendritic cells and macrophages? Semin Immunol 23: 58-64.
Bates, J. M., J. Akerlund, E. Mittge, and K. Guillemin. 2007. Intestinal alkaline phosphatase
detoxifies lipopolysaccharide and prevents inflammation in zebrafish in response to the gut microbiota. Cell Host & Microbe 2: 371-382.
Baumgart, D. C., and S. R. Carding. 2007. Inflammatory bowel disease: cause and
immunobiology. The Lancet 369: 1627-1640. Beutler, B. 2000. Tlr4: central component of the sole mammalian LPS sensor. Curr Opin
Immunol 12: 20-26. Beutler, B. 2004. Innate immunity: an overview. Mol Immunol 40: 845-859. Birjmohun, R. S. et al. 2007. High-density lipoprotein attenuates inflammation and
coagulation response on endotoxin challenge in humans. Arterioscl, Throm Vasc Biol 27: 1153-1158.
Bogunovic, M. et al. 2007. Enteroendocrine cells express functional Toll-like receptors. Am
J Physiol Gastrointest Liver Physiol 292: G1770-1783. Boldin, M. P., and D. Baltimore. 2012. MicroRNAs, new effectors and regulators of NF-
kappaB. Immunol Rev 246: 205-220. Borish, L. C., and J. W. Steinke. 2003. 2. Cytokines and chemokines. J Aller and Clini
Immunol 111: 460-475.
39
Brade, L., and H. Brade. 1985. A 28,000-dalton protein of normal mouse serum binds specifically to the inner core region of bacterial lipopolysaccharide. Infect. Immun. 50: 687-694.
Brikos, C., and L. A. O'Neill. 2008. Signalling of toll-like receptors. Handb Exp Pharmacol:
21-50. Brown, D. A., and J. K. Rose. 1992. Sorting of GPI-anchored proteins to glycolipid-enriched
membrane subdomains during transport to the apical cell surface. Cell 68: 533-544. Brown, D. A., and E. London. 1998. Functions of lipid rafts in biological membranes. Ann
rev cell and develop biol 14: 111-136. Buttenschoen, K., P. Radermacher, and H. Bracht. 2010. Endotoxin elimination in sepsis:
physiology and therapeutic application. Langenbeck's Arch Surg 395: 597-605. Calder, P. C. 2008. Polyunsaturated fatty acids, inflammatory processes and inflammatory
bowel diseases. Mol Nutr Food Res 52: 885-897. Calder, P. C. 2012. Mechanisms of action of (n-3) fatty acids. J Nutr 142: 592S-599S. Campbell, D. I., M. Elia, and P. G. Lunn. 2003. Growth faltering in rural Gambian infants is
associated with impaired small intestinal barrier function, leading to endotoxemia and systemic inflammation. J Nutr 133: 1332-1338.
Campbell, E. L. et al. 2010. Resolvin E1-induced intestinal alkaline phosphatase promotes
resolution of inflammation through LPS detoxification. Proc Nat Acad Sci 107: 14298-14303.
Cani, P. D., and N. M. Delzenne. 2010. Gut Microbiota, Diet, Endotoxemia, and Diseases.
Wiley-VCH Verlag GmbH & Co. KGaA. 511-524 Cario, E. et al. 2000. Lipopolysaccharide activates distinct signaling pathways in intestinal
epithelial cell lines expressing Toll-like receptors. J Immunol 164: 966-972. Cario, E. 2005. Bacterial interactions with cells of the intestinal mucosa: Toll-like receptors
and NOD2. Gut 54: 1182-1193. Cario, E., and D. K. Podolsky. 2006. Toll-like receptor signaling and its relevance to
intestinal inflammation. Ann N Y Acad Sci 1072: 332-338. Chaby, R. 2004. Lipopolysaccharide-binding molecules: transporters, blockers and sensors.
Cell Mol Life Sci 61: 1697-1713. Chapkin, R. S. et al. 2008a. Bioactive dietary long-chain fatty acids: emerging mechanisms
of action. Br J Nutr 100: 1152-1157.
40
Chapkin, R. S., N. Wang, Y. Y. Fan, J. R. Lupton, and I. A. Prior. 2008b. Docosahexaenoic
acid alters the size and distribution of cell surface microdomains. Biochim Biophys Acta 1778: 466-471.
Chassin, C. et al. 2008. TLR4 facilitates translocation of bacteria across renal collecting duct
cells. J Am Soc Nephrol 19: 2364-2374. Chen, G. Y., and G. Nuñez. 2010. Sterile inflammation: sensing and reacting to damage. Nat
Rev Immunol 10: 826-837. Chen, M. L., Z. Ge, J. G. Fox, and D. B. Schauer. 2006. Disruption of tight junctions and
induction of proinflammatory cytokine responses in colonic epithelial cells by Campylobacter jejuni. Infect. Immun. 74: 6581-6589.
Chiba, H., M. Osanai, M. Murata, T. Kojima, and N. Sawada. 2008. Transmembrane proteins
of tight junctions. Biochimica et Biophysica Acta (BBA) - Biomembranes 1778: 588-600.
Clark, R. T., A. Hope, M. Lopez-Fraga, N. Schiller, and D. D. Lo. 2009. Bacterial particle
endocytosis by epithelial cells is selective and enhanced by tumor necrosis factor receptor ligands. Clin. Vaccine Immunol. 16: 397-407.
Coetzee, G. A. et al. 1986. Serum amyloid A-containing human high density lipoprotein 3.
Density, size, and apolipoprotein composition. J Biol Chem 261: 9644-9651. Coll, R. C., and L. A. O'Neill. 2010. New insights into the regulation of signalling by toll-
like receptors and nod-like receptors. J Innate Immun 2: 406-421. Collins, J. K., G. Thornton, and G. O. Sullivan. 1998. Selection of probiotic strains for
human applications. Int Dairy J 8: 487-490. Contreras, J., and D. S. Rao. 2012. MicroRNAs in inflammation and immune responses.
Leukemia 26: 404-413. Courtois, F. et al. 2003. Membrane peroxidation by lipopolysaccharide and iron-ascorbate
adversely affects Caco-2 cell function: beneficial role of butyric acid. Am J Clin Nutr 77: 744-750.
Cummings, D. E. 2006. Ghrelin and the short- and long-term regulation of appetite and body
weight. Physiol Behav 89: 71-84. Daiwen, C., Z. Keying, and W. Chunyan. 2008. Influences of lipopolysaccharide-induced
immune challenge on performance and whole-body protein turnover in weanling pigs. Livestock Sci 113: 291-295.
41
Davidson, L. A. et al. 2009. n-3 Polyunsaturated fatty acids modulate carcinogen-directed
non-coding microRNA signatures in rat colon. Carcinogenesis 30: 2077-2084. De La Serre, C. B. et al. 2010. Propensity to high-fat diet-induced obesity in rats is associated
with changes in the gut microbiota and gut inflammation. Am J Physiol Gastrointest Liver Physiol 299: G440-448.
De Lartigue, G., C. B. de La Serre, and H. E. Raybould. 2011. Vagal afferent neurons in high
fat diet-induced obesity; intestinal microflora, gut inflammation and cholecystokinin. Physiol Behav 105:100-105.
Denker, B. M., and S. K. Nigam. 1998. Molecular structure and assembly of the tight
junction. Am J Physiol Renal Physiol 274: F1-9. Dinarello, C. A. 2000. Proinflammatory Cytokines*. Chest 118: 503-508. Dolgachev, V., and N. W. Lukacs. 2010. Chapter 2 - Acute and chronic inflammation
induces disease pathogenesis. Essent Con Mol Path p 15-24. Academic Press, San Diego.
Drewe, J., C. Beglinger, and G. Fricker. 2001. Effect of ischemia on intestinal permeability
of lipopolysaccharides. Eur J Clin Invest 31: 138-144. Dudley, M. A. et al. 1994. Jejunal brush border hydrolase activity is higher in tallow-fed pigs
than in corn oil-fed pigs. J Nutr 124: 1996-2005. Eckersall, P. D., and R. Bell. 2010. Acute phase proteins: Biomarkers of infection and
inflammation in veterinary medicine. Vet J 185: 23-27. Edelblum, K. L., and J. R. Turner. 2009. The tight junction in inflammatory disease:
communication breakdown. Curr Opiin Pharm 9: 715-720. Elin, R. J., and S. M. Wolff. 1976. Biology of endotoxin. Annl Rev of Med 27: 127-141. Emmanuel, D. G., S. M. Dunn, and B. N. Ametaj. 2008. Feeding high proportions of barley
grain stimulates an inflammatory response in dairy cows. J Dairy Sci 91: 606-614. Erridge, C., E. Bennett-Guerrero, and I. R. Poxton. 2002. Structure and function of
lipopolysaccharides. Microbes Infect 4: 837-851. Erridge, C., T. Attina, C. M. Spickett, and D. J. Webb. 2007. A high-fat meal induces low-
grade endotoxemia: evidence of a novel mechanism of postprandial inflammation. Am J Clin Nutr 86: 1286-1292.
42
Erridge, C. 2011. Diet, commensals and the intestine as sources of pathogen-associated molecular patterns in atherosclerosis, type 2 diabetes and non-alcoholic fatty liver disease. Atherosclerosis 216: 1-6.
Erwin, A. L., and R. S. Munford. 1991. Plasma lipopolysaccharide-deacylating activity
(acyloxyacyl hydrolase) increases after lipopolysaccharide administration to rabbits. Lab Invest 65: 138-144.
Evock-Clover, C. M., M. J. Myers, and N. C. Steele. 1997. Effects of an endotoxin challenge
on growth performance, carcass accretion rates, and serum hormone and metabolite concentrations in control pigs and those treated with recombinant porcine somatotropin. J Anim Sci 75: 1784-1790.
Fan, H., and J. A. Cook. 2004. Molecular mechanisms of endotoxin tolerance. J Endotoxin
Res 10: 71-84. Fetterman, J. W., Jr., and M. M. Zdanowicz. 2009. Therapeutic potential of n-3
polyunsaturated fatty acids in disease. Am J Health Syst Pharm 66: 1169-1179. Feulner, J. A. et al. 2004. Identification of Acyloxyacyl Hydrolase, a Lipopolysaccharide-
Detoxifying Enzyme, in the Murine Urinary Tract. Infect. Immun. 72: 3171-3178. Filipowicz, W., S. N. Bhattacharyya, and N. Sonenberg. 2008. Mechanisms of post-
transcriptional regulation by microRNAs: are the answers in sight? Nat Rev Genet 9: 102-114.
Flinn, A., V. Mani, M. Jeffrey, J. D. Spencer, and N. K. Gabler. 2010. Dietary n-3 fatty acids
differentially alter ileum nutrient transport in growing pigs under immune challenge. Midwest Joint ADSA-ASAS Meetings. 88(E-Suppl. 3):122. (Abstr.)
Gabay, C., and I. Kushner. 1999. Acute-phase proteins and other systemic responses to
inflammation. New Eng J Med 340: 448-454. Gabler, N. K., and M. E. Spurlock. 2008. Integrating the immune system with the regulation
of growth and efficiency. J Anim Sci 86: E64-74. García-Herrera, J., B. Abad, and M. J. Rodríguez-Yoldi. 2003. Effect of lipopolysaccharide
on D-fructose transport across rabbit jejunum. Inflammation Res 52: 177-184. García-Herrera, J. et al. 2008. Protein kinases, TNF-α, and proteasome contribute in the
inhibition of fructose intestinal transport by sepsis in vivo. Am J Physiol Gastroint liver Physiol 294: G155-G164.
Ghoshal, S., J. Witta, J. Zhong, W. de Villiers, and E. Eckhardt. 2009. Chylomicrons
promote intestinal absorption of lipopolysaccharides. J Lipid Res 50: 90-97.
43
Goldberg, R. F. et al. 2008. Intestinal alkaline phosphatase is a gut mucosal defense factor
maintained by enteral nutrition. Proc Natl Acad Sci U S A 105: 3551-3556. Grossberg, A. J., J. M. Scarlett, and D. L. Marks. 2010. Hypothalamic mechanisms in
cachexia. Physiol Behav 100: 478-489. Guo, H., N. T. Ingolia, J. S. Weissman, and D. P. Bartel. 2010. Mammalian microRNAs
predominantly act to decrease target mRNA levels. Nature 466: 835-840. Hall, D. M. et al. 2001. Mechanisms of circulatory and intestinal barrier dysfunction during
whole body hyperthermia. Am J Physiol Renal Physiol - Heart Circ Physiol 280: H509-H521.
Hanssen, S. A., D. Hasselquist, I. Folstad, and K. E. Erikstad. 2004. Costs of immunity:
immune responsiveness reduces survival in a vertebrate. Proc Biol Sci 271: 925-930. Harris, H. W. et al. 1993. Chylomicrons alter the fate of endotoxin, decreasing tumor
necrosis factor release and preventing death. J Clin Invest 91: 1028-1034. Harris, H. W., S. E. Brady, and J. H. Rapp. 2002. Hepatic endosomal trafficking of
lipoprotein-bound endotoxin in rats. J Surg Res 106: 188-195. Hasday, J. D., K. D. Fairchild, and C. Shanholtz. 2000. The role of fever in the infected host.
Microb Inf 2: 1891-1904. He, H.-T., and D. Marguet. 2008. T-cell antigen receptor triggering and lipid rafts: a matter
of space and time scales. EMBO Rep 9: 525-530. He, L., and G. J. Hannon. 2004. MicroRNAs: small RNAs with a big role in gene regulation.
Nat Rev Genet 5: 522-531. Heeg, K. 2007. The Innate Immune System. In: G. P. C. Adriana del Rey and O. B. Hugo
(eds.) NeuroImmune Biology No. Volume 7. p 87-99. Elsevier. Hietbrink, F. et al. 2009. Systemic inflammation increases intestinal permeability during
experimental human endotoxemia. Shock 32: 374-378. Hoffmann, J. A., F. C. Kafatos, C. A. Janeway, and R. A. B. Ezekowitz. 1999. Phylogenetic
Perspectives in Innate Immunity. Science 284: 1313-1318. Holck, J. T. et al. 1998. The influence of environment on the growth of commercial finisher
pigs. Swine Health Prod 6: 141-149.
44
Holst, O., A. J. Ulmer, H. Brade, H. D. Flad, and E. T. Rietschel. 1996. Biochemistry and cell biology of bacterial endotoxins. FEMS Immunol Med Microbiol 16: 83-104.
Hornef, M. W., B. H. Normark, A. Vandewalle, and S. Normark. 2003. Intracellular
recognition of lipopolysaccharide by toll-like receptor 4 in intestinal epithelial cells. J Exp Med 198: 1225-1235.
Hornstra, G., M. D. Al, A. C. van Houwelingen, and M. M. Foreman-van Drongelen. 1995.
Essential fatty acids in pregnancy and early human development. Eur J obs gyn reprod bio 61: 57-62.
Janes, P. W., S. C. Ley, A. I. Magee, and P. S. Kabouridis. 2000. The role of lipid rafts in T
cell antigen receptor (TCR) signalling. Semin Immunol 12: 23-34. Janeway, C. A., Jr., and R. Medzhitov. 2002. Innate immune recognition. Annu Rev
Immunol 20: 197-216. Johnson, K. J., P. A. Ward, S. Goralnick, and M. J. Osborn. 1977. Isolation from human
serum of an inactivator of bacterial lipopolysaccharide. Am J Pathol 88: 559-574. Johnson, R. W. 1997. Inhibition of growth by pro-inflammatory cytokines: an integrated
view. J Anim Sci 75: 1244-1255. Johnson, R. W. 1998. Immune and endocrine regulation of food intake in sick animals. Dome
Animal Endo 15: 309-319. Kanno, S., S. Emil, M. Kosi, H. Monforte-Munoz, and J. Atkinson. 1996. Small intestinal
absorption during endotoxemia in swine. Am Surg 62: 793-799. Karin, M., T. Lawrence, and V. Nizet. 2006. Innate immunity gone awry: Linking microbial
infections to chronic inflammation and cancer. Cell 124: 823-835. Kaur, J., S. Madan, A. Hamid, A. Singla, and A. Mahmood. 2007. Intestinal alkaline
phosphatase secretion in oil-fed rats. Dig Dis Sci 52: 665-670. Khafipour, E., D. O. Krause, and J. C. Plaizier. 2009. A grain-based subacute ruminal
acidosis challenge causes translocation of lipopolysaccharide and triggers inflammation. J Dairy Sci 92: 1060-1070.
Khvorova, A., A. Reynolds, and S. D. Jayasena. 2003. Functional siRNAs and miRNAs
Exhibit Strand Bias. Cell 115: 209-216. Kimball, S. R. et al. 2003. Endotoxin induces differential regulation of mTOR-dependent
signaling in skeletal muscle and liver of neonatal pigs. Am J Physiol Endocrinol Metab 285: E637-644.
45
Kindt, T. J., R. A. Goldsby, B. A. Osborne, and J. Kuby. 2007. Kuby immunology. W.H.
Freeman, New York. Kitchens, R. L., R. J. Ulevitch, and R. S. Munford. 1992. Lipopolysaccharide (LPS) partial
structures inhibit responses to LPS in a human macrophage cell line without inhibiting LPS uptake by a CD14-mediated pathway. J Exp Med 176: 485-494.
Kluger, M. J. 1978. The Evolution and Adaptive Value of Fever: Long regarded as a harmful
by-product of infection, fever may instead be an ancient ally against disease, enhancing resistance and increasing chances of survival. Amer Scient 66: 38-43.
Kluger, M. J., W. Kozak, C. A. Conn, L. R. Leon, and D. Soszynski. 1996. The adaptive
value of fever. Infec dis cli NorAmer 10: 1-20. Kogut, M. H., H. He, and P. Kaiser. 2005. Lipopolysaccharide binding protein/CD14/ TLR4-
dependent recognition of salmonella LPS induces the functional activation of chicken heterophils and up-regulation of pro-inflammatory cytokine and chemokine gene expression in these cells. Ani biotech 16: 165-181.
Koyama, I., T. Matsunaga, T. Harada, S. Hokari, and T. Komoda. 2002. Alkaline
phosphatases reduce toxicity of lipopolysaccharides in vivo and in vitro through dephosphorylation. Cli Biochem 35: 455-461.
Kozak, W. et al. 2000. Molecular mechanisms of fever and endogenous antipyresis. Annals
New York Acad Sci 917: 121-134. Kremmyda, L. S., E. Tvrzicka, B. Stankova, and A. Zak. 2011. Fatty acids as biocompounds:
their role in human metabolism, health and disease: a review. part 2: fatty acid physiological roles and applications in human health and disease. Biomed papers Medical Faculty of the University Palacky, Olomouc, Czechoslovakia 155: 195-218.
Lackeyram, D., C. Yang, T. Archbold, K. C. Swanson, and M. Z. Fan. 2010. Early weaning
reduces small intestinal alkaline phosphatase expression in pigs. J Nutr 140: 461-468. Lalles, J. P. 2010. Intestinal alkaline phosphatase: multiple biological roles in maintenance of
intestinal homeostasis and modulation by diet. Nutrev 68: 323-332. Lalles, J. P., and J. C. David. 2011. Fasting and refeeding modulate the expression of stress
proteins along the gastrointestinal tract of weaned pigs. J ani phy ani nut 95: 478-488. Lambert, G. P. et al. 2002. Selected contribution: Hyperthermia-induced intestinal
permeability and the role of oxidative and nitrosative stress. J Appl Physiol 92: 1750-1761; discussion 1749.
46
Lambert, G. P. 2004. Role of gastrointestinal permeability in exertional heatstroke. Exer sport sci rev 32: 185-190.
Lambert, G. P. 2008. Intestinal barrier dysfunction, endotoxemia, and gastrointestinal
symptoms: the 'canary in the coal mine' during exercise-heat stress? Med Sport Sci 53: 61-73.
Laugerette, F. et al. 2011. Emulsified lipids increase endotoxemia: possible role in early
postprandial low-grade inflammation. J Nutr Biochem 22: 53-59. Lemaire, L. C. et al. 1999. Thoracic duct in patients with multiple organ failure: no major
route of bacterial translocation. Ann surg 229: 128-136. Lenardo, M. J., and D. Baltimore. 1989. NF-κB: A pleiotropic mediator of inducible and
tissue-specific gene control. Cell 58: 227-229. Levels, J. H. M. et al. 2005. Lipopolysaccharide is transferred from high-density to low-
density lipoproteins by lipopolysaccharide-binding protein and phospholipid transfer protein. Infect. Immun. 73: 2321-2326.
Ley, R. E., D. A. Peterson, and J. I. Gordon. 2006. Ecological and evolutionary forces
shaping microbial diversity in the human intestine. Cell 124: 837-848. Li, Q. et al. 2008. n-3 polyunsaturated fatty acids prevent disruption of epithelial barrier
function induced by proinflammatory cytokines. Mol Immunol 45: 1356-1365. Libby, P. 2002. Inflammation in atherosclerosis. Nature 420: 868-874. Lindsay, M. A. 2008. microRNAs and the immune response. Trends Immunol 29: 343-351. Liu, F. et al. 2009. Heat-stress-induced damage to porcine small intestinal epithelium
associated with downregulation of epithelial growth factor signaling. J Anim Sci 87: 1941-1949.
Lochmiller, R. L., and C. Deerenberg. 2000. Trade-offs in evolutionary immunology: just
what is the cost of immunity? Oikos 88: 87-98. Lodish, H. F., B. Zhou, G. Liu, and C.-Z. Chen. 2008. Micromanagement of the immune
system by microRNAs. Nat Rev Immunol 8: 120-130. Lóránd, B. 2004. Bile acids in physico-chemical host defence. Pathophysiology 11: 139-145. Lu, M. et al. 2005. Lipopolysaccharide deacylation by an endogenous lipase controls innate
antibody responses to Gram-negative bacteria. Nat Immunol 6: 989-994.
47
Lund, E., S. Güttinger, A. Calado, J. E. Dahlberg, and U. Kutay. 2004. Nuclear export of microrna precursors. Science 303: 95-98.
Ma, D. W. L. et al. 2004. n-3 PUFA Alter caveolae lipid composition and resident protein
localization in mouse colon. FASEB J 18: 1040-1042. Ma, X., L. E. Becker Buscaglia, J. R. Barker, and Y. Li. 2011. MicroRNAs in NF-kappaB
signaling. J mol cell bio 3: 159-166. Magalhaes, J. G., I. Tattoli, and S. E. Girardin. 2007. The intestinal epithelial barrier: how to
distinguish between the microbial flora and pathogens. Semin Immunol 19: 106-115. Mages, J., H. Dietrich, and R. Lang. 2007. A genome-wide analysis of LPS tolerance in
macrophages. Immunobiology 212: 723-737. Maitra, S. K., D. Rachmilewitz, D. Eberle, and N. Kaplowitz. 1981. The hepatocellular
uptake and biliary excretion of endotoxin in the rat. Hepatology 1: 401-407. Malo, M. S. et al. 2006. The pro-inflammatory cytokines, IL-1beta and TNF-alpha, inhibit
intestinal alkaline phosphatase gene expression. DNA cell bio 25: 684-695. Manes, S., G. del Real, and C. Martinez-A. 2003. Pathogens: raft hijackers. Nat Rev
Immunol 3: 557-568. Mangold, H. K. 1995. The lipid handbook, Second Edition, F. D. Gunstone, J. L. Harwood
and F. B. Padley, Chapman & Hall, London, 1994, Lipid / Fett 97: 315-316. McDermott, C., and B. Fenwick. 1992. Neutrophil activation associated with increased
neutrophil acyloxyacyl hydrolase activity during inflammation in cattle. Am J Vet Res 53: 803-807.
McGettrick, A. F., and L. A. J. O’Neill. 2010. Regulators of tlr4 signaling by endotoxins. In:
X. Wang and P. J. Quinn (eds.) Endotoxins: structure, function and recognition. Subcell Biochem No. 53. p 153-171. Springer Netherlands.
McMurray, D. N., D. L. Bonilla, and R. S. Chapkin. 2011. n−3 Fatty acids uniquely affect
anti-microbial resistance and immune cell plasma membrane organization. Chem Phy Lipids 164: 626-635.
Medzhitov, R., P. Preston-Hurlburt, and C. A. Janeway, Jr. 1997. A human homologue of the
Drosophila Toll protein signals activation of adaptive immunity. Nature 388: 394-397.
Medzhitov, R. 2001. Toll-like receptors and innate immunity. Nat Rev Immunol 1: 135-145.
48
Meng, Q. et al. 2005. Regulation of amino acid arginine transport by lipopolysaccharide and nitric oxide in intestinal epithelial IEC-6 cells. J Gastrointest Surg 9: 1276-1285; discussion 1285.
Milenkovic, D. et al. 2012. Modulation of mirna expression by dietary polyphenols in apoe
deficient mice: A new mechanism of the action of polyphenols. PLoS ONE 7: e29837.
Miyajima, A., T. Kitamura, N. Harada, T. Yokota, and K. Arai. 1992. Cytokine receptors and
signal transduction. Annu Rev Immunol 10: 295-331. Moore, J. N., and D. D. Morris. 1992. Endotoxemia and septicemia in horses: experimental
and clinical correlates. J Am Vet Med Assoc 200: 1903-1914. Moresco, E. M. Y., D. LaVine, and B. Beutler. 2011. Toll-like receptors. Curr Biol 21: R488-
R493. Moriez, R. et al. 2005. Myosin light chain kinase is involved in lipopolysaccharide-induced
disruption of colonic epithelial barrier and bacterial translocation in rats. Amer J Path 167: 1071-1079.
Munford, R., M. Lu, and A. Varley. 2009. Chapter 2 Kill the Bacteria...and Also Their
Messengers? In: W. A. Frederick (ed.) Advances in Immunology No. Volume 103. p 29-48. Academic Press.
Munford, R. S., and C. L. Hall. 1986. Detoxification of bacterial lipopolysaccharides
(endotoxins) by a human neutrophil enzyme. Science 234: 203-205. Munford, R. S. 2005. Invited review: Detoxifying endotoxin: time, place and person. J End
Res 11: 69-84. Neal, M. D. et al. 2006. Enterocyte TLR4 mediates phagocytosis and translocation of
bacteria across the intestinal barrier. J Immunol 176: 3070-3079. Nusrat, A., J. R. Turner, and J. L. Madara. 2000. Molecular physiology and pathophysiology
of tight junctions: IV. Regulation of tight junctions by extracellular stimuli: nutrients, cytokines, and immune cells. Am J Physiol Gastrointest Liver Physiol 279: G851-857.
O'Connell, R. M., D. S. Rao, and D. Baltimore. 2012. microRNA Regulation of
Inflammatory Responses. Ann Rev Immunol 30: 295-312. O'Neill, L. A., F. J. Sheedy, and C. E. McCoy. 2011. MicroRNAs: the fine-tuners of Toll-like
receptor signalling. Nat Rev Immunol 11: 163-175.
49
Olofsson, P., G. Nylander, and P. Olsson. 1985. Endotoxin-transport routes and kinetics in intestinal ischemia. Acta chirurgica Scandinavica 151: 635-639.
Olofsson, P., G. Nylander, and P. Olsson. 1986. Endotoxin: Routes of transport in
experimental peritonitis. Amer J Surg 151: 443-446. Olsson, S., and R. Sundler. 2006. The role of lipid rafts in LPS-induced signaling in a
macrophage cell line. Mol Immunol 43: 607-612. Orellana, R. A. et al. 2007. Amino acids augment muscle protein synthesis in neonatal pigs
during acute endotoxemia by stimulating mTOR-dependent translation initiation. Am J Physiol Endocrinol Metab 293: E1416-1425.
Oswald, I. P. 2006. Role of intestinal epithelial cells in the innate immune defence of the pig
intestine. Vet Res 37: 359-368. Pearce, S. C., V. Mani, L. H. Baumgard, and N. K. Gabler. 2011. Heat stress increases small
intestinal permeability and circulating endotoxin in growing pigs Joint Annual Meetings of the ADSA and ASAS No. 649, New Orleans, LA.
Petsch, D., and F. B. Anspach. 2000. Endotoxin removal from protein solutions. Journal of
Biotechnology 76: 97-119. Pfeiffer, A. et al. 2001. Lipopolysaccharide and ceramide docking to CD14 provokes ligand-
specific receptor clustering in rafts. Euro J immunol 31: 3153-3164. Pie, S. et al. 2004. Weaning is associated with an upregulation of expression of inflammatory
cytokines in the intestine of piglets. J Nutr 134: 641-647. Pike, L. J. 2003. Lipid rafts: bringing order to chaos. J. Lipid Res. 44: 655-667. Pike, L. J. 2006. Rafts defined: a report on the Keystone Symposium on Lipid Rafts and Cell
Function. J Lipid Res 47: 1597-1598. Plata-Salamán, C. R., G. Sonti, J. P. Borkoski, C. D. Wilson, and J. M.H. Ffrench-Mullen.
1996. Anorexia induced by chronic central administration of cytokines at estimated pathophysiological concentrations. Phys Behav 60: 867-875.
Poelstra, K. et al. 1997. Dephosphorylation of endotoxin by alkaline phosphatase in vivo. Am
J Pathol 151: 1163-1169. Poltorak, A. et al. 1998. Defective LPS signaling in C3H/HeJ and C57BL/10ScCr mice:
mutations in Tlr4 gene. Science 282: 2085-2088.
50
Raetz, C. R. et al. 1991. Gram-negative endotoxin: an extraordinary lipid with profound effects on eukaryotic signal transduction. Faseb J. 5: 2652-2660.
Raetz, C. R., and C. Whitfield. 2002b. Lipopolysaccharide endotoxins. Annu Rev Biochem
71: 635-700. Rall, D. P., J. R. Gaskins, and M. G. Kelly. 1957. Reduction of febrile response to bacterial
polysaccharide following incubation with serum. Amer J Physiol 188: 559-562. Ravin, H. A., D. Rowley, C. Jenkins, and J. Fine. 1960. On the absorption of bacterial
endotoxin from the gastro-intestinal tract of the normal and shocked animal. J Exp Med 112: 783-792.
Read, T. E. et al. 1993. Chylomicrons enhance endotoxin excretion in bile. Infect. Immun.
61: 3496-3502. Rice, J. B. et al. 2003. Low-level endotoxin induces potent inflammatory activation of human
blood vessels: Inhibition by statins. Arterioscler Thromb Vasc Biol 23: 1576-1582. Roig-Perez, S., F. Guardiola, M. Moreto, and R. Ferrer. 2004. Lipid peroxidation induced by
DHA enrichment modifies paracellular permeability in Caco-2 cells: protective role of taurine. J. lipid res 45: 1418-1428.
Rosin, D. L., and M. D. Okusa. 2011. Dangers within: Damp responses to damage and cell
death in kidney disease. J Amer Soc Nephrol 22: 416-425. Rudbach, J. A., and A. G. Johnson. 1964. Restoration of endotoxin activity following
alteration by plasma. Nature 202: 811-812. Rudbach, J. A., and A. G. Johnson. 1966. Alteration and restoration of endotoxin activity
after complexing with plasma proteins. J Bacteriol 92: 892-898. Rutenburg, S., R. Skarnes, C. Palmkrio, and J. Fine. 1967. Detoxification of endotoxin by
perfusion of liver and spleen. Proc Soc Exp Biol Med 125: 455-459. Saini, S., S. Majid, and R. Dahiya. 2010. Diet, MicroRNAs and Prostate Cancer. Pharm Res
27: 1014-1026. Saitoh, S.-I. 2009. Chaperones and transport proteins regulate TLR4 trafficking and
activation. Immunobiology 214: 594-600. Sakumoto, R., E. Kasuya, T. Komatsu, and T. Akita. 2003. Central and peripheral
concentrations of tumor necrosis factor-α in Chinese Meishan pigs stimulated with lipopolysaccharide. J Ani Sci 81: 1274-1280.
51
Sampath, H., and J. M. Ntambi. 2005. Polyunsaturated fatty acid regulation of genes of lipid metabolism. Annu Rev Nutr 25: 317-340.
Sanchez de Medina, F. et al. 2004. Induction of alkaline phosphatase in the inflamed
intestine: a novel pharmacological target for inflammatory bowel disease. Biochem Pharmacol 68: 2317-2326.
Santaolalla, R., M. Fukata, and M. T. Abreu. 2011. Innate immunity in the small intestine.
Curr Opin Gastroenterol 27: 125-131. Sartin, J. L. et al. 2008. Central role of the melanocortin-4 receptors in appetite regulation
after endotoxin. J Animal Sci 86: 2557-2567. Sartin, J. L., B. K. Whitlock, and J. A. Daniel. 2011. Triennial Growth Symposium: Neural
regulation of feed intake: Modification by hormones, fasting, and disease. J Animal Sci 89: 1991-2003.
Satoh, M., S. Ando, T. Shinoda, and M. Yamazaki. 2008. Clearance of bacterial
lipopolysaccharides and lipid A by the liver and the role of arginino-succinate synthase. Innate Immun 14: 51-60.
Schaeffler, A. et al. 2009. Fatty acid-induced induction of Toll-like receptor-4/nuclear factor-
kappaB pathway in adipocytes links nutritional signalling with innate immunity. Immunology 126: 233-245.
Schinckel, A. P. et al. 1995. Effects of antigenic challenge on growth and composition of
segregated early-weaned pigs. Swine Health Prod 3: 228-234. Schweinburg, F. B., and J. Fine. 1960. Evidence for a lethal endotoxemia as the fundamental
feature of irreversibility in three types of traumatic shock. J Exp Med 112: 793-800. Shaikh, S. R., C. A. Jolly, and R. S. Chapkin. 2012. n-3 Polyunsaturated fatty acids exert
immunomodulatory effects on lymphocytes by targeting plasma membrane molecular organization. Mol Aspects Med 33: 46-54.
Shao, B. et al. 2011. Prolonged hepatomegaly in mice that cannot inactivate bacterial
endotoxin. Hepatology (Online first). Shen, L., C. R. Weber, D. R. Raleigh, D. Yu, and J. R. Turner. 2011. Tight junction pore and
leak pathways: A dynamic duo. Ann Rev of Physiol 73. Sheth, P., G. Samak, J. A. Shull, A. Seth, and R. Rao. 2009. Protein phosphatase 2A plays a
role in hydrogen peroxide-induced disruption of tight junctions in Caco-2 cell monolayers. Biochem J 421: 59-70.
52
Singleton, K. D., and P. E. Wischmeyer. 2006. Oral glutamine enhances heat shock protein expression and improves survival following hyperthermia. Shock 25: 295-299.
Smith, R. A. 1998. Impact of disease on feedlot performance: a review. J Anim Sci 76: 272-
274. Spaan, S., I. M. Wouters, I. Oosting, G. Doekes, and D. Heederik. 2006. Exposure to
inhalable dust and endotoxins in agricultural industries. J Environ Monit 8: 63-72. Spurlock, M. E. 1997. Regulation of metabolism and growth during immune challenge: an
overview of cytokine function. J. Anim. Sci. 75: 1773-1783. Steel, D. M., and A. S. Whitehead. 1994. The major acute phase reactants: C-reactive
protein, serum amyloid P component and serum amyloid A protein. Immunology Today 15: 81-88.
Steiger, M. et al. 1999. Effect of a prolonged low-dose lipopolysaccharide infusion on feed
intake and metabolism in heifers. J Anim Sci 77: 2523-2532. Stipanuk, M. H. 2006. Biochemical, physiological, and molecular aspects of human nutrition.
Sixth edition. St. Louis, Saunders Elsevier 6: 220-345 Suganuma, T., K. Irie, E. Fujii, T. Yoshioka, and T. Muraki. 2002. Effect of heat stress on
lipopolysaccharide-induced vascular permeability change in mice. J Pharmacol Exp Ther 303: 656-663.
Sykes BW, F. M. 2005. Equine endotoxaemia--a state-of-the-art review of therapy. Aust Vet
J 83: 45-50. Takanabe, R. et al. 2008. Up-regulated expression of microRNA-143 in association with
obesity in adipose tissue of mice fed high-fat diet. Biochem Biophy Res Commun 376: 728-732.
Targan, S. R., F. Shanahan, and L. C. Karp. 2003. Inflammatory Bowel Diesease: From
Bench to Bedside, 2nd edition. Springer Netherlands press. Tlaskalová-Hogenová, H. et al. 2004. Commensal bacteria (normal microflora), mucosal
immunity and chronic inflammatory and autoimmune diseases. Immunol Lett 93: 97-108.
Tomita, M., R. Ohkubo, and M. Hayashi. 2004. Lipopolysaccharide transport system across
colonic epithelial cells in normal and infective rat. Drug Metab Pharmacokinet 19: 33-40.
53
Triantafilou, M., K. Miyake, D. T. Golenbock, and K. Triantafilou. 2002. Mediators of innate immune recognition of bacteria concentrate in lipid rafts and facilitate lipopolysaccharide-induced cell activation. J Cell Sci 115: 2603-2611.
Triantafilou, M., and K. Triantafilou. 2002. Lipopolysaccharide recognition: CD14, TLRs
and the LPS-activation cluster. Trends Immunol 23: 301-304. Triantafilou, M., S. Morath, A. Mackie, T. Hartung, and K. Triantafilou. 2004. Lateral
diffusion of Toll-like receptors reveals that they are transiently confined within lipid rafts on the plasma membrane. J cell sci 117: 4007-4014.
Turner, J. R. et al. 1997. Physiological regulation of epithelial tight junctions is associated
with myosin light-chain phosphorylation. Amer J Phy - Cell Physiol 273: C1378-C1385.
Turner, J. R. 2006. Molecular basis of epithelial barrier regulation: from basic mechanisms to
clinical application. The American journal of pathology 169: 1901-1909. Turner, J. R. 2009. Intestinal mucosal barrier function in health and disease. Nat Rev
Immunol 9: 799-809. Turner, J. R. 2011. Dynamic regulation of the tight junction barrier. Ann Rev Physiol 73. Turvey, S. E., and D. H. Broide. 2010. Innate immunity. J Allergy Clini Immunol 125: S24-
S32. Tvrzicka, E., L. S. Kremmyda, B. Stankova, and A. Zak. 2011. Fatty acids as biocompounds:
their role in human metabolism, health and disease--a review. Part 1: classification, dietary sources and biological functions. Biomedical papers of the Medical Faculty of the University Palacky, Olomouc, Czechoslovakia 155: 117-130.
Uematsu, S., and S. Akira. 2007. Toll-like receptors and type i interferons. J Biol Chem 282:
15319-15323. Ulevitch, R. J., and A. R. Johnston. 1978. The modification of biophysical and endotoxic
properties of bacterial lipopolysaccharides by serum. J Clin Invest 62: 1313-1324. Ulevitch, R. J., A. R. Johnston, and D. B. Weinstein. 1979. New function for high density
lipoproteins. Their participation in intravascular reactions of bacterial lipopolysaccharides. J Clin Invest 64: 1516-1524.
Vaarala, O., M. A. Atkinson, and J. Neu. 2008. The "perfect storm" for type 1 diabetes: the
complex interplay between intestinal microbiota, gut permeability, and mucosal immunity. Diabetes 57: 2555-2562.
54
Vamadevan, A. S., Fukata, Masayuki, Arnold, Elizabeth T., Thomas, Lisa S., Hsu, David, Abreu, Maria T. 2010. Regulation of Toll-like receptor 4-associated MD-2 in intestinal epithelial cells: a comprehensive analysis. Innate Immunity 16: 93-103.
Van Leeuwen, P. A. et al. 1994. Clinical significance of translocation. Gut 35: S28-34. Van Oosten, M. et al. 2001.Aapolipoprotein E protects against bacterial lipopolysaccharide-
induced lethality. J Biol Chem 276: 8820-8824. Verstrepen, L. et al. 2008. TLR-4, IL-1R and TNF-R signaling to NF-kappa B: variations on
a common theme. Cell Mol Life Sci 65: 2964-2978. Vreugdenhil, A. C. E. et al. 2003. Lipopolysaccharide (lps)-binding protein mediates lps
detoxification by chylomicrons. J Immunol 170: 1399-1405. Wahid, F., A. Shehzad, T. Khan, and Y. Y. Kim. 2010. MicroRNAs: Synthesis, mechanism,
function, and recent clinical trials. Biochimica et Biophysica Acta (BBA) - Mol Cell Res 1803: 1231-1243.
Wassall, S. R., and W. Stillwell. 2008. Docosahexaenoic acid domains: the ultimate non-raft
membrane domain. Chem Phys Lipids 153: 57-63. Webel, D. M., R. W. Johnson, and D. H. Baker. 1998. Lipopolysaccharide-Induced
Reductions in Food Intake Do Not Decrease the Efficiency of Lysine and Threonine Utilization for Protein Accretion in Chickens. J Nutr 128: 1760-1766.
Werners, A. H., S. Bull, and J. Fink-Gremmels. 2005. Endotoxaemia: a review with
implications for the horse. Equine Vet J 37: 371-383. Wiznitzer, T., F. B. Schweinburg, N. Atkins, and J. Fine. 1960. On the relation of the size of
the intraintestinal pool of endotoxin to the development of irreversibility in hemorrhagic shock. J Exp Med 112: 1167-1171.
Wong, S. W. et al. 2009. Fatty acids modulate Toll-like receptor 4 activation through
regulation of receptor dimerization and recruitment into lipid rafts in a reactive oxygen species-dependent manner. J Biol Chem 284: 27384-27392.
Wright, K. J. et al. 2000. Integrated adrenal, somatotropic, and immune responses of growing
pigs to treatment with lipopolysaccharide. J. Anim. Sci. 78: 1892-1899. Yaqoob, P. 2009. The Nutritional Significance of Lipid Rafts. Ann Rev Nutr 29: 257-282. Yaron, S., G. L. Kolling, L. Simon, and K. R. Matthews. 2000. Vesicle-Mediated Transfer of
Virulence Genes from Escherichia coli O157:H7 to Other Enteric Bacteria. Appl. Environ. Microbiol. 66: 4414-4420.
55
Zebeli, Q., S. M. Dunn, and B. N. Ametaj. 2011. Perturbations of plasma metabolites
correlated with the rise of rumen endotoxin in dairy cows fed diets rich in easily degradable carbohydrates. J Dairy Sci 94: 2374-2382.
Zhou, R., S. P. O'Hara, and X.-M. Chen. 2011. MicroRNA regulation of innate immune
responses in epithelial cells. Cell Mol Immunol 8: 371-379. Zweifach, B. W., and A. Janoff. 1965. Bacterial Endotoxemia. Annu Rev Med 16: 201-220.
56
Figure 1. Simplified structure of lipopolysaccharide (LPS) from Gram negative bacteria
such as Escherichia coli. Lipopolysaccharide contains a distal ‘O’ polysaccharide region, a
core polysaccharide region divided into outer and inner core and an interior lipid A
component through which LPS is inserted into the cell membrane. ‘O’ polysaccharide region
is highly variable and contains approximately 10 to 25 repeated units and made up of
common hexose (Hex) sugars. Outer core polysaccharide contains common hexose sugars
such as glucose (Glc) and galactose (Gal) whereas inner core polysaccharide contains
unusual sugar such as 3-deoxy-D-manno-octulosonic acid (Kdo). Lipid A structure is
explained in the text. Arrows with acronyms AP (alkaline phosphatase) and acyloxyacyl
hydrolase (AOAH) indicate the cleavage points where these enzymes cleave the phosphate
and secondary fatty acyl chains respectively. GlcN - N-acetyl glucosamine; Hep - Heptose
57
Figure 2. Pathways of TLR 4 signaling. Lipopolysaccharide is recognized by TLR4 which
causes its localization to lipid raft. From lipid raft, TLR4 signals either through a MyD88 –
dependent pathway or TRIF-dependent pathway which results in the translocation of NF-κβ
or IRF3 to the nucleus and transcription of inflammatory cytokines. Adapted from
(McGettrick and O’Neill, 2010; Uematsu and Akira, 2007)
LBP
Endotoxin
Nuclear Membrane
Lipid Plasma Membrane
CD14
58
Figure 3. MicroRNA biogenesis and function in animal cells. MicroRNA is transcribed as
primary miRNA and then cleaved in the nucleus by RNAse enzyme Drosha to a pre-miRNA
which is exported to the cytoplasm. In cytoplasm Dicer cleaves the Pre-miRNA to a 21-25
nucleotide dimer. This dimer is loaded into RNA induced silencing complex and one strand
is destroyed and the other strand binds to the target mRNA either by repressing the
translation or by destabilizing the mRNA. Adapted from (Lodish et al., 2008)
59
Figure 4. Production of eicosanoids by n-3 and n-6 PUFA. Even though the pathway and the enzymes remain the same, n-3 PUFA produces less potent or anti-inflammatory eicosanoids. Dotted arrows indicate a decrease in synthesis. AA, arachidonic acid; EPA, Eicosapentaenoic acid; DHA, Docosahexaenoic acid; LOX, Lipoxygenase; COX, Cyclooxygenase; CYP, Cytochrome 450 enzymes. (Adapted from (Stipanuk, 2006))
Anti-inflammatory or
less potent Eicosanoids
Pro-inflammatory
eicosanoids
3-series prostaglandins
5-Series leukotrienes
Thrombaxanes
Resolvins
2-series prostaglandins
4-series leukotrienes
Lipoxins
EPA and DHA – Phospholipid- AA
EPA, DHA (n-3) AA (n-6)
Consumption through feed
EPA and DHA - Free - AA
Phospholipase action on cell membrane
Substrate for COX, LOX, CYP
Competition for the enzymes between EPA and AA
n-3 Eicosanoids n-6
AA replaced if EPA and DHA are present
60
Figure 5. A summary of intestinal endotoxin/LPS permeability and inflammation on gut
integrity and function. Gram negative bacteria in the intestine releases LPS during growth,
division, and death (1). Endotoxin/LPS may be free or bound to proteins such as LPS
binding protein (LBP) in the lumen. Recruitment of toll-like receptor 4 (TLR4), and
associated proteins to membrane lipid raft regions allow receptor mediated endocytosis of
bacteria and LPS in cells (2). Intracellular endotoxin/LPS may be transported bound to
organelles (i.e., golgi) or albumin proteins in the cytosol (3). Opening of tight junctions (TJ)
and increased paracellular permeability of LPS (4) can occur due to intestinal inflammation
or stress. Increased proinflammatory cytokine secretion and activation of innate and adaptive
immune cells and intestinal inflammation occurs from LPS transported across the intestinal
barrier (5). Secreted cytokines may enter the IEC through the basolateral side, resulting in
increased inflammation and the activation of myosin light chain kinase (MLCK) and
phosphorylate-myosin light chain (P-MLC). Together, this causes the disruption of tight
junction (TJ) complexes (6) and increased paracellular LPS permeability. After sensing of
LPS via TLR4, suppression of nutrient transport and enteroendocrine cell signaling (7) can
reduce appetite via the depolarization and secretion of appetite regulating neuropeptides such
as cholecystokinin (CCK) and glucagon like peptide-1 (GLP-1).
61
Table 1. General classification and major sources and functions of common fatty acids
Fatty acid class Nomenclature Major sources Important functions Saturated -Lauric -Myristic -Palmitic -Stearic -Arachidic
C12:0 Coconut oil
Energy storing molecule Structural integrity Signaling molecules
C14:0 Coconut oil, butterfat, cod liver oil
C16:0
Palm oil, lard, butterfat, beef tallow, cotton seed oil, cod liver oil
C18:0 Beef tallow, lard, butterfat, flax seed oil
C20:0 Peanut oil, corn oil Monounsaturated -oleic C18:1n-9
Olive oil, almond oil, canola oil, peanut oil, lard, beef tallow
Energy storing molecule Structural integrity Signaling molecules
n-3 Polyunsaturated - α-Linolenic (ALA) -Eicosapentaenoic (EPA) -Docosahexaenoic (DHA)
C18:3n-3 Flaxseed oil, canola oil, soybean oil, walnut
Structural integrity Signaling molecule Production of anti-inflammatory eicosanoids such as prostaglandins, leukotriene’s and resolving’s.
C20:5n-3 Sardines, salmon, certain algae
C22:6n-3 Sardines, salmon, certain algae
n-6 Polyunsaturated - Linoleic (LA) - Arachidonic (ARA)
C18:2n-6
Sunflower oil, corn oil, soybean oil, cottonseed oil, sesame oil, peanut oil, canola oil
Structural integrity Signaling molecule Production of pro-inflammatory eicosanoids such as prostaglandins and leukotriene’s.
C20:4n-6 Chicken, egg, beef tallow, lard
62
CHAPTER 3: DIETARY OIL COMPOSITION DIFFERENTIALLY MODULATES
INTESTINAL ENDOTOXIN TRANSPORT AND POSTPRANDIAL
ENDOTOXEMIA
Submitted and accepted with minor revision to Nutrition and Metabolism: An International
Journal
V. Mani,1,2 J. H. Hollis3 and N. K. Gabler, 1, 2.
Abstract
Background: Uptake of intestinal derived endotoxin and the subsequent endotoxemia can be
considered major predisposing factors for diseases such as atherosclerosis, sepsis, obesity
and diabetes. Dietary fat has been shown to increase postprandial endotoxemia. Therefore,
the aim of this study was to assess the effects of different dietary oils on intestinal endotoxin
transport and postprandial endotoxemia using swine as a model. We hypothesized that oils
rich in saturated fatty acids (SFA) would augment, while oils rich in n-3 polyunsaturated
fatty acids (PUFA) would attenuate endotoxin transport from the intestine and reduce
circulating concentrations.
Methods: Postprandial endotoxemia was measured in twenty four pigs following a porridge
meal made with either water (Control), fish oil (FO), vegetable oil (VO) or coconut oil (CO).
Blood was collected at 0, 1, 2, 3 and 5 hours postprandial and measured for endotoxin.
Furthermore, ex vivo ileum endotoxin transport was assessed using modified Ussing
chambers and intestines treated with either no oil or 12.5% (v/v) VO, FO, cod liver oil
63
(CLO), CO or olive oil (OO). Ex vivo mucosal to serosal endotoxin transport permeability
(Papp) was then measured by the addition of fluorescent labeled-lipopolysaccharide.
Results: Postprandial serum endotoxin concentrations were increased after a meal rich in
saturated fatty acids and decreased with higher n-3 PUFA intake. Compared to the no oil
control, fish oil and CLO which are rich in n-3 fatty acids reduced ex vivo endotoxin Papp by
50% (P<0.05). Contrarily, saturated fatty acids increased the Papp by 60% (P=0.008). Olive
and vegetable oils did not alter intestinal endotoxin Papp.
Conclusion: Overall, these results indicate that saturated and n-3 PUFA differentially
regulate intestinal epithelial endotoxin transport. This may be associated with fatty acid
regulation of intestinal membrane lipid raft mediated permeability.
Key words: Dietary fat, Endotoxin, Intestine
Background
The link between dietary fat and endogenous blood endotoxin has attracted increased
medical and biomedical interest over the last few years. Furthermore, hyperphagia, increased
adiposity and metabolic changes associated with high fat feeding can be recapitulated in mice
chronically infused with LPS for four weeks [1]. It has been reported that the structure of fat
consumed (emulsion vs. free oil) changes the extent of endotoxemia and that altering the
composition, structure and quality of dietary fats could improve health [2]. In healthy
humans, postprandial plasma endotoxin concentrations increase on average 18% after a high
fat meal (approximately 380 kcal from fat, 42 % of total energy) compared to the fasted state
[3]. These authors concluded that increased postprandial LPS may contribute to the
64
development of postprandial inflammation and disease. Ghanim et al. [4, 5] also showed that
in healthy adults, high fat, high carbohydrate meal (~900 kcal) increased postprandial plasma
LPS concentrations by 70%. However, Laugerette et al. [6] recently reported that dietary oil
composition differentially modulated murine inflammation and endotoxin permeability.
These authors also showed that fat composition, not quantity in the diet (22 vs. 3%) was
critical in modulating plasma endotoxemia. Collectively, these data show that dietary fat
intake and composition is able to modulate blood endotoxin and that this is associated with
acute inflammation and the metabolic diseases of obesity and diabetes.
Both Gram positive and Gram negative bacteria are present in large quantities in the
intestine. Interestingly, the total quantity of endotoxin, which is the gram negative bacterial
outer cell wall component, in the intestine alone could be up to one gram [7]. Even very
small quantities of endotoxin, pico-gram scale, in the systemic circulation have the potential
to elicit an inflammatory response in humans and animals [8]. Endotoxin is also
synonymously referred to as lipopolysaccharide (LPS), and both of these compounds are
major immunogens that elicit an inflammatory response in numerous tissues and cell types
via their recognition through pathogen-associated molecular patterns (PAMPs) and Toll-like
receptors in the innate immune system [9]. Lipopolysaccharide is thought to enter circulation
by permeability across the intestinal epithelium either via paracellular pathways through the
openings of intestinal tight junctions between two epithelial cells or by a transcellular
pathway [7]. Transcellular permeability and the associated endocytosis of intestinal derived
endotoxin may be facilitated by intracellular signaling processes mediated by the innate
immune receptor complex CD14/Toll like receptor 4 (TLR4)/MD-2, in association with the
cell membrane micro domain lipid raft [10]. Furthermore, circulating LPS concentrations
65
may also be augmented by permeability coupled to dietary lipids and chylomicrons [11].
In recent years accumulating research has investigated the link between dietary fat
and endogenous LPS in relation to metabolic inflammation [12, 13]. Current evidence
suggests that dietary fat augments circulating endotoxin concentrations and the resultant
postprandial endotoxemia leads to low-grade systemic inflammation which has been
implicated in the development of several metabolic diseases [1, 3, 14]. Intestinal derived
endotoxin and the subsequent acute endotoxemia are considered major predisposing factors
for inflammation associated diseases such as atherosclerosis, sepsis, obesity, type 2 diabetes
and Alzheimer's [15-17]. However, the ability of different types of oil and fatty acids to
facilitate uptake of intestinal endotoxin has been poorly characterized. Interestingly, saturated
and n-3 polyunsaturated fatty acids (PUFA) have been shown to reciprocally modulate the
LPS receptor, TLR4 signaling and its redistribution to cell membrane micro domains lipid
rafts [18]. This is postulated to be due to saturated fatty acids (SFA) such as lauric and
myristic acid being part of the fatty acyl side chain composition of lipid-A component of LPS
and the ability of n-3 PUFA to reduce the potency of LPS when substituted in place of
saturated fatty acids in lipid-A [19, 20]. Thus, there is clear linkage between fatty acids
(saturated, n-3 polyunsaturated, monounsaturated) and LPS signaling.
Therefore, the aim of this study was to assess the effects of various dietary fats on in
vivo and ex vivo intestinal LPS permeability and circulating concentrations using the pig as a
biomedical model. We hypothesize that oils rich in saturated fatty acids (SFA) would
augment, while the oils containing the n-3 PUFA (docosahexaenoic acid [DHA] and
eicosapentaenoic acid [EPA]) would attenuate, intestinal endotoxin permeability and
postprandial endotoxemia.
66
Methods
Materials and Animals
All the chemicals used for this study were purchased from Sigma-Aldrich (St. Louis, MO)
unless otherwise stated. All animal use and procedures were approved by the Iowa State
University Institutional Animal Care and Use Committee.
Effect of dietary oil on postprandial serum endotoxin concentration
Twenty four pigs (49 ± 7 kg BW) were raised on a typical corn-soybean diet that met or
exceeded their nutrient requirements [21] and randomly allocated to one of four treatments.
The treatments consisted of 500 g ground corn-soybean meal dough made up with either 1)
50 ml water (Control); 2) 50 ml FO (Spring Valley Inc., UT); 3) 50 ml VO (Hy-Vee Inc., IA)
; or 4) 50 ml CO (Spectrum Naturals Inc., NY). After an overnight fast, six pigs were fed
one of each porridge meal. Pigs voluntarily consumed the porridge meal with in ten minutes
after the feed was offered in front of them. Blood was collected at 0, 1, 2, 3, and 5 hours
postprandially by jugular venipuncture into pyrogen-free vaccutainer tubes using a sterile
needle. Proper precautionary measures were taken to prevent external contamination of
blood. Serum was separated by centrifuging at 2000 × g and was stored at -80 °C until
further analysis in pyrogen-free tubes.
Serum endotoxin concentration was measured using the end point fluorescent assay
using the recombinant factor C (rFC) system (LonzaTM, Switzerland). Briefly, the serum
samples were diluted 1000 times and 100 µl of the samples or standards were added to a 96
well plate and incubated at 37 °C for 10 min. Thereafter, 100 µL of rFC enzyme, rFC assay
buffer and rFC substrate were added at a ratio of 1:4:5 to the plate and an initial reading were
67
taken followed by 1 h incubation at 37 °C. The relative fluorescence unit (RFU) for each well
was determined (excitation 380 nm and emission 440 nm). A positive control from the assay
kit was used to ascertain the validity of the assay and the concentration of the endotoxin was
interpolated from the standard curve constructed from the standards and corrected for sample
dilution.
Ex vivo intestinal integrity and LPS permeability
Freshly isolated ileum segments from eleven pigs (21-28 days old) were placed in chilled
Krebs-Henseleit buffer (consisting of, in mmol/L: 25 NaHCO3, 120 NaCl, 1 MgSO4, 6.3
KCl, 2 CaCl2, 0.32 NaH2PO4; pH 7.4) for transport to the laboratory while under constant
aeration. Intestinal tissues were then stripped of their outer serosal layer and immediately
mounted into modified Ussing chambers (Physiologic Instruments Inc., San Diego, CA and
World Precision Instruments Inc. New Haven, CT). Each chamber and intestinal segment
(0.71 cm2) was bathed on its mucosal and serosal sides with 5 ml of Krebs-Henseleit buffer
and constantly gassed with 95% O2-5% CO2 mixture. Chambers were connected to a pair of
dual channel current and voltage electrodes containing 3% noble agar bridges and filled with
3 M potassium chloride to measure electrophysiological parameters of the intestinal
membranes or to measure the mucosal to serosal permeability of endotoxin. Transepithelial
resistance (TER) was not different across pigs, indicating no differences in paracellular
permeability or leaky gut (data not shown).
To rule out any influence that bile acids may have on intestinal integrity, TER and
macromolecule permeability was first tested on isolated ileum samples that were incubated
with porcine bile acid (0, 3, 6 and 9 mg/ml) for thirty minutes. Thereafter, FITC-labeled
68
dextran (FITC-Dextran, 4.4 KDa) mucosal to serosal transport was measured as described
previously [22]. Briefly, the mucosal chambers were challenged with 2.2 mg/mL FITC-
Dextran and chamber samples from both sides were collected every 10-15 min for eighty
minutes. The relative fluorescence was then determined using a fluorescent plate reader (Bio-
Tek, USA) with the excitation and emission wavelengths of 485 and 520 nm, respectively.
Thereafter, an apparent permeability coefficient (Papp) was calculated for each treatment:
Papp = dQ/(dt×A×C0)
Where: dQ/dt = transport rate (µg/min); C0 = initial concentration in the donor chamber
(µg/ml); A = area of the membrane (cm2).
The effect of dietary fat on endotoxin permeability was studied using ex vivo
permeability of fluorescein isothiocyanate (FITC) labeled-LPS (Escherichia coli 055:B5)
mounted into modified Ussing chambers. Briefly, segments of swine intestinal tissues were
treated with either 12.5 % (v/v) buffered saline control (CON), FO or CLO manufactured by
Spring Valley Inc., UT), VO, CO and OO purchased form Hy-Vee Supermarkets Inc., IA).
All oils were commercial retail available and then mixed with 20 mM sodium
taurodeoxycholate (bile acid) for micelle formation to simulate the intestinal milieu. Each
mucosal chamber was then challenged with 20 µg/mL FITC-LPS and chamber samples were
collected every 10-15 min for eighty minutes. The relative fluorescence of each sample was
then determined using a fluorescent plate reader (Bio-Tek, USA) with the excitation and
emission wavelengths of 485 and 520 nm, respectively. The apparent permeability
coefficient was then calculated similar to that described above for FITC-Dextran.
69
Lipid rafts, dietary oil and ex vivo intestinal endotoxin permeability
To examine the role of lipid rafts in intestinal endotoxin permeability, ileum segments from
16 pigs (56±4 days of age) were mounted in Ussing chambers as described above. Segments
were pre-treated with or without 25 mM Methyl-β-cyclo dextrin (MβCD, a synthetic lipid
raft modifier) for 30 min. Thereafter, the mucosal chamber was spiked with either saline-bile
acid (CON) or Coconut oil-bile acid (12.5% v/v) and the FITC-LPS apparent permeability
coefficient was calculated.
Fatty acid analysis
Fatty acid profiles of the dietary oils used to make the porridge were determined and
analyzed by GC-MS [23, 24]. One ml oil was mixed with 0.5 mL of 4:1 hexane and 125 µg/L
heptadecanoic acid was added to each sample as an internal standard. FAME were analyzed
by GC on a Hewlett-Packard model 6890 fitted with an Omegawax 320 (30-m × 0.32-mm
i.id. 0.25 um) capillary column. Hydrogen was the carrier gas. The temperature program
ranged from 80 to 250°C with a temperature rise of 5°C/min. The injector and detector
temperatures were 250°C and 1 µL of sample was injected and run split. Fatty acids methyl
esters were identified by their relative retention times on the column with respect to
appropriate standards and heptadecanoic acid.
Data analysis
Results are presented as means ± S.E.M and were analyzed with the Proc Mixed procedure of
SAS (Cary, NC). In the model, repetition or day of Ussing chamber run was used as a
random effect. Statistical significance of difference was analyzed by analysis of variance
70
(ANOVA) followed by Tukey’s range test for pair wise comparison of all treatment means.
Differences were considered significant at P ≤ 0.05 and a tendency at P ≤ 0.10.
Results
Dietary oil fatty acid profiles
The fatty acid composition of the oils used to make the porridge meal and/or in the ex vivo
transport study are reported in Table 1. The coconut oil contained high concentrations of
saturated fatty acids (89 %), particularly lauric, myristic, and palmitic acids. Olive oil
contained a very high content of monounsaturated oleic acid and a moderate amount of
palmitic acid, with a saturated fat content of 29 %. Vegetable oil used in this study contained
a high quantity (50 %) of arachidonic acid (20:4n6), 32 % oleic acid and 13 % palmitic acid.
The fish oil used consisted of 35 % docosahexaenoic acid (DHA) and 19 % eicosapentaenoic
acid (EPA), while the cod liver oil contained 32 % palmitic acid, 25 % arachidonic acid,
8.6% EPA and 4.3% DHA. The n6:n3 ratio was highest in the olive oil > vegetable oil > cod
liver oil > fish oil > coconut oil.
Effect of dietary oil on postprandial serum endotoxin concentration
To assess the effect of dietary lipids on postprandial serum endotoxin concentrations, pigs
received a porridge meal containing either 50 mL of saline, CO, VO or FO. The endotoxin
concentration of the various oils used did not differ (data not shown). Change in postprandial
serum endotoxin concentration due to different meal treatments are presented in Figure 1A.
The overall postprandial serum endotoxin concentrations were significantly lower in the
meals constituting saline or FO, with the mean overall serum endotoxin concentration
71
increasing two-fold over the saturated coconut oil meal treatment (P<0.05, Figure 1B).
However, meals made up with VO were not different from the saline, CO or FO treatments
(P<0.05). Interestingly, the CO meal significantly elevated serum endotoxin concentrations
after 2 hours versus the saline and FO, and these remained elevated at 3 and 5 hour
postprandial (P<0.05, Figure 1A).
Effect of exogenous porcine bile acid on ex vivo intestinal integrity
Bile acids have been shown to increase the intestinal permeability in cultured Caco-2 cell
lines [25]. To rule out the effect that exogenous bile acid may reduce intestinal integrity,
freshly isolated pig ileum segments were used to measure TER (Figure 2A) and FITC-
Dextran permeability (Figure 2B). As these segments were exposed to increasing
concentrations of porcine bile ex vivo, no differences in intestinal integrity were observed
(P>0.10, Figure 2). This might be due to the tolerance of intestinal tissues towards bile acid
because of previous exposure in vivo contrary to cell cultures where the cells are not exposed
to the bile acids previously.
Effect of dietary oil on ex vivo intestinal endotoxin permeability
The ex vivo mucosal to serosal ileum endotoxin permeability was assessed using modified
Ussing chambers and FITC-LPS permeability assay (Figure 3). Compared to the saline no oil
control treatment, the endotoxin Papp was significantly lower in both the FO and CLO
treatments (P<0.05). As hypothesized, the higher saturated fat content of CO significantly
increased the endotoxin Papp compared to the saline, FO and CLO (P<0.05). However,
mucosal treatment with VO and OO did not differ from the saline or n-3 treatments (P>0.05),
but still attenuated endotoxin Papp versus the coconut oil treatment (P<0.05, Figure 3).
Transepithelial resistance was not different due to ex vivo oil treatment (data not shown).
72
Effect of lipid raft modification of saturated fat induced endotoxin permeability
To test the hypothesis that destabilization of intestinal lipid rafts would decrease saturated fat
induced endotoxin permeability, colon samples were pretreated with the lipid raft modifier
methyl-β-cyclodextrin (MβCD) and coconut oil ex vivo. FITC-LPS permeability was then
measured (Figure 4A). As expected, the CO treatment significantly augmented the colon
endotoxin Papp compared to the saline control (P<0.05). However, the endotoxin Papp was
significantly reduced with the MβCD treatment compared to the saline control (1.54 vs. 0.07,
P=0.04). In the presence of MβCD and CO, the colon Papp was attenuated three fold from
the CO alone treatment (P<0.05). Importantly, colon integrity and permeability as measured
by transepithelial resistance was not altered by either short term CO, MβCD and the
combination of these two treatments compared to the saline control (P=0.98, Figure 4B).
Discussion
In Western diets, vegetable, canola and palm oils are common components of the diet
and to a lesser extent, long chain n-3 PUFA (DHA and EPA) oils from algal or marine
sources [26, 27]. In recent years, the development of obesity, inflammation, atherosclerosis
and other metabolic diseases has been linked to low grade endotoxemia associated with high
dietary fat and energy intake [3, 14, 28-30]. Further, these studies and others have raised
questions on whether this diet induced endotoxemia reflects changes in energy and fat
content of the diet, intestinal permeability or diet induced changes in gut microbiota. In the
current study, we used ex vivo and in vivo methods to examine intestinal permeability to
endotoxin as it relates to dietary oil composition. All pigs were clinically healthy and raised
73
on typical commercial swine corn-soybean diets. We observed no differences in intestinal
integrity due to our in vivo or ex vivo treatments [31]. Importantly, we only examined the
acute actions of a meal or oil bolus treatment and did not conduct a prolonged feeding trial in
an attempt to change the pig microbiota populations or the fatty acid profiles of tissues.
We hypothesized that dietary intake of oils rich in DHA and EPA would attenuate
intestinal LPS permeability and postprandial circulating endotoxin. We found that dietary
cod liver and fish oils attenuated serum endotoxin concentrations compared to the coconut oil
and the endotoxin levels in these pigs were similar to the control group (Figure 1). To the
best of our knowledge, there are no other studies that have shown this effect of DHA and
EPA on endotoxin transport and blood endotoxemia.
Interestingly, only one paper has examined the effects of dietary oil composition on
endotoxin uptake and related inflammation [6]. However, contrary to our results, the report
by [6] laugerette et al states that rape seed (canola) and sunflower oil, with high unsaturated
fatty acid content, augmented plasma endotoxemia by 50-75%. Cani et al. [1], also observed
a similar increase in endotoxemia in mice orally administered corn oil with or without LPS
compared to water alone. However, we observed no change in serum postprandial endotoxin
concentration or intestinal endotoxin transport due to dietary vegetable oil compared to the
saline control (Figures 1 & 3). Further work is needed to explain these discrepancies between
the two studies. Additionally, we also observed a significant increase in postprandial
endotoxemia after a porridge meal mixed with coconut oil (Figure 1). Again, this contradicts
data presented by Laugerette et al. [6] in which palm oil, high in saturated fatty acids, had no
effect on plasma endotoxin concentrations in mice. However, these authors did report an
increase in plasma LPS binding protein and argued that this protein is a better marker of
74
endotoxemia due to the short half-life of circulating endotoxin. One issue is that LPS binding
protein can be up regulated by inflammation and acute stress as well as both gram positive
and negative infections. As the magnitude of LBP response goes down with multiple
episodes of infection [32], this could be a result of the agonistic effects of saturated fatty acid
on pro-inflammatory signaling and not circulating endotoxin.
Gram negative bacteria, particularly those found in the distal ileum and colon might
be one of the major sources for circulating endotoxin [33]. It has been estimated that a single
cell of Escherichia coli contains approximately 106 Lipid A or endotoxin molecules and a
typical human intestinal tract could harbor approximately one gram of endotoxin [33-35].
Interestingly, the bacterial population in the intestine is not static. Multiple studies have
shown that bacterial composition shifts to either gram positive majority or gram negative
majority based on the composition of the diet consumed [36-38]. A majority of these studies
show that consuming high saturated fat diet for longer period results in higher gram negative
bacterial populations and high fiber diets results in gram positive bacterial populations. Even
though there are no known techniques available to identify which bacterial species the LPS
molecules originated from, it is believed that this endotoxemia is due to a raise in
Enterobacteriaceae [37, 39]. Laugerette et al. [6], reaffirmed this and showed that fatty acid
composition of different dietary oils can alter intestinal microbiota populations. Moreover,
these authors demonstrated that feeding a diet high in palm oil which is rich in SFAs
significantly increased the gram negative bacteria Escherichia coli groups, which can be
significant source of endotoxin in the cecal content of mice compared to milk fat, rape seed
and sunflower oil fed diets.
75
During intestinal stress, ischemia, inflammation and diseases, paracellular
permeability occurs through the tight junction, as known as “leaky gut” [40]. Alternatively,
transcellular or intracellular permeability can occur, particularly in healthy individuals [41].
Transcellular endotoxin transported across a cell membrane has been shown to occur via
TLR4 and soluble GPI anchored receptor CD14 in a lipid raft mediated mechanism [42, 43].
Additionally, chylomicron associated LPS permeability has also been suggested to play a key
role in intestinal LPS transport from the intestinal epithelial cell [11, 44, 45]. Importantly,
we observed no decrease in intestinal integrity which might enhance paracellular
permeability as assessed by transepithelial resistance or FITC-dextran permeability due to
treatment or short term raft destabilization (Figure 4B). These data suggest that under healthy
intestinal epithelial conditions, endotoxin is most likely transported via lipid raft mediated
endocytosis.
The signaling and transport process for endotoxin is initiated in specialized
membrane micro domains called lipid rafts [43]. Lipid rafts are membrane regions rich in
cholesterol, glycolipids, sphingolipids and saturated fatty acids, which result in a ‘rigid’
membrane structure compared to the adjacent ‘fluid’ regions [46]. In immune cells, LPS
triggers the recruitment of TLR4 into the lipid raft, where it interacts with CD14 and other
associated proteins such as MD-2 resulting in an inflammatory signaling cascade [47, 48].
Thus, the two major consequences of preventing endotoxin recognition by dissociating the
lipid raft to attenuate TLR4 recruitment include reduced inflammatory signaling and
attenuated LPS permeability. We observed that if intestinal lipid rafts are dissociated ex vivo
with MβCD, then endotoxin permeability is attenuated in the ileum (Figure 4). Interestingly,
saturated fat induced endotoxin permeability is also significantly reduced. Stimulation of
76
TLR4 receptor has been shown to result in the endotoxin permeability across the intestinal
epithelial cells [41]. TLR4 is not only implicated in the transcellular permeability of LPS but
also for live bacteria [49]. Since saturated fatty acids and n-3 PUFA can reciprocally
modulate TLR4 signaling [50], the fatty acid composition of oil in the diet has the potential
to increase or decrease endotoxin transport. Altogether, these data suggest that apical
endotoxin transport in the intestines is arguably raft mediated in healthy individuals.
In vitro experiments show clearly that n-3 PUFA disrupt TLR4 signalling and the
activation of NFκB by LPS in a murine monocytic cell line [51]. Moreover, DHA modulates
TLR4 signaling in vitro in RAW 264.7 macrophages and 293T cells [50], human monocytes
and dendritic cells [52] and adipose tissue. We have previously shown in pigs that dietary
EPA and DHA are effective means of influencing the inflammatory status and pathways
influenced by TLR4 signaling induced by LPS [53] and in altering intestinal function [24,
54]. Therefore, one could postulate that antagonizing TLR4 recruitment to lipid rafts and it’s
signaling by DHA and EPA, or stimulating these processes with saturated fatty acids, would
lead to increased endotoxin transport and circulating postprandial endotoxin.
Another mechanism through which LPS can enter the circulation is through micelles.
Since the LPS side chains are made up of fatty acids, LPS can be incorporated into the
micelles and transported into the intestinal epithelial cell [55]. In intestinal epithelial cells,
chylomicrons transport the absorbed lipids into various parts of the body. High fat
administration has been shown to proportionately increase the endotoxin content of the
chylomicron indicating that high fat consumption indeed enhances higher endotoxin
permeability into the intestinal epithelial cell and incorporation into chylomicron [11, 56].
Furthermore, even though the mechanism is not clear, high intake of fat has been shown to
77
cause internalization of tight junction proteins and increase in the paracellular permeability to
macro molecules including endotoxin [37]. Even though, this mode of endotoxin
permeability cannot be ruled out, we speculate that the rate of incorporation of fatty acids
into micelles would not vary due to oil composition. Therefore, we propose that the
difference in intestinal endotoxin permeability we observed is primarily transcellular
permeability that involves lipid rafts and receptor mediated endocytosis [43].
In conclusion, these data suggest that dietary oils can differentially alter intestinal
LPS permeability. Oils rich in DHA and EPA seem to attenuate LPS permeability, while oils
high in saturate fatty acids seem to augment LPS permeability. Furthermore, intestinal LPS
permeability in healthy subjects may be regulated through a lipid raft mediated mechanism.
Saturated fatty acids may be stabilizing the lipid rafts allowing for greater LPS permeability.
Even though a transient increase in the permeability level may not cause an immediate
significant physiological effect, this has been shown to result in transient increase in the pro-
inflammatory cytokines. Additionally, the biological relevance of the transient increase in
serum endotoxins and their associated impact on health need to be studied further.
Acknowledgements
This work was partially supported by funds acquired from the Iowa Pork Producers
Association and the Iowa State University Nutrition and Wellness Research Center. The
authors would like to thank Ms. Martha Jeffery and Yong Zhou for their assistance with the
animal and laboratory work presented in this project.
78
Author details
1Department of Animal Science, Iowa State University, Ames, IA 50011, USA.
2Interdepartmental Toxicology Graduate Program, Iowa State University, Ames, IA 50011,
USA. 3Department of Food Science and Human Nutrition, Iowa State University, Ames, IA
USA.
List of abbreviations used
CON: Control; VO: Vegetable oil; CLO: Cod liver oil; CO: Coconut oil; OO: Olive oil;
FITC: fluorescein isothiocyanate; TLR4: Toll like receptor 4; TER: Transepithelial
resistance; LPS: Lipopolysaccharide; FA: Fatty acids; PAMPs; Pattern associated molecular
patterns; PUFA: Polyunsaturated fatty acids; SFA: Saturated fatty acids; Papp: Apparent
permeability co-efficient; FAME: Fatty acid methyl esters; MβCD: Methyl-beta-cyclo
dextrin; rFC: Recombinant factor C; RFU: Relative fluorescent unit; DHA: Docosahexaenoic
acid; EPA: Eicosapentaenoic acid; IEC: Intestinal epithelial cell.
Competing Interests
The authors declare that they have no competing interests.
Author’s contributions
VM, JH and NKG designed and conducted research presented. NKG was the principle
investigator and the corresponding author and both NKG and JH obtained funding for this
work. VM was the graduate student supervised by NKG whom conducted most of the animal
79
and laboratory work and wrote the manuscript. JH and NKG supervised and revised the
manuscript. All authors read and approved the final manuscript.
References
1. Cani PD, Amar J, Iglesias MA, Poggi M, Knauf C, Bastelica D, Neyrinck AM, Fava F, Tuohy KM, Chabo C, et al: Metabolic endotoxemia initiates obesity and insulin resistance. Diabetes 2007, 56:1761-1772.
2. Laugerette F, Vors C, Geloen A, Chauvin MA, Soulage C, Lambert-Porcheron S, Peretti N, Alligier M, Burcelin R, Laville M, et al: Emulsified lipids increase endotoxemia: possible role in early postprandial low-grade inflammation. J Nutr Biochem 2011, 22:53-59. 3. Erridge C, Attina T, Spickett CM, Webb DJ: A high-fat meal induces low-grade endotoxemia: evidence of a novel mechanism of postprandial inflammation. Am J Clin Nutr 2007, 86:1286-1292. 4. Ghanim H, Abuaysheh S, Sia CL, Korzeniewski K, Chaudhuri A, Fernandez-Real JM, Dandona P: Increase in plasma endotoxin concentrations and the expression of toll-like receptors and suppressor of cytokine signaling-3 in mononuclear cells after a high-fat, high-carbohydrate meal. Diab Care 2009, 32:2281-2287.
5. Ghanim H, Sia CL, Upadhyay M, Korzeniewski K, Viswanathan P, Abuaysheh S, Mohanty P, Dandona P: Orange juice neutralizes the proinflammatory effect of a high-fat, high-carbohydrate meal and prevents endotoxin increase and Toll-like receptor expression. Amer J Clin Nutr 2010, 91:940-949. 6. Laugerette F, Furet JP, Debard C, Daira P, Loizon E, Geloen A, Soulage CO, Simonet C, Lefils-Lacourtablaise J, Bernoud-Hubac N, et al: Oil composition of high-fat diet affects metabolic inflammation differently in connection with endotoxin receptors in mice. Am J Physiol Endocrinol Metab 2012, 302:E374-386.
7. Berg RD: Bacterial translocation from the gastrointestinal tract. Trends Microbiol 1995, 3:149-154.
80
8. Copeland S, Warren HS, Lowry SF, Calvano SE, Remick D: Acute inflammatory response to endotoxin in mice and humans. Clini and Diagn Lab Immunol 2005, 12:60-67. 9. Fitzgerald KA, Rowe DC, Golenbock DT: Endotoxin recognition and signal transduction by the TLR4/MD2-complex. Microbes Infect 2004, 6:1361-1367. 10. Mani V, Weber TE, Baumgard LH, Gabler NK: Growth and development symposium: Endotoxin, inflammation, and intestinal function in livestock. J Anim Sci 2012, 90:1452-1465. 11. Ghoshal S, Witta J, Zhong J, de Villiers W, Eckhardt E: Chylomicrons promote intestinal absorption of lipopolysaccharides. J Lipid Res 2009, 50:90-97. 12. Hall DM, Buettner GR, Oberley LW, Xu L, Matthes RD, Gisolfi CV: Mechanisms of circulatory and intestinal barrier dysfunction during whole body hyperthermia. Am J Phy - Heart Circ Phy 2001, 280:H509-H521. 13. Cani PD, Delzenne NM: Gut Microbiota, Diet, Endotoxemia, and Diseases. Wiley-VCH Verlag GmbH & Co. KGaA; 2010. 14. Amar J, Burcelin R, Ruidavets JB, Cani PD, Fauvel J, Alessi MC, Chamontin B, Ferrieres J: Energy intake is associated with endotoxemia in apparently healthy men. Am J Clin Nutr 2008, 87:1219-1223. 15. Vaarala O, Atkinson MA, Neu J: The "perfect storm" for type 1 diabetes: the complex interplay between intestinal microbiota, gut permeability, and mucosal immunity. Diabetes 2008, 57:2555-2562. 16. Blaut M, Klaus S: Intestinal Microbiota and Obesity. In Appetite Control. Volume 209. Edited by Joost H-G: Springer Berlin Heidelberg; 2012: 251-273: Handbook of Experi Pharm].
17. Erridge C: Diet, commensals and the intestine as sources of pathogen-associated molecular patterns in atherosclerosis, type 2 diabetes and non-alcoholic fatty liver disease. Atherosclerosis 2011, 216:1-6. 18. Lee JY, Zhao L, Youn HS, Weatherill AR, Tapping R, Feng L, Lee WH, Fitzgerald KA, Hwang DH: Saturated fatty acid activates but polyunsaturated fatty acid inhibits
81
Toll-like receptor 2 dimerized with Toll-like receptor 6 or 1. J Biol Chem 2004, 279:16971-16979. 19. Kitchens RL, Ulevitch RJ, Munford RS: Lipopolysaccharide (LPS) partial structures inhibit responses to LPS in a human macrophage cell line without inhibiting LPS uptake by a CD14-mediated pathway. J Exp Med 1992, 176:485-494. 20. Munford RS, Hall CL: Detoxification of bacterial lipopolysaccharides (endotoxins) by a human neutrophil enzyme. Science 1986, 234:203-205. 21. Nutrition SoS, Nutrition CoA, Council NR: Nutrient Requirements of Swine: 10th Revised Edition. The National Academies Press; 1998. 22. Wang Q, Fang CH, Hasselgren P-O: Intestinal permeability is reduced and IL-10 levels are increased in septic IL-6 knockout mice. Am Journal Phy - Reg Integ Comp Phy 2001, 281:R1013-R1023. 23. Lepage G, Roy CC: Direct transesterification of all classes of lipids in a one-step reaction. J Lipid Res 1986, 27:114-120. 24. Gabler NK, Radcliffe JS, Spencer JD, Webel DM, Spurlock ME: Feeding long-chain n-3 polyunsaturated fatty acids during gestation increases intestinal glucose absorption potentially via the acute activation of AMPK. J Nutr Biochem 2009, 20:17-25. 25. Araki Y, Katoh T, Ogawa A, Bamba S, Andoh A, Koyama S, Fujiyama Y, Bamba T: Bile acid modulates transepithelial permeability via the generation of reactive oxygen species in the Caco-2 cell line. Free radic biol med 2005, 39:769-780. 26. Cordain L, Eaton SB, Sebastian A, Mann N, Lindeberg S, Watkins BA, O'Keefe JH, Brand-Miller J: Origins and evolution of the Western diet: health implications for the 21st century. Am J Clin Nutr 2005, 81:341-354. 27. Arterburn LM, Hall EB, Oken H: Distribution, interconversion, and dose response of n−3 fatty acids in humans. Amer J Clin Nutr 2006, 83:S1467-1476S. 28. Cani PD, Bibiloni R, Knauf C, Waget A, Neyrinck AM, Delzenne NM, Burcelin R: Changes in gut microbiota control metabolic endotoxemia-induced inflammation in high-fat diet-induced obesity and diabetes in mice. Diabetes 2008, 57:1470-1481.
82
29. Clemente-Postigo M, Queipo-Ortuno MI, Murri M, Boto-Ordonez M, Perez-Martinez P, Andres-Lacueva C, Cardona F, Tinahones FJ: Endotoxin increase after fat overload is related to postprandial hypertriglyceridemia in morbidly obese patients. J lipid res 2012, 53:973-978. 30. Pendyala S, Walker JM, Holt PR: A high-fat diet is associated with endotoxemia that originates from the gut. Gastroenterology 2012, 142:1100-1101 e1102. 31. Lang J, Blikslager A, Regina D, Eisemann J, Argenzio R: Synergistic effect of hydrochloric acid and bile acids on the pars esophageal mucosa of the porcine stomach. Am J Vet Res 1998, 59:1170-1176. 32. Blairon L, Wittebole X, Laterre PF: Lipopolysaccharide-binding protein serum levels in patients with severe sepsis due to gram-positive and fungal infections. J Infect Dis 2003, 187:287-291. 33. Berg RD: Bacterial translocation from the gastrointestinal tract. Adv Exp Med Biol 1999, 473:11-30. 34. Raetz CR, Whitfield C: Lipopolysaccharide endotoxins. Annu Rev Biochem 2002, 71:635-700. 35. Erridge C, Bennett-Guerrero E, Poxton IR: Structure and function of lipopolysaccharides. Microbes Infect 2002, 4:837-851. 36. Hildebrandt MA, Hoffmann C, Sherrill–Mix SA, Keilbaugh SA, Hamady M, Chen YY, Knight R, Ahima RS, Bushman F, Wu GD: High-fat diet determines the composition of the murine gut microbiome independently of obesity. Gastroenterology 2009, 137:1716-1724.e1712. 37. Cani PD, Bibiloni R, Knauf C, Waget A, Neyrinck AM, Delzenne NM, Burcelin R: Changes in gut microbiota control metabolic endotoxemia-induced inflammation in high-fat diet–induced obesity and diabetes in mice. Diabetes 2008, 57:1470-1481. 38. de La Serre CB, Ellis CL, Lee J, Hartman AL, Rutledge JC, Raybould HE: Propensity to high-fat diet-induced obesity in rats is associated with changes in the gut microbiota and gut inflammation. Am J Phy - Gastroint Liver Phy 2010, 299:G440-G448.
83
39. Venketeshwer Rao A, Shiwnarain N, Koo M, Jenkins DJA: Effect of fiber-rich foods on the composition of intestinal microflora. Nutr Res 1994, 14:523-535. 40. Balzan S, Quadros CdA, Cleva Rd, Zilberstein B, Cecconello I: Bacterial translocation: Overview of mechanisms and clinical impact. J Gastroenter Hepat 2007, 22:464-471. 41. Tomita M, Ohkubo R, Hayashi M: Lipopolysaccharide transport system across colonic epithelial cells in normal and infective rat. Drug Metab Pharmacokinet 2004, 19:33-40. 42. Poltorak A, He X, Smirnova I, Liu MY, Van Huffel C, Du X, Birdwell D, Alejos E, Silva M, Galanos C, et al: Defective LPS signaling in C3H/HeJ and C57BL/10ScCr mice: mutations in Tlr4 gene. Science 1998, 282:2085-2088. 43. Triantafilou M, Miyake K, Golenbock DT, Triantafilou K: Mediators of innate immune recognition of bacteria concentrate in lipid rafts and facilitate lipopolysaccharide-induced cell activation. J Cell Sci 2002, 115:2603-2611. 44. Grunfeld C, Feingold KR: Endotoxin in the gut and chylomicrons: translocation or transportation? J Lipid Res 2009, 50:1-2. 45. Laugerette F, Vors C, Peretti N, Michalski MC: Complex links between dietary lipids, endogenous endotoxins and metabolic inflammation. Biochimie 2011, 93:39-45. 46. Simons K, Toomre D: Lipid rafts and signal transduction. Nat Rev Mol Cell Biol 2000, 1:31-39. 47. Lien E, Means TK, Heine H, Yoshimura A, Kusumoto S, Fukase K, Fenton MJ, Oikawa M, Qureshi N, Monks B, et al: Toll-like receptor 4 imparts ligand-specific recognition of bacterial lipopolysaccharide. J of Clinil Investigat 2000, 105:497-504. 48. Lu Y-C, Yeh W-C, Ohashi PS: LPS/TLR4 signal transduction pathway. Cytokine 2008, 42:145-151. 49. Neal MD, Leaphart C, Levy R, Prince J, Billiar TR, Watkins S, Li J, Cetin S, Ford H, Schreiber A, Hackam DJ: Enterocyte TLR4 mediates phagocytosis and translocation of bacteria across the intestinal barrier. J Immunol 2006, 176:3070-3079.
84
50. Lee JY, Ye J, Gao Z, Youn HS, Lee WH, Zhao L, Sizemore N, Hwang DH: Reciprocal modulation of Toll-like receptor-4 signaling pathways involving MyD88 and phosphatidylinositol 3-kinase/AKT by saturated and polyunsaturated fatty acids. J Biol Chem 2003, 278:37041-37051. 51. Lee JY, Plakidas A, Lee WH, Heikkinen A, Chanmugam P, Bray G, Hwang DH: Differential modulation of Toll-like receptors by fatty acids: preferential inhibition by n-3 polyunsaturated fatty acids. J Lipid Res 2003, 44:479-486. 52. Weatherill AR, Lee JY, Zhao L, Lemay DG, Youn HS, Hwang DH: Saturated and polyunsaturated fatty acids reciprocally modulate dendritic cell functions mediated through TLR4. J Immunol 2005, 174:5390-5397. 53. Gabler NK, Spencer JD, Webel DM, Spurlock ME: n-3 PUFA attenuate lipopolysaccharide-induced down-regulation of toll-like receptor 4 expression in porcine adipose tissue but does not alter the expression of other immune modulators. J Nutr Biochem 2008, 19:8-15. 54. Gabler NK, Spencer JD, Webel DM, Spurlock ME: In utero and postnatal exposure to long chain (n-3) PUFA enhances intestinal glucose absorption and energy stores in weanling pigs. J Nutr 2007, 137:2351-2358. 55. Kelly CJ, Colgan SP, Frank DN: Of Microbes and Meals. Nutr Clinil Prac 2012, 27:215-225. 56. Clemente-Postigo M, Queipo-Ortuno MI, Murri M, Boto-Ordonez M, Perez-Martinez P, Andres-Lacueva C, Cardona F, Tinahones F: Endotoxin increase after fat overload is related to postprandial hypertriglyceridemia in morbidly obese patients. J Lipid Res 2012.
85
Figure 1. Dietary oil alters postprandial serum endotoxin concentrations in pigs fed a single
dietary oil-based meal. A) Delta change in serum endotoxin concentrations. B) Mean
postprandial serum endotoxin concentration. Different letters (a,b) represent significant
difference at P<0.05. Treatments are a porridge meal made with either no oil (saline), fish oil
(FO), vegetable oil (VO) and coconut oil (CO). n=6 pigs/treatment. Data are means ± S.E.M.
-0.8-0.6-0.4-0.20.00.20.40.60.81.01.21.4
0 1 2 3 4 5
Del
ta E
ndot
oxin
(EU
/mL
)
Hours
COVOFOSaline
b
aa
a
b
aba
a
0.0
2.0
4.0
6.0
8.0
10.0
12.0
Saline VO FO CO
Ser
um E
ndot
oxin
(E
U/m
l) b
ab
a a
a)
b)
b
a
86
Figure 2. The effect of increasing porcine bile acid concentration on ex vivo intestinal
integrity and permeability. A) Transepithelial resistance (TER) and B) FITC-Dextran
transport (4.4 kDa). Freshly isolated ileum samples were mounted into modified Ussing
chambers and incubated with the indicated concentration of bile acid for 30 minutes and then
FITC-Dextran was added to mucosal side. Permeation coefficient was calculated by taking
samples from chambers every 10-15 minutes and measuring the amount of fluorescence.
Different letters represent significant difference at P < 0.05. n = 11 pigs. Data are means ±
S.E.M.
0
50
100
150
200
0 1 3 6
Tra
nsep
ithe
lial
R
esis
tanc
e (Ω
.cm
2 )
Bile acid (mg/ml)
0.0
0.5
1.0
1.5
2.0
2.5
3.0
0 1 3 6
Dex
tran
Per
mea
tion
C
oeff
icie
nt (
Pap
p)
Bile acid (mg/ml)
A
B
87
Figure 3. Ex vivo endotoxin transport in pig ileum tissue exposed to different dietary oil
treatments. Freshly isolated ileum samples were mounted into modified Ussing chambers and
mixed with the indicated oils and 20mM bile acid for 120 minutes and FITC-LPS transport
was measured. Different letters represent significant difference at P < 0.05. n = 11 per
treatment. Data are means ± S.E.M.
0
1
2
3
4
5
6
7
8
9
Saline Coconutoil
Cod liveroil
Fish oil Vegetableoil
Olive oil
End
otox
in P
erm
eati
on C
oeff
icie
nt (
Pap
p)
a
b
c c
ac
ac
88
Figure 4. Lipid raft modifier methyl beta cyclodextrin (MβCD) decreases ex vivo endotoxin
transport. A) Endotoxin transport and B) transepithelial resistance was measured using
Ussing chambers in ileum tissues treated with either control (water), MβCD, coconut oil, or
coconut oil plus MβCD. Tissue (n= 7 /trt) were pretreated with these treatments for 30 min
before FITC-LPS transport was assessed. Different letters represent significant difference at
P < 0.05. Data are means ± S.E.M.
0.00.51.01.52.02.53.03.54.0
Saline Saline + MβCD
Coconut oil Coconut oil + MβCD
End
otox
in P
erm
eati
on
Coe
ffic
ient
(P
app)
b
a
c
ab
0.0
20.0
40.0
60.0
80.0
100.0
120.0
140.0
Saline Saline + MβCD
Coconut oil Coconut oil + MβCD
Tra
nsep
ithe
lial
Res
ista
nce
(Ω.c
m2 )
B
A
89
Table 1. Dietary oil fatty acid composition used to make the porridge (g/100g FA)
Oil Source Compound Coconut oil1 Fish oil2 Olive oil3 Vegetable oil4 Cod liver oil5 8:0 8.22 0.00 0.01 0.00 0.00 10:0 6.98 0.00 0.00 0.00 0.00 12:0 36.51 0.00 0.05 0.03 0.00 14:0 21.00 6.87 0.32 0.09 4.62 16:0 11.87 14.78 25.74 12.84 32.24 16:1 0.02 8.40 1.67 0.10 4.19 18:0 3.61 2.99 2.60 5.67 4.02 18:1 8.74 8.51 55.69 25.89 12.65 18:2 n6 1.93 0.92 12.66 47.19 25.28 18:3 n3 0.00 0.40 0.54 6.92 4.05 20:5 n3 0.00 19.19 0.00 0.00 8.68 22:6 n3 0.00 34.57 0.00 0.00 4.27 Other 1.11 3.38 0.71 1.26 0.00 Saturated 88.96 24.63 29.20 19.70 40.88 n3 0.00 54.17 0.54 6.92 17.00 n6 1.93 1.99 12.66 47.19 25.28 n6:n3 0.00 0.04 23.37 6.82 1.49
1Source coconut oil was (Spectrum Naturals, NY) 2Source fish oil was (Spring Valley, UT)
3Source olive oil was (Hy-Vee, IA) 4Source vegetable oil was (Hy-Vee, IA) 5Source cod liver oil was (Spring Valley, UT)
90
CHAPTER 4: DIETARY N-3 FATTY ACIDS REDUCE INTESTINAL
LIPOPOLYSACCHARIDE PERMEABILITY AND ALTER MEMBRANE RAFT
LIPID COMPOSITION AND FUNCTION
A manuscript prepared for submission to Journal of Lipid Research
V. Mani,*,†
*Department of Animal Science, †Interdepartmental Toxicology Graduate Program, Iowa
State University, Ames, IA.
Abstract
Fish oil and its n-3 polyunsaturated fatty acids (PUFA), particularly docosahexaenoic
acid (DHA) and eicosapentaenoic acid (EPA), have been shown to antagonize
lipopolysaccharide (LPS) or endotoxin signaling and alter membrane lipid raft size and
order in immune cells. Therefore, we hypothesized that enrichment of intestinal epithelial
membrane phospholipids with DHA and EPA would alter membrane composition and
function. This enrichment would also reduce intestinal lipid raft mediated LPS permeability
and signaling. Further, we also hypothesized that in the presence of a peak inflammatory
challenge, intestinal LPS permeability and signaling would be dramatically altered due to
desensitization of Toll like receptor 4 (TLR4) recruitment into lipid rafts. Twenty pigs
(22±2.4 kg) were fed two diets: 1) control (CON); 2) CON plus 0.5% Gromega™ (Dn3, JBS
91
United Inc.), high in DHA and EPA n-3 PUFA. After eight weeks, CON and Dn3 pigs were
challenged (n=5 pigs/trt) with either an intramuscular injection of Escherichia coli LPS
(LPS; 10 µg/kg BW) or saline (SAL). Four hours after LPS or SAL, pigs were euthanized
and ileum and colon segments mounted into Ussing chambers to measure ex vivo FITC-LPS
apparent permeability coefficient (Papp) as a marker of LPS permeability. Ileum and colon
mucosa were assessed for n-3 FA enrichment, lipid raft isolated and membrane localization
of TLR4 determined. Compared to the CON, pigs fed Dn3 had increased ileum and colon
EPA, DHA and total n-3 PUFA content (P<0.05; 200, 250, 300%, respectively). Overall,
ileum LPS permeability did not differ due to FA or LPS treatments. However, Dn3-SAL
treated pigs tended to have decreased LPS permeability by 37% compared to the CON-SAL
pigs (P=0.06). Pigs challenged with LPS had attenuated colon LPS permeability (P=0.02).
Pigs fed Dn3 also had reduced colon LPS permeability compared to the CON (P=0.03; 2.0
vs. 7.4 Papp, respectively). Compared to CON-SAL pigs, ileum and colon TLR4 recruitment
into lipid raft micro domains was decreased in the Dn3-SAL pigs. However, LPS reduced
ileum lipid raft TLR4 protein in CON, but not in Dn3 fed pigs. Localization of TLR4 into
lipid raft did not differ in the colon of CON-LPS and Dn3-LPS groups. These data indicate
that DHA and EPA decrease TLR4 recruitment into intestinal lipid raft. This may explain
how n-3 PUFA attenuate receptor mediated LPS permeability and febrile response.
Furthermore, reduced lipid raft localization of TLR4 post LPS challenge, may describe an
LPS tolerance mechanism.
Supplementary key words: Lipopolysaccharide • Endotoxin • Intestine • Lipid raft • n-3
polyunsaturated fatty acids • Pigs
92
Introduction
Lipopolysaccharide (LPS) and endotoxemia is associated with the prevalence and
incidence of inflammation, sepsis, Alzheimer’s disease atherosclerosis and metabolic
dysfunctions (1-3). Even though LPS is also synonymously known as endotoxin in the
scientific literature, there are biochemical and physiological differences between these two
compounds. Therefore, for scientific clarity we will refer to LPS in this chapter.
Lipopolysaccharide is an integral component of the gram negative bacterial cell wall outer
membrane. Importantly, gram negative bacteria particularly that found in the distal small
intestine, cecum and colon, can be major sources of circulating Lipopolysaccharide (4).
However, the intestinal epithelium provides a physical barrier that separates luminal bacteria
and other inflammatory molecules from entering the systemic circulation. This is critical, as
it has been estimated that a single cell of Escherichia coli contains approximately 106 LPS
molecules (5).
Lipopolysaccharide is recognized by numerous cell types including immune cells,
myocytes, adipocytes and intestinal epithelial cells (IEC), to produce pro-inflammatory
cytokines that contribute to the efficient control of invading molecule. Structurally, LPS
consists of an O-polysaccharide, core polysaccharide and a Lipid A region which possess the
most biological endotoxic activity. Its recognition and signaling is mediated via TLR4, a key
membrane pattern recognition receptor that in association with LPS-binding protein (LBP),
CD14 and MD2, results in the transmission of the signal into the cell to initiate the
inflammatory signaling cascade (6). Moreover, recent work has revealed that for this signal
to occur TLR4 protein is recruited in membrane microdomains called lipid rafts following
93
stimulation by LPS and that subsequent lipid raft integrity is crucial for LPS-induced cellular
activation (7).
Lipid rafts are membrane regions rich in cholesterol, glycolipids, sphingolipids and
saturated fatty acids (SFA), which result in a ‘rigid’ membrane structure compared to the
adjacent ‘fluid’ regions (8). However, these dynamic assemblies of cholesterol and
sphingolipids are not only important in signal transduction and partitioning of receptors into
raft regions, but also bacterial invasion (9). Interestingly, recent work in T cell and B cell
models has demonstrated dietary fatty acids to alter lipid raft structure and function.
Moreover, when n-3 polyunsaturated fatty acids (PUFA) such as docosahexaenoic acid
(DHA) and eicosapentaenoic acid (EPA) are packed into raft microdomains, changes in the
molecular composition and order of lipid rafts may occur (10-12). Consequently, these
disordered-dissociated raft environments due to n-3 PUFAs alter protein clustering and
cellular function and may explain the immuno-suppressive and anti-inflammatory benefits of
n-3 PUFA.
Therefore, in the present study we hypothesized that enrichment of intestinal epithelial
membrane phospholipids with DHA and EPA would alter membrane composition and
function. This enrichment would reduce intestinal lipid raft mediated LPS permeability and
signaling. Further, in the presence of a peak immune challenge, intestinal LPS permeability
and signaling would be dramatically altered due to desensitization of TLR4 recruitment to
lipid rafts.
94
Materials and Methods
Materials. All the chemicals used for the experiment were purchased from Sigma-Aldrich
(St. Louis, MO) unless otherwise stated. The dietary source of n-3 PUFA, Gromega™ (JBS
United Inc., Sheridan, IN) contained 14% DHA and 14% EPA of total fat. Anti-TLR4, anti-
CD14 and anti-galectin4 and their respective secondary antibodies were obtained from Santa
Cruz Biotechnologies (Santa Cruz, CA).
Animals and Experimental Design. All animal procedures were approved by the Iowa State
University Institutional Animal Care and Use Committee and adhered to the ethical and
humane use of animals for research. Twenty pigs (22 ± 2.4 kg BW) were individually
penned and fed one of two diets for eight weeks. Ten pigs were fed a standard corn-soybean
control diet (CON) and ten pigs were fed the basal diet supplemented with 0.5 % Gromega™
(Dn3, JBS United Inc., Sheridan, IN), which was high in DHA and EPA (Table 1).
Gromega™ was mixed in the basal diet in substitution to corn. Both diets were formulated to
meet or exceed the swine nutrient requirements (13). Pigs were fed ad libitum and had free
access to water all the time. After 8 weeks of tissue n-3 PUFA enrichment, both the CON and
Dn3 groups were fasted overnight, equally sub-divided (n=5/trt) and challenged with either
an intramuscular injection of saline (SAL) or lipopolysaccharide (LPS, from Escherichia coli
serotype 055:B5, 10 µg/kg BW, Sigma, St. Louis, MO). Following the peak febrile response,
as measured by rectal temperature, blood was collected for measuring serum endotoxin
concentrations and other inflammatory parameters. Blood was collected by venipuncture in
pyrogen-free vaccutainer tubes using a sterile needle. Proper precautionary measures were
taken to prevent external contamination of blood. Pigs were euthanized via captive bolt and
95
immediate exsanguination. Immediately following euthanasia, fresh segments of ileum and
colon were collected for intestinal function assays. A 20 cm segment of ileum 120 cm from
the ileal-cecal junction and a 10 cm segment of proximal colon 60 cm from the rectum were
isolated. Serosal stripped segments and mucosal scrapings were collected from both the
ileum and colon, snap frozen in liquid nitrogen and stored at -80 oC until further analysis. All
fresh and frozen segments of ileum and colon were flushed with ice cold Krebs buffer to
remove any undigested food material before freezing as well as before mucosal scrapings
collection.
Intestinal Function and Permeability. Fresh segments of the ileum and colon were removed
and placed in chilled Krebs-Henseleit buffer (consisting of, in mmol/L: NaHCO3, 120 NaCl,
1 MgSO4, 6.3 KCl, 2 CaCl, 0.32 NaH2PO4; pH 7.4) for transport to the laboratory while
under constant aeration until clamped in the modified Ussing chambers. Tissues stripped of
outer serosal layers were immediately mounted in a modified Ussing Chamber. Each
segment (0.71 cm2) was bathed on its mucosal and serosal sides with Krebs buffer and
constantly gassed with 95% O2-5% CO2 mixture and the temperature was maintained at 37°C
by circulating water. Each chamber was connected to a pair of dual channel current and
voltage electrodes submerged in 3% noble agar bridges and filled with 3M potassium
chloride for electrical conductance (Physiologic Instruments Inc., San Diego, CA and World
Precision Instruments Inc. Sarasota, FL) to measure tight junction integrity and the mucosal
to serosal permeability. A short circuit current was established and stabilized for about 10
minutes and basal measurements like potential difference (PD), resistance (R), short circuit
current (ISC) were taken using the included software (Acquire and Analyze, Physiological
96
instruments). The measurements were observed in a computer monitor in real-time as line
graphs and tissue responses were monitored continuously. Resistance of the tissue was
determined by passing a current of 100 µA across the tissue using the electrodes and
correcting for the PD deflection for fluid resistance. The current required to nullify the PD
present on the tissue is termed ISC and it is a measure of net active ion transport in the
intestinal tissue. The ISC of the intestinal tissue was calculated from simultaneous PD and R
measurements by using ohm’s law, I = V/R, where I is the current in amperes, V is the
electromotive force in volts, and R is the resistance in ohms.
Additionally, the mucosal to serosal permeability of LPS was assessed as previously
described by Tomita et al (14). Briefly, the mucosal chambers were challenged with 20
µg/mL fluorescein isothiocyanate labeled LPS (FITC-LPS) and chamber samples from both
sides were collected every 10-15 min. The relative fluorescence was then determined using a
fluorescent plate reader (BioTek, Winooski, VT) with the excitation and emission
wavelengths of 485 and 520 nm, respectively. An apparent permeability coefficient (Papp)
was then calculated (14) using the area of the membrane and rate of FITC-LPS permeability,
where dQ/dt = transport rate (µg/min); C0 = initial concentration in the donor chamber
(µg/mL); A = area of the membrane (cm2):
Papp = dQ/(dt×A×C0)
Serum Endotoxin Assay. Serum LPS concentration was measured by an end point fluorescent
assay using the recombinant factor C (rFC) system (LonzaTM, Basel, Switzerland). Briefly,
the serum samples were diluted 1,000 times and 100 µL of the samples and standards were
added to a 96 well round bottom plate and incubated at 37 °C for 10 min. After incubation,
97
100 µL of rFC enzyme, rFC assay buffer and rFC substrate were added at a ratio of 1:4:5 to
the plate and an initial reading were taken followed by 1 h incubation at 37 °C. Thereafter the
relative fluorescence unit (RFU) for each well was determined (excitation 380 nm and
emission 440 nm). A positive control from the assay kit was used to ascertain the validity of
the assay and the concentration of the endotoxin was interpolated from the standard curve
constructed from the standards and corrected for sample dilution.
Subcellular Fractionation of the Intestinal Epithelium. Apical membranes were isolated from
fresh mucosal scrapings based on divalent cation precipitation method as previously
described (15, 16). All the procedures were performed on ice unless otherwise stated. Briefly,
the mucosal scrapings were homogenized (1:10 w/v) in a homogenization buffer (containing
2 mM Tris-HCL and 50 mM mannitol, pH 7.1 and protease inhibitor cocktail (Complete,
Roche, IN)) using a mechanical homogenizer. The resulting homogenate was centrifuged at
500 x g for 10 min to remove all the unbroken cells and nuclear debris. The resulting
supernatant was then further centrifuged at 2,700 x g for 10 min to sediment the
mitochondria. The supernatant was then adjudged with 10 mM MgCl2, incubated on ice for
10 min and centrifuged at 1,150 x g. The supernatant was then further centrifuged at 48,000 x
g for 60 min. The resulting pellet was saved and contained the apical membranes. Purity of
the apical membrane preparation was ascertained by measuring the alkaline phosphatase
activity using quantichrom™ alkaline phosphatase assay kit (DALP-250, Gentaur,
Kampenhout, Belgium) according to the manufacturer’s instructions.
98
Lipid Raft Isolation. Lipid raft fractions from the pig intestinal membranes were obtained
according to the method described by Danielsen et al (17) and Nguyen et al (18). Briefly, 1-
2 mg/mL of apical membrane protein were dissolved in a Hepes/NaCl buffer (pH 7.1, 25 mM
and 150 mM, respectively) containing 1% triton-100 for 10 min on ice. The extracts were
then laid on top of equal volume of 80% sucrose with in an ultracentrifuge tube resulting in a
final concentration of 40% sucrose. This preparation was layered on top with 30% and 5%
sucrose with a volume of 4.3 mL and 1.75 mL respectively. This was centrifuged at 217,000
x g for 20 h at 4 °C and 12 fractions were collected per tube. Each fraction was 800 µL
starting with fraction one at the top and twelve at the bottom. The protein concentration of
each lipid raft fraction was determined using BCA assay (Pierce, Rockford, IL). Lipid raft
fractions were confirmed by cholesterol enrichment and the presence of the intestinal lipid
raft marker protein galectin 4. Cholesterol content of the lipid raft fractions were measured
using a Cholesterol Assay Kit (Molecular Probes, Eugene, OR) according to the
manufacturer’s instructions.
Protein Expression. Lipid raft protein marker galectin 4 and proteins of interest, TLR4 and
CD14, were measured by dot blot method. Briefly, 10-20 µg protein of the lipid raft fractions
were applied directly on a nitrocellulose membrane by vacuum and then blocked with 5%
non-fat dry milk. The primary antibody was added at a concentration according to the
manufacturer’s instruction and incubated overnight. The secondary antibody was added at a
concentration of 1:10,000 to 1:20,000. Blots were developed by a chemiluminescence
detection kit according to the protocol supplied by the manufacturer (Pierce, Rockford, IL).
99
Phospholipid fatty acid composition. Total lipids from lipid raft and non-raft regions of the
membrane fractions were extracted by the method of Folch et al (19). Individual
phospholipids were separated by one dimensional thin layer chromatography as described by
Chapkin et al (10) using silica gel 60 G plates. Developing solvent used was
Chloroform/methanol/acetic acid/water (50:37.5:3.5:2, v/v). Individual phospholipids were
scraped from TLC plate and spiked with 125 µg/L of heptadecanoic acid (17:0) as an internal
standard. Trans-esterification was carried out using 6% methanolic-HCl for 16-18 h while
heating at 75 oC. The resulting FAME were then analyzed using gas chromatography by the
method described below.
Fatty acid profiles. Intestinal fatty acid profiles were determined according to Lepage and
Roy (20) and analyzed by GC-MS. Briefly, 0.5 g of tissue was homogenized in 2.5 ml of 4:1
Hexane and 125 µg/L of heptadecanoic acid/L methanol was added to each sample as an
internal standard. FAME were analyzed by GC on a Hewlett-Packard model 6890 fitted with
a Omegawax 320 (30-m × 0.32-mm i.d, 0.25 µm) capillary column (Sigma-Aldrich, St Louis,
USA). Hydrogen was the carrier gas. The temperature program ranged from 80 to 250°C
with a temperature rise of 5°C/min. The injector and detector temperatures were 250°C and 1
µL of sample was injected and run splitless. Fatty acids methyl esters were identified by
their retention times on the column with respect to appropriate standards.
Statistical Analysis. All data are expressed as means ± SEM. The main effects of dietary
treatment, challenge and their interaction were determined by the Proc Mixed procedure in
100
SAS (Cary, NC), and differences were established using the least significant difference.
Differences were deemed significant at P < 0.05 and tendency at P < 0.10.
Results
EPA and DHA supplementation leads to enrichment of the intestine. Pigs were fed a
regular corn-soybean meal diet (CON, n=10) or a diet supplemented with 0.5% EPA and
DHA (Dn3, n=10) for eight weeks from weaning. Although not the objective of this study,
no differences in feed intake or body weight gains were observed between the two treatments
(data not shown). Both ileum and colon mucosal scrapings fatty acid profiles were analyzed
to ascertain the EPA and DHA enrichment of the intestinal epithelial tissue (Table 2). As
expected, the Dn3 group had a significantly higher EPA and DHA in both ileum and colon
than the CON group indicating that the intestinal epithelium was enriched with n-3 PUFA’s
(Table 2). Interestingly, we saw a corresponding decrease in the n-6 fatty acid, arachidonic
acid (AA) in ileum, as well as colon. The n6:n3 PUFA ratio was also reduced in the Dn3
treatment. The 4 h LPS challenge did not affect the fatty acid composition of the tissues (data
not shown).
Dietary n-3 PUFA reduces serum LPS concentration. Circulating LPS concentrations
were measured in serum to assess whether dietary EPA and DHA could attenuate blood
endotoxemia. Compared to the CON group, serum LPS concentrations were significantly
lower in the Dn3 pigs (P<0.05, Fig. 1). This indicates that long term dietary n-3 PUFA
supplementation can modulate endogenous blood endotoxin concentrations.
101
Anti-inflammatory effect of EPA and DHA supplementation. CON and Dn3 pigs were
subdivided into two groups (n=5) and challenged with either an intramuscular injection of
saline or lipopolysaccharide to study the effect of dietary n-3 PUFA on an inflammatory
challenge. A gross assessment of this inflammatory challenge was indicated by the changes
in the pig’s febrile response to SAL or LPS (Figure 2). Irrespective of diet, LPS challenged
pigs had higher rectal temperatures than SAL group (P<0.001). After 1 h, both the LPS
challenged groups had significantly higher rectal temperatures compared to the SAL groups.
However, the Dn3 pigs had an attenuated febrile response to LPS compared to the CON-LPS
pigs (P=0.011). Interestingly, Dn3 challenged group had a numerically lower febrile response
at two hours which became significantly lower than the CON challenged group by 4 hour
(P<0.05).
Ileum integrity increases under EPA and DHA supplementation. Transepithelial
electrical resistance (TER) is a measure of intestinal permeability and integrity. Higher TER
values indicate a healthy, less macromolecular permeable intestine with well-formed tight
junctions. TER was measured in the ileum of CON and Dn3 pigs before the FITC-LPS
permeability. Dn3-SAL group had a higher TER than any other treatment groups indicating
supplementation with EPA and DHA improves the health of the intestine. Interestingly, LPS
challenge did not change the TER integrity in the CON-LPS, but lowered the TER in the
Dn3-LPS group (Fig. 3). This indicates that n-3 PUFA helps in maintaining a healthy
intestine under normal circumstances, but not under a systemic immune challenge.
102
We hypothesized that EPA and DHA enrichment of the intestinal epithelium would
mitigate mucosal to serosal permeability of LPS from the intestinal lumen. To test this
hypothesis, we used the Ussing chamber model to study the ex-vivo permeability of FITC-
LPS in the ileum and colon tissues. In ileum, the Dn3-SAL group tended to have a lower ex-
vivo LPS permeability compared to the CON-SAL group (4.7 vs. 1.8). Furthermore, LPS
challenges tended to reduce the LPS permeability compared to the CON-SAL (P < 0.10).
However, colon LPS permeability (Fig. 4B) in the CON-SAL pigs were higher than the Dn3-
SAL pigs (11.4 vs. 3.3, P=0.02). Irrespective of diet, LPS challenge lowered LPS
permeability compared to SAL challenged pigs in colon. However, colon LPS permeability
did not differ between the CON-LPS and Dn3-LPS pigs (P>0.05).
EPA and DHA enrichment alters the fatty acid composition of ileum and colon lipid
rafts. The fatty acid composition of phospholipids in the lipid raft fractions from the ileum
(Fig. 5) and colon (Fig. 6) which were separated using thin layer chromatography was
analyzed by GC-MS. Lipopolysaccharide challenge did not affect the phospholipid
composition in the raft and non-raft fractions and therefore only the CON and Dn3 treatment
is shown. The sphingomyelin raft fractions were rich in the n-6 fatty acid, arachidonic acid
(AA). The CON raft fractions were numerically higher in AA compared to other Dn3 raft and
CON and Dn3 diet non-raft fractions. In the colon, again sphingomyelin AA content was
higher in the CON raft fraction versus the Dn3 lipid raft, CON and Dn3 non-raft fractions.
Interestingly, EPA and DHA were not detected in the sphingomyelin irrespective of dietary
treatment (Fig. 5A and 6A).
103
Phosphatidyl serine had a better distribution of fatty acids across the fractions. AA
was approximately three-fold higher in the CON raft and non-raft fractions of ileum, and
two-fold higher in CON lipid raft colon fraction compared to Dn3 counterparts. EPA was
detectable across all fractions. In ileum, Dn3 non-raft fraction was ten-fold higher in EPA
than CON. In colon, Dn3 raft and non-raft fractions were eight- and eighteen-fold higher than
their respective raft and non-raft fractions. DHA concentration, in ileum and colon, was four-
fold higher in the Dn3 raft fraction compared to the CON raft. In the non-raft fractions, DHA
was 1.5-fold higher in ileum compared to 3-fold higher in colon (Fig. 5B and 6B).
Phosphatidyl ethanolamine had a more even distribution of EPA, and DHA, as well
as AA between the raft and non-raft fractions (Fig. 5C and 6C). Ileum AA concentration was
1.8-fold higher in CON non-raft fraction compared to raft. Colon concentration of AA was
approximately three- and two-fold higher in both CON raft and non-raft fractions,
respectively, compared to Dn3 fractions. EPA was undetectable in CON raft from ileum and
in the colon, higher EPA was present in CON non-raft ileum, while only trace amounts were
present in CON non-raft colon. Both ileum and colon Dn3 raft and non-raft fractions were
enriched with EPA and DHA. DHA was detectable in all the fractions and DHA
concentration was four-to six-fold higher in the Dn3 raft fractions compared to the CON.
Phosphatidyl inositol (Fig. 5D and 6D) had a higher AA in non-raft fractions of both
ileum and colon and there was a corresponding decrease in the AA concentration in the Dn3
fractions. EPA was not present in any of the lipid raft fractions. EPA concentration was six-
fold higher in the Dn3 non-raft group in ileum, whereas present in equal concentration in
colon non-raft fractions. DHA was not present in any of the lipid raft groups except colon
104
Dn3. In the non-raft groups, DHA concentration was ten-fold higher in Dn3 than CON in
ileum, and five-fold higher in colon (Figure 5D and 6D).
Phosphatidyl choline non-raft fractions were enriched with AA in both ileum and
colon, and raft fractions contained only low quantities of AA (Fig. 5E and 6E). Surprisingly,
we couldn’t detect EPA and DHA in raft fractions of both ileum and colon. EPA was rich in
non-raft fractions of Dn3 ileum and CON and Dn3 colon. DHA was three-fold higher in both
non-raft fractions of ileum and colon compared to CON (Fig. 5E and 6E).
Dietary n-3 PUFA and LPS challenge alter TLR4 and CD14 localization in the
intestinal epithelium lipid rafts. To pursue the mechanistic aspect of the difference in the
LPS between the CON and Dn3 enriched pigs, lipid rafts were isolated from the apical
membrane of ileum (Fig. 7) and colon (Fig. 8) mucosal scrapings. Purity of the membrane
preparation from contamination by immune cells was ascertained by measuring the alkaline
phosphatase levels in both ileum and colon apical membranes (Supplemental figure 1and 2).
Lipid raft and lipid insoluble (non-raft) fractions were identified by the presence of intestinal
lipid raft marker protein galectin 4 and cholesterol. In our system and based on galectin 4 and
cholesterol content, the raft fractions were identified as fractions 2-7, compared to the non-
raft fractions 1 and 8-12. Irrespective of location, treatment with n-3 PUFA decreased TLR4
protein levels in the rafts of pig ileum (Fig. 7) and colon (Fig. 8) fractions. Interestingly, the
colon tissues had higher TLR4 expression than the ileum. However, exposure to LPS for four
hours reduced TLR4 protein expression in the CON lipid raft fractions, but not the Dn3
fractions. CD14 protein was found predominantly in the lipid raft fractions in both the ileum
105
(Fig. 7) and colon (Fig. 8). Similarly, LPS challenge also attenuated CD14 expression in
these fractions.
Modifications of lipid rafts reduce intestinal LPS permeability. Lipid rafts have been
shown to be essential for TLR4 recruitment and LPS signaling as well as permeability in
immune cells (21, 22). Therefore, we wanted to further test the role of lipid rafts in ileum and
colon LPS permeability. To do this, freshly isolated ileum and colon segments were treated
on their mucosal side with the lipid raft modifier methyl-β-cyclodextrin (MβCD; 25 mM).
Methyl-β-cyclodextrin is a carbohydrate molecule with a pocket for binding cholesterol and
its mode of action depletes cholesterol from the lipid raft microdomain to dissociate rafts (9).
We hypothesized that by increasing raft dissociation and reducing TLR4 recruitment into the
lipid raft microdomain, intestinal transcellular LPS permeability would be attenuated. Thus,
we have shown that incubation with MβCD significantly reduced the FITC-LPS permeability
in both ileum and colon (Fig. 9). Interestingly, the effect was more pronounced in the colon
compared to the ileum. This is indirect evidence that lipid raft play a significant role in
intestinal LPS permeability.
Discussion
The health benefits of long chain n-3 PUFA such as those found in fish oil and algae,
DHA and EPA, have been widely touted (23, 24). However, the biological impact of DHA
and EPA enrichment into intestinal cell membranes and on LPS permeability and signaling
has not been well established. We hypothesized that enrichment of intestinal epithelial
106
membrane phospholipids with DHA and EPA would alter membrane composition and
function. Furthermore, this n-3 PUFA enrichment would reduce intestinal lipid raft mediated
LPS permeability and signaling.
We have previously shown that dietary EPA and DHA are effective in influencing the
inflammatory status and those pathways influenced by TLR4 signaling (25). Moreover, this
is further supported by the high consumption of EPA and DHA, 7.6 g/d, which inhibited
TLR4 and NOD2 signaling pathways and improved intestinal integrity under inflammatory
conditions in pigs (26). Although not the main objective of the current study, the Dn3 pigs
had a reduced LPS induced febrile and cytokine response to LPS compared to the CON pigs.
Altogether, these data supports work that has shown n-3 PUFA to modulate the immune
response and to be immuno-suppressive and anti-inflammatory (27, 28).
Interestingly, the signaling process for LPS is initiated in specialized membrane
micro domains called lipid rafts (7). Lipid rafts are membrane regions rich in cholesterol,
glycolipids, sphingolipids and saturated fatty acids, which result in a ‘rigid’ membrane
structure compared to the adjacent ‘fluid’ regions (8). In immune cells, LPS triggers the
recruitment of TLR4 into the lipid raft where it interacts with CD14 and other associated
proteins such as MD-2 resulting in an inflammatory signaling cascade (29, 30). Thus,
preventing LPS recognition by dissociating the lipid raft to attenuate TLR4 recruitment may
have two major consequences. Firstly, reduced inflammatory signaling and secondly,
attenuated LPS permeability.
Enrichment of the membrane phospholipids with n-3 PUFA have been shown to alter
membrane composition and function (26, 31, 32). This is in agreement with our current work
in which dietary n-3 PUFA in the Dn3 pigs increased intestinal membrane DHA and EPA
107
contents compared to the CON pigs. Importantly, n-3 PUFA enrichment results in the
dissociation of lipid rafts in T-cells (10, 11) and decreases the recruitment of TLR4 to the raft
region in macrophages (28). n-3 PUFA enrichment of phosphatidyl ethanolamine and
phoshphatidyl serine has been shown to dissociate the lipid rafts in T-cells (10). We also
observed a similar result in our study. Therefore, lipid rafts may be a major target of DHA
and EPA that lead to the down regulation of TLR4 signaling (33). Although TLR4
recruitment into the lipid rafts has been poorly characterized, we have demonstrated that this
does also occur in the pig intestinal epithelium and that DHA and EPA enrichment attenuates
TLR4 protein recruitment into raft microdomains. Changes in raft lipid composition by DHA
and EPA affect both the size and order of rafts (21) and cellular function (9, 34, 35).
The permeability of gastrointestinal tract LPS has been shown to be modified by high
dietary fat and caloric intake in humans and animals (36-38). Mechanistically, both bacteria
and LPS intestinal permeability can occur via either a paracellular pathway through tight
junction openings or transcellular pathways. Paracellular permeability is often associated
with intestinal stress and hypoxia that modifies tight junction complexes and intestinal
integrity (39). However, transcellular mediated LPS or bacterial permeability may also be
independent to that of paracellular or tight junction facilitated permeability. Bacteria and LPS
permeability across the intestinal epithelium has been shown to be mediated by TLR4 present
in the IEC (14, 40). Additionally, lipids rafts have been found to be important in transcellular
permeability of LPS and bacteria including E. coli, Salmonella, Listeria and Mycoplasma
(41, 42). Thus, bacterial invasion and LPS permeability may exploit endocytic pathways
facilitated by clustered lipid rafts. This notion is supported by the fact that when colon or
ileum segments are treated with MβCD, we observed a significant reduction in FITC-LPS
108
permeability. Pretreatment of IEC cells with MβCD has also shown to reduce LPS-mediated
NFκB activation in a dose dependent manner which was reversed with cholesterol addition
because MβCD acts by decreasing the cholesterol content of the cell membrane (43).
Collectively, these data suggest that LPS permeability and TLR4 mediated signaling in
intestinal epithelial cells requires the presence of lipid rafts.
An intriguing result from our current study was the observation that a four hour LPS
challenge decreased TLR4 localization into the lipid raft fractions. This decreased membrane
protein localization must be a mechanism for LPS tolerance. Studies have shown that prior
exposure to LPS leads to a transient state of refractoriness to further LPS re-stimulation and
decreases cell surface expression of TLR4 (25, 44). However, LPS tolerance studies using
human THP-1 cells have shown TLR4 surface expression is unchanged post LPS challenge,
but LPS mediated TLR4 mobilization to lipid rafts was attenuated during tolerance (45).
Furthermore, this tolerance appears to be protein kinase C (PKC)-ζ and the phosphatase
SHIP dependent and is restored upon the restoration of PKC activity (45). Therefore, TLR4
appears to be not constitutively found within the rafts, but recruited following initial
stimulation to initiate a receptor response.
In conclusion, our data demonstrates that EPA and DHA supplementation enriches
specific intestinal epithelial membrane phospholipids. This results in dissociation of lipid
rafts leading to dislocation of LPS signaling proteins like TLR4 and CD14 from the rafts.
Thus, giving rise to decreased recognition, permeability and signaling of LPS. This may
mechanistically explain why endogenous and exogenous LPS induced inflammatory and
febrile responses are attenuated due to dietary DHA and EPA. Our results also indicate that
109
during an immune challenge, EPA and DHA supplemented animals are well equipped to
fight the challenge.
Acknowledgments
VM, JH and NKG designed and conducted research presented. NKG was the principle
investigator and NKG, JHH and JDS obtained funding for this work. VM was the graduate
student supervised by NKG whom conducted most of the animal and laboratory work. TEW
and JHH conducted aspects of the laboratory and data analysis. All authors contributed to the
writing of the manuscript, read and approved the final manuscript. The authors would also
like to thanks JBS United Inc., for supplying the pigs and feed for this project.
References
1. Pussinen, P. J., A. S. Havulinna, M. Lehto, J. Sundvall, and V. Salomaa. 2011. Endotoxemia is associated with an increased risk of incident diabetes. Diab Care 34: 392-397.
2. Cani, P. D., J. Amar, M. A. Iglesias, M. Poggi, C. Knauf, D. Bastelica, A. M. Neyrinck, F. Fava, K. M. Tuohy, C. Chabo, A. Waget, E. Delmee, B. Cousin, T. Sulpice, B. Chamontin, J. Ferrieres, J. F. Tanti, G. R. Gibson, L. Casteilla, N. M. Delzenne, M. C. Alessi, and R. Burcelin. 2007. Metabolic endotoxemia initiates obesity and insulin resistance. Diabetes 56: 1761-1772.
3. Vaarala, O., M. A. Atkinson, and J. Neu. 2008. The "perfect storm" for type 1 diabetes: the complex interplay between intestinal microbiota, gut permeability, and mucosal immunity. Diabetes 57: 2555-2562.
4. Berg, R. D. 1999. Bacterial translocation from the gastrointestinal tract. Adv Exp Med Biol 473: 11-30.
110
5. Raetz, C. R., and C. Whitfield. 2002. Lipopolysaccharide endotoxins. Annu Rev Biochem 71: 635-700.
6. Akira, S., and K. Takeda. 2004. Toll-like receptor signalling. Nat Rev Immunol 4: 499-511.
7. Triantafilou, M., K. Miyake, D. T. Golenbock, and K. Triantafilou. 2002. Mediators of innate immune recognition of bacteria concentrate in lipid rafts and facilitate lipopolysaccharide-induced cell activation. J Cell Sci 115: 2603-2611.
8. Simons, K., and D. Toomre. 2000. Lipid rafts and signal transduction. Nat Rev Mol Cell Biol 1: 31-39.
9. Simons, K., and D. Toomre. 2000. Lipid rafts and signal transduction. Nat rev. Mol cell biol 1: 31-39.
10. Fan, Y.-Y., D. N. McMurray, L. H. Ly, and R. S. Chapkin. 2003. Dietary (n-3) Polyunsaturated Fatty Acids Remodel Mouse T-Cell Lipid Rafts. J. Nutr. 133: 1913-1920.
11. Fan, Y. Y., L. H. Ly, R. Barhoumi, D. N. McMurray, and R. S. Chapkin. 2004. Dietary docosahexaenoic acid suppresses T cell protein kinase C theta lipid raft recruitment and IL-2 production. J Immunol 173: 6151-6160.
12. Ye, S., L. Tan, J. Ma, Q. Shi, and J. Li. 2010. Polyunsaturated docosahexaenoic acid suppresses oxidative stress induced endothelial cell calcium influx by altering lipid composition in membrane caveolar rafts. Prostaglandins Leukot Essent Fatty Acids 83: 37-43.
13. NRC. 1998. Nutrient Requirements of Swine. 10th ed. Natl. Acad. Press, Washington, DC.
14. Tomita, M., R. Ohkubo, and M. Hayashi. 2004. Lipopolysaccharide transport system across colonic epithelial cells in normal and infective rat. Drug Metab Pharmacokinet 19: 33-40.
15. Hansen, G. H., E. D. K. Pedersen, L. Immerdal, L.-L. Niels-Christiansen, and E. M. Danielsen. 2005. Anti-glycosyl antibodies in lipid rafts of the enterocyte brush border: a possible host defense against pathogens. Am J Physiol Gastrointest Liver Physiol 289: G1100-1107.
111
16. Gylfason, G. A., E. Knútsdóttir, and B. Ásgeirsson. 2010. Isolation and biochemical characterisation of lipid rafts from Atlantic cod (Gadus morhua) intestinal enterocytes. Comp Biochem Physiol Part B: Biochem Mol Biol 155: 86-95.
17. Danielsen, E. M. 1995. Involvement of Detergent-Insoluble Complexes in the Intracellular Transport of Intestinal Brush Border Enzymes. Biochemistry 34: 1596-1605.
18. Nguyen, H. T., A. B. Amine, D. Lafitte, A. A. Waheed, C. Nicoletti, C. Villard, M. Letisse, V. Deyris, M. Roziere, L. Tchiakpe, C. D. Danielle, L. Comeau, and A. Hiol. 2006. Proteomic characterization of lipid rafts markers from the rat intestinal brush border. Biochem Biophys Res Commun 342: 236-244.
19. Folch, J., M. Lees, and G. H. Sloane Stanley. 1957. A simple method for the isolation and purification of total lipides from animal tissues. J Biol Chem 226: 497-509.
20. Lepage, G., and C. C. Roy. 1986. Direct transesterification of all classes of lipids in a one-step reaction. J Lipid Res 27: 114-120.
21. Rockett, B. D., H. Teague, M. Harris, M. Melton, J. Williams, S. R. Wassall, and S. R. Shaikh. 2012. Fish oil increases raft size and membrane order of B cells accompanied by differential effects on function. J lipid res 53: 674-685.
22. Langelier, B., A. Linard, C. Bordat, M. Lavialle, and C. Heberden. 2010. Long chain-polyunsaturated fatty acids modulate membrane phospholipid composition and protein localization in lipid rafts of neural stem cell cultures. J cell biochem 110: 1356-1364.
23. Fetterman, J. W., Jr., and M. M. Zdanowicz. 2009. Therapeutic potential of n-3 polyunsaturated fatty acids in disease. Am J Health Syst Pharm 66: 1169-1179.
24. Browning, L. M. 2003. n-3 Polyunsaturated fatty acids, inflammation and obesity-related disease. Proc Nutr Soc 62: 447-453.
25. Gabler, N. K., J. D. Spencer, D. M. Webel, and M. E. Spurlock. 2008. n-3 PUFA attenuate lipopolysaccharide-induced down-regulation of toll-like receptor 4 expression in porcine adipose tissue but does not alter the expression of other immune modulators. J Nutr Biochem 19: 8-15.
26. Liu, Y., F. Chen, J. Odle, X. Lin, S. K. Jacobi, H. Zhu, Z. Wu, and Y. Hou. 2012. Fish Oil Enhances Intestinal Integrity and Inhibits TLR4 and NOD2 Signaling Pathways in Weaned Pigs after LPS Challenge. J Nutr 142: 2017-2024.
112
27. Calder, P. C. 2007. Immunomodulation by omega-3 fatty acids. Prostaglandins Leukot Essent Fatty Acids 77: 327-335.
28. Wong, S. W., M. J. Kwon, A. M. Choi, H. P. Kim, K. Nakahira, and D. H. Hwang. 2009. Fatty acids modulate Toll-like receptor 4 activation through regulation of receptor dimerization and recruitment into lipid rafts in a reactive oxygen species-dependent manner. J Biol Chem 284: 27384-27392.
29. Lien, E., T. K. Means, H. Heine, A. Yoshimura, S. Kusumoto, K. Fukase, M. J. Fenton, M. Oikawa, N. Qureshi, B. Monks, R. W. Finberg, R. R. Ingalls, and D. T. Golenbock. 2000. Toll-like receptor 4 imparts ligand-specific recognition of bacterial lipopolysaccharide. J Clin Investigat 105: 497-504.
30. Lu, Y.-C., W.-C. Yeh, and P. S. Ohashi. 2008. LPS/TLR4 signal transduction pathway. Cytokine 42: 145-151.
31. Gabler, N. K., J. D. Spencer, D. M. Webel, and M. E. Spurlock. 2007. In utero and postnatal exposure to long chain (n-3) PUFA enhances intestinal glucose absorption and energy stores in weanling pigs. J Nutr 137: 2351-2358.
32. Ferrer, C., E. Pedragosa, M. Torras-Llort, X. Parcerisa, M. Rafecas, R. Ferrer, C. Amat, and M. Moreto. 2003. Dietary Lipids Modify Brush Border Membrane Composition and Nutrient Transport in Chicken Small Intestine. J. Nutr. 133: 1147-1153.
33. Chapkin, R. S., W. Kim, J. R. Lupton, and D. N. McMurray. 2009. Dietary docosahexaenoic and eicosapentaenoic acid: Emerging mediators of inflammation. Prostaglandins, Leukotrienes Essent Fatty Acids 81: 187-191.
34. Rockett, B. D., A. Franklin, M. Harris, H. Teague, A. Rockett, and S. R. Shaikh. 2011. Membrane raft organization is more sensitive to disruption by (n-3) PUFA than nonraft organization in EL4 and B cells. J Nutr 141: 1041-1048.
35. Schley, P. D., D. N. Brindley, and C. J. Field. 2007. (n-3) PUFA alter raft lipid composition and decrease epidermal growth factor receptor levels in lipid rafts of human breast cancer cells. J Nutr 137: 548-553.
36. Amar, J., R. Burcelin, J. B. Ruidavets, P. D. Cani, J. Fauvel, M. C. Alessi, B. Chamontin, and J. Ferrieres. 2008. Energy intake is associated with endotoxemia in apparently healthy men. Am J Clin Nutr 87: 1219-1223.
37. Laugerette, F., C. Vors, A. Geloen, M. A. Chauvin, C. Soulage, S. Lambert-Porcheron, N. Peretti, M. Alligier, R. Burcelin, M. Laville, H. Vidal, and M. C. Michalski.
113
2011. Emulsified lipids increase endotoxemia: possible role in early postprandial low-grade inflammation. J Nutr Biochem 22: 53-59.
38. Erridge, C., T. Attina, C. M. Spickett, and D. J. Webb. 2007. A high-fat meal induces low-grade endotoxemia: evidence of a novel mechanism of postprandial inflammation. Am J Clin Nutr 86: 1286-1292.
39. Turner, J. R. 2006. Molecular basis of epithelial barrier regulation: from basic mechanisms to clinical application. AmerJ path 169: 1901-1909.
40. Neal, M. D., C. Leaphart, R. Levy, J. Prince, T. R. Billiar, S. Watkins, J. Li, S. Cetin, H. Ford, A. Schreiber, and D. J. Hackam. 2006. Enterocyte TLR4 mediates phagocytosis and translocation of bacteria across the intestinal barrier. J Immunol 176: 3070-3079.
41. Lafont, F., and F. G. van der Goot. 2005. Bacterial invasion via lipid rafts. Cell Microbiol 7: 613-620.
42. Manes, S., G. del Real, and A. C. Martinez. 2003. Pathogens: raft hijackers. Nature reviews. Immunology 3: 557-568.
43. Hornef, M. W., B. H. Normark, A. Vandewalle, and S. Normark. 2003. Intracellular recognition of lipopolysaccharide by toll-like receptor 4 in intestinal epithelial cells. J Exp Med 198: 1225-1235.
44. Medvedev, A. E., A. Lentschat, L. M. Wahl, D. T. Golenbock, and S. N. Vogel. 2002. Dysregulation of LPS-Induced Toll-Like Receptor 4-MyD88 Complex Formation and IL-1 Receptor-Associated Kinase 1 Activation in Endotoxin-Tolerant Cells. J Immunol 169: 5209-5216.
45. Cuschieri, J., J. Billigren, and R. V. Maier. 2006. Endotoxin tolerance attenuates LPS-induced TLR4 mobilization to lipid rafts: a condition reversed by PKC activation. J Leukoc Biol 80: 1289-1297.
114
Table1. Feed composition of the experimental diet (%, as fed basis)
1Gromega™ was supplied by JBS United, Inc., containing approximately 14% EPA and 14% DHA of total fatty acids. 2Supplied per kilogram of diet: vitamin A, 8364 IU; vitamin D3, 1533 IU; vitamin E, 45 IU; vitamin K, 2.2 IU; choline, 6.5 mg; riboflavin, 4.2 mg; niacin, 21 mg; pantothenic acid, 17 mg; vitamin B-12, 28 mg; biotin, 1.6 mcg; folic acid, 0.0005 mg; Zn, 112 ppm as zinc sulfate and zinc oxide; Mn, 54 ppm as manganous oxide; Fe, 145 ppm as ferrous carbonate and ferrous sulfate; Cu, 20 ppm as copper chloride; I, 0.76 ppm as ethylenediamine dihydriodide; Se, 0.25 ppm as sodium selenite.
Feed Component Control Dn3
Corn 61.11 60.59
Soybean meal 48% 31.67 31.67
Meat & bone Meal 5.00 5.00
Salt 0.56 0.56
Gromega™ 1 - 0.53
Dicalcium phosphate 0.41 0.41
L-Lysine 0.36 0.36
DL-Methionine 0.18 0.18
Limestone 0.17 0.17
Threonine 0.11 0.11
Premix2 0.36 0.36
Selenium 0.05 0.05
Choline chloride 0.03 0.03
Calculated composition
Energy, kcal/kg 3,238 3,238
Crude Protein, % 22.36 22.36
SID Lysine, % 1.35 1.35
Available Phosphorus, % 0.37 0.37
Ether Extract, % 3.80 3.80
Crude Fiber, % 2.36 2.36
115
Table 2. Fatty acid composition of ileum and colon of mucosal scrapings in pigs fed either the control diet (CON) or a diet enriched with long chain n-3 PUFA (Dn3).
Ileum Colon Fatty Acid (%) CON1 Dn31 P-value3 CON1 Dn31 P-value3 14:0 0.23 ± 0.09 0.57 ± 0.09 0.03 1.00± 0.14 0.76± 0.14 0.27 16:0 22.51 ± 0.86 25.29 ± 0.86 0.05 22.41± 0.28 22.32± 0.28 0.83 16:1 1.66 ± 0.31 2.09 ± 0.31 0.37 2.73 ± 0.32 2.64 ± 0.32 0.84 18:0 14.85 ± 0.63 16.00 ± 0.63 0.43 23.71 ± 0.74 18.9 ± 0.74 0.0018 trans-18:1n-9 3.13 ± 0.9 3.12 ± 0.9 0.83 4.43 ± 0.61 4.96± 0.61 0.24 cis-18:1n-9 18.99 ± 0.49 19.27 ± 0.49 0.98 22.80 ± 0.25 23.91 ± 0.25 0.18 18:3n-3 0.67 ± 0.07 0.63 ± 0.07 0.70 ND2 ND2 20:0 0.00 ± 0.07 0.15 ± 0.07 0.14 0.19 ± 0.08 0.00± 0.08 0.14 20:1 0.08 ± 0.11 0.26 ± 0.11 0.25 0.29 ± 0.12 0.20 ± 0.12 0.62 20:2 0.67 ± 0.03 0.62 ± 0.03 0.13 0.47 ± 0.11 0.47 ± 0.11 0.98 20:3n-6 0.57 ± 0.03 0.73 ± 0.03 0.006 0.41 ± 0.08 0.78 ± 0.08 0.01 20:4n-6 7.40 ±0.38 5.83 ± 0.38 0.02 6.17 ± 0.42 4.64 ± 0.42 0.03 20:5n-3 (EPA) 0.00 ± 0.07 1.18 ± 0.07 < 0.0001 0.00 ± 0.04 0.87 ± 0.04 < 0.0001 22:0 0.47 ± 0.03 0.53 ± 0.03 0.15 0.27 ± 0.12 0.21 ± 0.12 0.77 24:0 0.85 ± 0.06 0.98 ± 0.06 0.14 0.81 ± 0.05 1.01 ± 0.05 0.03 24:1 0.37 ± 0.07 0.47 ± 0.07 0.35 0.36 ± 0.12 0.24 ± 0.12 0.51 22:6n-3 (DHA) 0.88 ± 0.24 1.72 ± 0.24 0.006 0.07 ± 0.11 1.31 ± 0.11 < 0.0001 Saturated 39.00 ± 1.24 43.37 ± 1.24 0.04 49.66 ± 0.73 44.26 ± 0.73 0.0008 ∑(n-3) PUFA 1.56 ± 0.35 3.98 ± 0.35 0.001 0.07 ± 0.13 2.18 ± 0.13 < 0.0001 ∑(n-6) PUFA 29.35 ± 1.34 24.47 ± 1.34 0.03 15.77 ± 0.98 17.21 ± 0.98 0.33 (n-6)/(n-3) 20.51 ± 1.57 6.29 ± 1.57 0.0006 46.37 ± 1.7 8.11 ± 1.7 < 0.0001 1Fatty acid composition was measured by GC-MS on five pigs per treatment and expressed as a percentage of total fatty acids analyzed (mean fatty acid ± SEM). 2ND, not detected. 3Within tissue, significant difference between CONT verses Dn3.
116
Fig. 1. Dietary n-3 PUFA decreases endogenous serum LPS concentrations in pigs. Pigs were fed either a control (CON) or DHA and EPA rich (Dn3) diets for eight weeks. n= 5 pigs/trt. Different letters represent significant difference at P < 0.05.
0.0
0.2
0.4
0.6
0.8
1.0
1.2
CON Dn3
Serum Endotoxin
(Arbitrary Units)
a
b
117
Fig. 2. Dietary n-3 PUFA attenuates the febrile response in pigs induced by lipopolysaccharide (LPS) immune challenge. Pigs fed either a control (CON) or n-3 PUFA (Dn3) diet for eight weeks were immune challenged with LPS 10 µg/kg (LPS) or saline (SAL) control non-challenged. Rectal temperatures were measured every hour to assess the febrile response. Different letters a,b,c represent significant differences (P<0.05) within each hour. n = 5 pigs/trt/challenge/time.
118
Fig. 3. Effect of dietary n-3 PUFA supplementation and LPS challenge on transepithelial electrical resistance (TER) of the ileum measured in the Ussing chamber in pigs fed either control (CON) or n-3 PUFA (Dn3) diets and immune challenged with either saline (SAL) or Lipopolysaccharide 10 µg/kg (LPS) four hours post-challenge. n= 5 pigs/trt. Different letters represent significant difference at P < 0.05.
0
25
50
75
100
125
150
175
SAL LPS
TER
(Arbitrary Units) Con
Dn3a a
b
a
119
Fig. 4. Dietary n-3 PUFA supplementation and inflammatory challenge decrease LPS permeability in ileum and colon. Ex vivo ileum (a) and colon (b) LPS permeability in the Ussing chamber in pigs fed either control (CON) or n-3 FA’s rich (Dn3) diets and immune challenged with either saline (SAL) or lipopolysaccharide 10 µg/kg (LPS) four hours post challenge. n= 5 pigs/trt. Different letters represent significant difference at P < 0.05 and * represents tendency P < 0.10.
0.0
2.0
4.0
6.0
8.0
10.0
12.0
14.0
SAL LPS
Perm
eation Coefficient
(cm/m
in)
CON
Dn3
B)
a
a* a* a*
0.0
2.0
4.0
6.0
8.0
10.0
12.0
14.0
SAL LPS
Perm
eation Coefficient
(cm/m
in)
a
c
bc bc
A)
120
Fig. 5. Dietary n-3 PUFA supplementation enriches PUFA content of specific phospholipid classes of ileum. Lipid raft fractions were isolated from the apical membrane of ileum, phospholipids were isolated from the fractions using thin layer chromatography. Fatty acid composition of each phospholipid was identified and quantified. Phosphatidyl serine and phosphatidyl ethatnolamine were enriched in n-3 PUFA.
0.0
0.1
0.2
0.3
0.4
0.5
0.6
20:4n6 20:5n3 22:6n3 n6/n3
g/100g
0.0
2.0
4.0
6.0
8.0
10.0
12.0
14.0
20:4n6 20:5n3 22:6n3 n6/n3
g/100g
0.0
2.0
4.0
6.0
8.0
20:4n6 20:5n3 22:6n3 n6/n3
g/100g
0.0
2.0
4.0
6.0
8.0
10.0
20:4n620:5n322:6n3 n6/n3
g/100g
0.02.55.07.5
10.012.515.017.520.0
20:4n620:5n322:6n3 n6/n3
g/100g
CON lipid raft
Dn3 lipid raft
CONSOL
Dn3SOL
(D) Phosphatidyl Inositiol (E) Phosphatidyl Choline
(A) Sphingomyelin (B) Phosphatidyl Serine (C) Phosphatidyl Ethanolamine
121
Fig. 6. Dietary n-3 PUFA supplementation enriches PUFA content of specific phospholipid classes of colon. Lipid raft fractions were isolated from the apical membrane, phospholipids were isolated from the fractions using thin layer chromatography. Fatty acid composition of each phospholipid was identified and quantified. Phosphatidyl serine and phosphatidyl ethatnolamine were enriched in n-3 PUFA.
0.0
0.1
0.2
0.3
0.4
0.5
0.6
20:4n620:5n322:6n3 n6/n3
g/100g
0.0
2.0
4.0
6.0
8.0
20:4n620:5n322:6n3 n6/n3
g/100g
0.0
1.0
2.0
3.0
4.0
5.0
6.0
7.0
20:4n6 20:5n3 22:6n3 n6/n3
g/100g
0.0
1.0
2.0
3.0
4.0
5.0
6.0
20:4n6 20:5n3 22:6n3 n6/n3
g/100g
0.0
1.0
2.0
3.0
4.0
20:4n6 20:5n3 22:6n3 n6/n3
g/100g
CON lipidraft
Dn3 lipid raft
(A) Sphingomyelin (B) Phosphatidyl Serine (C) Phosphatidyl Ethanolamine
(D) Phosphatidyl Inositiol (E) Phosphatidyl Choline
122
Fig. 7. Dietary n-3 PUFA supplementation and immune challenge decrease the localization of LPS signaling proteins TLR 4 and CD 14. Lipid raft fractions were isolated from the brush border membrane of ileum, cholesterol and Galectin 4 were used as lipid raft markers. Fractions 2-7 were considered raft or lipid soluble fractions and 8-12 were considered non-raft or lipid insoluble fractions.
123
Fig. 8. Dietary n-3 PUFA supplementation and inflammatory challenge decrease the localization of LPS signaling proteins TLR 4 and CD 14. Lipid raft fractions were isolated from the apical membrane of colon, cholesterol and Galectin 4 were used as lipid raft markers. Fractions 2-7 were considered raft or lipid soluble fractions and 8-12 were considered non-raft or lipid insoluble fractions.
124
Fig. 9. Lipid raft modifier methyl-β-cyclodextrin (MβCD) decreases LPS permeability in ileum and colon. Ex vivo ileum and colon LPS permeability was measured in the Ussing chamber in tissues treated with either control (CON) or MβCD for thirty minutes. n= 7 pigs/trt. Different letters represent significant difference at P < 0.05.
0.0
0.4
0.8
1.2
1.6
2.0
2.4
2.8
3.2
3.6
4.0
Ileum Colon
Perm
eation Coefficient
(cm/m
in) CON
MβCD
a
c
b
b
125
Supplemental Fig. 1. Alkaline phosphatase activity in the CON and Dn3 treatment groups in the brush border membrane (BBM) and basolateral membrane (BLM) of ileum indicating the purity of the membrane preparations. Different letters represent significant difference at P<0.05.
126
Supplemental Fig. 2. Alkaline phosphatase activity in the CON and Dn3 treatment groups in the apical membrane and basolateral membrane (BLM) of colon indicating the purity of the membrane preparations. Different letters represent significant difference at P<0.05.
127
CHAPTER 5: MATERNAL n-3 PUFA SUPPLEMENTATION IN PIGS
ATTENUATES AN INFLAMMATORY CHALLENGE LATER IN LIFE2
A manuscript prepared for submission to the Journal of Nutrition
V. Mani,*,†
*Department of Animal Science, Iowa State University, Ames, IA, 50011;
†Interdepartmental Toxicology Graduate Program, Iowa State University, Ames, IA, 50011
Abstract
Long-chain n-3 polyunsaturated fatty acids (PUFA) such as DHA and EPA possess
strong anti-inflammatory properties. Together with the fact that the maternal diet can have
beneficial effects on the offspring later in life, we hypothesized that maternal dietary EPA
and DHA exposure would have beneficial anti-inflammatory effects in the offspring later in
life. To test this, 30 piglets from the following treatment groups were used in a 3×2 factorial
design. Ten pigs whose dams fed diets devoid of DHA and EPA (CON); 10 pigs which were
from dams and themselves fed diets containing DHA and EPA (Cn3); and 10 pigs with only
maternal dietary exposure to DHA and EPA (Mn3). All diets were corn-soybean meal based
and the n-3 PUFA diets were the same supplemented with 0.5 % algal DHA and EPA in
place of corn. At ten weeks of age, five pigs from each treatment were challenged with either
2 This research was supported by the Iowa Pork Producers Association and the USDA/Iowa
State University Nutrition and Wellness Research Center.
128
saline (SAL) or 10 µg/kg BW lipopolysaccharide (LPS). At 4h post challenge, blood was
collected and pigs were euthanized. Overall, the Cn3-LPS and Mn3-LPS groups had a lower
febrile and serum tumor necrosis factor-α (TNF-α) response. Further buffy coat mRNA
expression of cytokines TNF-α, Interleukin (IL)-1β and IL-10 were attenuated compared to
CON-LPS (P<0.05) in these two groups. Additionally, post inflammatory challenge mRNA
for the LPS signaling proteins TLR4, CD14, and Myd88 were down-regulated in both n-3
PUFA treatments compared to the CON-LPS group (P<0.05). Dietary treatment did not
affect the LPS detoxification mRNA abundance for acyloxyacyl hydrolase and the acute
phase protein C-reactive protein (P>0.05). These results indicate that maternal n-3 PUFA
supplementation can have beneficial effects in offspring towards attenuating LPS induced
inflammation later in life.
Key words: Inflammation, Lipopolysaccharide, Maternal diet, n-3 PUFA,
Introduction
Western diets are low in n-3 polyunsaturated fatty acids (PUFA), and provide
excessive amounts of n-6 fatty acids, such as linoleic acid and arachidonic acid, which leads
to a very high n-6:n-3 ratio of up to 15:1 – 17:1(1). This is important as n-3 and n-6 fatty
acids can regulate the expression and function of proteins and genes that control cell growth,
metabolism and communication differentially (2). High n6:n3 ratio promotes the
pathogenesis of many diseases, including cardiovascular diseases, cancer, diabetes and
inflammatory diseases (3). A lower n-6:n-3 ratio is associated with decreased risk and this
was highlighted in a cardiovascular disease prevention study, where a ratio of 4:1 was
129
associated with a major decrease in total mortality (4). The long chain PUFA
eicosapentaenoic acid (EPA, C20:5n3) and docosahexaenoic acid (DHA, C22:6n3) have been
shown to possess strong anti-inflammatory properties (5). However, these n-3 PUFA need to
be supplemented through diet as they have limited synthesis in mammals due to low Δ5 and
Δ6 desaturase enzyme expression (6). DHA and EPA exert their anti-inflammatory action
through three key processes. Firstly by competition and suppression of arachidonic acid (AA)
derived pro-inflammatory eicosanoids as they compete for cyclooxygenase and lipoxygenase
enzymes (7). Secondly, via Toll-like receptor 4 (TLR4) and nuclear factor (NF)-κβ
suppression that leads to decreased pro-inflammatory cytokine secretion (8). Thirdly, by
incorporation into plasma membrane phospholipids and changing membrane structure and
function that antagonizes inflammatory signaling (9, 10).
Inflammation is part of initial immune response to protect an animal from harmful
agents such as lipopolysaccharide (LPS) as well as live pathogenic microbes (11).
Irrespective of the stimuli the classical immune activation for inflammation starts with the
sensing of the inflammatory agent by either the cell surface or intracellular TLR’s and NOD
like receptors (12). The subsequent activation of the master transcription factor NF-κβ,
results in the secretion of pro-inflammatory cytokines and inflammation (13, 14). If this is
persistent, it has the potential to cause tissue damage and predisposing subjects to metabolic
diseases such as diabetes, obesity and atherosclerosis (15, 16).
Infant and piglet survival is markedly dependent on the ability to transition from the
prenatal to postnatal phase in which intestinal maturation is still occurring. During the
transition from the prenatal to postnatal environment and from suckling to weaning, infants
130
undergo dramatic shifts in nutrient supply and profiles. These transition periods are
associated with early inflammatory responses that may contribute to physiological and
functional disorders (17, 18). Furthermore, studies have shown that maternal diet during
gestation and lactation induces stable alterations to the physiology and phenotype of the
offspring through epigenetic programming as well as enrichment of the fetal tissue (19).
Fatty acids and their derivatives can influence both the early immune system development
and maturation by regulating metabolic processes and the gene and protein expression of
important enzymes and cytokines (20). It has been shown that maternal dietary fatty acid
changes can modify neonatal neutrophil function in the offspring (21). This gives an
opportunity where the young ones can be physiologically and immunologically prepared
through maternal supplementation of n-3 PUFA for their early part of life when they are
vulnerable to many diseases which are detrimental for the health and production performance
later (22).
Therefore, based on previous research in which DHA and EPA attenuated LPS
induced Inflammation (23, 24), we hypothesized that maternal (gestation and lactation)
supplementation of DHA and EPA would attenuate an inflammatory challenge by LPS and
antagonize the production of pro-inflammatory cytokines and febrile response in offspring
later in life.
131
Materials and Methods
Materials. All the chemicals used for the experiment were purchased from Sigma-Aldrich (St
Louis, MO) unless otherwise stated. The dietary source of n-3 PUFA, Gromega™ (JBS
United Inc., Sheridan, IN) contained 14% DHA and 14% EPA.
Animals and Experimental Design. All animal procedures were approved by the Iowa State
University Institutional Animal Care and Use Committee and adhered to the ethical and
humane use of animals for research. Five sows were fed a basal diet and 10 sows a diet
enriched with n-3 PUFA upon confirmation of pregnancy: 1) standard corn-soybean meal
diets were fed to one group (CON) and 2) the basal diet supplemented with 0.5% Gromega™
(JBS United Inc., Sheridan, IN), which is an enriched source of algal EPA and DHA. Upon
farrowing, litters were standardized to 10 piglets per litter within 24 h of birth, with cross
fostering only occurring within treatment. At weaning (18-21 days of age), two piglets from
each sow were separated and individually penned during the ten week nursery period. In the
nursery, CON pigs stayed on a DHA and EPA devoid diets (n=10), while piglets from five n-
3 PUFA fed sows (n=10) were also switched to the CON diet in the nursery (Mn3). The 10
remaining piglets were fed nursery diets supplemented with 0.5 % Gromega™ (Cn3). In all
diets, Gromega™ was mixed in the basal diet in substitution to corn and formulated to meet
or exceeded the nutrient requirements of the respective growth period (25). An example of
the later nursery diet is given in Table 1.
Pigs were fed ad libitum and had free access to water all the time. After 8 weeks in
the nursery and performance data collection, all pigs were fasted overnight and challenged
with either an intramuscular injection of saline (SAL) or lipopolysaccharide (LPS, from
132
Escherichia coli Serotype 055:B5, 10 µg/kg BW, Sigma-Aldrich, St. Louis, MO). Following
the peak febrile response at four hours as measured by rectal temperature, blood was
collected for isolating buffy coat and blood assays.
Buffy coat isolation. Twenty mL of blood was mixed with 30 ml of RBC lysis buffer (1.45 M
NH4Cl, 0.1M KHCO3, 5 mM EDTA, pH 8.0) and vigorously shaken for 15 min. The tubes
were centrifuged at 300 g for 5 min at 4°C. The supernatant was discarded leaving the white
blood cells and 20 mL of ice cold RBC lysis buffer was added again. This was vortexed for
few minutes and centrifuged at 300 x g for 5 min at 4°C. Supernatant was discarded and 20
mL of room temperature phosphate buffered saline (PBS; containing 137 mM NaCl, 2.7 mM
KCl, 10 mM Na2HPO4.2H2O, 2 mM KH2PO4, pH 7.4) was added. This tube was vortexed
and centrifuged at 300 x g for 5 min at 4°C. The supernatant was discarded and the pellet was
resuspended in 1 mL of PBS and stored at -80°C until further analysis.
Serum inflammatory cytokine concentration. Tumor necrosis factor-α levels were quantified
from the serum collected after four hours of immune challenge with LPS. A quantitative
sandwich enzyme immunoassay ELISA was performed using a commercially available kit
(R&D Systems Inc., Minneapolis, MN).
RNA isolation and quantitative PCR. Total RNA was isolated from tissue samples using
Trizol (Invitrogen, Inc., Carlsbad, CA) reagent according to the manufacturer’s protocol and
the RNA pellets were resuspended in nuclease free water. Total RNA was quantified by
measuring the absorbance at 260nm using a spectrophotometer (ND-100, NanoDrop
133
Technologies, Rockland, DE) and the purity was assessed by determining the ratio of the
absorbance at 260 and 280 nm (NanoDrop). All samples had 260/280 nm ratios above 1.8.
The integrity of the RNA preparations was verified by visualization of the 18S and 28S
ribosomal bands stained with SYBR® Safe DNA gel stain (Life technologies, Carlsbad, CA)
after electrophoresis on 2% agarose gels. Total RNA (1μg) was transcribed in a reaction
combining genomic DNA elimination using a commercially available cDNA synthesis kit
(Quantitect® reverse transcription kit, Qiagen, Valencia, CA). cDNA was quantified using
NanoDrop and used for real-time quantitative PCR reaction. Amplification was carried out in
a total volume of 25 μL containing 2X quantitect SYBR Green PCR master mix (Quantitect®
SYBR® Green PCR kit, Qiagen, Valencia, CA), forward and reverse primers (0.3 μM) and
400 ng of cDNA. The primers used are listed in Table 1. The cycling conditions were, after
an initial 15 min denaturation step at 95°C, the reactions were cycled 50 times under the
following parameters: 95°C for 30 s, 55°C for 30 s, and 72°C for 30 s. Optical detection was
carried out at 72°C. At the end of the PCR, melt curve analysis was conducted to validate the
specificity of the primers. A non-template control was run with every assay and all
determinations were performed in triplicate. The mRNA abundance values for each sample
were normalized to RPL32 according to the 2-ΔΔCT method (26).
Fatty acid analysis. Fatty acid profiles of the whole blood were determined and analyzed by
GC-MS (27, 28). 0.2 g of buffy coat tissue was mixed with 2.5 ml of 4:1 hexane and 125
µg/L heptadecanoic acid was added to each sample as an internal standard. FAME were
analyzed by GC on a Hewlett-Packard model 6890 fitted with an Omegawax 320 (30-m ×
0.32-mm i.id. 0.25 um) capillary column. Hydrogen was the carrier gas. The temperature
134
program ranged from 80 to 250°C with a temperature rise of 5°C/min. The injector and
detector temperatures were 250°C and 1 µL of sample was injected and run split. Fatty acids
methyl esters were identified by their relative retention times on the column with respect to
appropriate standards and heptadecanoic acid.
Statistical Analyses. All data are expressed as means ± SEM. The main effects of dietary
treatment and LPS challenge were determined by the Proc Mixed procedure in SAS (Cary,
NC), and treatment differences were established using the least significant difference.
Differences were deemed significant at P < 0.05 and tendencies at P < 0.10.
Results
Fatty acid composition. Fatty acid profiles were measured in the buffy coats in all three
dietary treatment groups of pigs to ascertain the difference in n-3 PUFA enrichment or
depletion (Table 3). As expected, the Cn3 group had a high EPA and DHA content compared
to the CON (P<0.0001). Interestingly, the Mn3 buffy coats also had moderate amounts of
EPA and DHA ten weeks after last dietary exposure from maternal milk (P<0.05). However,
the DHA and EPA content of Mn3 treatment was only half of the Cn3 treatment content
(P<0.05). As such, all three treatment groups differed in total n-3 PUFA content, with the
CON having the lowest, Mn3 and Cn3 treatments having the highest (1.53 vs. 3.70 vs. 5.98,
respectively, P<0.0001). The CON group also had the highest n6:n3 ratio, followed by the
Mn3 and CON groups (P=0.0003). The four hour LPS challenge (SAL vs. LPS) did not alter
these fatty acid profiles (data not shown).
135
Effect of dietary fat on the febrile response induced by LPS. To assess the anti-inflammatory
effect of maternal and continuous dietary n-3 PUFA on nursery pigs, an acute systemic LPS
challenge was given. Irrespective of diet, LPS challenged pigs had higher febrile response as
assessed by rectal temperature changes compared to the SAL groups (P < 0.001, Fig. 1).
After 1 h, all three LPS challenged groups had significantly elevated rectal temperatures
compared to the SAL groups. Moreover, the Cn3-LPS pigs had a lower febrile response
within the four hour challenge period than the CON-LPS pigs (P = 0.011). While the Mn3-
LPS group tended to have a comparatively lower febrile response compared to the CON-LPS
pigs (P < 0.10, Fig. 1).
Blood cytokine response to inflammatory challenge. Tumor necrosis factor-α concentration, a
marker of systemic inflammation, was measured in serum collected 4 h post challenge (Fig.
2). As expected all the LPS challenged pigs had an augmented TNF-α concentration
compared to the SAL pigs (P<0.0001). Dietary n-3 PUFA supplementation attenuated serum
TNF-α concentration (P<0.0073) and there was a diet and challenge interaction (P<0.0172).
Furthermore, CON-LPS pigs had a significantly higher TNF-α concentration than both the
Mn3-LPS and Cn3-LPS pigs (P<0.01).
Buffy coat LPS signaling pathway mRNA expression. Lipopolysaccharide challenge caused
an increase in the mRNA abundance of major LPS signaling molecules such as TLR4, CD14
and Myd88 in the peripheral blood cells irrespective of the dietary treatment (P=0.0003,
136
Table 3). There was no dietary effect on mRNA abundance. However, there was a diet by
LPS interaction for these three genes (P<0.0012). Interestingly, TLR4, CD14 and Myd88
mRNA abundance followed the same pattern as the febrile response and serum TNF-α
concentration. The Cn3-LPS and Mn3-LPS mRNA levels were lower than CON-LPS
(P<0.05).
As expected, the LPS challenge also caused an increase in the mRNA abundance of
major pro-inflammatory cytokines TNF-α and IL-1β, and the anti-inflammatory cytokine IL-
10, irrespective of the dietary treatment (P<0.05, Table 3). There was no dietary effect but
there was a diet by LPS interaction. All cytokine mRNA expression also followed the same
trend as the LPS signaling genes with CON-LPS group having higher expression compared
to a significantly lower expression in Mn3-LPS and Cn3 LPS groups (P<0.05) indicating the
pro-inflammatory effect of LPS challenge and anti-inflammatory effect of supplementing n-
3 PUFA either maternally or continuously. Inducible nitric oxide synthase (iNOS) expression
was not affected by the LPS challenge (P=0.15) or dietary treatment (P=0.47).
Acyloxyacyl hydrolase (AOAH) is a major LPS detoxification enzyme present in the
liver and immune cells and C-reactive protein (CRP) is one of the major acute phase proteins
secreted during inflammatory challenge by liver and immune cells. The LPS challenge
resulted in an approximately 5 fold increase in the AOAH mRNA expression and more than
a 1000 fold increase in CRP mRNA expression, irrespective of the dietary treatment
(P<0.05). There was no diet by LPS interaction (P>0.05), for both genes.
137
Discussion
Long chain n-3 PUFA such as DHA and EPA are known to attenuate LPS induced
inflammation (24, 29-32). Recently, fish oil has been shown to directly inhibit TLR4 and
NOD2 signaling and inflammation in pigs (23). Moreover, we and others have also shown
that maternal supplementation of n-3 PUFA has beneficial effects in the offspring (20, 33). In
pigs, maternal n-3 PUFA supplementation increases glucose absorption in weanling piglets
and helps maintain the nutritional status and health during this early weaning transition
period (28). Therefore, this study herein was conducted to examine whether maternal
supplementation of DHA and EPA during gestation and lactation would have long lasting
protective effects against acute inflammatory challenges and inflammation in the offspring
later in life.
Nutritional manipulation of tissue fatty acid profiles in utero is not a new
phenomenon. Providing supplemental fat to sows in late gestation and lactation not only
improves body condition scores and productivity, but also enhances piglet performance (34-
36). It is also well established that the fatty acid content of the suckling piglet is determined
by the fatty acid content of the sow diet (37-39). Rooke et al., (38, 40, 41) and Fritsche et al.,
(39), fed sows salmon and tuna oils late in gestation and showed both sow and neonatal
tissue enrichment of DHA and EPA. In our study, the evidence of continuous
supplementation of n-3 PUFA was obvious in the Cn3 treatment in which enrichment with
EPA and DHA was clearly seen. Surprisingly, the Mn3 treatment also had significant DHA
and EPA content, even after supplementation of diets devoid of DHA and EPA for seven
weeks post weaning. Interestingly, it has been shown that maternal supplementation does not
138
enrich the fatty acid composition of all the tissues evenly. Liver n-3 PUFA enrichment is
highest followed by muscle and then the subcutaneous adipose tissue (42, 43). Usually,
when supplementation of n-3 PUFA is stopped, the fatty acid composition of the tissues
change rapidly reflecting the current dietary fatty acid intake (34). Lymphocytes have long
life span of about 30 days (44). So, the possibility of immune cells enriched through maternal
supplementation present in the circulation for two months is remote. However, Hoile et al.,
(45) showed that maternal n-3 PUFA supplementation causes stable DNA methylation
pattern changes in Fads2 gene which encodes Δ6 desaturase, a rate limiting enzyme in n-3
PUFA synthesis. This epigenetic mechanism may also partially explain the higher DHA and
EPA content of the buffy coat in our Mn3 pigs.
Piglet survival is markedly dependent on the ability to transition in the pre and
postnatal phases (46). This is even more critical as early weaning (15-21 days of age) stress
can result in sustained impairment in intestinal barrier function and heightened inflammation
post weaning (47). Interestingly, fatty acids and their derivatives could be used to influence
the early immune system development and maturation by regulating metabolic processes and
the gene and protein expression of important enzymes and cytokines (20). It has been shown
that maternal dietary fatty acid changes can modify neonatal neutrophil function (21).
Epigenetic studies have also shown that some nutrients consumed during pregnancy and/or
lactation induces stable alterations to the physiology and phenotype of the offspring (19).
Along these lines, evidences currently exists for maternal n-3 PUFA supplementation to
cause stable alterations in the epigenetic machinery that the beneficial effect is carried over
for a long duration (45). The higher n-3 PUFA content of buffy coat from maternally
139
supplemented pigs in our study confirms that epigenetic mechanism may be involved. We
currently have collaborators examining DNA methylation profiles in these pigs to test this
theory (Boddicker and Ross, unpublished).
Protective effect of maternal n-3 PUFA supplementation towards inflammation was
studied by administering an LPS challenge and collecting blood samples at the peak immune
response. Webel et al. (48) have shown that the peak inflammatory response induced by
exogenous LPS occurs at 2-4 h post challenge in pigs. This is associated with elevated body
temperature and blood TNF-α, cortisol, and IL-6 concentrations. Blood urea nitrogen
concentrations are elevated compared to the control between 6-12 h post challenge.
Knowing the peak response occurs at 2-4 h, by design we examined the impact Cn3 and Mn3
treatments have on LPS induced febrile response and inflammation markers. As expected,
LPS induced an elevated febrile and serum cytokine response over the 4 h period. As
hypothesized, Mn3 and Cn3 supplementation attenuated both responses. This is in agreement
with other DHA and EPA research showing n-3 PUFA decreasing the LPS induced
inflammatory response (23, 24, 29). Additionally, EPA and DHA can replace arachidonic
acid in the cell membrane and act as competitive agonist for cyclooxygenase and
lipoxygenase enzymes which otherwise synthesize pro-inflammatory mediators from the
arachidonic acid (49). These pro-inflammatory mediators stimulate the secretion of cytokines
such as TNF-α and IL-1β. This competition leads to the production of less inflammatory or
anti-inflammatory eicosanoids and resolvins (50). Furthermore, DHA and EPA can also
decrease the action of pro-inflammatory transcription factor NF-κB and activate the nuclear
140
receptor PPARγ which reduces the secretion of pro-inflammatory cytokines and increasing
the anti-inflammatory cytokine secretion (10).
Lipopolysaccharide, when present in the circulation is bound to LPS binding protein
(LBP) which presents the LPS monomer to CD14. Toll like receptor 4 recognizes the LPS
presented by CD14 in association with MD-2 and then the signal is transmitted intracellularly
through Myd88 dependent and independent pathways both ultimately stimulating the
secretion of cytokines (14, 51). Recent evidences indicate that saturated and n-3 PUFA can
reciprocally modulate the expression and signaling of LPS signaling receptor TLR4 (52).
Additionally, n-3 PUFA enrichment in macrophage and T cell membranes dissociate the lipid
raft, preventing the TLR4 localization into the raft which will attenuate the LPS recognition
and signaling, and cell function (32, 53).
All evidences point to the fact that under n-3 PUFA supplementation decreased
expression and signaling of TLR4 occurs. We also observed a decreased mRNA expression
of TLR4 and other LPS signaling pathway proteins CD14 and Myd88 under n-3 PUFA
supplementation in both the continuous and maternal supplemented pigs. Since maternal
supplemented pig buffy coat cells are also enriched with n-3 PUFA it is a plausible
mechanism through which they might attenuate the inflammation by decreasing the
expression of these LPS signaling genes either through the decreased expression of pro-
inflammatory mediators or through activation of nuclear receptor PPARγ (10).
Lipopolysaccharide detoxification enzyme AOAH is secreted by monocyte-
macrophages, dendritic cells and neutrophils. Acyloxyacyl hydrolase removes the secondary
acyl chains of the lipid-A component of LPS rendering it unable to be bind to TLR4 (54).
141
Faster LPS detoxification is essential after an inflammatory challenge to limit the detrimental
effects of LPS. Higher mRNA expression of AOAH in LPS treated pig immune cells indicate
the immune cells trying to limit the negative effects of LPS via increased detoxification.
However, diet had no influence on AOAH mRNA expression. Further, acute phase protein
C-reactive protein (CRP) mRNA levels in the blood cells were very highly elevated
indicating the acute phase response happening after the LPS challenge. Acute phase proteins
are inflammatory mediators mainly secreted by liver and also by peripheral immune cells
which usually bind to the immune stimulant which in turn helps facilitate its neutralization
through the complement system (55). C-reactive protein (CRP) is a major acute phase protein
and shown to be secreted by immune cells in response to an LPS challenge (56, 57). n-3
PUFA supplementation did not have any impact on the secretion of CRP again indicating the
need for a maximum response from the acute phase proteins.
Overall, our results indicate that maternal n-3 PUFA supplementation enriches the
immune cells and attenuates the adverse effects of an acute inflammatory challenge even ten
weeks after birth (58). Maternal supplementation with n-3 PUFA may provide protective
effect like a regular n-3 PUFA supplementation later in the life, importantly during the early
stages of life which might be important for maintaining the health of the animal during the
crucial transition period.
Literature Cited
1. Simopoulos AP. The importance of the omega-6/omega-3 fatty acid ratio in cardiovascular disease and other chronic diseases. Exp Biol Med (Maywood). 2008 Jun;233:674-88.
142
2. Stipanuk MH. Biochemical, physiological, and molecular aspects of human nutrition. 2006.
3. Simopoulos AP. Essential fatty acids in health and chronic diseases. Forum Nutr. 2003;56:67-70.
4. Wang C, Harris WS, Chung M, Lichtenstein AH, Balk EM, Kupelnick B, Jordan HS, Lau J. n-3 Fatty acids from fish or fish-oil supplements, but not alpha-linolenic acid, benefit cardiovascular disease outcomes in primary- and secondary-prevention studies: a systematic review. Am J Clin Nutr. 2006 Jul;84:5-17.
5. Calder PC. Long-chain fatty acids and inflammation. Proc Nutr Soc. 2012 Feb 28:1-6.
6. Saravanan P, Davidson NC, Schmidt EB, Calder PC. Cardiovascular effects of marine omega-3 fatty acids. Lancet. 2010 Aug 14;376:540-50.
7. Tilley SL, Coffman TM, Koller BH. Mixed messages: modulation of inflammation and immune responses by prostaglandins and thromboxanes. J Clinical Investigat. 2001;108:15-23.
8. Lee JY, Hwang DH. The modulation of inflammatory gene expression by lipids: mediation through Toll-like receptors. Mol Cells. 2006 Apr 30;21:174-85.
9. Chapkin RS, Kim W, Lupton JR, McMurray DN. Dietary docosahexaenoic and eicosapentaenoic acid: Emerging mediators of inflammation. Prostaglandins, Leukotrienes Essent Fatty Acids. 2009;81:187-91.
10. Sampath H, Ntambi JM. Polyunsaturated fatty acid regulation of genes of lipid metabolism. Annu Rev Nutr. 2005;25:317-40.
11. Janeway CA, Jr., Medzhitov R. Innate immune recognition. Annu Rev Immunol. 2002;20:197-216.
12. Kawai T, Akira S. The role of pattern-recognition receptors in innate immunity: update on Toll-like receptors. Nat Immunol. 2010;11:373-84.
13. Miyajima A, Kitamura T, Harada N, Yokota T, Arai K. Cytokine receptors and signal transduction. Annu Rev Immunol. 1992;10:295-331.
14. McGettrick AF, O’Neill LAJ. Regulators of TLR4 Signaling by Endotoxins. In: Wang X, Quinn PJ, editors. Endotoxins: Structure, Function and Recognition: Springer Netherlands; 2010. p. 153-71.
143
15. Vaarala O. Is the origin of type 1 diabetes in the gut[quest]. Immunol Cell Biol. 2012;90:271-6.
16. Delzenne N, Cani P. Gut Microbiota and the Pathogenesis of Insulin Resistance. Curr Diab Reports. 2011:1-6.
17. Boudry G, Lalles JP, Malbert CH, Bobillier E, Seve B. Diet-related adaptation of the small intestine at weaning in pigs is functional rather than structural. J pediatric gastroent nutr. 2002 Feb;34:180-7.
18. Boudry G, Peron V, Le Huerou-Luron I, Lalles JP, Seve B. Weaning induces both transient and long-lasting modifications of absorptive, secretory, and barrier properties of piglet intestine. J Nutr. 2004 Sep;134:2256-62.
19. Burdge GC, Hanson MA, Slater-Jefferies JL, Lillycrop KA. Epigenetic regulation of transcription: a mechanism for inducing variations in phenotype (fetal programming) by differences in nutrition during early life? Br J Nutr. 2007 Jun;97:1036-46.
20. Enke U, Seyfarth L, Schleussner E, Markert UR. Impact of PUFA on early immune and fetal development. Br J Nutr. 2008 Dec;100:1158-68.
21. Prescott SL, Barden AE, Mori TA, Dunstan JA. Maternal fish oil supplementation in pregnancy modifies neonatal leukotriene production by cord-blood-derived neutrophils. Clin Sci (Lond). 2007 Nov;113:409-16.
22. Dewey KG, Mayers DR. Early child growth: how do nutrition and infection interact? Maternal & child nutrition. 2011 Oct;7 Suppl 3:129-42.
23. Liu Y, Chen F, Odle J, Lin X, Jacobi SK, Zhu H, Wu Z, Hou Y. Fish Oil Enhances Intestinal Integrity and Inhibits TLR4 and NOD2 Signaling Pathways in Weaned Pigs after LPS Challenge. J Nutr. 2012 Nov;142:2017-24.
24. Gabler NK, Spencer JD, Webel DM, Spurlock ME. n-3 PUFA attenuate lipopolysaccharide-induced down-regulation of toll-like receptor 4 expression in porcine adipose tissue but does not alter the expression of other immune modulators. J Nutr Biochem. 2008 Jan;19:8-15.
25. NRC. Nutrient Requirements of Swine. 10th ed. Washington, DC: Natl. Acad. Press; 1998.
26. Livak KJ, Schmittgen TD. Analysis of Relative Gene Expression Data Using Real-Time Quantitative PCR and the 2−ΔΔCT Method. Methods. 2001;25:402-8.
144
27. Lepage G, Roy CC. Direct transesterification of all classes of lipids in a one-step reaction. J Lipid Res. 1986 Jan;27:114-20.
28. Gabler NK, Radcliffe JS, Spencer JD, Webel DM, Spurlock ME. Feeding long-chain n-3 polyunsaturated fatty acids during gestation increases intestinal glucose absorption potentially via the acute activation of AMPK. J Nutr Biochem. 2009 Jan;20:17-25.
29. Carroll JA, Gaines AM, Spencer JD, Allee GL, Kattesh HG, Roberts MP, Zannelli ME. Effect of menhaden fish oil supplementation and lipopolysaccharide exposure on nursery pigs. I. Effects on the immune axis when fed diets containing spray-dried plasma. Domest Anim Endocrinol. 2003 May;24:341-51.
30. De Smedt-Peyrusse V, Sargueil F, Moranis A, Harizi H, Mongrand S, Laye S. Docosahexaenoic acid prevents lipopolysaccharide-induced cytokine production in microglial cells by inhibiting lipopolysaccharide receptor presentation but not its membrane subdomain localization. J neurochem. 2008 Apr;105:296-307.
31. Lee JY, Plakidas A, Lee WH, Heikkinen A, Chanmugam P, Bray G, Hwang DH. Differential modulation of Toll-like receptors by fatty acids: preferential inhibition by n-3 polyunsaturated fatty acids. J Lipid Res. 2003 Mar;44:479-86.
32. Wong SW, Kwon MJ, Choi AM, Kim HP, Nakahira K, Hwang DH. Fatty acids modulate Toll-like receptor 4 activation through regulation of receptor dimerization and recruitment into lipid rafts in a reactive oxygen species-dependent manner. J biol chem. 2009 Oct 2;284:27384-92.
33. Li M, Sloboda DM, Vickers MH. Maternal obesity and developmental programming of metabolic disorders in offspring: evidence from animal models. Experiment diabetes res. 2011;2011:592408.
34. Averette Gatlin L, See MT, Hansen JA, Sutton D, Odle J. The effects of dietary fat sources, levels, and feeding intervals on pork fatty acid composition. J Anim Sci. 2002 Jun;80:1606-15.
35. Averette LA, Odle J, Monaco MH, Donovan SM. Dietary fat during pregnancy and lactation increases milk fat and insulin-like growth factor I concentrations and improves neonatal growth rates in swine. J Nutr. 1999 Dec;129:2123-9.
36. Pettigrew JF. Supplemental dietary fat for peripartalbsows: A review. J Anim Sci. 1981;53:107-17.
145
37. Rooke JA, Bland IM, Edwards SA. Relationships between fatty acid status of sow plasma and that of umbilical cord, plasma and tissues of newborn piglets when sows were fed on diets containing tuna oil or soyabean oil in late pregnancy. Br J Nutr. 1999 Sep;82:213-21.
38. Rooke JA, Sinclair AG, Ewen M. Changes in piglet tissue composition at birth in response to increasing maternal intake of long-chain n-3 polyunsaturated fatty acids are non-linear. Br J Nutr. 2001 Oct;86:461-70.
39. Fritsche KL, Alexander DW, Cassity NA, Huang SC. Maternally-supplied fish oil alters piglet immune cell fatty acid profile and eicosanoid production. Lipids. 1993 Aug;28:677-82.
40. Rooke JA, Bland IM, Edwards SA. Effect of feeding tuna oil or soyabean oil as supplements to sows in late pregnancy on piglet tissue composition and viability. Br J Nutr. 1998 Sep;80:273-80.
41. Rooke JA, Sinclair AG, Edwards SA. Feeding tuna oil to the sow at different times during pregnancy has different effects on piglet long-chain polyunsaturated fatty acid composition at birth and subsequent growth. Br J Nutr. 2001 Jul;86:21-30.
42. Missotten J, De Smet S, Raes K, Doran O. Effect of supplementation of the maternal diet with fish oil or linseed oil on fatty-acid composition and expression of Δ5- and Δ6-desaturase in tissues of female piglets. animal. 2009;3:1196-204.
43. Rooke JA, Bland IM, Edwards SA. Effect of feeding tuna oil or soyabean oil as supplements to sows in late pregnancy on piglet tissue composition and viability. British J Nutr. 1998;80:273-80.
44. Tangye SG. Staying alive: regulation of plasma cell survival. Trends Immunol. 2011;32:595-602.
45. Hoile SP, Irvine NA, Kelsall CJ, Sibbons C, Feunteun A, Collister A, Torrens C, Calder PC, Hanson MA, et al. Maternal fat intake in rats alters 20:4n-6 and 22:6n-3 status and the epigenetic regulation of Fads2 in offspring liver. J Nutr Biochem. 2012.
46. Pluske JR, Williams IH, Aherne FX. Maintenance of villus height and crypt depth in piglets by providing continuous nutrition after weaning. Anim Sci. 1996;62:131-44.
47. Smith F, Clark JE, Overman BL, Tozel CC, Huang JH, Rivier JE, Blikslager AT, Moeser AJ. Early weaning stress impairs development of mucosal barrier function in the porcine intestine. Am J Physiol Gastrointest Liver Physiol. 2010 Mar;298:G352-63.
146
48. Webel DM, Finck BN, Baker DH, Johnson RW. Time course of increased plasma cytokines, cortisol, and urea nitrogen in pigs following intraperitoneal injection of lipopolysaccharide. J Anim Sci. 1997 Jun;75:1514-20.
49. Allen KG, Harris MA. The role of n-3 fatty acids in gestation and parturition. Exp Biol Med (Maywood). 2001 Jun;226:498-506.
50. Calder PC. The relationship between the fatty acid composition of immune cells and their function. Prostaglandins, Leukotrienes Essent Fatty Acids. 2008;79:101-8.
51. Uematsu S, Akira S. Toll-like Receptors and Type I Interferons. J Biol Chem. 2007 May 25, 2007;282:15319-23.
52. Weatherill AR, Lee JY, Zhao L, Lemay DG, Youn HS, Hwang DH. Saturated and polyunsaturated fatty acids reciprocally modulate dendritic cell functions mediated through TLR4. J Immunol. 2005 May 1;174:5390-7.
53. Kim W, Fan YY, Barhoumi R, Smith R, McMurray DN, Chapkin RS. n-3 polyunsaturated fatty acids suppress the localization and activation of signaling proteins at the immunological synapse in murine CD4+ T cells by affecting lipid raft formation. J Immunol. 2008 Nov 1;181:6236-43.
54. Munford RS. Invited review: Detoxifying endotoxin: time, place and person. J Endotoxin Res. 2005 April 1, 2005;11:69-84.
55. Balaji R, Wright KJ, Hill CM, Dritz SS, Knoppel EL, Minton JE. Acute phase responses of pigs challenged orally with Salmonella typhimurium. JAnim Sci. 2000 July 1, 2000;78:1885-91.
56. Haider DG, Leuchten N, Schaller G, Gouya G, Kolodjaschna J, Schmetterer L, Kapiotis S, Wolzt M. C-reactive protein is expressed and secreted by peripheral blood mononuclear cells. ClinExperi Immunol. 2006;146:533-9.
57. Liu N, Liu J-T, Ji Y-Y, Lu P-P. C-reactive protein triggers inflammatory responses partly via TLR4/IRF3/NF-κB signaling pathway in rat vascular smooth muscle cells. Life Sci. 2010;87:367-74.
58. Calder PC. n-3 polyunsaturated fatty acids, inflammation, and inflammatory diseases. Am J Clin Nutr. 2006 Jun;83:1505S-19S.
147
Table1. Example of the nursery diet feed composition (%, as fed basis)
1Gromega™ was supplied by JBS United, Inc., containing approximately 14% EPA and 14% DHA of total fatty acids. 2Supplied per kilogram of diet: vitamin A, 8364 IU; vitamin D3, 1533 IU; vitamin E, 45 IU; vitamin K, 2.2 IU; choline, 6.5 mg; riboflavin, 4.2 mg; niacin, 21 mg; pantothenic acid, 17 mg; vitamin B-12, 28 mg; biotin, 1.6 mcg; folic acid, 0.0005 mg; Zn, 112 ppm as zinc sulfate and zinc oxide; Mn, 54 ppm as manganous oxide; Fe, 145 ppm as ferrous carbonate and ferrous sulfate; Cu, 20 ppm as copper chloride; I, 0.76 ppm as ethylenediamine dihydriodide; Se, 0.25 ppm as sodium selenite.
Feed Component Control Dn3
Corn 61.11 60.59
Soybean meal 48% 31.67 31.67
Meat & bone Meal 5.00 5.00
Salt 0.56 0.56
Gromega™ 1 - 0.53
Dicalcium phosphate 0.41 0.41
L-Lysine 0.36 0.36
DL-Methionine 0.18 0.18
Limestone 0.17 0.17
Threonine 0.11 0.11
Premix2 0.36 0.36
Selenium 0.05 0.05
Choline chloride 0.03 0.03
Calculated composition
Energy, kcal/kg 3,238 3,238
Crude Protein, % 22.36 22.36
SID Lysine, % 1.35 1.35
Available Phosphorus, % 0.37 0.37
Ether Extract, % 3.80 3.80
Crude Fiber, % 2.36 2.36
148
Table 2. Primer sequences for quantitative real-time PCR1
Gene Sense (5’- 3’) Antisense (5’- 3’) TLR4 GAA TAT TTT TCT AAC CTG CCC AAC CTG GAG CCA GCC AGA CCT TGA ATA CAA GTT TTC ATT ACA TC CD14 TGG ACC TCA GTC ACA ACT CG CCT TTA GGC ACT TGC TCC AG Myd88 AAG TTT GCA CTC AGC CTC TCT CCA ACA GAC AGT GAT GAA CCG CAG GAT TNF-α ACT CGG AAC CTC ATG GAC AG AGG GGT GAG TCA GTG TGA CC IL-1β AAA GGG GAC TTG AAG AGA G CTG CTT GAG AGG TGC TGA TAT
IL-10 ATG GGC GAC TTG TTG CTG AC CAC AGG GCA GAA ATT GAT GAC A
iNOS ATG TCC GAG GCA AAC ACC ACA TTC GCA TGC TGC TGA GAG CTT TGT TGA
AOAH TCA GGG GGA CAG AAA TAT GG CCA GAA TCA CGC AGA ATC AC CRP TGC CCA GAC AGA CAT GAT CGG AAA TGA GCC TTG CAG TCA GAC TCA CAT
Primer Abbreviations: TLR4, Toll like receptor4; CD14, Cluster of differentiation 14; Myd88, Myeloid differentiation factor 88; TNF-α, Tumor Necrosis Factor- α; IL-1β, Interleukin-1β; IL-10-Interleukin-10; iNOS, inducible nitric oxide synthase; AOAH, Acyloxyacyl hydrolase; CRP-C-Reactive Protein.
149
Table 3. Buffy coat fatty acid composition of pigs fed either the control diet (CON) or a diet enriched with long chain n-3 PUFA only through maternally (Mn3) or continuously (Cn3).
Fatty Acid (%)1 CON Mn3 Cn3 P-value2 16:0 20.10 ± 0.34 20.61 ± 0.34 21.41 ± 0.34 0.33
18:0 17.36 ± 1.40 14.22 ± 1.39 16.89 ± 1.39 0.30 18:3n-3 0.87 ± 0.09 0.84 ± 0.09 1.00 ± 0.09 0.42 18:3n-6 0.29 ± 0.17 0.28 ± 0.17 0.21 ± 0.17 0.94 20:2 0.69 ± 0.27 1.24 ± 0.27 0.33 ± 0.27 0.14
20:3n-6 1.26 ± 0.25 1.51 ± 0.25 0.85 ± 0.25 0.25 20:4n-6 11.23 ± 0.30 11.35 ± 0.30 10.67 ± 0.30 0.30 20:5n-3 (EPA) 0.00 ± 0.03 0.45 ± 0.03 1.10 ± 0.03 < 0.0001 22:6n-3 (DHA) 0.00 ± 0.06 1.10 ± 0.06 2.09 ± 0.06 < 0.0001 Saturated 34.07 ± 0.62 34.46 ± 0.62 35.85 ± 0.62 0.18 ∑(n-3) PUFA 1.53 ± 0.26 3.70 ± 0.26 5.98 ± 0.26 < 0.0001 ∑(n-6) PUFA 42.96 ± 0.46 42.32 ± 0.46 42.65 ± 0.46 0.63 (n-6)/(n-3) 23.80 ± 1.36 11.43 ± 1.36 7.13 ± 1.36 0.0003 1Fatty acid composition was measured by GC-MS on three pigs per treatment and expressed as a percentage of total fatty acids (mean ± SEM).
150
Table 4. Effects of maternal n-3 PUFA supplementation on mRNA expression of major LPS signaling molecules, cytokine genes, LPS detoxification gene AOAH and acute phase protein gene CRP under an acute inflammatory challenge in peripheral immune cells1
Genes Control Maternal Continuous SEM P-value Saline LPS Saline LPS Saline LPS Diet Challenge Diet*Challenge
TLR4 1.00a 18.54b 2.16a 8.45c 1.41a 8.51c 2.74 0.19 0.0003 0.0012 CD14 1.00a 5.41b 2.30a 3.49b 1.65a 2.34c 0.98 0.48 0.02 0.05
Myd88 1.00a 18.59b 2.29a 8.80c 2.84a 10.19cb 2.93 0.37 0.0004 0.003 TNF-α 1.00a 5.07b 0.25a 1.79c 0.88a 1.57c 0.94 0.12 0.08 0.008 IL-1β 1.00a 2.27b 0.40a 1.38c 0.27a 1.45c 0.28 0.01 0.0001 0.0009 iNOS 1.00 1.14 1.31 0.34 1.64 0.36 0.53 0.83 0.15 0.47 IL-10 1.00a 4.34b 0.59a 2.61bc 0.99a 2.21c 0.69 0.22 0.0009 0.01
AOAH 1.00 6.73 1.05 4.80 1.07 6.21 1.28 0.64 0.0002 0.32 CRP 1.00 1215 1.33 1205 1.17 1140 90.43 0.93 0.0001 0.23 1Values are mean and pooled SE, n=5 pigs/trt. Means in the same row without a common letter differ, P < 0.05. All data were acquired using real time PCR. RPL32 was used as the housekeeping gene and the Control-Saline treatment was used as the reference sample per gene. The expression values were normalized to RPL32 housekeeper.
151
Figure 1. Febrile response of pigs fed either control (CON) or n-3 PUFA rich diets until the lactation through maternal supplementation (Mn3) or throughout the life (Cn3) and challenged with either saline (SAL) or LPS 10 µg/kg (LPS) after eight weeks. n = 5 pigs/trt. Different letters a,b,c represent significant differences within each hour (P<0.05). Diet P = 0.011, Challenge P < 0.001, Time P < 0.001.
152
Fig. 2. Effects of maternal n-3 PUFA on serum tumor necrosis factor (TNF)-α concentration after a 4 hour LPS challenge in pigs. Pigs fed either control (CON) devoid of DHA and EPA, n-3 PUFA diets throughout life (Cn3) or only during maternal period of gestation and lactation (Mn3). Pigs where challenged with either saline (SAL) or LPS 10 µg/kg (LPS) at 11 weeks of age. n = 5 pigs/trt. Different letters a,b,c represent significant differences at (P<0.05). Diet P = 0.0073, Challenge P < 0.0001, Diet*Challenge P < 0.0172.
0
300
600
900
1200
1500
1800
SAL LPS
TN
F-α
pg/m
l CON
Mn3
Cn3
c
a a
b
c
a
153
CHAPTER 6: INTESTINAL INTEGRITY, ENDOTOXIN TRANSPORT AND
DETOXIFICATION IN PIGS DIVERGENTLY SELECTED FOR RESIDUAL FEED
INTAKE3
Submitted to Journal of Animal Science and is under review
V. Mani,*,† A. J. Harris*, A. F. Keating*,†, T. E. Weber*, J. M. Dekkers* and N. K. Gabler*,†,4
*Department of Animal Science, Iowa State University, Ames, IA, 50011;
†Interdepartmental Toxicology Graduate Program, Iowa State University, Ames, IA, 50011
Abstract
Microbes and microbial components potentially impact the performance of pigs
through immune stimulation and altered metabolism. These immune modulating factors can
include endotoxin from gram negative bacterial outer membrane component, commonly
referred to as lipopolysaccharide (LPS). In this study, our objective was to examine the
relationship between intestinal barrier integrity, endotoxin and inflammation with feed
efficiency (FE), using pig lines divergently selected for residual feed intake (RFI) as a
3 This research was supported by the Agriculture and Food Research Initiative Competitive
Grants 2010-65206-20670 (to N. K. Gabler) and 2011-68004-30336 (to J. F. Patience)
from the USDA National Institute of Food and Agriculture.
4 Corresponding author: [email protected]
154
model. Twelve gilts (62 ± 3 kg BW) from the low RFI (LRFI, more efficient) and 12 from
the high RFI (HRFI, less efficient) were used. Individual performance data was recorded for
five weeks. At the end of the experimental period, ADFI of LRFI pigs was lower (P < 0.001),
average daily gain (ADG) not different between the two lines (P = 0.72) but the Gain: Feed
ratio of LRFI pigs was higher than for HRFI pigs (P = 0.019). Serum endotoxin
concentration (P<0.01) and the acute phase protein haptoglobin (P<0.05) were higher in
HRFI pigs. Transepithelial resistance of the ileum, transport of FITC-Dextran and FITC-LPS
in ileum and colon, as well as tight junction protein mRNA expression in ileum, did not
differ between the lines, indicating the two lines did not differ in transport characteristics at
the intestinal level. Ileum inflammatory markers, myeloperoxidase and IL-8, were found to
be higher in HRFI pigs (<0.05). Alkaline phosphatase (ALP) activity was significantly
increased in the LRFI pigs in ileum and liver tissues and negatively correlated with blood
endotoxin (P<0.05). Lysozyme activity in the liver was not different between the lines,
however, the LRFI pigs had a twofold higher lysozyme activity in ileum (P<0.05). Despite
the difference in their activity, ALP or lysozyme mRNA expression was not different
between the lines in either tissue. Lower endotoxin and inflammatory markers and the
enhanced activities of antimicrobial enzymes in the LRFI line may not fully explain the
difference in the feed efficiency between the lines; but they have the potential to prevent the
growth potential in HRFI pigs. Further studies are needed to identify the other mechanisms
that may contribute to the higher endotoxin levels in the HRFI pigs and the higher feed
efficiency in the LRFI pigs.
Key words: Endotoxin • Feed efficiency • Intestinal integrity • Pig
155
Introduction
Feed efficiency has become a major goal in pig research and breeding programs for
economic, environmental and food security reasons. Residual feed intake (RFI) has been
adopted as a reliable method for measuring, selecting for and studying FE. Pigs with low
RFI (LRFI) consume less feed for a given amount of growth and backfat as pigs with higher
RFI (HRFI) (Cai et al., 2008; Gilbert et al., 2007). Yorkshire pigs selected for LRFI for 5
generations, differed by up to 124 g/day in ADFI with no significant reduction in weight gain
compared to randomly selected HRFI pigs (Boddicker et al., 2011). However, the physiology
that underlies this improved FE has been poorly defined.
Inflammation can have a major impact on growth performance and feed efficiency
(Schinckel et al., 1995) and could contribute to lower maintenance nutrient requirements in
pigs selected for reduced RFI (Barea et al., 2010; Boddicker et al., 2011). Lipopolysaccharide
(LPS), a Gram negative bacterial outer membrane component referred also as endotoxin, is a
chronic innate immune stimulator in pigs (Gabler et al., 2008; Webel et al., 1997; Weber and
Kerr, 2008). Importantly, Gram negative bacteria are present in the gastrointestinal tract in
large amounts and can serve as a major source of systemic endotoxin (Cani and Delzenne,
2010; Ravin et al., 1960). However, intestinal barrier integrity plays critical host defense
functions against luminal immunogens such as endotoxin. Once in circulation, endotoxin
activates the immune system via toll like receptors (TLR), which results in repartitioning of
nutrients for immune function, rather than towards anabolism (Kimball et al., 2003;
Rakhshandeh and de Lange, 2012). Additionally, detoxification processes can prevent the
negative effects of endotoxin (Elsbach, 2000). Therefore, our objective was to examine the
156
relationship between intestinal barrier integrity, endotoxin and inflammation with FE, using
pig lines divergently selected for RFI as a model.
Materials and Methods
All animal procedures were approved by the Iowa State University Institutional
Animal Care and Use Committee and adhered to the ethical and humane use of animals for
research. All chemicals used for the experiment were purchased from Sigma-Aldrich (St.
Louis, MO) unless otherwise stated.
Animals and Experimental Design
Twelve pigs per line (62 ± 3 kg, BW) were selected and matched across lines for age
and weight from the seventh generation of the Iowa State University RFI selection project
(Cai et al., 2008). Pigs were individually penned and had free access to water and feed at all
times. All pigs were fed a common commercial corn-soybean meal-distillers dry grain with
soluble diet formulated to meet or exceed the nutrient requirements for this size pig (NRC,
1998). Feed intake and body weights were recorded on a weekly basis and used to calculate
average daily gains and RFI for each pig, as previously described (Cai et al., 2008; Young et
al., 2011).
After five weeks, all pigs were fasted overnight and whole blood (10 mL) was
collected via venipuncture and serum separated by centrifugation at 2000 × g at 4°C.
Thereafter, pigs were euthanized via captive bolt followed by exsanguination. Immediately
following euthanasia, segments of ileum and mid colon were collected and flushed with ice
157
cold Krebs-Henseleit buffer (consisting of, in mmol/L: 25 NaHCO3, 120 NaCl, 1 MgSO4, 6.3
KCl, 2 CaCl2, 0.32 NaH2PO4; pH 7.4) to remove any undigested food material. Fresh ileum
and colon segments were used for ex vivo integrity measures and for mucosal scrapings. A 20
cm segment of ileum 150 cm from the ileal-cecal junction and a 10 cm segment of proximal
colon 60 cm from the rectum were isolated. Ileum and colon segments were flushed with ice
cold Krebs-Henseleit buffer. For mucosal scrapings, intestinal segments were then cut open
longitudinally along the mesenteric border and the epithelial layer gently scrapped with a
glass slide without disturbing the underlying lamina propria. Ileum and colon samples that
were not used for ex vivo work were then snap frozen in liquid nitrogen and stored at -80oC
until analysis.
Intestinal Integrity
Electrophysiological measurements were taken using modified Ussing chambers as
previously described (Albin et al., 2007; Gabler et al., 2009; Moeser et al., 2012). Briefly,
fresh segments of the ileum and colon were removed and placed on ice in Krebs-Henseleit
buffer for transport to the laboratory while under constant aeration until clamped in the
modified Ussing chambers. To assess tight junction integrity and the mucosal to serosal
endotoxin transport, tissues stripped of outer serosal layers were immediately mounted in a
modified Ussing Chamber, with each chamber connected to a pair of dual channel current
and voltage electrodes submerged in 3% noble agar bridges and filled with 3M potassium
chloride for electrical conductance (Physiologic Instruments Inc., San Diego, CA and World
Precision Instruments Inc., New Haven, CT). Each segment (0.71 cm2) was bathed on its
mucosal and serosal sides with Krebs buffer and constantly gassed with 95% O2-5% CO2
158
mixture. The temperature of all tissues and apparatus was constantly maintained at 37 oC
using circulating warm water. A short circuit current was established and stabilized for about
10 minutes and transepithelial resistance (TER) was measured using the included software
(Acquire and Analyze, Physiological instruments, San Diego, CA).
After recording the basal electrophysiological measurements, the mucosal to serosal
macromolecule transport of fluorescein isothiocyanate labeled dextran (4.4 KDa; FITC-
Dextran) was assessed to measure the integrity of both ileum and colon, as previously
described (Wang et al., 2001). Briefly, the mucosal chambers were treated with 2.2 mg/mL
FITC-Dextran, and chamber samples from both sides were collected every 10-15 min. The
relative fluorescence was then determined using a fluorescent plate reader (Bio-Tek,
Winooski, VT), with excitation and emission wavelengths of 485 and 520 nm, respectively.
An apparent permeability coefficient (Papp) was then calculated using the area of the
membrane and rate of FITC-Dextran transport, where dQ/dt = transport rate (µg/min); C0 =
initial concentration in the donor chamber (µg/mL); A = area of the membrane (cm2):
Papp = dQ/ (dt×A×C0)
The mucosal to serosal transport of LPS was also assessed as previously described by Tomita
et al., (2004). Briefly, the mucosal chambers were challenged with 20 µg/mL fluorescein
isothiocyanate labeled LPS (FITC-LPS) and chamber samples from both sides were
collected every 10-15 min. The fluorescence and apparent permeability coefficient was
calculated as described for FITC-Dextran.
159
Circulating Endotoxin
Serum endotoxin concentrations were measured by an end point fluorescent assay
using the recombinant factor C (rFC) system (Lonza, Basel, Switzerland). Briefly, the serum
samples were diluted 1000X in pyrogen free water and 100µL of the samples and standards
were added to a 96 well round bottom plate and incubated at 37°C for 10 min. After
incubation, 100 µL of rFC enzyme, rFC assay buffer and rFC substrate were added at a ratio
of 1:4:5 to the plate and an initial reading were taken followed by 1h incubation at 37°C.
Thereafter, the relative fluorescence unit (RFU) for each well was determined (excitation 380
nm and emission 440 nm). The concentration of the endotoxin was interpolated from the
standard curve constructed from the standards and corrected for sample dilution.
Alkaline Phosphatase activity
Alkaline phosphatase (ALP) activity was measured using the Quantichrom ALP
assay kit (DALP-250, Gentaur, Bioassay systems, Hayward, CA). Protein was extracted
using potassium phosphate buffer (PPB), pH 6.0 from liver and ileum and the protein
concentration was determined using BCA assay (Pierce, Rockford, IL) and 50 µL of sample
was added to a 150 µL working solution containing magnesium acetate, p-nitrophenyl
phosphate and assay buffer in a 96 well plate. The optical density at 405 nm was measured at
time 0 and after 4 minutes using a Synergy 4 microplate reader (Bio-Tek, Winooski, VT) and
ALP activity was calculated according to the manufacturer’s instructions.
160
Myeloperoxidase Activity
Myeloperoxidase (MPO) activity was measured in the whole ileal tissue as an
indicator of inflammation and neutrophil infiltration using an o-dianasidine assay (de La
Serre et al., 2010; Suzuki et al., 1983). Tissue samples were homogenized in PPB pH 6.0,
containing 0.5% hexadecyltrimethylammonium bromide (HTAB) and then freeze-thawed on
ice and vortexed three times. Samples were then centrifuged for 15 min at 10,000 x g. The
resulting supernatant was transferred to a new tube and the remaining pellet was resuspended
in 500 µL of PPB + 0.5% HTAB. The re-suspended pellet was freeze-thawed and
homogenized twice and 500 µL of this solution was transferred to a new tube. Samples were
then centrifuged again at 10,000 x g for 15 min and the supernatant was collected. The final
supernatant was mixed with o-dianasidine dihydrochloride and 0.005% hydrogen peroxide.
One unit of MPO activity was expressed as the amount of MPO needed to degrade 1 µmol of
hydrogen peroxide/min/mL. Absorbance was read at 460 nm for 10 min reaction time and
absorbance was calculated on mL sample/mg tissue basis.
Lysozyme activity
Whole ileum and liver samples were analyzed for lysozyme activity using the
EnzChek fluorescent assay which compares sample lysozyme activity to lysozyme activity
on Micrococcus Lysodeikticus cell walls (Invitrogen-Molecular Probes, Carlsbad,
California). Samples were diluted and fluorescence was measured using excitation emission
wavelengths of 485 and 530nm and the lysozyme activity were interpolated from the
standard curve constructed from the standards and corrected for sample dilution.
161
Interleukin-8 and Haptoglobin Assays
Ileal protein (100 μg) extracts were analyzed for interleukin-8 (IL-8) concentration
using a porcine-specific ELISA (DuoSet® Porcine IL8, catalog number DY535, R&D
systems, Minneapolis, MN, USA) per the manufacturer’s instructions. Haptoglobin was
analyzed using a commercially available ELISA (ALPCO diagnostics, Salem, NH). Briefly,
samples were added to wells adsorbed with anti-porcine haptoglobin antibodies. After
washing, horseradish peroxidase (HRP) conjugated anti haptoglobin antibodies were added
to the plate. After another washing, the HRP was assayed by the addition of the chromogenic
substrate 3,3’,5,5’-tetramethylbenzidine (TMB) and the absorbance was measured at 450 nm.
The quantity of haptoglobin in the test sample was interpolated from the standard curve
constructed from the standards and corrected for sample dilution.
Quantitative real-time PCR
Total RNA was isolated from tissue samples using Trizol (Invitrogen Inc., Carlsbad,
CA) reagent according to the manufacturer’s protocol and the RNA pellets were resuspended
in nuclease free water. To eliminate potential genomic DNA contamination, the RNA
samples were treated with a DNase I kit (DNA-free, Ambion Inc., Austin, TX) per the
manufacturer’s instructions. Total RNA was quantified by measuring the absorbance at
260nm using a spectrophotometer (ND-100, NanoDrop Technologies, Rockland, DE) and the
purity was assessed by determining the ratio of the absorbance at 260 and 280 nm. All
samples had 260/280 nm ratios above 1.8. The integrity of the RNA preparations was
verified by visualization of the 18S and 28S ribosomal bands stained with ethidium bromide
after electrophoresis on 1.2% agarose gels (E-gel; Invitrogen Inc., Carlsbad, CA). A good
162
preparation was indicated by the presence of 28S and 18S bands that were not smeared and
by the 28S band stained with a greater intensity than the 18S band. Total RNA (1 μg) was
reverse transcribed using a commercially available cDNA synthesis kit (iScript, BioRad
Laboratories, Hercules, CA). The iScript kit used a blend of oligo (dT) and random hexamer
primers for cDNA synthesis and the reverse transcriptase is RNAse H+ to ensure removal of
the RNA template. The primers used for real-time RT-PCR are presented in Table 1.
Amplification was carried out in a total volume of 25 μL containing 1X iQ SYBR
Green Supermix (BioRad Laboratories, Hercules, CA), forward and reverse primers (0.1
μg/μL) and 1 μL of the 20 μL cDNA reaction. After an initial 5 min denaturation step at
95°C, the reactions were cycled 40 times under the following parameters: 95°C for 30 s,
60°C for 30 s, and 72°C for 30 s. Optical detection was carried out at 72°C. At the end of the
PCR, melt curve analysis was conducted to validate the specificity of the primers. A non-
template control was run with every assay and all determinations were performed in
duplicate. Presence of a single PCR product of the correct size for each primer set was
verified by visualizing the PCR products via electrophoresis on 1% agarose gels stained with
ethidium bromide. The mRNA abundance values for each sample were normalized to β2
microglobulin according to the 2-ΔΔCT method (Livak and Schmittgen, 2001).
Statistical Analyses
All results were expressed as LS means ± SEM. The main effect of line (HRFI versus
LRFI) was determined by the Proc Mixed procedure in SAS (Cary, NC) with age matched
pairs (repetition) as a random effect. However, for Ussing chamber data tissue (colon verses
ileum) was also included as a fixed effect. Statistical significance of differences was
163
determined by Tukey’s range test for pair wise comparisons. Differences were deemed
significant at P ≤ 0.05 and tendencies at P ≤ 0.10. Phenotypic correlations between serum
endotoxin, ileum Endotoxin permeability, ALP and lysozyme with RFI, ADG, ADFI and G:F
were computed based on residuals derived from the above models using the CORR
procedure of SAS.
Results
Twelve gilts per line weighing approximately (62±3, kg BW) were used for the study.
At the end of the experimental period, growth performance was measured. As expected, the
LRFI pigs consumed less feed than their HRFI counterparts (ADFI: 1.90 vs. 2.23 kg/day, P <
0.001). However, the ADG did not differ between the lines (0.67 vs. 0.65, kg/day, P = 0.72).
Since the LRFI pigs consumed less feed for the same ADG, their G:F ratio was higher than
the HRFI pigs (0.35 vs. 0.29, P = 0.019). These results confirm that the effect of selection for
RFI was maintained in the gilts used for this study.
Intestinal integrity was assessed by measuring the TER and macromolecule
permeability in freshly isolated ileum and colon samples. Transepithelial resistance, an
electrophysiological measure of intestinal integrity, was not different in either the ileum or
colon of pigs divergently selected for RFI (Ileum: 108 vs. 103 Ω/cm2, Colon: 78 vs. 73
Ω/cm2, Table 1). However, irrespective of line, colon TER was significantly lower than in
the ileum (P < 0.05). Further, these data were supported by additional ex vivo analysis of
intestinal integrity using FITC-Dextran, a macromolecule permeability marker. No
164
differences between lines were observed in Papp for either the ileum or colon (P > 0.05,
Table 1).
Ex vivo intestinal endotoxin transport characteristics were also assessed using FITC-
LPS in modified Ussing chambers in the two RFI lines. Similar to the TER and FITC-
Dextran values, we found no differences between the lines in either ileum and colon FITC-
LPS transport (P > 0.05, Table 2). The tight junction proteins claudin 3 and 4 and occludin
are three important proteins involved in intestinal barrier function and integrity. Gene
expression analysis of these tight junction proteins also indicated no difference between the
lines (P > 0.05, Table 3).
Serum endotoxin concentrations were found to be lower in the LRFI than in the HRFI
gilts (6.19 vs. 17, EU/ml, P < 0.05, Figure 1). Furthermore, the serum acute phase protein,
haptoglobin, was also lower in LRFI pigs than in HRFI gilts (P ≤ 0 .05, Figure 2). The
presence of a higher endotoxin load and the consequent increase in haptoglobin secretion has
the potential to cause a generalized inflammation. The ileum was assessed for the presence of
general inflammatory markers. Ileum myeloperoxidase activity was lower in the LRFI pigs
than in the HRFI pigs (P = 0.047, Figure 3). The proinflammatory cytokine, IL-8 protein
expression, also tended to be lower in the ileum of LRFI versus HRFI pigs (1.7 vs. 1.1, µg/g
protein, P = 0.062, Figure 4).
Alkaline phosphatase activity (Figure 5) was measured and found to be significantly
increased in the LRFI pigs in both liver (62 vs. 93 mU/mg protein, P<0.018) and ileum (597
vs. 947 mU/mg protein, P<0.01). Lysozyme activity in the liver was not different between
the lines but ileum lysozyme activity in LRFI pigs was almost twice as high as in HRFI pigs
(8.7 vs. 14.4, U/mg protein, P<0.01, Figure 6). Although we saw differences in activity of
165
these enzymes, surprisingly, no difference was found in the mRNA expression in either
ileum or liver (Table 4). mRNA expression of LPS detoxification gene acyloxyacyl
hydrolase (AOAH) present in liver and ileum tissues was quantified to assess differences
between the two lines. The expression profiles of these genes was not different, indicating
that at the mRNA level, LPS detoxification enzyme AOAH expression was not altered due to
blood endotoxin, selection for RFI, or FE (Table 4).
Residual correlations of performance traits with endotoxin transport and serum
concentrations, ALP and RFI were generally moderate (Table 5). Interestingly, this is the
first data to our knowledge in swine that shows a significant positive correlation between
intestinal endotoxin transport and circulating endotoxin (P = 0.019). Weak negative
correlations were observed with FE measures and endotoxin permeability and circulating
concentrations. Furthermore, ileum ALP activity was moderately negatively correlated with
endotoxin concentration (P = 0.027). Lysozyme activity was poorly correlated with all
parameters measures (P > 0.05).
Discussion
The current study was conducted to identify if differences in intestinal integrity,
circulating endotoxin and its associated inflammatory markers may partially be responsible
for difference in FE between pigs that were divergently selected for RFI. The physiological
mechanisms underlying RFI or FE in swine are poorly defined. However, differences in
nutrients and energy digestibility, metabolic efficiency of nutrient use, basal metabolic rate
and energy expenditure are presumed to be contributing to differences in RFI, either alone or
166
in combination (Barea et al., 2010; Boddicker et al., 2011; Herd and Arthur, 2009).
Endotoxin and its associated inflammation can reduce digestibility and alter intestinal
nutrient transport and post-absorptive metabolism (Rakhshandeh and de Lange, 2012). The
net effect of increased circulating endotoxin or endotoxemia is reduced growth, increased
energy expenditure and antagonizing lean tissue accretion (Orellana et al., 2007). Thus, it
results in partitioning energy and other nutrients away from growth and towards immune
system requirements and thus may contribute to differences in FE.
The gastrointestinal tract contains large quantities of both gram positive and negative
bacteria in which bacterial populations gradually increase from approximately 0-103 per mL
of luminal contents in the duodenum to 1011 per mL in the colon (Berg, 1999). The gram-
negative bacterial family Enterobacteriaceae, includes genera such as Escherichia,
Salmonella, Shigella, Klebsiella, Citrobacter and Enterobacter, and serves as a major source
of endotoxin (Billiar et al., 1988). Some of these strains are commensals, while others can be
classified as opportunistic pathogens. The outer leaf of the gram negative bacterial outer
membrane is mainly composed of a unique glycolipid generally known as endotoxin, or if
purified, often referred to as LPS. Lipid A is the bioactive-immunogenic component that can
stimulate localized or systemic inflammation via its recognition through toll like receptors
(TLR) and other immune system sensing mechanisms (Beutler, 2000). Endotoxin may enter
systemic circulation through routes including: 1) nonspecific paracellular transport through
the tight junctions; 2) transcellular transport, potentially through lipid raft membrane
domains via TLR4 mediated endocytosis (Tomlinson and Blikslager, 2004; Triantafilou et
al., 2002); or 3) chylomicron facilitated transport into circulation during fat digestion (Kelly
et al., 2012). All three transport routes may be altered by diet, management conditions and
167
environmental stressors (Mani et al., 2012). Furthermore, although characterization of
intestinal microbial populations was not within the scope of this study, we cannot rule out
RFI line specific differences in Enterobacteriaceae populations that may partially explain the
increase in circulating endotoxin.
Interestingly, the presence of higher circulating endotoxin also has the potential to
affect intestinal health and function (Gardiner et al., 1995). Ileal MPO activity and IL-8
protein expression were lower in the LRFI pigs. Both of these markers are commonly used
for assessing intestinal inflammation and neutrophil infiltration (Suzuki et al., 1983). A
“leaky” or porous intestine allows the harmful agents into the circulation, which can cause
localized inflammation of the intestine and systemic inflammation (Vaarala et al., 2008).
Further, decreased expression of tight junction proteins claudin 3 and 4 during inflammation
have been implicated in increased intestinal permeability (Pinton et al., 2010). In our study,
TER was not different between the lines and this was corroborated further by no differences
in the paracellular transport of FITC-Dextran or FITC-LPS transport. Furthermore, mRNA
expression of the tight junction proteins claudins 3 and 4 and occludin were not different
between the lines. Together, these data indicate that in healthy pigs, intestinal integrity is
tightly controlled and may not contribute significantly to differences in FE.
The presence of higher blood endotoxin has the potential to contribute to the
development of an inflammatory state and reduce growth potential. In our study, serum
endotoxin and the acute phase protein, haptoglobin, were found to be significantly lower in
the LRFI pigs. Repeated exposure to endotoxin augments haptoglobin concentration
compared to a single endotoxin exposure (Dritz et al., 1996; Wright et al., 2000). As
haptoglobin is a good marker of tissue damage and the acute phase response in swine (Hall et
168
al., 1992), this supports our serum endotoxin data, which suggest that the LRFI pigs were
exposed to comparatively lower levels of endotoxin intermittently, although the two lines
shared the same environmental conditions (i.e. housing and diets). Furthermore, LRFI pigs
appear to be experiencing a comparatively lower acute phase response. However, the high
immune response of HRFI pigs appear not to be a result of increased intestinal permeability
or endotoxin transport but could be a result of differences in detoxification processes.
Animals and humans harbor low concentrations of circulating endotoxin even in
normal and healthy conditions (Erridge et al., 2007). Intriguingly, we found that the LRFI
pigs had lower endotoxin levels compared to the HRFI pigs, with no difference in the
intestinal integrity and transport characteristics between the lines. The potential biological
process that might account for the lower endotoxin levels in the LRFI pigs may include the
efficiency of endotoxin clearance, neutralization or detoxification. These processes occur in
various tissues, including immune cells, liver, kidney and intestine. Furthermore, various
binding proteins and enzymes such as ALP, lysozyme, and AOAH are involved (Munford et
al., 2009). Alkaline phosphatase is a hydrolase enzyme present in liver, intestine and kidney
tubules and it dephosphorylates bacterial LPS and reduces its toxicity (Bates et al., 2007;
Poelstra et al., 1997). Further, in the intestine ALP reduces trans-mucosal passage of bacteria
and also protects against LPS-induced inflammation (Lallès, 2010). Higher ALP activity in
both liver and ileum of LRFI pigs indicates that they deactivated or neutralized endotoxin
more efficiently. This may be affirmed by the moderately negative correlation between ALP
and serum endotoxin concentration. Further evidences suggest that ALP can also mitigate
body weight loss after an immune challenge (Bol-Schoenmakers et al., 2010).
169
To further explore the difference in endotoxin metabolism, we measured AOAH
mRNA expression. Acyloxyacyl hydrolase is an important lipase enzyme that selectively
removes the secondary fatty acyl chains attached to the primary chains in the lipid A moiety
and detoxifies endotoxin (McDermott and Fenwick, 1992). This leads to an LPS molecule
which could bind the signaling proteins MD2/TLR4 but does not have the potential to initiate
the signal or can only be a partial agonist (Lu et al., 2005). The fact that we did not see
evidence of differential AOAH mRNA expression in the intestine or liver was surprising.
However, AOAH mRNA and activity appear to be correlated in a tissue or cell specific
manner (Feulner et al., 2004). Therefore, liver and intestinal mRNA expression may not be
correlated in swine or immune and Kupffer cell specific expression needs to be determined,
where activity and expression of AOAH are greater.
Lysozyme is another important antimicrobial peptide secreted by various cells of the
body, including cells in the intestine and liver. Lysozyme regulates microbial populations by
lysing the bacterial cell wall component peptidoglycan and it also binds to and detoxifies
LPS (Takada et al., 1994). In our study, although lysozyme activity in the liver was not
different between the two lines, ileum lysozyme activity was higher in LRFI pigs, which may
explain the lower serum endotoxin and haptoglobin levels in the LRFI pigs and higher FE.
Supporting this hypothesis, a recent study found that feeding lysozyme to young pigs
improved their health and FE (May et al., 2012). Surprisingly, although ALP and lysozyme
activity was different between the two lines in ileum and liver, mRNA expression of both
enzymes were not different in the liver and ileum, indicating a post-translational mechanism
which may act differently in the two lines of pigs.
170
In conclusion, our results indicate that LRFI pigs seem to have a more robust
intestinal and liver endotoxin detoxification and higher active anti-microbial enzymes
including ALP, ileum lysozyme and the inflammatory mediator enzyme myeloperoxidase,
and that HRFI pigs seem to be undergoing a greater level of basal inflammation. Although
lower serum endotoxin and the associated decreased inflammatory markers and the enhanced
activities of antimicrobial enzymes in the LRFI pigs may not explain the line difference in
FE wholly, it has the potential to be a significant contributing factor. Further studies are
needed to identify other mechanisms that contribute to the lower endotoxin levels in the
LRFI pigs and how this is associated with their higher FE.
Literature Cited
Albin, D. M., J. E. Wubben, J. M. Rowlett, K. A. Tappenden, and R. A. Nowak. 2007. Changes in small intestinal nutrient transport and barrier function after lipopolysaccharide exposure in two pig breeds. J. Anim. Sci. 85: 2517-2523.
Barea, R. et al. 2010. Energy utilization in pigs selected for high and low residual feed intake. J. Anim. Sci. 88: 2062-2072.
Bates, J. M., J. Akerlund, E. Mittge, and K. Guillemin. 2007. Intestinal Alkaline Phosphatase Detoxifies Lipopolysaccharide and Prevents Inflammation in Zebrafish in Response to the Gut Microbiota. Cell Host & Microbe 2: 371-382.
Berg, R. D. 1999. Bacterial translocation from the gastrointestinal tract. Adv. Exp. Med. Biol. 473: 11-30.
Beutler, B. 2000. Tlr4: central component of the sole mammalian LPS sensor. Curr. Opin. Immunol. 12: 20-26.
Billiar, T. R. et al. 1988. Intestinal gram-negative bacterial overgrowth in vivo augments the in vitro response of Kupffer cells to endotoxin. Annals Surg 208: 532-540.
Boddicker, N., N. K. Gabler, M. E. Spurlock, D. Nettleton, and J. C. Dekkers. 2011. Effects of ad libitum and restricted feed intake on growth performance and body composition of Yorkshire pigs selected for reduced residual feed intake. J. Anim. Sci. 89: 40-51.
171
Bol-Schoenmakers, M. et al. 2010. Intestinal alkaline phosphatase contributes to the reduction of severe intestinal epithelial damage. Euro J Pharmacol 633: 71-77.
Cai, W., D. S. Casey, and J. C. Dekkers. 2008. Selection response and genetic parameters for residual feed intake in Yorkshire swine. J. Anim. Sci. 86: 287-298.
Cani, P. D., and N. M. Delzenne. 2010. Gut Microbiota, Diet, Endotoxemia, and Diseases. Wiley-VCH Verlag GmbH & Co. KGaA.
de La Serre, C. B. et al. 2010. Propensity to high-fat diet-induced obesity in rats is associated with changes in the gut microbiota and gut inflammation. Am. J. Physiol. 299: G440-G448.
Dritz, S. S. et al. 1996. Influence of lipopolysaccharide-induced immune challenge and diet complexity on growth performance and acute-phase protein production in segregated early-weaned pigs. J. Anim. Sci. 74: 1620-1628.
Elsbach, P. 2000. Mechanisms of disposal of bacterial lipopolysaccharides by animal hosts. Microbes Infect 2: 1171-1180.
Erridge, C., T. Attina, C. M. Spickett, and D. J. Webb. 2007. A high-fat meal induces low-grade endotoxemia: evidence of a novel mechanism of postprandial inflammation. Am. J. Clin. Nutr. 86: 1286-1292.
Feulner, J. A. et al. 2004. Identification of acyloxyacyl hydrolase, a lipopolysaccharide-detoxifying enzyme, in the murine urinary tract. Infect Immun 72: 3171-3178.
Gabler, N. K., J. S. Radcliffe, J. D. Spencer, D. M. Webel, and M. E. Spurlock. 2009. Feeding long-chain n-3 polyunsaturated fatty acids during gestation increases intestinal glucose absorption potentially via the acute activation of AMPK. J. Nutr. Biochem. 20: 17-25.
Gabler, N. K., J. D. Spencer, D. M. Webel, and M. E. Spurlock. 2008. n-3 PUFA attenuate lipopolysaccharide-induced down-regulation of toll-like receptor 4 expression in porcine adipose tissue but does not alter the expression of other immune modulators. J. Nutr. Biochem. 19: 8-15.
Gardiner, K. R. et al. 1995. Significance of systemic endotoxaemia in inflammatory bowel disease. Gut 36: 897-901.
Gilbert, H. et al. 2007. Genetic parameters for residual feed intake in growing pigs, with emphasis on genetic relationships with carcass and meat quality traits. J. Anim. Sci. 85: 3182-3188.
172
Hall, W. F., T. E. Eurell, R. D. Hansen, and L. G. Herr. 1992. Serum haptoglobin concentration in swine naturally or experimentally infected with Actinobacillus pleuropneumoniae. J. Am. Vet. Med. Assoc. 201: 1730-1733.
Herd, R. M., and P. F. Arthur. 2009. Physiological basis for residual feed intake. J. Anim. Sci. 87: E64-71.
Kelly, C. J., S. P. Colgan, and D. N. Frank. 2012. Of Microbes and Meals. Nutr Clinical Pract 27: 215-225.
Kimball, S. R. et al. 2003. Endotoxin induces differential regulation of mTOR-dependent signaling in skeletal muscle and liver of neonatal pigs. Am. J. Physiol. Endocrinol. Metab. 285: E637-644.
Lallès, J.-P. 2010. Intestinal alkaline phosphatase: multiple biological roles in maintenance of intestinal homeostasis and modulation by diet. Nutr Rev 68: 323-332.
Livak, K. J., and T. D. Schmittgen. 2001. Analysis of Relative Gene Expression Data Using Real-Time Quantitative PCR and the 2−ΔΔCT. Method. Methods 25: 402-408.
Lu, M. et al. 2005. Lipopolysaccharide deacylation by an endogenous lipase controls innate antibody responses to Gram-negative bacteria. Nat. Immunol. 6: 989-994.
Mani, V., T. E. Weber, L. H. Baumgard, and N. K. Gabler. 2012. Growth and Development Symposium: Endotoxin, inflammation, and intestinal function in livestock. J. Anim. Sci. 90: 1452-1465.
May, K. D., J. E. Wells, C. V. Maxwell, and W. T. Oliver. 2012. Granulated lysozyme as an alternative to antibiotics improves growth performance and small intestinal morphology of 10-day-old pigs. J. Anim. Sci. 90: 1118-1125.
McDermott, C., and B. Fenwick. 1992. Neutrophil activation associated with increased neutrophil acyloxyacyl hydrolase activity during inflammation in cattle. Am. J. Vet Res. 53: 803-807.
Moeser, A. J., L. B. Borst, B. L. Overman, and J. S. Pittman. 2012. Defects in small intestinal epithelial barrier function and morphology associated with peri-weaning failure to thrive syndrome (PFTS) in swine. Res Vet Sci. 93(2): 975-982.
Munford, R., M. Lu, and A. Varley. 2009. Chapter 2 Kill the Bacteria...and Also Their Messengers? In: W. A. Frederick (ed.) Advances in Immunology No. Volume 103. p 29-48. Academic Press.
173
Orellana, R. A. et al. 2007. Insulin stimulates muscle protein synthesis in neonates during endotoxemia despite repression of translation initiation. Am. J. Physiol. Endocrinol. Metab. 292: E629-636.
Pinton, P. et al. 2010. Deoxynivalenol Impairs Porcine Intestinal Barrier Function and Decreases the Protein Expression of Claudin-4 through a Mitogen-Activated Protein Kinase-Dependent Mechanism. J. Nutr. 140: 1956-1962.
Poelstra, K. et al. 1997. Dephosphorylation of endotoxin by alkaline phosphatase in vivo. Am. J. Pathol. 151: 1163-1169.
Rakhshandeh, A., and C. F. de Lange. 2012. Evaluation of chronic immune system stimulation models in growing pigs. Animal: International J Anim Biosci 6: 305-310.
Ravin, H. A., D. Rowley, C. Jenkins, and J. Fine. 1960. On the absorption of bacterial endotoxin from the gastro-intestinal tract of the normal and shocked animal. J. Exp. Med. 112: 783-792.
Schinckel, A. P. et al. 1995. Effects of antigenic challenge on growth and composition of segregated early-weaned pigs. Swine Health Prod 3: 228-234.
Suzuki, K., H. Ota, S. Sasagawa, T. Sakatani, and T. Fujikura. 1983. Assay method for myeloperoxidase in human polymorphonuclear leukocytes. Analy Biochem 132: 345-352.
Takada, K., N. Ohno, and T. Yadomae. 1994. Detoxification of lipopolysaccharide (LPS) by egg white lysozyme. FEMS Immunol Med Microbiol 9: 255-263.
Tomita, M., R. Ohkubo, and M. Hayashi. 2004. Lipopolysaccharide transport system across colonic epithelial cells in normal and infective rat. Drug Metab. Pharmacokinet. 19: 33-40.
Tomlinson, J. E., and A. T. Blikslager. 2004. Interactions between lipopolysaccharide and the intestinal epithelium. Amer Vete Med Assoc 224: 1446-1452.
Triantafilou, M., K. Miyake, D. T. Golenbock, and K. Triantafilou. 2002. Mediators of innate immune recognition of bacteria concentrate in lipid rafts and facilitate lipopolysaccharide-induced cell activation. J Cell Sci 115: 2603-2611.
Vaarala, O., M. A. Atkinson, and J. Neu. 2008. The "perfect storm" for type 1 diabetes: the complex interplay between intestinal microbiota, gut permeability, and mucosal immunity. Diabetes 57: 2555-2562.
174
Wang, Q., C. H. Fang, and P.-O. Hasselgren. 2001. Intestinal permeability is reduced and IL-10 levels are increased in septic IL-6 knockout mice. Am J Phy - Reg, Integ Comp Physiol 281: R1013-R1023.
Webel, D. M., B. N. Finck, D. H. Baker, and R. W. Johnson. 1997. Time course of increased plasma cytokines, cortisol, and urea nitrogen in pigs following intraperitoneal injection of lipopolysaccharide. J. Anim. Sci. 75: 1514-1520.
Weber, T. E., and B. J. Kerr. 2008. Effect of sodium butyrate on growth performance and response to lipopolysaccharide in weanling pigs. J. Anim. Sci. 86: 442-450.
Wright, K. J. et al. 2000. Integrated adrenal, somatotropic, and immune responses of growing pigs to treatment with lipopolysaccharide. J. Anim. Sci. 78: 1892-1899.
Young, J. M., W. Cai, and J. C. Dekkers. 2011. Effect of selection for residual feed intake on feeding behavior and daily feed intake patterns in Yorkshire swine. J. Anim. Sci. 89: 639-647.
175
Figure 1. Circulating serum endotoxin levels in pigs divergently selected for high (HRFI) or low (LRFI) residual feed intake. N= 12 pigs/line.
0
5
10
15
20
25S
eru
m E
nd
otox
in(E
U/m
L)
HRFI LRFI
P = 0.0014
176
Figure 2. Serum haptoglobin concentration in pigs divergently selected for high (HRFI) or low (LRFI) residual feed intake. N= 12 pigs/line.
0.0
0.1
0.2
0.3
0.4
0.5
0.6
0.7
Hap
togl
obin
(mg/
mL
)
HRFI LRFI
P ≤ 0.05
177
Figure 3. Ileum myeloperoxidase activity in pigs divergently selected for high (HRFI) or low (LRFI) residual feed intake. N= 12 pigs/line.
0
1
2
3
4
5M
yelo
per
oxid
ase
Act
ivit
y(m
U/m
g p
rote
in)
HRFI LRFI
P = 0.047
178
Figure 4. Ileum interleukin 8 protein concentration in pigs divergently selected for high (HRFI) or low (LRFI) residual feed intake. N= 12 pigs/line.
0.0
0.5
1.0
1.5
2.0
2.5
Inte
rleu
kin
-8(µ
g/g
pro
tein
)
HRFI LRFI
P = 0.062
179
Figure 5. Liver and Ileum alkaline phosphatase activity in pigs divergently selected for high (HRFI) or low (LRFI) residual feed intake. N= 6 pigs/line.
0
200
400
600
800
1000
1200
Liver Ileum
Alk
alin
e P
hso
ph
atas
e ac
tivi
ty(m
U/m
g p
rote
in)
HRFI
LRFI
P < 0.018
P < 0.01
180
Figure 6. Liver and ileum lysozyme activity in pigs divergently selected for high (HRFI) or low (LRFI) residual feed intake. N= 6 pigs/line.
0
5
10
15
20
Liver Ileum
Lys
ozym
e ac
tivi
ty
(U/m
g p
rote
in)
HRFI
LRFI
P < 0.01
P = 0.25
181
Table 1. Primer sequences for quantitative real-time PCR
Target gene Sense (5'- 3') Antisense (5'- 3') AOAH (159 bp) TCAGGGGGACAGAAATATGG CCAGAATCACGCAGAATCAC Lysozyme (NM_214392.2; 80 bp) CGGTGCGAGTTCGCCAGAATTC AAACACACCCAGTTCGCCAGGC Intestinal alkaline phosphatase (XM_003133729; 139 bp)
GTCAGAACGGAGTTCGGAAG
AGGCCCATGAGGTGTGTTAC
Claudin 3 (NM_001160075; 95 bp) CATCGGCAGCAGCATTATC ACACTTTGCACTGCATCTGG Claudin 4 (NM_001161637.1; 110 bp) AGGTGATGGGTATCGCCCTGGC CGACGTGACGATGTTGCTGCC Occludin (NM_00163647; 115 bp) ATCCTGGGTGTGATGGTGTT ACTGGTTGCAGAGGGCATAG
β-2-Microglobulin TGGTCTTTCTACCTTCTGGTCC TGTGATGCCGGTTAGTGGTCTC
182
Table 2. Intestinal integrity is not altered in gilts divergently selected for low (LRFI) and high (HRFI) residual feed intake
Parameters Ileum Colon
SEM P-value
LRFI1 HRFI1 LRFI1 HRFI1 Line Tissue Line*Tissue TER2 (Ω/cm2) 108 103 78 73 13.9 0.66 0.04 0.99 FITC-Dextran3 (Papp) 0.48 0.52 0.13 0.19 0.09 0.15 <0.001 0.50 FITC-LPS3 (Papp) 2.76 3.63 3.95 3.39 0.72 0.83 0.54 0.35
1 n=6 pigs/line. 2 Transepithelial resistance (TER). 3Papp=Apparent permeability coefficient (µg/mL/min/cm).
183
Table 3. Ileum tight junction protein gene expression pigs selected for high (HRFI) or low residual feed intake (LRFI).
Gene HRFI1,2 LRFI1,2 SEM P-value
Claudin 3 14.76 14.41 0.530 0.65
Claudin 4 8.09 8.00 0.874 0.94
Occludin 13.75 12.01 0.936 0.22 1 N=6 pigs/line. 2 Mean gene expression (ΔΔCT) from β-2-microglobulin housekeeper.
184
Table 4. Lipopolysaccharide and Gram positive bacteria detoxification mRNAs in pigs divergently selected for high (HRFI) and low (LRFI) residual feed intake
1 N=6 pigs/line. 2 Mean gene expression (ΔΔCT) from β-2-microglobulin housekeeper.
Gene HRFI1,2 LRFI1,2 SEM P-value
Liver Acyloxyacyl hydrolase 5.38 6.34 0.87 0.30
Ileum Acyloxyacyl hydrolase 7.45 6.98 0.35 0.37
Ileum Lysozyme 8.22 7.41 0.97 0.57
Ileum Alkaline Phosphatase 12.38 11.97 0.77 0.71
185
Table 5. Residual correlations of performance parameters, endotoxin transport and serum concentration, and alkaline phosphatase
in gilts divergently selected for residual feed intake1
ADFI2 ADG2 Gain:Feed2 RFI Index3
Serum endotoxin2
Ileum Endotoxin permeability2
Ileum Alkaline Phosphatase2
Ileum Lysozyme2
ADFI1 1.000 0.35 0.003
-0.58 0.003
0.65 0.0008
0.57 0.003
0.50 0.10
-0.45 0.14
-0.21 0.49
ADG1 1.00 0.55 0.006
0.02 0.92
0.14 0.52
-0.29 0.35
0.28 0.38
0.40 0.20
Gain:Feed1 1.00 -0.55 0.007
-0.40 0.052
-0.47 0.13
0.47 0.12
0.34 0.27
RFI Index2 1.00 0.34 0.13
0.57 0.052
-0.43 0.17
-0.26 0.41
Serum endotoxin1
1.00 0.66 0.019
-0.63 0.027
-0.43 0.16
Ileum Endotoxin permeability1
1.00 -0.40 0.19
-0.49 0.105
Ileum Alkaline Phosphatase1
1.00 0.25 0.43
Ileum Lysozyme2
1.00
1Upper row = residual correlations. Bottom row = P ‐ values. 2ADFI = kg/d, ADG = g/d, Serum endotoxin = EU/mL, Ileum Endotoxin permeability = Papp, Ileum Alkaline Phosphatase = mU/mg; Ileum Lysozyme = U/mg. 3Residual feed intake (RFI) = adfi‐β1(ontest wt deviation)+β2(offtest wt deviation)+β3(metabolic mid‐wt)+β4(adg)+β5(offtest backfat)
186
CHAPTER 7. GENERAL CONCLUSIONS
A multitude of factors affect the health and production performance of farm animals
and human health and wellbeing. Lipopolysaccharide and its associated inflammation is one
such factor that has received much attention. This thesis research provided further
understanding into the mechanism by which LPS enters the body and its ability to induce
inflammation as well as the impact dietary fat has on modulation of intestinal LPS
permeability and signaling. A particular emphasis was placed on the role DHA and EPA n-3
PUFA have on these processes.
Recent evidence suggests that high caloric and high dietary fat increases serum LPS
concentration and induce acute low grade inflammation, a predisposing factor for common
metabolic diseases such as obesity, insulin resistance and atherosclerosis (Erridge et al.,
2007; Ghanim et al., 2010). In Chapter 3 of this thesis, we first sought to explore whether
fatty acid composition of common household dietary oils differentially modulates intestinal
LPS permeability using in vivo and ex vivo pig models. Dietary oils were orally administered
to pigs and postprandial serum LPS concentration determined. Additionally, freshly isolated
ileum tissues were pretreated ex vivo in modified Ussing chambers with different dietary oils
and FITC-LPS permeability was assessed. These experiments indicated that oils rich in n-3
PUFA, such as fish and cod liver oil decreased postprandial LPS concentration. Oils rich in
saturated fatty acids, such as coconut oil, increased the ileum LPS permeability. However,
oils rich in monounsaturated fatty acids, i.e. corn oil and olive oil, did not alter LPS
permeability or circulating LPS concentration. Interestingly, corn oil has been previously
187
Figure 1. Schematic representation of lipopolysaccharide (LPS) intestinal permeability and systemic signaling under normal, n-3 PUFA supplemented and LPS challenge conditions. Under normal conditions, lipid rafts are enriched with cholesterol, n-6 and saturated fatty acids and they are stable or ordered to facilitate membrane signaling. Lipopolysaccharide stimulation causes toll-like receptor (TLR)-4 localization into lipid rafts which facilitate receptor mediated LPS permeability or signaling. This results in increased pro-inflammatory cytokine production and immune activation. However, n-3 PUFA such as docosahexaenoic acid (DHA) and eicosapentaenoic acid (EPA) enrich membrane phospholipids and cause lipid rafts to become less ordered and dissociated. This leads to decreased localization of TLR4 into the rafts which eventually results in attenuated LPS signaling and permeability. Alternatively, after LPS challenge, decreased localization of TLR4 into raft occurs which causes an attenuated inflammatory response and desensitization to subsequent LPS. The dotted lines and boxes indicate mechanisms which are not completely understood yet.
188
shown to increase postprandial endotoxemia (Cani et al., 2007; Laugerette et al., 2012). This
discrepancy may be due to the different species of animals used in these papers and divergent
experimental conditions. Finally, in this Chapter we explored the role of saturated fatty acids
and lipid raft mediated LPS permeability in ex vivo intestinal segments. We showed that
saturated fatty acids stabilize the lipid rafts which enhance LPS permeability and dissociation
of lipid raft lead to decreased saturated fatty acid mediated LPS permeability implicating
lipid raft’s essential role in LPS permeability.
Lipopolysaccharide enters the circulation from the intestine through three major
routes. 1) Receptor mediated endocytosis through toll like receptor (TLR) 4 mediated
mechanisms; 2) paracellular permeability through tight junctions if the intestine is damaged;
or 3) postprandial permeability through micelles (Kelly et al., 2012; Tomita et al., 2004).
Paracellular and micellar mode of entry may not account completely for the decreased LPS
permeability we observed with dietary n-3 PUFA in Chapter 3. To explore the mechanisms
by which of n-3 PUFA attenuate intestinal LPS permeability, we raised pigs on either a corn-
soybean or EPA and DHA enriched diets (Chapter 4). Thereafter, we stimulated an
inflammatory response in these pigs with LPS and measured their inflammatory parameters.
These data suggest n-3 PUFA attenuated the LPS induced febrile and inflammatory response.
This work agrees with research by Huang et al in which DHA and EPA reduced LPS
signaling and inflammation (Huang et al., 2012).
Interestingly, n-3 PUFA supplemented pigs also had lower endogenous circulating
LPS concentration and reduced ex vivo intestinal LPS permeability (Chapter 4). Intestinal
epithelial cells are part of innate immune system and express TLRs similar to immune cells
189
such as macrophages (Abreu, 2010). In macrophages, DHA attenuated LPS mediated
immune signaling by preventing the localization of the LPS receptor TLR4 into the cell
membrane lipid raft microdomains (Fan et al., 2004; Wong et al., 2009). Therefore, we
explored whether the same phenomena might be exhibited in the intestinal epithelium and
that n-3 PUFA dissociation of the lipid raft order may explain attenuated transcellular LPS
permeability. Lipid raft from the intestinal epithelium were isolated and the LPS signaling
and permeability proteins (TLR4 and CD14) localization into lipid rafts were measured.
Herein, we report that dietary n-3 PUFA enrichment decreased localization of TLR4 and
CD14 in the lipid rafts. Phospholipid fatty acid composition of the lipid raft fractions
revealed the enrichment of phosphatidyl ethanolamine and phosphatidyl serine with DHA
and EPA which has the potential to dissociate the lipid rafts and prevent the localization of
proteins (Fan et al., 2003). Therefore, n-3 PUFA enrichment associated destabilization and
dissociation of the lipid raft results in decreased LPS signaling and permeability which might
account for the decreased LPS permeability and circulating LPS concentrations in our pig
models.
An acute systemic inflammatory challenge resulted in the removal of intestinal TLR4
and CD14 from the lipid rafts of control pigs making the animal vulnerable to any further
immune challenge whereas n-3 PUFA supplemented pigs had TLR4 and CD14 still present
in the rafts giving the advantage of defending the next immune challenge. Our results
indicate that enrichment of intestinal epithelial cell membrane phospholipids with n-3 PUFA
destabilizes and dissociates the lipid raft resulting in decreased LPS signaling and
permeability.
190
Long term supplementation of high dietary saturated fat shifts the microbial
population of the intestine resulting in the death of gram negative bacteria in large numbers
which subsequently become sources of serum LPS as well as decreasing the beneficial gram
positive bacteria which would contribute to gram negative bacterial overgrowth (Cani et al.,
2007; Kim et al., 2012; Laugerette et al., 2012). Interestingly, long term n-3 PUFA
supplementation has not been shown to change the microbial population of the intestine
(Geier et al., 2009; Li et al., 2011). So, in our study n-3 PUFA supplementation may not
have shifted the microbial population towards more Gram negative organisms which might
have led to more LPS production. The differences we observed with regard to the serum LPS
might have come mostly from differences in intestinal TLR4 localization in the lipid rafts
and transcellular LPS permeability.
Maternal supplementation of n-3 PUFA during gestation and lactation has been
shown to have beneficial effects in the offspring immediately after birth as well as later in
life such as increasing IQ and controlling obesity and neutrophil infiltration (Helland et al.,
2003; Taylor and Poston, 2007). In Chapter 5 of our research we examined the effect of
maternal n-3 PUFA supplementation during both gestation and lactation modulating LPS
induced inflammation later in life. Maternal n-3 PUFA supplementation had an anti-
inflammatory effect which is almost equivalent to the continuously supplemented pigs.
Maternal n-3 PUFA supplementation induced the n-3 PUFA enrichment of buffy coat,
decreased the febrile response, decreased the serum cytokine levels for TNF-α and mRNA
abundance of cytokines TNF-α, IL-1β and IL-10 in buffy coat cells. Further supplementation
also decreased expression of LPS signaling proteins including TLR4, CD14 and Myd88 in
191
buffy coat cells under LPS challenge. Our research indicates that maternal supplementation
with n-3 PUFA provides protective advantages against inflammation later in life.
To understand the relationship between intestinal barrier integrity, endotoxin and
inflammation with feed efficiency, in Chapter 6 we used pigs divergently selected for
residual feed intake (RFI, with low RFI being more efficient compared to high RFI). These
two lines of pigs provide an excellent model to study the physiological mechanisms behind
feed efficiency in pigs. HRFI pigs exhibited a greater level of basal inflammation compared
to their LRFI counterparts. Furthermore, the LRFI pigs had lower circulating endotoxin
concentration and more robust LPS detoxification and anti-microbial enzyme machinery.
Chronic immune stimulation like persistent presence of higher endotoxin in the serum has the
potential to divert nutrients away from anabolic processes to immune functions resulting in
reduced growth (Buchanan and Johnson, 2007; Gabler and Spurlock, 2008). Lower
endotoxin and inflammatory markers and the enhanced activities of antimicrobial enzymes in
the LRFI line may not fully explain the difference in the feed efficiency between the lines;
but they have the potential to prevent the growth potential in HRFI pigs.
Overall, this research lays the foundation for several hypothesis driven objectives
which will have immense beneficial effects for humans and livestock. The first line of
research could be to measure the exact contribution of LPS and its associated inflammation
on feed efficiency, appetite and lean tissue accretion in livestock. This work could be done
with animals of same genetic background and raised in germ free environment administered
with a known dose(s) of LPS.
192
A second line of research could identify the changes in intestinal bacterial populations
and their contribution to endotoxemia. Little is known about the effects of dietary fats on
intestinal microbiota. Metagenomic and bacteria viability assays could be used to determine
the dynamic shift in bacterial populations during fatty acid administration. Further, whether
processed oils have the same biological effects as unprocessed oils should also be
investigated as cooking at high temperatures is known to degrade unsaturated fatty acids
which might have a different biological function and also has the potential for negative health
consequences.
Thirdly, one could identify the exact percentage of n-3 PUFA need to be
supplemented to give the beneficial anti-inflammatory effects and also does not compromise
the carcass quality. Further, studying immune cell infiltration into the intestinal epithelium
and the extent of intestinal inflammation contributes towards intestinal integrity and function
warrants more attention. Further, investigation of mechanisms of anti-inflammatory effect of
n-3 PUFA in the intestine will have beneficial effects and therapeutic applications in two
most important human intestinal diseases like infectious bowel disease and ulcerative colitis.
Finally, Mechanism of n-3 PUFA epigenetic modifications during maternal
supplementation and the anti-inflammatory effect in the offspring of n-3 PUFA could also be
a potential avenue for research. Changes in methylation pattern through binding assays,
assessing chromatin remodeling through histone modifications using chromatin immune
precipitation assay as well as deep sequencing for identifying single nucleotide
polymorphisms under n-3 PUFA supplementation can be carried out.
193
In conclusion, this dissertation presented evidence that the presence of LPS is
correlated to feed efficiency. Furthermore, dietary fat in particular saturated and n-3 PUFA
differentially modulates intestinal LPS permeability and signaling. These fatty acids appear
to play a critical role in lipid raft mediated signaling and assembly of signaling proteins. By
studying the role of lipid rafts and dietary fatty acids in LPS and bacterial pathogenesis, gives
us opportunities to better understand, prevent and treat disease and inflammation. This
research will then enable us to improve livestock performance and human health and
wellbeing.
Reference
Abreu, M. T. 2010. Toll-like receptor signalling in the intestinal epithelium: how bacterial recognition shapes intestinal function. Nat Rev Immunol 10: 131-144.
Buchanan, J. B., and R. W. Johnson. 2007. Regulation of food intake by inflammatory
cytokines in the brain. Neuroendocrinology 86: 183-190. Cani, P. D. et al. 2007. Metabolic endotoxemia initiates obesity and insulin resistance.
Diabetes 56: 1761-1772. Erridge, C., T. Attina, C. M. Spickett, and D. J. Webb. 2007. A high-fat meal induces low-
grade endotoxemia: evidence of a novel mechanism of postprandial inflammation. Am J Clin Nutr 86: 1286-1292.
Fan, Y.-Y., D. N. McMurray, L. H. Ly, and R. S. Chapkin. 2003. Dietary (n-3)
Polyunsaturated Fatty Acids Remodel Mouse T-Cell Lipid Rafts. J. Nutr. 133: 1913-1920.
Fan, Y. Y., L. H. Ly, R. Barhoumi, D. N. McMurray, and R. S. Chapkin. 2004. Dietary docosahexaenoic acid suppresses T cell protein kinase C theta lipid raft recruitment and IL-2 production. J Immunol 173: 6151-6160.
Gabler, N. K., and M. E. Spurlock. 2008. Integrating the immune system with the regulation
of growth and efficiency. J Anim Sci 86: E64-E74.
194
Geier, M. S. et al. 2009. Dietary omega-3 polyunsaturated fatty acid does not influence the intestinal microbial communities of broiler chickens. Poult Sci 88: 2399-2405.
Ghanim, H. et al. 2010. Orange juice neutralizes the proinflammatory effect of a high-fat,
high-carbohydrate meal and prevents endotoxin increase and Toll-like receptor expression. Am J Clin Nutr 91: 940-949.
Helland, I. B., L. Smith, K. Saarem, O. D. Saugstad, and C. A. Drevon. 2003. Maternal
supplementation with very-long-chain n-3 fatty acids during pregnancy and lactation augments children's IQ at 4 years of age. Pediatrics 111: e39-44.
Huang, S. et al. 2012. Saturated fatty acids activate TLR-mediated pro-inflammatory
signaling pathways. J Lipid Res 53:2002-2013. Kelly, C. J., S. P. Colgan, and D. N. Frank. 2012. Of Microbes and Meals. Nutrition in
Clinical Practice 27: 215-225. Kim, K.-A., W. Gu, I.-A. Lee, E.-H. Joh, and D.-H. Kim. 2012. High Fat Diet-Induced Gut
Microbiota Exacerbates Inflammation and Obesity in Mice via the TLR4 Signaling Pathway. PLoS ONE 7: e47713.
Laugerette, F. et al. 2012. Oil composition of high-fat diet affects metabolic inflammation
differently in connection with endotoxin receptors in mice. Am J Physiol Endocrinol Metab 302: E374-386.
Li, Q. et al. 2011. Fish Oil Enhances Recovery of Intestinal Microbiota and Epithelial
Integrity in Chronic Rejection of Intestinal Transplant. PLoS ONE 6: e20460. Taylor, P. D., and L. Poston. 2007. Developmental programming of obesity in mammals.
Experimental Physiology 92: 287-298. Tomita, M., R. Ohkubo, and M. Hayashi. 2004. Lipopolysaccharide transport system across
colonic epithelial cells in normal and infective rat. Drug Metab Pharmacokinet 19: 33-40.
Wong, S. W. et al. 2009. Fatty acids modulate Toll-like receptor 4 activation through
regulation of receptor dimerization and recruitment into lipid rafts in a reactive oxygen species-dependent manner. J Biol Chem 284: 27384-27392.
195
APPENDIX: ABSTRACTS SUBMITTED
The modulation of intestinal endotoxin transport by different dietary fats
Venkatesh Mani1,3 and Nicholas K. Gabler1,2
1Department of Animal Science, 2Nutrition and Wellness Research Center (NWRC), 3Interdepartmental Toxicology Graduate Program, Iowa State University, Ames, IA, 50010
Experimental Biology, Anaheim, CA, April, 2010,
Intestinal derived endotoxin and the subsequent endotoxemia are considered to be
major predisposing factors for diseases such as atherosclerosis, sepsis, obesity and diabetes.
Therefore, the aim of this study was to assess the effects of dietary fat on intestinal endotoxin
transport. We hypothesized that saturated fat (SF) would augment, while n-3 fatty acids (FA)
would attenuate endotoxin transport across the small intestine of pigs. Eleven pigs (three-four
weeks of age) were euthanized and jejunum segments were mounted in modified Ussing
chambers. Segments were treated with either no oil (CON), 12.5% (v/v) vegetable oil (VO),
DHA (DO), cod liver oil (CLO), coconut oil (CO) or olive oil (OO) in 20 mM bile acid. Ex
vivo endotoxin transport was measured by the addition of fluoroscein isothiocyanate labeled
lipopolysaccharide (FITC-LPS, 20 µg/mL) and serial sampling of the mucosal and serosal
chambers. Fluorescence was measured in a plate reader and an apparent permeability
coefficient (Papp) was calculated using the surface area and transport rate. Compared to the
CON, DO and CLO reduced the endotoxin Papp by 50% (P<0.01). However, versus the
CON, CO increased the Papp by 60% (P=0.008). OO and VO Papp were not different from
the CON. Overall, these data indicate that fat high in n-3 FA can attenuate intestinal
endotoxin transport, while SF augments endotoxin transport. This work was supported by the
USDA and NWRC.
196
Dietary n-3 fatty acids attenuates colon endotoxin transport in growing pigs
Venkatesh Mani 1,, Nicholas Boddicker 1,, Emily Kuntz 1,, Allison Flinn 1,, Joel Spencer 12 and Nicholas Gabler1
1Iowa State University, Ames, IA, 2JBS United, Sheridan IN, 3USDA-ARS, Ames, IA.
Midwest Animal Science Meeting, Des Moines, IA, March, 2010
Intestinal absorption of the bacterial endotoxin plays an important role in the
development of intestinal dysfunction, inflammation, peripheral tissue catabolism and
reduced pig performance by activating the immune system. However, the ability of dietary n-
3 fatty acids (FA), such as docosahexaenoic acid (DHA) and eicosapentaenoic acid (EPA), to
regulate intestinal endotoxin transport in growing pigs is unknown. Therefore, this study
aimed to evaluate the ability of dietary n-3 FA to attenuate large intestine endotoxin transport
and circulating endotoxin levels in growing pigs under basal or immune challenged
conditions. Ten pigs (22±2.4 kg BW) were fed one of two diets, either a standard corn-
soybean control diet (CON) or the CON plus 0.5% Gromega™ (JBS United Inc., Sheridan,
IN), which was high in DHA and EPA (GRO). After 8 weeks of feeding, the CON and GRO
groups were sub-divided and challenged (n=5 pigs/trt) with an intramuscular injection of
either saline (SAL) or lipopolysaccharide (CH; LPS 10 µg/kg BW). The febrile response was
measured by rectal temperature hourly, blood was collected at 0 and 4 h for serum endotoxin
levels and the pigs were euthanized 4 hrs post-challenge. Segments of the mid-colon were
isolated, flushed and mounted in modified Ussing chambers to measure ex vivo FITC-LPS
endotoxin transport and an apparent permeability coefficient (Papp) was calculated using the
area of the membrane and transport rate. Average rectal temperatures tended to be reduced in
197
the GRO vs CON pigs, P<0.055. Furthermore, CON pigs had higher endotoxin transport
compared to the GRO pigs (7.4 vs 2.0, respectively, P=0.02). Irrespective of diet, CH
lowered the endotoxin transport compared to the SAL pigs (P=0.02). There is significant
difference between CON-SAL and GRO-SAL colon Papp (11.4 vs 3.3, respectively, P<0.01),
however, there were no differences between the CON-CH and GRO-CH pigs. Four hour
post-challenge serum endotoxin level tended to five-fold higher in the CON vs GRO pigs
(P=0.07). Overall, these data indicate that n-3 FA may mitigate colon transport and serum
levels of endotoxin
198
Bitter compounds decrease gastric emptying and influence intestinal nutrient transport
Venkatesh Mani1’4, James Hollis2,3 and Nicholas K. Gabler1, 3,4
1Department of Animal Science, 2Department of Food Science and Human Nutrition, 3Nutrition and Wellness Research Center, 4Interdepartmental Toxicology Program, Iowa State University, Ames, IA, 50010
Experimental Biology, Washington D.C, April, 2011.
Taste alters food perception and may contribute to body weight regulation. Bitter
taste receptor expression has been demonstrated in the tongue, stomach, intestine, and lung.
Bitter compounds increase intestinal hormone secretions of GLP-1, PYY, GIP and CCK,
which are associated with gastric emptying, intestinal motility and satiety. Therefore, the
aim of this study was to assess the effect of bitter compounds on gastric emptying (GE) and
nutrient transport (NT) in pigs. Sixteen pigs (35±3 kg body weight) were fasted overnight
and fed a 600 g meal that was either a control meal or an identical meal containing 1 mM
phenylthiocarbamide (PTC). Exactly 45 min after completing the meal, all pigs were
euthanized and the weight of gastric contents measured. Further, jejunum segments were
excised and mounted into modified Ussing chambers for NT. The jejunum was pre-treated
for 30 minutes with or without 5 mM PTC before measuring glucose, lysine and glutamine
transport. All pigs ate their respective meal. However, the PTC meal decreased gastric
emptying by 30% compared to the control (P < 0.01). Glucose, lysine and glutamine NT was
increased by 250% compared to the control pigs (P<0.05). However, ex vivo jejunum pre-
treatment with PTC had no effect on NT (P > 0.1). Overall, these data indicate that feeding
PTC decreases GE and increases NT in the intestine, but localized exposure of the intestine
to PTC doesn’t have any effect.
199
The effects of immune stressors on porcine intestinal epithelial cell integrity and
inflammation
V. Mani1, S.C. Pearce1, A. J.Harris1, T.E. Weber 2 and N.K. Gabler1
1Department of Animal Science, 2USDA-ARS, Ames, IA, Iowa State University, Ames, IA
Digestive Physiology of Pigs, Keystone, Colorado, June, 2012
Intestinal epithelial cells continually encounter luminal pathogens, immunogens and toxins.
However, data regarding the effects of these substances on intestinal integrity and function in
pigs are limited. Our study objective was to examine the effect of immunogens on barrier
integrity and inflammation in IPEC-J2 cells. Cells were plated on 0.4 µm pore size collagen
coated transwells, where they form a single confluent monolayer, polarize and form tight
junctions (TJ). The transepithelial electrical resistance (TER) was measured to evaluate TJ
formation and integrity along with FITC-Dextran (FD, 4 kDa) macromolecule permeability.
When the cells attained peak TER, approximately 9 days post confluence, cells were treated
with the immune agonists lipopolysaccharide (LPS, 10 µg/ml, E.coli 055:05), PolyI:C (PIC,
20 µg/ml), zymosan (ZYM, 100 µg/ml) and deoxynivalenol (DON, 20 µm) on the luminal
side, or with tumor necrosis factor α (TNFα) and interleukin 1β (IL1β) on the basolateral side
for 48 hours. The TER and FD permeability was assessed for membrane integrity. Interleukin
8 (IL-8) secreted into the media was measured as a marker of inflammation. After 48 h of
DON or TNFα treatment, TER was significantly reduced compared to the non-challenged
control (P<0.05; 53 and 63%, respectively). The TER was not different from the control
when cells were exposed to ZYM, PIC or IL1β. Further, FD permeability did not differ
200
between the treatments. Compared to the control, media IL-8 concentrations were increased
by TNFα and LPS (P<0.05; 0.03, 2.68 and 0.96 ng/ml, respectively). Treatment with PIC
and ZYM did not increase IL-8 secretion (P>0.10; 0.61 and 0.31 ng/ml respectively). These
data indicate that IPEC-J2 cells are particularly responsive to inflammation and barrier
integrity modifications induced by DON, TNFα and LPS. However, barrier integrity appears
to be maintained under most challenge conditions.
201
Lipopolysaccharide and n-3 fatty acids alter intestinal Toll like receptor 4 (TLR4)
recruitment and function
V. Mani1, J.D. Spencer2, J. Hollis1, T.E. Weber 3 and N.K. Gabler1
1Iowa State University, Ames, IA, 2JBS United, Sheridan IN, 3USDA-ARS, Ames, IA.
Digestive Physiology of Pigs, Keystone, Colorado, June, 2012
Previously we reported that dietary n-3 fatty acids (FA) decrease intestinal
lipopolysaccharide (LPS) transport (LT) and serum endotoxin in pigs. Endotoxin or LPS is
recognized by TLR4 to initiate an innate immune response. Localization of TLR4 to lipid raft
(LR) membrane micro domains is critical for cellular LT and signaling in numerous cells.
Our objective was to examine the effects of n-3 FA and LPS on intestinal TLR4 LR
recruitment and LT. Twenty pigs (22±2.4 kg) were fed two diets: 1) control (CON); 2) CON
plus 0.5% Gromega™ (GRO, JBS United Inc.), high in docosahexaenoic acid (DHA) and
eicosapentaenoic acid (EPA) n-3 FA. After eight weeks, the CON and GRO pigs were
challenged (n=5 pigs/trt) with either an I.M. injection of E. coli LPS (CH; 10 µg/kg BW) or
saline (SAL). Four hours after CH or SAL, pigs were euthanized and ileum and colon
segments mounted into Ussing chambers to measure ex vivo FITC-LPS apparent
permeability coefficient (Papp) as a marker of LT. Ileum and colon mucosa were assessed for
n-3 FA enrichment, LR isolated and membrane localization of TLR4 determined. Compared
to the CON, pigs fed GRO had increased ileum and colon EPA, DHA and total n-3 FA
content (P<0.05; 200, 250, 300%, respectively). Overall, ileum LT did not differ due to FA
or CH treatments. However, GRO-SAL treated pigs tended to have decreased LT by 37%
202
compared to the CON-SAL pigs (P=0.06). Pigs injected with CH had attenuated colon LT
(P=0.02). Pigs fed GRO also had reduced colon LT compared to the CON (P=0.03; 2.0 vs.
7.4 Papp, respectively). Compared to CON-SAL treated pigs, ileum and colon TLR4
recruitment into LR micro domains was decreased in the GRO-SAL pigs. However, CH
reduced ileum LR TLR4 protein in CON, but not GRO fed pigs. Localization of TLR4 into
LR didn’t differ in the colon of CON-CH and GRO-CH treatment groups. These data
indicate that n-3 FA decrease TLR4 recruitment into intestinal LR. This may explain how
DHA and EPA attenuate receptor mediated LT and LPS induced febrile response.
Furthermore, reduced LR localization of TLR4 post CH, may describe an LPS tolerance
mechanism.