two novel alkane hydroxylase-rubredoxin fusion genes ... · alkane hydroxylation is the key step in...

APPLIED AND ENVIRONMENTAL MICROBIOLOGY, Oct. 2011, p. 7279–7288 Vol. 77, No. 200099-2240/11/$12.00 doi:10.1128/AEM.00203-11Copyright © 2011, American Society for Microbiology. All Rights Reserved.

Two Novel Alkane Hydroxylase-Rubredoxin Fusion Genes Isolatedfrom a Dietzia Bacterium and the Functions of Fused Rubredoxin

Domains in Long-Chain n-Alkane Degradation�

Yong Nie, Jieliang Liang, Hui Fang, Yue-Qin Tang, and Xiao-Lei Wu*Department of Energy and Resources Engineering, College of Engineering, Peking University,

Beijing 100871, People’s Republic of China

Received 28 January 2011/Accepted 19 August 2011

Two alkane hydroxylase-rubredoxin fusion gene homologs (alkW1 and alkW2) were cloned from a Dietziastrain, designated DQ12-45-1b, which can grow on crude oil and n-alkanes ranging in length from 6 to 40carbon atoms as sole carbon sources. Both AlkW1 and AlkW2 have an integral-membrane alkane monooxy-genase (AlkB) conserved domain and a rubredoxin (Rd) conserved domain which are fused together. Phylo-genetic analysis showed that these two AlkB-fused Rd domains formed a novel third cluster with all the Rdsfrom the alkane hydroxylase-rubredoxin fusion gene clusters in Gram-positive bacteria and that this thirdcluster was distant from the known AlkG1- and AlkG2-type Rds. Expression of the alkW1 gene in DQ12-45-1bwas induced when cells were grown on C8 to C32 n-alkanes as sole carbon sources, but expression of the alkW2gene was not detected. Functional heterologous expression in an alkB deletion mutant of Pseudomonas fluore-scens KOB2�1 suggested the alkW1 could restore the growth of KOB2�1 on C14 and C16 n-alkanes and inducefaster growth on C18 to C32 n-alkanes than alkW1�Rd, the Rd domain deletion mutant gene of alkW1, whichalso caused faster growth than KOB2�1 itself. In addition, the artificial fusion of AlkB from the Gram-negativeP. fluorescens CHA0 and the Rds from both Gram-negative P. fluorescens CHA0 and Gram-positive Dietzia sp.DQ12-45-1b significantly increased the degradation of C32 alkane compared to that seen with AlkB itself. Inconclusion, the alkW1 gene cloned from Dietzia species encoded an alkane hydroxylase which increased growthon and degradation of n-alkanes up to C32 in length, with its fused rubredoxin domain being necessary tomaintain the functions. In addition, the fusion of alkane hydroxylase and rubredoxin genes from bothGram-positive and -negative bacteria can increase the degradation of long-chain n-alkanes (such as C32) in theGram-negative bacterium.

Alkane hydroxylation is the key step in alkane degradationin microorganisms, and alkane hydroxylases play an importantrole in the microbial degradation of alkanes (34). There arethree classes of alkane hydroxylases in microorganisms, de-pending on the chain length of the alkane substrate. The sol-uble nonheme di-iron monooxygenases (sMMO) and mem-brane-bound particulate copper-containing enzymes (pMMO)are the main enzymes that catalyze the oxygenation of alkanesC1 to C5 in length (21). The integral-membrane alkane mono-oxygenase (AlkB)-related alkane hydroxylases (37) and cyto-chrome P450 enzymes (35) found in fungi and bacteria canoxidize long-chain alkanes with up to 16 carbon atoms. Amongthe members of the third class of enzymes, which can catalyzethe oxidation of alkanes longer than C18, only one C15 to C36

alkane monooxygenase (LadA) found in Geobacillus thermod-enitrificans NG80-2, which is distinct from other known AlkB-type alkane hydroxylases, has been cloned and the activities ofpurified LadA on alkanes with different chain lengths havebeen previously identified (8). In the AlkB system, three indi-vidual genes encoding AlkB, rubredoxin (Rd), and Rd reduc-tase are often involved in alkane hydroxylation, with Rd and

Rd reductase as essential electron transfer components foralkane hydroxylation by AlkB (36); however, novel genes en-coding AlkB-Rd fusion proteins were recently cloned fromGram-positive bacteria.

Compared to the well-studied Gram-negative bacteria, al-kane hydroxylation of Gram-positive bacteria has been muchless extensively investigated. However, many Gram-positivebacteria such as Mycobacterium, Corynebacterium, and Rhodo-coccus, which belong to actinomycetes, can degrade a largevariety of n-alkanes with chains ranging from C10 to C36 inlength and are ideal candidate strains for the biodegradation ofhydrocarbons (2). Comparative genomic research on the re-leased genome sequences in GenBank has shown that the alkBgenes can often be found in the whole genome of Gram-positive bacteria, especially in actinomycetes. In addition,among the limited researches into alkane hydroxylases, thegenes encoding AlkB are reported to exist in Gram-positivebacteria, including Mycobacterium tuberculosis H37Rv (7), My-cobacterium bovis AF2122 (9), and Nocardia farcinicaIFM10152 (13), as well as in strains in the genus Rhodococcus(30). Interestingly, the genes encoding AlkB-Rd fusion pro-teins have so far been cloned only from Gram-positive Nocar-dioides sp. strain CF8 (11), Prauserella rugosa NRRL B-2295(27), and Dietzia sp. E1 (3). Whether this kind of fusion isbeneficial for the hydroxylation of long-chain alkanes by Gram-positive bacteria is still unknown.

Among the Gram-positive bacteria, Dietzia species (23) iso-

* Corresponding author. Mailing address: Department of Energyand Resources Engineering, College of Engineering, Peking Univer-sity, Beijing 100871, P. R. China. Phone and fax: 86-10-62759047.E-mail: [email protected].

� Published ahead of print on 26 August 2011.

7279

on Decem

ber 10, 2020 by guesthttp://aem

.asm.org/

Dow

nloaded from

http://aem.asm.org/

lated from diverse environments, including oil fields, deep seasediments, and soil, are able to grow on alkanes with variouschain lengths ranging from C6 to C24, pristane, and aromatichydrocarbons, including xylene, naphthalene, phenanthrene,benzoate, carbazole, quinoline, and toluene (4, 20, 38). Inaddition, the gene encoding the AlkB-Rd fusion protein wasalso cloned from Dietzia sp. E1, which has confirmed functionsin the degradation of C20 n-alkanes (3). Previously, we alsoisolated Dietzia sp. DQ12-45-1b from the oil production waterof a deep subterranean oil reservoir in the Daqing oilfield innortheastern China and found that the strain can degradehydrocarbons C6 to C40 in length as well as crude oil as solecarbon sources (39). Whether there is also a gene encodingthe AlkB-Rd fusion protein in our Dietzia strain and whetherthere are contributions of the fusion to long-chain degradationare still unknown.

We therefore isolated and characterized the alkane hydroxy-lases from Dietzia sp. DQ12-45-1b and found two novel alkanehydroxylase-Rd fusion gene homologs. Their distinctive struc-tures and the contribution of the fused Rd to alkane degrada-tion have been investigated here.

MATERIALS AND METHODS

Bacterial strains and plasmids. The bacterial strains and plasmids used in thisstudy are presented in Table 1. Pseudomonas fluorescens KOB2�1, which is thealkB gene knockout mutant of P. fluorescens CHA0 and cannot grow on C10 toC16 n-alkanes, was used to assess the activities of alkane hydroxylases. To prop-agate the cells, the strain Dietzia sp. DQ12-45-1b and Pseudomonas fluorescensCHA0 and its alkB deletion mutant KOB2�1 as well as recombinants ofKOB2�1 were grown in Luria-Bertani (LB) medium at 30°C. Escherichia coliDH5� was grown in LB medium at 37°C. To examine the growth on alkanes,strain Dietzia sp. DQ12-45-1b was grown in a minimal medium [5 g of NaCl, 1 gof NH4H2PO4, 1 g of (NH4)2SO4, 1 g of K2HPO4, 0.2 g of MgSO4, and 3 g ofKNO3 per liter of deionized water; pH 7.2] with 0.1% (vol/vol) MT microele-ments (MT stock contained 2.78 g of FeSO4 � 7H2O, 1.98 g of MnCl2 � 4H2O,2.81 g of CoSO4 � 7H2O, 1.47 g of CaCl2 � 2H2O, 0.17 g of CuCl2 � 2H2O, 0.29 gof ZnSO4 � 7H2O, and 1 N HCl per liter of deionized water), supplemented with0.1% (vol/vol) liquid n-alkanes or 0.1% (wt/vol) solid n-alkanes as the carbonsources at 30°C. P. fluorescens KOB2�1 and its recombinants were grown in E2medium (15) supplied with 0.1% (vol/vol) MT microelements and 0.5% liquidn-alkanes (vol/vol) or 0.1% solid n-alkanes (wt/vol) as sole carbon sources.Liquid C14 and C16 alkanes at room temperature were added directly to the E2medium for the P. fluorescens recombinants. Solid alkanes maintained at roomtemperature were first dissolved in dioctylphthalate, forming 5% (wt/vol) alkane-dioctylphthalate solutions, and then the solutions were added to the E2 medium

at 2% (vol/vol) as described previously (27). E. coli strains harboring plasmidswere grown with appropriate antibiotics (ampicillin, 100 �g/ml; gentamicin, 10�g/ml). Gentamicin (100 �g/ml) was used for the P. fluorescens KOB2�1 recom-binants. Plasmids and chromosomal DNA extraction, purification, enzymaticdigestion, DNA ligation, and transformation of E. coli and P. fluorescensKOB2�1 were performed using standard molecular techniques (25).

Cloning of alkane hydroxylase genes. Chromosomal DNA was isolated fromDietzia sp. DQ12-45-1b and used to amplify the conserved fragments of the alkBgenes in actinomycetes with primers alkB-conF (GACGGGGAGAACCCGCCGG) and alkB-conR (GTGGGCGGTGTTGATGCCGAT), which were de-signed according to the alignment of the alkane hydroxylase genes from Myco-bacterium tuberculosis H37Rv (7), Corynebacterium jeikeium K411 (32), andRhodococcus strain Q15 (40). After PCR amplification (3 min at 94°C, 25 cyclesof 30 s at 94°C, 30 s at 60°C, and 1 min at 72°C, 10 min at 72°C, and maintenanceat 10°C), the PCR products were cloned into pGEM-T Easy vector (Promega,Madison, WI) and sequenced.

To clone the complete alkW1 gene and its flanking sequences by nested inversePCR, primer pair NIF1 (CGGCGAGTCGTTCTGGGCGTTTC) and NIF2 (CGGTGGGCTCATCGCGGTGTTC) and primer pair NIR1 (GTGGTGTCCGCGGTTGTGCTCGAT) and NIR2 (CGAGCTCGTGTGCGGTGTTGATCC)were designed according to the conserved fragment of the alkW1 sequence. Thechromosomal DNA of DQ12-45-1b was digested with different restriction en-zymes and purified by a standard phenol-ethanol procedure (25). The digestedDNA (10 ng) was ligated with T4 DNA ligase and used as the template forinverse PCR. The first inverse PCR (1st PCR) was performed with the primersNIF1 and NIR1 and a two-step PCR program (5 min at 94°C, 25 cycles of 30 sat 94°C, and 8 min at 68°C, 10 min at 68°C, and maintenance at 10°C). The PCRproducts were diluted at 1:1,000 and then used as the templates for the secondinverse PCR (2nd PCR). The 2nd PCR was performed with primers NIF2 andNIR2 and the same PCR program as was used for the 1st PCR. The 2nd PCRproducts were cloned into the pGEM-T Easy vector and sequenced.

The complete alkW2 gene and flanking sequences were cloned by the use of aGenome Walking kit (TaKaRa, Japan) with the protocols recommended by themanufacturer. The specific primers FspI (GGGCGGGCTGGGCCTGGTGGCCAA), Fsp2 (TCGTCAACTACCTCGAGCACTACGG), and Fsp3 (GAGCTGGAGAAGAATCGTCTCGCT) were used for 3� genome walking. The specificprimers RspI (AGCGAGACGATTCTTCTCCAGCTC), Rsp2 (AGACGAGGGAGCCTGCGACG), and Rsp3 (TTGGCCACCAGGCCCAGCCCGCCC) de-signed according to the conserved fragment of alkW2 were used for 5� genomewalking. The PCR products were cloned into the pGEM-T easy vector andsequenced.

The DNA sequence data were analyzed using Geneious Pro 4.8.5 software(Biomatters Ltd.) and assembled using Contig Express. The open reading frames(ORFs) were identified using the “ORF Finder” program in NCBI and com-pared with those in the GenBank database using the blastx program. The nu-cleotide and predicted amino acid sequences were compared with those in theGenBank database using the blastn and blastx programs (http://blast.ncbi.nlm.nih.gov/). Sequence alignments were generated by ClustalW2. The phylogenetictrees were determined using the neighbor-joining algorithm and the Jukes-Cantor correction factor and generated by ClustalW2.

TABLE 1. List of strains and plasmids used in the study

Strain or plasmid Relevant characteristic(s) (genotype)a Reference or source

StrainsP. fluorescens KOB2�1 alkB gene knockout mutant of CHA0 27P. fluorescens CHA0 Grows on C12–C32 alkanes 25E. coli DH5� Cloning strain TaKaRaDietzia sp. DQ12-45-1b Grows on C10–C40 alkanes 39

Plasmids (cloning and expression vectors)pGEM-T easy Cloning vector, Ampr PromegapCom8 Broad-host-range expression vector with PalkB, Gmr, oriT, and alkS 29pCom8-alkW1 pCom8 with Dietzia sp. DQ12-45-1b alkW1 gene This studypCom8-alkW1�Rd pCom8 with fused-Rd-domain-deleted mutant of alkW1 This studypCom8-alkB pCom8 with gene encoding AlkB This studypCom8-alkBRd1 pCom8 with gene encoding the AlkB-Rd1 fusion protein This studypCom8-alkBRd2 pCom8 with gene encoding the AlkB-Rd2 fusion protein This studypCom8-alkBRd45 pCom8 with gene encoding the AlkB-Rd45 fusion protein This study

a Amp, ampicillin; Gm, gentamicin.

7280 NIE ET AL. APPL. ENVIRON. MICROBIOL.

on Decem


.asm.org/

Dow

nloaded from

http://aem.asm.org/

Real-time reverse transcription-PCR (RT-PCR) for detecting induction ofalkW1 and alkW2 genes by n-alkanes. To investigate the induction of alkW1 andalkW2 in strain DQ12-45-1b by different n-alkanes, DQ12-45-1b cells grown at toan early exponential phase in minimal medium supplemented with 1% sucrose ordifferent n-alkanes (0.1% [vol/vol] for liquid alkanes and 0.1% [wt/vol] for solidalkanes at room temperature) as sole carbon sources were collected by centrif-ugation (6,000 � g for 10 min at room temperature). To investigate changes inexpression with time, the DQ12-45-1b cells were grown on 0.1% (vol/vol) C16 and0.1% (wt/vol) C24 and collected at different time points. Total RNA from thecollected cells was extracted separately using TRIzol reagent (Invitrogen, Carls-bad, CA), treated with DNase I, and purified using TRIzol reagent. Reversetranscription was performed using 0.5 �g of total RNA with random primers anda ReverTra Ace reverse transcription kit (TOYOBO, Japan). Specific cDNA wasthen quantified using real-time PCR (CFX real-time PCR system; Bio-Rad) withSYBR green Ex Taq kit II (TaKaRa, Japan). The specific gene primer pairs,consisting of primer pair alkW1rtF (TTCCTGTCGATGCCGTTCGT) andallBr1rtR (TCGAGCTTGTCCATCACCTCGT), primer pair alkW2rtF (TCCTGGATCCCGAGCCCGAC) and alkW2rtR (TCTCCGAGCGCCTCCACGTA), and primer pair 16rtF (GTCTCATGTTGCCAGCACGTT) and 16rtR(GCAGCCCTCTGTACTAGCCAT), were used for amplifying the alkW1,alkW2, and 16S rRNA genes, respectively. All of the experiments were per-formed according to the instructions from the manufacturers of the reagents orinstruments. The PCR products were confirmed by cloning into pGEM-T easyvector and sequencing. The reverse transcript of 16S rRNA gene was used as theinternal reference to normalize the integrity of the total RNA results. Thereverse transcripts of the DNA gyrase B gene (gyrB) and DNA-directed RNApolymerase gene (rpoB) were also used as internal references to verify theresults. The specific primer pair gyrBF (CAAGCGCACCTTCCACTACCC) andgyrBR (ACCCGGAGTTCCACTGCATCG) and the specific primer pair rpoBF(TCCCGCCAGACCAAGTCAGT) and rpoBR (TCCTCCGACCCGATGAACCAC) were used for amplifying gyrB and rpoB, respectively. The gene expressionlevel was normalized against that of the 16S rRNA gene and was calculated bythe ��Ct method (18) with the sucrose sample as the control. All of the exper-iments were repeated in triplicate.

Heterologous expression of alkW1 and the gene encoding the AlkB-Rd fusionprotein in P. fluorescens. To investigate the activities of the alkW1 gene, anexpression plasmid was constructed to restore the growth of P. fluorescensKOB2�1 on n-alkanes. The alkW1 gene from the chromosomal DNA of Dietziasp. DQ12-45-1b was amplified using primers alkW1-F (GGAATTCCATATGTCCAGCACCGAATACAT, with the NdeI restriction enzyme site) and alkW1-R

(CCCAAGCTTGCTACTTCACGGGCAGGAAG, with the HindIII restrictionenzyme site) and a program consisting of 5 min at 94°C, 25 cycles of 30 s at 94°C,and 2 min at 68°C, 10 min at 68°C, and maintenance at 10°C. The PCR productwas cloned into the pCom8 vector (29) with NdeI and HindIII restriction sitesand transformed into E. coli DH5� to construct the pCom8-alkW1 plasmid(Fig. 1).

To investigate the activities and importance of the fused Rd domains inlong-chain alkane degradation, five expression plasmids were constructed andheterologously expressed in P. fluorescens KOB2�1 (Fig. 1). First, alkW1�Rd, thefused Rd domain (Rd45) deletion mutant of the alkW1 gene, was amplified usingthe primers alkW1�Rd-F (GGAATTCCATATGTCCAGCACCGAATACAT,with the NdeI restriction enzyme site) and alkW1�Rd-R (CCCAAGCTTCTACTCGCCGGTCGGTGAGGT, with the HindIII restriction enzyme site). ThePCR product was cloned into pCom8 vector with NdeI and HindIII restrictionsites and transformed into E. coli DH5� to construct pCom8-alkW1�Rd plas-mids. Second, the alkB gene from the chromosomal DNA of P. fluorescens CHA0was amplified using the primers alkB-F (GGGAATTCCATATGACTGTTTCCGTGG) and alkB-R (CGCGGATCCCTAAAGAGCGGTGTCTGAATCGG)and the program described above. The PCR product was cloned into pCom8vector with the NdeI and BamHI restriction sites to construct pCom8-alkB. Thegenes encoding AlkB, Rd1, and Rd2 from P. fluorescens CHA0 and Rd45 fromDQ12-45-1b were used to construct the artificial AlkB-Rd fusion protein-encod-ing genes in the expression plasmids pCom8-alkBRd1, pCom8-alkBRd2, andpCom8-alkBRd45. The alkB gene without the stop codon from P. fluorescensCHA0 was amplified using the primers alkB-F and alkBT-R (CGCGGATCCGCGGGGCCCAAGAGCGGTGTCTGAATCGG). The PCR product wascloned into pCom8 vector with the NdeI and ApaI restriction sites to con-struct pCom8-alkBT. The Rd1 and Rd2 genes from the chromosomal DNA ofP. fluorescens CHA0 were amplified using primer pair Rd1-F (TATGGGCCCAGCACCTACGCTGAAAAC) and Rd1-R (CGCGGATCCCTACAGCTTCACCATGTTG) and primer pair Rd2-F (TATGGGCCCAAAAAGTGGCAATGTGT) and Rd2-R (CGCGGATCCTCAAGCGATCTCGATCAT),respectively. Rd45 was amplified using primers Rd45-F (TATGGGCCCGTGGCGGAGAATGTCCT) and Rd45-R (CGCGGATCCCTACTTCACGGGCAGGAAGT). The PCR products were cloned into pCom8-alkBT with theApaI and BamHI restriction sites to construct pCom8-alkBRd1, pCom8-alkBRd2, and pCom8-alkBRd45, whose structures are shown in Fig. 1. Suc-cessful cloning was verified by sequencing. Each of the six expression plasmidswas transformed into the P. fluorescens KOB2�1 cells by electroporation. Allof the recombinants were grown with 100 �g/ml gentamicin.

FIG. 1. Structure of the recombinant plasmids for expression of the AlkB and AlkB-Rd fusion proteins. The numbers above the coding regionscorrespond to the amino acid residues from the amino terminals of AlkW1, AlkB, Rd1, and Rd2. The letters under the coding regions indicatethe additional amino acids linking the AlkB and Rd proteins. PalkB, gene promoter; rrnB term., gene terminator; �, AlkB conserved domain ofAlkW1; f, Rd conserved domain of AlkW1; u, AlkB from P. fluorescens CHA0; o, Rd1 from P. fluorescens CHA0; s, Rd2 from P. fluorescensCHA0.

VOL. 77, 2011 NOVEL ALKANE HYDROXYLASE-RUBREDOXIN FUSION GENES 7281

on Decem


.asm.org/

Dow

nloaded from

http://aem.asm.org/

After the construction of all the KOB2�1 recombinants, P. fluorescens CHA0and KOB2�1 and cells of its recombinants were first grown in LB medium. Thecells from the LB medium were washed three times with E2 medium andinoculated into 50 ml of E2 medium (with the final concentration expressed as anoptical density at 600 nm [OD600] of 0.05) with different n-alkanes as sole carbonsources. To assess the influence of the solvent dioctylphthalate on the growth ofthe cells, cells were cultured in E2 medium with 5% (vol/vol) solvent as the solecarbon source in parallel. The cells were then cultured at 30°C and shaken at 150rpm. To investigate the roles of the Rd domain of AlkW1, growth of the pCom8-alkW1 and pCom8-alkW1�Rd recombinant cells on n-alkanes was measured asthe increase of the OD600 in the culture with time. To investigate the degradationefficiency of the artificial AlkB-Rd fusion proteins, pCom8-alkB, pCom8-alk-BRd1, pCom8-alkBRd2, and pCom8-alkBRd45 recombinants, together with P.fluorescens CHA0 and KOB2�1 harboring pCom8 as the controls, were culturedon 0.1% (wt/vol) C32 alkanes as the sole carbon source for 35 days. An additionalset of uninoculated flasks containing E2 medium with n-alkanes was incubated inparallel to assess the loss of n-alkanes without cells during culture. All theexperiments described above were repeated in triplicate.

Analytical methods. The residual alkanes in the cultures were extracted withn-hexane at a 3:1 ratio (vol/vol) and shaken vigorously for 30 s. The mixtureswere incubated for 30 min at room temperature and centrifuged at 12,000 � g for10 min at room temperature. The hexane layer was harvested, and the residualalkanes were quantified using gas chromatography-mass spectrometry (GC-MS),an Agilent 7890C GC, and a 5975C MS (Agilent). The samples were separatedon an Agilent HP-5AS capillary column (30 m by 0.25 mm) using the followingtemperature program: 1 min isotherm at 140°C, a ramp of 20°C/min to 260°C, 5min isotherm at 260°C, a ramp of 20°C/min to 280°C, and isotherm at 280°C.Helium was used as the carrier gas at a flow rate of 2 ml/min. The GC-MS spectrawere analyzed with ChemStation software, and the alkane concentrations werecalculated from the integrated peak area. The degradation ratio of n-alkanes wascalculated with the equation R � ([U] � [S])/[U], where R, [U], and [S] representthe n-alkane degradation ratio, the residual n-alkane concentrations in the cell-free culture, and the concentration in the culture inoculated with cells, respec-tively. Calculations and statistics were determined using Origin 6.0 software(OriginLab Co., Northampton, MA). The values are presented as means �standard deviations (SD). Data were analyzed statistically using a two-tailedStudent’s t test, and P values of 0.05 or less were considered statistically signif-icant.

Nucleotide sequence accession numbers. The Dietzia sp. DQ12-45-1b 16SrRNA gene sequence, alkW1 gene sequence, and alkW2 gene sequence havebeen submitted to GenBank under accession numbers HQ32877, HQ850582,and HQ8505823, respectively.

RESULTS

Cloning and analysis. Two 647-bp DNA fragments, namely,seq1 and seq2, were isolated from Dietzia sp. DQ12-45-1b byPCR using primers designed on the basis of different alkanemonooxygenases from other Gram-positive bacteria. Theblastx search results indicated that the peptides encoded by theseq1 and seq2 fragments were 94% and 81% identical, respec-tively, to the alkane hydroxylase-rubredoxin fusion protein inDietzia sp. E1. An 8,356-bp DNA sequence that included seq1was amplified by nested inverse PCR from the DNA digestedwith HindIII and PstI. And a 2,032-bp DNA sequence thatincluded seq2 was obtained using thermal asymmetric inter-laced PCR (TAIL-PCR). Two putative alkane hydroxylasegenes encoding two AlkB-Rd fusion proteins were identifiedand annotated as alkW1 and alkW2, referring to the group ofAlkB-Rd fusion proteins.

The alkW1 and alkW2 genes exhibited 79.1% DNA sequenceidentity, and their derived proteins exhibited 69.4% amino acidsequence identity. Both AlkW1 and AlkW2 consisted of twoconserved domains of the integral-membrane alkane monoox-ygenase domain and the Rd domain. The sequence analysisshowed that the alkW1 gene encoded a 515-amino-acid proteinwith 85.4% amino acid sequence identity to an alkane hydrox-

ylase-Rd fusion protein of Dietzia sp. E1 and 67% to 70%identity to the alkane 1-monooxygenase of Rhodococcus sp.Q15, Geobacillus sp. MH-1, and Rhodococcus equi ATCC33707. The alkW2 gene encoded a 499-amino-acid protein. Thealignment of AlkW1 and AlkW2 amino acid sequences withother published AlkB sequences showed that both AlkW1 andAlkW2 had eight histidines within three His boxes and a HYGmotif that are highly conserved in AlkB hydroxylases (Fig. 2A).Phylogenetic analysis of the alkane hydroxylases showed thatAlkW1 and AlkW2 clustered with the alkane hydroxylase fromDietzia sp. E1 and are close to other alkane hydroxylases fromGram-positive bacteria, such as Rhodococcus and Mycobacte-rium, and distant from those from Gram-negative bacteria(Fig. 2B).

The Rd domains were often thought to be divided into twogroups, with AlkG1-type Rds related to AlkG1 and AlkG2-type Rds related to AlkG2 in Pseudomonas putida GPo1 (36).However, the Rd domains of AlkW1 and AlkW2 were clearlyclustered together with other AlkB-Rd fusion proteins fromGram-positive bacteria whereas they were distant from theAlkG1 and AlkG2-type Rds, forming a novel third cluster ofRds (Fig. 3B). According to the alignment of the amino acidsequence of the AlkB-fused Rds with sequences of other Rds,two CXXCG motifs were found in the AlkB-fused Rds. TheC(S/P)DCGVR motif as the second CXXCG iron bindingmotif was conserved in the AlkB-fused Rds (Fig. 3A). Further-more, the other five AlkB-Rd fusion protein sequences fromGram-positive bacteria were found in GenBank by blastpsearches using C(S/P)DCGVR as the query sequence. Theamino acid alignment of 10 AlkB-fused Rds showed that all ofthe AlkB-fused Rds had two CXXCG motifs and that thesecond C(S/P)DCGVR motif was conserved (data not shown).

The open reading frame analysis revealed that there wereeight ORFs, namely, ORF1 (putative N-acetyltransferase),ORF2 (beta subunit of tryptophan synthase), ORF3 (short-chain dehydrogenase), ORF4 (ABC transporter ATP bindingprotein), ORF5 (putative TetR transcriptional regulatory pro-tein), ORF6 (putative thioesterase family protein), ORF7(short-chain dehydrogenase), and alkW1 in the alkW1 genecluster (Fig. 2C). The arrangement of the ORFs in the alkW1gene cluster was different from that of other known alk geneclusters, whose Rd-encoding gene, Rd reductase-encodinggene, and transcriptional regulatory protein-encoding genewere often found immediately downstream of the alkB gene(Fig. 2C). In addition, no individual Rd-encoding genes orRd-encoding reductase genes were found in the alkW1 genecluster.

Induction of alkW1 and alkW2 in Dietzia sp. DQ12-45-1b. Weinvestigated whether expression of alkW1 or alkW2 was in-duced when cells of Dietzia sp. DQ12-45-1b were grown onn-alkanes. Total RNA was isolated from Dietzia sp. DQ12-45-1b cells grown on n-alkanes ranging from C8 to C32 inlength, and quantitative RT-PCR using alkW1 or alkW2 wasperformed with 16S rRNA as the internal reference by the��Ct method. gyrB and rpoB were also used as internal refer-ences for quantifying the expression level of alkW1 or alkW2;the results were similar to those determined using 16S rRNAas the internal reference (data not shown). The results showedthat alkW1 was induced when the cells were grown on n-al-kanes ranging from C8 to C32 in length. In distinction from the


on Decem


.asm.org/

Dow

nloaded from

http://aem.asm.org/

results seen with induction of alkW1, results of induction ofalkW2 were negligible when the cells were grown on n-alkanescompared with cells grown on sucrose (Fig. 4A). The resultsindicated that alkW1 might be related to n-alkane degradationof DQ12-45-1b, whereas alkW2 might play an undefined role inalkane hydroxylation. Therefore, we investigated the functionof AlkW1 in n-alkane hydroxylation.

In addition, expression of alkW1 changed with time (Fig.4B). The transcription level of alkW1 indicated that alkW1 wasinduced after 12 h, reached a peak value after 5 days, andstayed at a significantly high level when Dietzia sp. DQ12-45-1b

was grown on C16. Expression of alkW1 was also upregulatedafter 12 h and reached a peak value after 10 days when grownon C24. Expression of alkW1 induced by C16 and C24 alkaneswas consistent with our previous study results, which suggestedthat Dietzia sp. DQ12-45-1b could reach the early exponential-growth phase at days 5 and 10 when grown on C16 and C24

alkanes (39).Functions of alkW1 and the AlkB-fused Rd domains. To

elucidate the alkane hydroxylation activities of AlkW1 and thefunctions of the AlkB-fused Rd domains, P. fluorescensKOB2�1 lacking the alkB gene was used as the host system for

FIG. 2. Part of the multiple sequence alignment of alkane hydroxylases AlkW1 and AlkW2 from Dietzia sp. DQ12-45-1b with other knownintegral-membrane alkane hydroxylases. (A) The conserved amino acid residues in all sequences are indicated on a dark gray background. Thethree conserved histidine boxes (Hist-1, Hist-2, and Hist-3) and one HYG motif are underlined. The degree of conservation associated with eachposition is indicated by the bar graph shown above the alignment (created using ClustalW2). (B) Phylogenetic relationship based on the completeamino acid sequences of AlkW1 and AlkW2 from Dietzia sp. DQ12-45-1b and other published AlkB amino acid sequences. The Phylogenetic treewas determined using the neighbor-joining algorithm and the Jukes-Cantor correction factor and generated by ClustalW2. (C) Organizations ofalkB genes in different organisms. Alkane hydroxylases are indicated with black arrows; Rds and fused Rd domains are indicated with hatchedarrows; tetR transcriptional regulator proteins are indicated with gray arrows; other genes are indicated with open arrows.


on Decem


.asm.org/

Dow

nloaded from

http://aem.asm.org/

functional expression of alkW1 and alkW1�Rd as well as alkB-Rd1, alkB-Rd2, and alkB-Rd45 fused protein-encoding genesconstructed artificially from P. fluorescens CHA0 and Dietziasp. DQ12-45-1b. KOB2�1 lacking the alkB gene could notgrow on n-alkanes up to 16 carbon atoms in length but couldgrow on n-alkanes from C18 to C28 in length. The KOB2�1recombinants containing both alkW1 and alkW1�Rd were ableto grow on C14 and C16 n-alkanes without a significant differ-ence in growth rates (Fig. 5). Although the host KOB2�1strain could grow on n-alkanes ranging from C18 to C32 inlength, KOB2�1 recombinants containing alkW1 showed fastergrowth than the alkW1�Rd recombinant and the pCom8 con-trol on C18, C20, and C28 n-alkanes. For C24, the alkW1 recom-binant reached the exponential phase and the stationary phaseearlier and showed a higher OD600 value during culture growththan other recombinants (Fig. 5). None of the recombinants

could grow on the solvent dioctylphthalate as the sole carbonsource (data not shown). The degradation of n-alkanes for 35days suggested that the KOB2�1 recombinant containingalkW1 degraded more n-alkanes ranging from C18 to C32 inlength than the KOB2�1 alkW1�Rd recombinant, which inturn degraded more n-alkanes than the KOB2�1 control (Fig.6). The results indicate that AlkW1 indeed has the ability toincrease cell growth and degrade long-chain n-alkanes. Theresults also indicate that the lack of the fused Rd domainimpeded the degradation of long-chain alkanes and obstructedthe growth of the bacteria.

The plasmids containing artificially constructed AlkB-Rd fu-sion protein-encoding genes were also expressed in P. fluore-scens KOB2�1, and the alkane hydroxylase activities were de-termined by measuring the alkane degradation ratio of theKOB2�1 recombinants on C32 alkane. P. fluorescens CHA0

FIG. 3. Multiple sequence alignment of the fused Rd domains of AlkW1 and AlkW2 from Dietzia sp. DQ12-45-1b with other published Rds.(A) The conserved amino acid residues in all sequences are indicated on a dark gray background. The degree of conservation of each position isindicated by the bar graph shown above the alignment (created using ClustalW2). (B) Phylogenetic tree based on the amino acid sequences of thefused Rd domains of AlkW1, AlkW2, and other published Rds. The phylogenetic tree was determined using the neighbor-joining algorithm andthe Jukes-Cantor correction factor and was generated using ClustalW2.


on Decem


.asm.org/

Dow

nloaded from

http://aem.asm.org/

and the KOB2�1 control, as well as the KOB2�1 cells com-plemented with the alkB and alkB-Rd1 genes, had little effecton the rate of degradation of C32. However, the C32 degrada-tion rates of the cells carrying alkB-Rd2 and alkB-Rd45 weredouble those seen with CHA0 and the KOB2�1 control (Fig.7). All of these results suggest that the fusion of Rd to AlkBcould be beneficial for the hydroxylation of long-chain alkanes(at least for C32 alkane) and that the fused Rd domains mightbe essential for the degradation seen with long-chain alkanes(C18 to C32 in length) for both Gram-positive and Gram-neg-ative bacteria.

DISCUSSION

Alkane-degrading bacteria are widely distributed in naturalenvironments, and most of them belong to the Gammaproteo-

bacteria and Actinomycetales. The enzyme system for long-chain alkane degradation is still far from clear. LadA fromGeobacillus thermodenitrificans NG80-2, the first and so far theonly experimentally confirmed long-chain alkane hydroxylasethat can convert alkanes ranging from C15 to C36 in length toalkanol in vitro, is an extracellular protein that is distinct fromthe AlkB-like or P450-like alkane hydroxylases (17). Amongthe AlkB-like alkane hydroxylases that can hydroxylate long-chain alkanes, a new family that includes the integral-mem-brane alkane hydroxylase AlkM with the common conservedHis boxes and HYG motif has been found in Acinetobacter sp.M-1 and Acinetobacter sp. ADP1 (24, 31). Expression ofAlkMa is induced by solid alkanes (C22 in length), and ex-pression of AlkMb is induced by liquid alkanes (C22 inlength). However, the enzyme activities of AlkMa and AlkMbhave not been detected in cell extracts of Acinetobacter sp. M-1or in vitro. Another flavin binding monooxygenase, AlmA fromAcinetobacter sp. DSM 17874, has been proved to be involvedin the bacterial degradation of alkanes with a chain lengthlonger than C32 via functional studies of almA gene disruptionmutants (33). However, whether AlmA can catalyze the oxi-dation of long-chain alkanes is unknown and needs to be con-firmed. The AlkB-type alkane hydroxylase system of Gordoniasp. strain SoCg has been also reported to be involved in thedegradation of solid n-alkanes, although the hydroxylation ac-tivities of solid n-alkanes have not been detected (19). Re-cently, a novel AlkB-Rd fusion alkane hydroxylase was foundin Dietzia sp. E1 by Bihari et al. (3) and was shown to partlycontribute to the degradation of C20 alkane. Their work sug-gested that the AlkB-Rd fusion alkane hydroxylase might playan important role in long-chain alkane degradation, but themechanisms and the role of the fused Rd domain were notinvestigated. In this study, two AlkB-Rd fusion protein-encod-ing genes annotated as alkW1 and alkW2 were cloned fromDietzia sp. DQ12-45-1b. The functions of AlkW1 and its fusedRd domain deletion mutant were identified by heterologousexpression in P. fluorescens KOB2�1. The results suggestedthat AlkW1 was active on n-alkanes ranging in length from C8

to C32 and that the fused Rd domain was essential for thefunction of AlkW1 for long-chain n-alkane degradation. Incontrast, the artificial fusion of the alkB gene from Gram-negative P. fluorescens with the rubredoxin genes from bothGram-negative P. fluorescens (Rd2) and Gram-positive Dietziasp. (Rd45) doubled the C32 alkane degradation ratio of Gram-negative P. fluorescens KOB2�1. Our results suggest that thefused Rd domain and the fusion of alkane hydroxylase andrubredoxin are novel structures that essentially contribute tothe hydroxylation of long-chain n-alkanes with chain lengthsranging from C18 to C32, which is in accordance with the resultsof Bihari et al. as determined with C20 n-alkanes (3). On theother hand, the alkW2 gene was not induced and might play anundefined role.

Rd is an essential electron transfer component of the AlkBsystem (16). It shuttles electrons from Rd reductase to AlkB.The Rd-encoding genes are generally associated with alkBgenes or Rd reductase-encoding genes in the alk gene clusterin both Gram-positive and Gram-negative bacteria (1, 14, 27,40). The Rds are usually thought to be divided into AlkG1 andAlkG2 types that are related to AlkG1 and AlkG2 in P. putidaGPo1. It has been suggested that the AlkG1-type Rds are

FIG. 4. Real-time RT-PCR analysis of the induction of alkW1 andalkW2 in cells grown on n-alkanes. (A) The results show that expres-sion of alkW1 was induced in cells grown on n-alkanes C8 to C32 inlength compared with cells grown on sucrose. Expression of alkW2 wasnot induced in cells grown on alkanes. (B) Expression of alkW1 in cellsgrown on C16 and C24 over time after seeding. (*, P 0.05 comparedto sucrose control [n � 3/group]; #, P 0.05 compared to the cellresults without alkane induction, as determined by Student’s t test. Alldata represent means � SD.)


on Decem


.asm.org/

Dow

nloaded from

http://aem.asm.org/

FIG. 5. Growth of the pCom8 recombinant control and alkW1 and alkW1�Rd recombinant strains on n-alkanes. The growth was measured asthe increases in OD600 in the culture over time.

7286

on Decem


.asm.org/

Dow

nloaded from

http://aem.asm.org/

distinguished from the AlkG2-type Rds by the insertion of anarginine downstream of the second CXXCG motif (36) thatresults in unfavorably close contact with the positively chargedmolecular surface of Rd reductase (10) and creates an obstacleinterfering with electron transfer (6). Therefore, only AlkG2-type Rds are suggested to be able to transfer electrons to thealkane hydroxylase and to be responsible for alkane hydroxy-lation. However, in our study, two new fused Rds, containingtwo conserved metal binding CXXCG motifs, were isolated.The first conserved CXXCG motif of the Rd45 found in thisstudy was the same as that of the AlkG2-type Rds, although itssecond iron binding CXXCG motif consisted of a conservedC(P/S)DCGVR sequence that was different from those of bothAlkG1 and AlkG2 Rds. The results determined with both theRd45 deletion mutation and the AlkB-Rd45 fusion proteinconfirmed that Rd45 represents a novel rubredoxin distinctfrom other AlkG1 and AlkG2-type Rds and indicated thatRd45 is essential to long-chain alkane degradation and bacte-rial growth on long-chain alkanes. In fact, phylogenetic analysisof the Rds from different species clearly showed that all of theAlkB-fused Rds clustered together, forming a novel third clus-ter of Rds that were significantly distinct from either AlkG1-type Rds or AlkG2-type Rds. In addition, all the AlkB-fusedRds contained the conserved C(P/S)DCGVR motif in additionto the first CXXCG motifs, and all were from Gram-positiveActinomycetes.

In general, the amino acid sequence of Rd presents in threedifferent forms, i.e., as an individual protein (i.e., Rd1 and Rd2in P. fluorescens pf-5) (22), as a fusion protein consisting of twoRds (i.e., AlkG in P. putida GPo1), or as an AlkB-Rd fusionprotein (i.e., AlkB in Nocardioides sp. CF8, AlkB in Prauserellarugosa NRRL B-2295, and Dietzia sp. E1�, as well as in AlkW1in the present report) (3, 11, 28). Among these forms, theAlkB-Rd fusion proteins are less frequently found and their

functions have not been defined. The AlkB-fused Rd ofPrauserella rugosa NRRL B-2295 could not complement theRd deletion mutant, indicating that AlkB-fused Rds might nottransfer electrons separately (36). In contrast, the AlkB-fusedRd (Rd45) in Dietzia sp. DQ12-45-1b, as well as the artificialfusion proteins of AlkB-Rd2, proved to have the ability toinduce hydroxylation of long-chain alkanes in our study, sug-gesting that the AlkB-fused Rds might transfer electrons onlyin fused form and not in separated form. Our results alsoindicated that it did not matter whether the fused Rds camefrom Gram-positive or Gram-negative bacteria; the AlkB-Rdfusion form could promote AlkB hydroxylation activity in long-chain alkane degradation. There are two possibilities with re-spect to mechanisms that may explain why the AlkB-Rd fusionprotein is beneficial for the hydroxylation of long-chain al-kanes. One possibility is that fusion of the alkB and rubredoxingenes could reduce the distance between the metal bindingsites of alkane hydroxylase and Rd and consequently makeelectron transfer easier. A similar system is the reductive scis-sion of molecular oxygen catalyzed by cytochrome P450 (5, 12,26). Another possible driving force for the higher catalyticefficiency of the AlkB-Rd fusion protein on long-chain alkanesmight be the steric effects on the bindings of the substrates andenzyme or the enzyme and Rd. Long-chain n-alkanes mayoccupy the steric sites, hinder the binding of substrates to theenzyme, and disrupt the electron transfer between Rd and theenzyme. This negative effect might have been removed whenRd fused with AlkB and formed an entire molecule (Fig. 5 and6). However, the exact mechanisms responsible for the role ofthe Rd domain in AlkW1 and AlkB-Rd fusion proteins needfurther research.

Interestingly, although Rd1 and Rd2 were from the same P.fluorescens CHA0 strain, their fusion proteins showed differentactivities. The activity of the AlkB-Rd1 fusion protein wassimilar to that of AlkB, but the activity of the AlkB-Rd2 fusionprotein was higher than that of AlkB for C32 alkane degrada-tion, which was similar to that of AlkW1 and AlkB-Rd45 fusionproteins. The extra 11 amino acid residuals at the N terminus

FIG. 7. Effects of artificial AlkB-Rd fusion protein-encoding geneson the degradation of C32 alkane of P. fluorescens KOB2�1. (*, P 0.05 compared to CHA0 and pCom8 control [n � 3/group], as deter-mined by Student’s t test. All data represent means � SD.)

FIG. 6. Degradation of alkanes in cultures of pCom8 recombinantand alkW1 and alkW1�Rd recombinants grown with alkanes as solecarbon sources. The degradation ratio of alkanes ranging from C18 toC32 in length in the alkW1 recombinant culture was higher than that inthe KOB2�1 and alkW1�Rd recombinant cultures, which was coinci-dent with the growth of KOB2�1 and its recombinants on alkanes(Fig. 5). (*, P 0.05 compared to pCom8 control [n � 3/group]; #,P 0.05 compared to alkW1�Rd [n � 3/group], as determined byStudent’s t test. All data represent means � SD.)


on Decem


.asm.org/

Dow

nloaded from

http://aem.asm.org/

of Rd1 (Fig. 3A) could be the reason for these phenomena.The longer sequence of Rd1 might elongate the distance be-tween AlkB and Rd1, thus hindering the electron transporta-tion, or might increase the negative steric effects for long-chainn-alkane hydroxylation.

In summary, novel AlkB-Rd fusion protein-encoding geneswere identified in the long-chain alkane-degrading strain Diet-zia sp. DQ12-45-1b and the fusion of AlkB and Rd mightenhance the activities of AlkB with respect to long-chain n-al-kanes. These results may offer a new approach for increasinglong-chain alkane degradation for enhanced microbial oil re-covery and bioremediation of hydrocarbon-polluted environ-ments.

ACKNOWLEDGMENTS

The study was supported by the National High Technology Researchand Development Program of China (2009AA063501) and the Na-tional Natural Science Foundation of China (30870086, 31070107, and40821140541). We are indebted to Theo Smits for kindly providing P.fluorescens CHA0 and KOB2�1 and the pCom8 plasmid and to LeiWang of Nankai University and Guangming Xiong of University Med-ical School Schleswig-Holstein of Kiel, Germany, for their valuablediscussions.

REFERENCES

1. Amouric, A., et al. 2010. Identification of different alkane hydroxylase sys-tems in Rhodococcus ruber strain SP2B, an hexane-degrading actinomycete.J. Appl. Microbiol. 108:1903–1916.

2. Ashraf, W., A. Mihdhir, and J. C. Murrell. 1994. Bacterial oxidation ofpropane. FEMS Microbiol. Lett. 122:1–6.

3. Bihari, Z., et al. 2011. Functional analysis of long-chain n-alkane degrada-tion by Dietzia spp. FEMS Microbiol. Lett. 316:100–107.

4. Bødtker, G., I. V. Hvidsten, T. Barth, and T. Torsvik. 2009. Hydrocarbondegradation by Dietzia sp. A14101 isolated from an oil reservoir modelcolumn. Antonie Van Leeuwenhoek 96:459–469.

5. Cao, P., H. Bulow, B. Dumas, and R. Bernhardt. 2000. Construction andcharacterization of a catalytic fusion protein system: P-450 (11 beta)-adreno-doxin reductase-adrenodoxin. Biochim. Biophys. Acta 1476:253–264.

6. Chen, C.-J., Y.-H. Lin, Y.-C. Huang, and M.-Y. Liu. 2006. Crystal structureof rubredoxin from Desulfovibrio gigas to ultra-high 0.68A resolution.Biochem. Biophys. Res. Commun. 349:79–90.

7. Cole, S. T., et al. 1998. Deciphering the biology of Mycobacterium tuberculosisfrom the complete genome sequence. Nature 393:537–544.

8. Feng, L., et al. 2007. Genome and proteome of long-chain alkane degradingGeobacillus thermodenitrificans NG80-2 isolated from a deep-subsurface oilreservoir. Proc. Natl. Acad. Sci. U. S. A. 104:5602–5607.

9. Garnier, T., et al. 2003. The complete genome sequence of Mycobacteriumbovis. Proc. Natl. Acad. Sci. U. S. A. 100:7877–7882.

10. Hagelueken, G., et al. 2007. Crystal structure of the electron transfer com-plex rubredoxin rubredoxin reductase of Pseudomonas aeruginosa. Proc.Natl. Acad. Sci. U. S. A. 104:12276–12281.

11. Hamamura, N., C. M. Yeager, and D. J. Arp. 2001. Two distinct monooxy-genases for alkane oxidation in Nocardioides sp. strain CF8. Appl. Environ.Microbiol. 67:4992–4998.

12. Inui, H., A. Maeda, and H. Ohkawa. 2007. Molecular characterization ofspecifically active recombinant fused enzymes consisting of CYP3A4, NA-DPH-cytochrome P450 oxidoreductase, And cytochrome b5. Biochemistry46:10213–10221.

13. Ishikawa, J., et al. 2004. The complete genomic sequence of Nocardia far-cinica IFM 10152. Proc. Natl. Acad. Sci. U. S. A. 101:14925–14930.

14. Kok, M., et al. 1989. The Pseudomonas oleovorans alkBAC operon encodestwo structurally related rubredoxins and an aldehyde dehydrogenase. J. Biol.Chem. 264:5442–5451.

15. Lageveen, R. G., et al. 1988. Formation of Polyesters by Pseudomonas oleo-vorans: Effect of Substrates on Formation and Composition of Poly-(R)-3-Hydroxyalkanoates and Poly-(R)-3-Hydroxyalkenoates. Appl. Environ. Mi-crobiol. 54:2924–2932.

16. Lee, H. J., J. Basran, and N. S. Scrutton. 1998. Electron transfer from flavinto iron in the Pseudomonas oleovorans rubredoxin reductase-rubredoxinelectron transfer complex. Biochemistry 37:15513–15522.

17. Li, L., et al. 2008. Crystal structure of long-chain alkane monooxygenase(LadA) in complex with coenzyme FMN: unveiling the long-Chain alkanehydroxylase. J. Mol. Biol. 376:453–465.

18. Livak, K. J., and T. D. Schmittgen. 2001. Analysis of relative gene expressiondata using real-time quantitative PCR and the 2�DD CT method. Methods25:402–408.

19. Lo Piccolo, L., C. De Pasquale, R. Fodale, A. M. Puglia, and P. Quatrini.2011. Involvement of an alkane hydroxylase system of Gordonia sp. strainSoCg in degradation of solid n-alkanes. Appl. Environ. Microbiol. 77:1204–1213.

20. Maeda, M., et al. 1998. Isolation and characterization of a new aromaticcompound-degrading alkalitrophic bacteria. J. Gen. Appl. Microbiol. 44:101–106.

21. Merkx, M., et al. 2001. Dioxygen activation and methane hydroxylation bysoluble methane monooxygenase: a tale of two irons and three proteins.Angew. Chem. 40:2782–2807.

22. Paulsen, I. T., et al. 2005. Complete genome sequence of the plant com-mensal Pseudomonas fluorescens Pf-5. Nat. Biotechnol. 23:873–878.

23. Rainey, F. A., S. Klatte, R. M. Kroppenstedt, and E. Stackebrandt. 1995.Dietzia, a new genus including Dietzia maris comb. nov., formerly Rhodococ-cus maris. Int. J. Syst. Evol. Microbiol. 45:32–36.

24. Ratajczak, A., W. Geissdorfer, and W. Hillen. 1998. Alkane hydroxylase fromAcinetobacter sp. strain ADP1 is encoded by alkM and belongs to a newfamily of bacterial integral-membrane hydrocarbon hydroxylases. Appl. En-viron. Microbiol. 64:1175–1179.

25. Sambrook, J., and D. W. Russell. 2001. Molecular cloning: a laboratorymanual, 3rd ed. Cold Spring Harbor Laboratory Press, Cold Spring Harbor,NY.

26. Sibbesen, O., J. De Voss, and P. de Montellano. 1996. Putidaredoxin reduc-tase-putidaredoxin-cytochrome P450cam triple fusion protein. J. Biol. Chem.271:22462–22469.

27. Smits, T. H. M., S. B. Balada, B. Witholt, and J. B. van Beilen. 2002.Functional analysis of alkane hydroxylases from Gram-negative and Gram-positive bacteria. J. Bacteriol. 184:1733–1742.

28. Smits, T. H. M., M. Rothlisberger, B. Witholt, and J. B. van Beilen. 1999.Molecular screening for alkane hydroxylase genes in Gram-negative andGram-positive strains. Environ. Microbiol. 1:307–317.

29. Smits, T. H. M., M. Seeger, B. Witholt, and J. B. van Beilen. 2001. Newalkane-responsive expression vectors for Escherichia coli and Pseudomonas.Plasmid 46:16–24.

30. Takei, D., K. Washio, and M. Morikawa. 2008. Identification of alkanehydroxylase genes in Rhodococcus sp. strain TMP2 that degrades a branchedalkane. Biotechnol. Lett. 30:1447–1452.

31. Tani, A., T. Ishige, Y. Sakai, and N. Kato. 2001. Gene structures and regu-lation of the alkane hydroxylase complex in Acinetobacter sp. strain M-1. J.Bacteriol. 183:1819–1823.

32. Tauch, A., et al. 2005. Complete genome sequence and analysis of themultiresistant nosocomial pathogen Corynebacterium jeikeium K411, a lipid-requiring bacterium of the human skin flora. J. Bacteriol. 187:4671–4682.

33. Throne-Holst, M., A. Wentzel, T. E. Ellingsen, H.-K. Kotlar, and S. B.Zotchev. 2007. Identification of novel genes involved in long-chain n-alkanedegradation by Acinetobacter sp. strain DSM 17874. Appl. Environ. Micro-biol. 73:3327–3332.

34. van Beilen, J. B., and E. G. Funhoff. 2007. Alkane hydroxylases involved inmicrobial alkane degradation. Appl. Microbiol. Biotechnol. 74:13–21.

35. van Beilen, J. B., et al. 2006. Cytochrome P450 alkane hydroxylases of theCYP153 family are common in alkane-degrading eubacteria lacking integralmembrane alkane hydroxylases. Appl. Environ. Microbiol. 72:59–65.

36. van Beilen, J. B., et al. 2002. Rubredoxins involved in alkane oxidation. J.Bacteriol. 184:1722–1732.

37. van Beilen, J. B., M. G. Wubbolts, and B. Witholt. 1994. Genetics of alkaneoxidation by Pseudomonas oleovorans. Biodegradation 5:161–174.

38. von der Weid, I., et al. 2007. Identification and biodegradation potential ofa novel strain of Dietzia cinnamea isolated from a petroleum-contaminatedtropical soil. Syst. Appl. Microbiol. 30:331–339.

39. Wang, X. B., et al. 12 June 2011, posting date. Degradation of petroleumhydrocarbons (C6–C40) and crude oil by a novel Dietzia strain. Bioresour.Technol. doi:10.1016/j.biortech.2011.06.009.

40. Whyte, L. G., et al. 2002. Gene cloning and characterization of multiplealkane hydroxylase systems in Rhodococcus strains Q15 and NRRL B-16531.Appl. Environ. Microbiol. 68:5933–5942.


on Decem


.asm.org/

Dow

nloaded from

http://aem.asm.org/

two novel alkane hydroxylase-rubredoxin fusion genes ... · alkane hydroxylation is the key step in...

Documents