Transgenic Arabidopsis and tobacco plants overexpressingan aquaporin respond differently to various abiotic stresses

Ji Young Jang Æ Seong Hee Lee Æ Ji Ye Rhee ÆGap Chae Chung Æ Sung Ju Ahn Æ Hunseung Kang

Received: 26 January 2007 / Accepted: 3 May 2007 / Published online: 24 May 2007

� Springer Science+Business Media B.V. 2007

Abstract Despite the high isoform multiplicity of aqu-

aporins in plants, with 35 homologues including 13 plasma

membrane intrinsic proteins (PIPs) in Arabidosis thaliana,

the individual and integrated functions of aquaporins under

various physiological conditions remain unclear. To better

understand aquaporin functions in plants under various

stress conditions, we examined transgenic Arabidopsis and

tobacco plants that constitutively overexpress Arabidopsis

PIP1;4 or PIP2;5 under various abiotic stress conditions.

No significant differences in growth rates and water

transport were found between the transgenic and wild-type

plants when grown under favorable growth conditions. The

transgenic plants overexpressing PIP1;4 or PIP2;5 dis-

played a rapid water loss under dehydration stress, which

resulted in retarded germination and seedling growth under

drought stress. In contrast, the transgenic plants overex-

pressing PIP1;4 or PIP2;5 showed enhanced water flow and

facilitated germination under cold stress. The expression of

several PIPs was noticeably affected by the overexpression

of PIP1;4 or PIP2;5 in Arabidopsis under dehydration

stress, suggesting that the expression of one aquaporin

isoform influences the expression levels of other aquapo-

rins under stress conditions. Taken together, our results

demonstrate that overexpression of an aquaporin affects the

expression of endogenous aquaporin genes and thereby

impacts on seed germination, seedling growth, and stress

responses of the plants under various stress conditions.

Keywords Abiotic stress � Aquaporin � Arabidopsis

thaliana � Tobacco � Transgenic plants � Water channel

Abbreviations

PIP Plasma membrane intrinsic protein

Introduction

Water uptake and flow across cellular membranes is

important not only for plant growth under favorable con-

ditions but also for ability of a plant to tolerate adverse

environmental conditions (Bohnert et al.1995; Steudle and

Peterson 1998; Blumwald 2000). Plants possess large

families of aquaporins that are divided into four different

subfamilies based on subcellular localization and sequence

similarity: plasma membrane intrinsic proteins (PIPs),

tonoplast intrinsic proteins (TIPs), NOD26-like MIPs or

NOD26-like intrinsic proteins (NIPs), and small basic

intrinsic proteins (SIPs) (Jauh et al. 1999; Quigley et al.

2001; Tyerman et al. 2002). The genome of Arabidopsis

encodes 35 aquaporin genes that include 13 PIPs, 10 TIPs,

9 NIPs, and 3 SIPs (Johanson et al. 2001; Quigley et al.

2001). The structural and biochemical properties of aqu-

aporins have been studied in detail (Johansson et al. 2000;

Chaumont et al. 2001; Murata et al. 2000), and the sub-

cellular localization, water transport activity, and regula-

tion of plant aquaporins have been described previously

Electronic supplementary material The online version of thisarticle (doi:10.1007/s11103-007-9181-8) contains supplementarymaterial, which is available to authorized users.

J. Y. Jang � S. H. Lee � J. Y. Rhee � G. C. Chung �S. J. Ahn � H. Kang (&)

Department of Plant Biotechnology, Agricultural Plant Stress

Research Center and Biotechnology Research Institute, College

of Agriculture and Life Sciences, Chonnam National University,

300 Yongbong-dong, Buk-gu, Gwangju 500-757, Korea

e-mail: hskang@chonnam.ac.kr

123

Plant Mol Biol (2007) 64:621–632

DOI 10.1007/s11103-007-9181-8

(Kaldenhoff et al. 1998; Martre et al. 2002; Maurel et al.

2002; Siefritz et al. 2002; Tyerman et al. 2002).

The importance of aquaporins in the responses of plants

to environmental stresses has been implicated by the

observation that the expression of aquaporin isoforms is

differently modulated by various environmental stresses,

including high salinity, drought, and cold, in various plant

species (Mariaux et al. 1998; Smart et al. 2001; Suga et al.

2002; Sakr et al. 2003; Jang et al. 2004; Alexandersson

et al. 2005; Boursiac et al. 2005; Sakurai et al. 2005; Zhu

et al. 2005). During the last several years, attempts to

understand the roles of aquaporins in response to envi-

ronmental stresses have prompted the analysis of trans-

genic plants and loss-of-function mutant lines (Reviewed

by Hachez et al. 2006). Reduction of the expression of

PIP1 and PIP2 aquaporins in Arabidopsis and NtAQP1

aquaporin in tobacco by means of an antisense construct

resulted in alterations in root hydraulic conductivity,

resistance to water stress, or recovery from water deficit

(Martre et al. 2002; Siefritz et al. 2002). Aharon et al.

(2003) overexpressed PIP1;2 in tobacco plants and found

that, under favorable growth conditions, the transgenic

tobacco plants displayed increased growth rates, transpi-

ration rates, stomatal density, and photosynthetic effi-

ciency, whereas PIP1;2 overexpression had a negative

effect under drought stress. It has been shown that over-

expression of a barley aquaporin raised salt sensitivity in

transgenic rice plants (Katsuhara et al. 2003), and the

contribution of a single aquaporin gene to root water up-

take has also been demonstrated (Javot et al. 2003). More

recently, the role of lily PIP1 in osmotic water permeability

of leaf cells was demonstrated (Ding et al. 2004). Lian

et al. (2004) showed that transgenic rice plants overex-

pressing aquaporin RWC3 were more tolerant to drought

stress compared with non-transformed control plants, and

overexpression of BnPIP1 in transgenic tobacco plants

resulted in an increased tolerance to water stress (Yu et al.

2005). Despite the increasing number of reports demon-

strating the roles of aquaporins in plant response to envi-

ronmental stresses, the function of each individual

aquaporin isoform and the integrated function of aquapo-

rins in response to various environmental stresses remain

poorly understood.

In the previous report, we showed that PIP aquaporin

isoforms are expressed at different levels in both the aerial

parts and the roots of Arabidopsis plants; these isoforms

are regulated differently by various abiotic stresses,

including drought, salt, or cold stress (Jang et al. 2004). To

understand the stress responses of transgenic plants over-

expressing an aquaporin, we overexpresed the Arabidopsis

PIP1 or PIP2 in Arabidopsis and tobacco plants, and ob-

served growth performance and stress tolerance of the

transgenic plants under drought, salt, or cold stress. Among

the 13 PIP genes, we investigated PIP1;4 and PIP2;5 as

representative PIP1-type and PIP2-type aquaporins,

respectively. PIP2;5 was chosen because it is the PIP that is

up regulated in the roots and aerial parts of Arabidopsis by

both drought and cold stresses (Jang et al. 2004). PIP1;4

was chosen because it is not down regulated by drought

stress and is slightly up regulated in the roots by cold stress

compared with other PIP1-type aquaporins (Jang et al.

2004). Because PIP1;4 and PIP2;5 are expressed at low

levels in both the aerial parts and the roots of Arabidopsis

plants (Jang et al. 2004), it is also of interest to examine

whether the overexpression of PIP1;4 or PIP2;5 influences

the expression of other endogenous PIP members in Ara-

bidopsis under stress conditions. In this report, we dem-

onstrate that the transgenic plants respond differently to

changing environmental conditions, and the observed

phenotypes are closely correlated with the ability of aqu-

aporins to transport water in the transgenic plants,

emphasizing the importance of aquaporin-mediated water

transport in plant responses to environmental stresses.

Materials and methods

Plant materials and growth conditions

Arabidopsis thaliana ecotype Columbia was grown on

half-strength Murashige and Skoog (1962) (MS) medium at

23 ± 2�C under a long day condition (16-h-light/8-h-dark

cycle). Tobacco (Nicotiana tabacum cv. Xanthi) was grown

either on half-strength solid MS medium or hydroponically

in the nutrient solution (Cooper 1975) under a long day

condition. For the experiments in pots, the seeds were sown

on a 2:1:1 mixture of vermiculite, peat moss, and perlite.

The pots were placed in the dark for 3 days at 4�C and

were then transferred to normal growth conditions. The

plants were watered once per week. For cell pressure probe

measurement, tobacco seeds were germinated for 2 to

3 days at 22�C on filter paper soaked with tap water. After

germination, seedlings were transferred to 1/5-strength

Cooper medium and grown at 23 ± 2�C under 12-h-light/

12-h-dark cycle at a light intensity of 300 lE m–2 s–1.

Oxygen was supplied by continuous aeration of the nutrient

solution. To avoid excessive depletion of any particular

ion, the entire solution was replaced frequently.

Germination and seedling growth assays under stress

conditions

Seeds from individual plants grown in identical environ-

mental conditions were harvested on the same day and used

for germination and seedling growth assays. Germination

assays were carried out on three replicates of 20–30 seeds.

622 Plant Mol Biol (2007) 64:621–632

123

Seeds were sown on MS medium supplemented with 1.5%

sucrose, and the plates were placed at 4�C for 3 days in the

dark and then transferred to normal growth conditions. To

determine the effect of salt or dehydration on germination,

the medium was supplemented with various concentrations

of NaCl ranging from 75 to 150 mM or with concentra-

tions of mannitol ranging from 100 to 400 mM, respec-

tively. To determine the effect of cold on germination, the

seeds on MS plates were placed in an incubator maintained

at 10�C under white light. A seed was regarded as ger-

minated when the radicle protruded through the seed coat.

To determine the effect of salt or dehydration on seedling

growth, the 3-day-old seedlings germinated in normal

medium were transferred to the medium supplemented

with various concentrations of NaCl or mannitol, respec-

tively, and the seedling growth was monitored for 14 days.

To test the effect of cold stress on seedling growth, the

seeds were allowed to germinate at normal growth condi-

tions and were then transferred to an incubator maintained

at 10�C. The plates were placed vertically in a growth

chamber and the length of roots was measured under these

stress conditions.

Vector construction and plant transformation

The coding regions of PIP1;4 and PIP2;5 cDNA were

prepared by PCR and ligated into the pGEM T-easy vector

(Promega, Madison, WI, USA). The vector was digested

with XbaI and BamHI, and the resulting DNA was then

subcloned into the pBI121 vector linearized by double

digestion with the same restriction enzymes. All DNA

manipulations were performed according to the standard

procedures (Sambrook et al. 1989), and PIP-coding regions

and the junction sequences were confirmed by DNA

sequencing. Transformation of Arabidopsis was performed

according to the vacuum infiltration method (Bechtold and

Pelletier 1998) using Agrobacterium tumefaciens GV3101.

Tobacco transformation was done according to the leaf disc

method (Gallois and Marinho 1995) using A. tumefaciens

GV3101. Seeds were harvested and plated on kanamycin

(50 lg/ml for Arabidopsis and 100 lg/ml for tobacco) and

carbenicillin (250 lg/ml for Arabidopsis and 500 lg/ml for

tobacco) selection medium to identify transgenic plants.

After further selection of transgenic lines with a segrega-

tion ratio of 3:1, T3 or T4 homozygous lines were used for

the phenotypic investigation.

RNA extraction, reverse-transcription PCR, and real-

time RT-PCR

Total RNA was extracted from the frozen samples using

the Plant RNeasy extraction kit (Qiagen, Valencia, CA,

USA). The concentration of RNA was accurately quantified

by spectrophotometric measurements, and 5 lg of total

RNA was separated on 1.2% formaldehyde agarose gel to

check the concentrations and to monitor the integrity of

samples. A half to one microgram of total RNA was used in

an RT-PCR system (Qiagen) together with gene-specific

primers; PIP1;4 (forward, 5¢ TCTAGAATGGAAGGCA

AAGAAGAAGATG 3¢; reverse, 5¢ GGATCCCTAACTC

TTGCTCTTGAAAGG 3¢), PIP2;5 (forward, 5¢ GGGATC

CCAATGACGAAGGAAGTGG 3¢; reverse, 5¢ CTCGA

GTTAAACGTGAGGCTGGCTC 3¢), Arabidopsis actin

(forward, 5¢ CAGCAGAGCGGGAAATTGTAAGAG 3¢;reverse, 5¢ TTCCTTTCAGGTGGTGCAACGAC 3¢),tobacco actin (forward, 5¢ TGGACTCTGGTGATGGTGTC

3¢; reverse, 5¢ CCTCCAATCCAAACACTGTA 3¢). The

real-time quantification of RNA targets was performed in

the Rotor-Gene 2000 real-time thermal cycling system

(Corbett Research, Sydney, Australia) using the QuantiTect

SYBR Green RT-PCR kit (Qiagen) as described (Kim et al.

2003). The gene-specific primers for 13 PIP-type aquaporins

are as previously described (Jang et al. 2004), and the

primers for 12 H+-ATPases are listed in Supplemental Table

S1. After normalization of the RNA content using actin gene

expression pattern in each sample, the expression levels of

each gene in wild type and transgenic plants under stress

conditions were calculated by comparing their expression

levels under non-stressed control plants.

Western blot analysis

Total proteins were extracted by incubating the plant

materials in the detergent solution containing 0.1% (w/v)

Triton X-100 and 1% (w/v) SDS, and were separated by

SDS-12% PAGE. The gels were subsequently used for

Western blotting where the proteins in the gel were trans-

ferred to a polyvinylidene difluoride membrane. The

membrane was incubated with the buffer containing the

anti-PAQs, the antibody of which was raised against the

synthetic peptide (KDYNEPPPAPLFEPGELSSWS) con-

taining a conserved sequence among PIP-type aquaporins

in the N-terminal parts and reacts with most PIP-type

aquaporin isoforms (Ohshima et al. 2001). After three cy-

cles of washing with TBS-T buffer or PBS-milk, the

membrane was incubated for 1 h with anti-IgG antiserum

conjugated to horseradish peroxidase (Sigma-Aldrich, St.

Louis, MO, USA). After a further three cycles of washing

with the same buffer, the proteins on the membrane were

detected by the enhanced chemiluminescence system

(ECL, Amersham Biosciences, Uppsala, Sweden).

Cell pressure probe measurements

Cell pressure probe measurements were essentially per-

formed as described previously (Lee et al. 2005a). The

Plant Mol Biol (2007) 64:621–632 623

123

Tw1/2 was used as a direct measure of changes in Lp, as

the elastic modulus of the cells did not change signifi-

cantly between 10 and 22�C (Lee et al. 2005b). An oil-

filled glass capillary tube with a tip diameter ranging

from 6 to 8 lm was attached to the probe. Excised to-

bacco roots were fixed on a metal sledge, and the

nutrient solution was poured along the roots during the

experiments. Measurements were made on the second to

third layer of cortical cells at a distance of about 30–

50 mm from the root apex. Hydrostatic pressure relax-

ations were induced by rapidly moving the meniscus

using the micrometer screw of the probe and keeping it

at the new position until a steady pressure was again

attained. Pressure versus time curve was recorded from

which Tw1/2 was evaluated. When turgor pressure was

stable, 3 to 4 hydrostatic pressure relaxations were in-

duced to measure Tw1/2 before exposing the cells to

different conditions such as high salt (50 mM NaCl),

dehydration (100 mM mannitol), HgCl2 (50 and

100 lM), or cold stress (10�C).

Measurements of sap flow, photosynthesis, stomatal

conductance, transpiration, and chlorophyll

fluorescence

A heat-balance sap-flow gauge (Dynamax, Houston, TX,

USA) was used to measure sap flow through the main

stems of approximately 40-day-old tobacco plants. A

10 mm stem-gauge was attached to the stem just above

the cotyledons. Gauge signals, recorded with a data logger

(Campbell Scientific, Logan, UT, USA), were collected

every 1 min and averaged over 15 min. The entire

experiment was repeated three times. Photosynthesis was

measured with a portable photosynthesis measuring sys-

tem (LI-6400, LI-COR, Lincoln, NE, USA). The chamber

was clamped over the first fully expanded leaf by

enclosing the leaf in a transparent cuvette that was held

horizontally. The stomatal resistance and transpiration

rate were measured with an LI-1600 steady state po-

rometer as previously described (Shulze et al. 1982).

Chlorophyll fluorescence was measured by an OSI-FL

chlorophyll fluorescence measurement system (Opti- Sci-

ences, Inc., Hudson, NH, USA) as previously described

(Oquist and Wass 1988).

Statistical analysis

Data were square root-transformed prior to analysis, and

differences in Tw1/2, stomatal resistance, transpiration, and

gene expression levels between the wild-type and trans-

genic plants were compared by t-test (P £ 0.05; Sigma-

Plot software; Systat Software, Inc.).

Results

Overexpression of PIP1;4 or PIP2;5 does not enhance

plant vigor and water transport under favorable growth

conditions

To examine the responses of transgenic plants overex-

pressing a single aquaporin isoform under various stress

conditions, we generated transgenic Arabidopsis and to-

bacco plants constitutively overexpressing PIP1;4 or

PIP2;5 under control of the cauliflower mosaic virus 35S

promoter (35S::PIP1;4 or 35S::PIP2;5 plants). Transgenic

Arabidopsis and tobacco plants were used for phenotype

comparison, and transgenic tobacco plants were employed

for the measurements of cell pressure probe, sap flow,

stomatal conductance, and transpiration. The expression of

PIP1;4 and PIP2;5 in T3 transgenic plants was confirmed

by RT-PCR analysis (Fig. 1). We further conformed the

overexpression of PIP1;4 and PIP2;4 by protein gel blot

analysis using an anti-PAQs antibody that was prepared to

detect most PIP-type aquaporins (Ohshima et al. 2001). It

was evident that the expression of PIP1;4 and PIP2;5 is

much higher in transgenic plants than in wild-type plants

(Fig. 1). The intensity of the bands corresponding to PIP2;5

was weaker than that of PIP1;4, which may result from the

fact that the anti-AQP antibody used in this study was

raised against the synthetic peptide of the conserved region

of PIP1-type aquaporins and therefore reacts more strongly

Actin

PIP

PIP

Actin

WT T-1 T-2 T-3 WT T-1 T-2 T-3PIP1;4 PIP2;5

(A)

(B)

WT 1;4-1 1;4-2 2;5-1 2;5-2

WT 1;4-1 1;4-2 2;5-1 2;5-2

WT T-1 T-2 T-3 WT T-1 T-2 T-3PIP1;4 PIP2;5

PIP

PIP

Fig. 1 Confirmation of the transgenic lines. RT- PCR and Western

analyses of the expression of PIP1;4 or PIP2;5 in the wild-type plants

and independent transgenic lines (T-1, T-2, and T-3) in (A) two-

week-old whole Arabidopsis plants grown in MS medium and (B)

two-week-old tobacco plants grown in MS medium

624 Plant Mol Biol (2007) 64:621–632

123

with PIP1;4 than PIP2;5. The expression levels of PIP1;4

and PIP2;5 were quite similar in both the roots and aerial

parts of transgenic plants as determined by RT-PCR and

protein gel blot analysis (data not shown). Three repre-

sentative plants were subsequently selected for further

analysis. The expression of PIP1;4 or PIP2;5 in the trans-

genic tobacco plants was also assessed by the measurement

of their respective water transport activities using a cell

pressure probe. In all of the plants tested, the half-time of

water exchange (Tw1/2) observed upon hydrostatic pressure

relaxation was in the range of 1 to 2 s (Tables 1 and 2).

The Tw1/2 was used as a direct measure of changes in Lp, as

the cell elastic modulus did not change significantly

depending on stress conditions (Lee et al. 2005b). The

water transport activity of PIP1;4 and PIP2;5 that contain

four cysteine residues at the positions of 83, 105, 141 and

146, and 74, 96, 132 and 137, respectively, should be

inhibited by HgCl2 treatment. The half-time of water ex-

change (Tw1/2) in the wild-type tobacco plants markedly

increased upon the addition of 50 lM HgCl2, whereas

Tw1/2 in the transgenic plants expressing PIP1;4 or PIP2;5

remained constant at the same HgCl2 concentration. A

much higher concentration of HgCl2 (100 lM) was re-

quired to block the water transport in the transgenic plants

(Table 1), which indicates that larger numbers of aquaporin

are present in the transgenic plants compared with the wild-

type plants.

To assess the effect of PIP1;4 or PIP2;5 overexpression

on plant growth at favorable growth conditions, we ana-

lyzed seed germination and seedling growth of the wild-

type and transgenic plants under normal growth conditions.

No differences in germination and seedling growth were

observed among the wild-type and overexpression lines

(Fig. 2). Photosynthesis, chlorophyll fluorescence, stomatal

resistance, and transpiration were not changed in the

transgenic plants compared with the wild-type plants

under normal growth conditions (data not shown).

These observations demonstrate that overexpression of

PIP1;4 or PIP2;5 does not contribute to the enhancement of

plant vigor and water transport under favorable growth

conditions.

Overexpression of PIP1;4 or PIP2;5 causes a rapid

water loss under drought stress

We then investigated the effect of overexpression of PIP1;4

or PIP2;5 on germination and growth of Arabidopsis and

tobacco plants under osmotic stress conditions. When

the seeds of wild-type and 35S::PIP1;4 or 35S::PIP2;5

Arabidopsis plants were germinated in the presence of

Table 1 Effect of HgCl2 on the water permeability of cortical cells in the wild-type and transgenic tobacco plants

Plant Half-time of water exchange (Tw1/2) (s)

Control 50 lM HgCl2 100 lM HgCl2

Wild type 1.4 ± 0.4a 5.2 ± 0.4b 6.0 ± 1.3b

PIP1;4-1 1.3 ± 0.5a 2.1 ± 0.4a 5.1 ± 1.9b

PIP1;4-3 1.4 ± 0.6a 1.9 ± 0.4a 4.9 ± 1.7b

PIP2;5-1 1.1 ± 0.3a 1.5 ± 0.6a 6.2 ± 1.3b

PIP2;5-3 1.2 ± 0.2a 1.5 ± 0.5a 5.2 ± 1.1b

Different concentrations of HgCl2 were added to the circulating medium after performing control measurements for 20 min, and the water

exchange was measured for an additional 30 min. Values are means ± SD (n = 6), and the different letters in each low and column indicate

statistically significant differences (P £ 0.05)

Table 2 Effect of dehydration stress on hydrostatic and osmotic hydraulic conductivity of cortical cells, stomatal resistance, and transpiration in

the wild-type and transgenic tobacco plants

Plant Hydrostatic Lp (Tw1/2)a (s) Osmotic Lp (Tw

1/2)a (s) Stomatal resistance(cm s–1) Transpiration(lg cm–2 s–1)

Wild type 1.9 ± 0.6a 226.8 ± 39.1b 1.77 ± 0.50d 5.37 ± 1.40f

PIP1;4-1 1.5 ± 0.4a 119.8 ± 16.0c 2.66 ± 1.52e 4.60 ± 1.71f

PIP1;4-3 1.4 ± 0.4a 121.8 ± 17.0c 2.70 ± 1.54e 4.65 ± 1.75f

PIP2;5-1 1.7 ± 0.6a 80.8 ± 19.9c 2.87 ± 1.55e 3.66 ± 1.83g

PIP2;5-3 1.6 ± 0.5a 81.9 ± 20.8c 2.85 ± 1.54e 3.71 ± 1.79g

Hydrostatic and osmotic hydraulic conductivity of cortical cells were measured in the medium containing 100 mM mannitol for dehydration

stress. Stomatal resistance and transpiration rates were measured in the plants subjected to dehydration stress at 200 mM mannitol for 1 daya The half-time of water exchange was used as a direct measure of changes in Lp. Values are means ± SD (n = 7), and the different letters in

each column indicate statistically significant differences (P £ 0.05)

Plant Mol Biol (2007) 64:621–632 625

123

200 mM mannitol, approximately 60% of wild-type seeds

germinated at day 3, while only 45–55% of the transgenic

seeds germinated at day 3. Nearly 90% of wild-type seeds

germinated by day 6, but germination rates of the trans-

genic lines were approximately 75–85% at day 6 (Fig. 3A).

This retardation of germination in 35S::PIP1;4 or

35S::PIP2;5 lines was more severe at a higher mannitol

concentration, in that ~25% and 70% of wild-type seeds

germinated at days 3 and 6, respectively, while only 10–

20% and 45–60% of the transgenic seeds germinated at

days 3 and 6, respectively, in the presence of 300 mM

mannitol (data not shown). Similar patterns of retarded

germination were also observed for the transgenic tobacco

plants compared with wild-type plants under dehydration

stress (data not shown). To further confirm the effect of

PIP1;4 or PIP2;5 overexpression on the growth perfor-

mance of Arabidopsis and tobacco plants under drought

(B)

5.8 0.4 5.5 0.9 5.9 0.5

WT PIP1;4 PIP2;5

(C)

(D)

0

20

40

60

80

100

120

0 1 2 3 4 5Days

)%( noitani

mreG

Col-01;4-11;4-22;5-12;5-2

(A)

Fig. 2 Growth of the wild-type and transgenic plants under normal

growth conditions. (A) Germinations of the wild-type (Col-0) and

transgenic (1;4-1, 1;4-2, 2;5-1, and 2;5-2) Arabidopsis plants were

measured on MS medium, and the (B) the wild-type and transgenic

Arabidopsis seedlings were photographed 21 days after germination.

Root lengths (cm) are means ± SD obtained from three independent

experiments (n = 20–25). (C) The wild-type and transgenic Arabid-opsis plants were photographed 14 days after germination on soil, and

(D) the wild-type and transgenic tobacco seedlings were photo-

graphed 4 weeks after germination on soil

(B)

(C)

PIP1;4

0

20

40

60

80

100

120

0 2 4 6 8 10Days

)%( etar lavi vruS

Col-01:4-11;4-22;5-12;5-2

40 63 168% 3% 6%

Col-0 PIP2;5

WT PIP1;4 PIP2;5

0

20

40

60

80

100

120

0 1 2 3 4 5 6 7Days

)%( noitani

mreG

Col-01;4-11;4-22;5-12;5-2

(A)

Fig. 3 Drought sensitivity of the transgenic plants expressing either

PIP1;4 or PIP2;5. (A) Germinations of the wild-type (Col-0) and

transgenic (1;4-1, 1;4-2, 2;5-1, and 2;5-2) Arabidopsis plants were

measured on MS medium supplemented with 200 mM mannitol. (B)

Phenotypes and survival rates of 4-week-old tobacco (top) and 2-

week-old Arabidopsis plants (bottom) subjected to drought stress for

2 weeks. The numbers below photograph represent survival rates (%)

of the plants. (C) Survival rates of Arabidopsis plants were examined

on MS medium supplemented with 400 mM mannitol. Values are

means ± SE obtained from five independent experiments (n = 20–25)

626 Plant Mol Biol (2007) 64:621–632

123

stress, water was withheld from 2-week-old Arabidopsis

and 6-week-old tobacco plants, and the phenotypes of the

plants were monitored for several days. It was evident that

the transgenic plants that overexpressed PIP1;4 or PIP2;5

wilted much faster and survived less than the non-trans-

formed plants (Fig. 3B). The transgenic Arabidopsis and

tobacco plants started wilting as soon as day 10 and day 20,

respectively, after the termination of irrigation, at which

time the non-transformed control plants still showed a

nearly normal phenotype. It took 15 days without irrigation

for the wild-type Arabidopsis and 25 days for the control

tobacco plants to start to visibly wilt. It was apparent that

35S::PIP1;4 and 35S::PIP2;5 Arabidopsis plants showed

lower survival rates than the non-transformed plants in the

medium supplemented with 400 mM mannitol (Fig. 3C).

Although the difference was not significant, stomatal

resistance in the transgenic tobacco plants is slightly higher

than that in wild-type plants, whereas transpiration in the

transgenic tobacco plants is slightly lower than that ob-

served in wild-type plants under dehydration stress (Ta-

ble 2). No significant changes in photosynthesis and

chlorophyll fluorescence were observed between the wild-

type and transgenic plants (data not shown). These obser-

vations reveal that overexpression of PIP1;4 or PIP2;5 had

a negative effect on water status in the transgenic plants,

which resulted in retarded germination and growth of

Arabidopsis and tobacco plants under drought stress.

Since it is apparent that overexpression of PIP1;4 or

PIP2;5 in Arabidopsis and tobacco plants caused faster

wilting of the plants under drought stress, we next inves-

tigated, by employing the cell pressure probe, whether

these changes in phenotype are directly related to the water

transport activities of aquaporins under dehydration stress

conditions. This experiment was conducted only on the

transgenic tobacco plants due to the technical feasibility of

the measurements. When osmotic stress was applied to the

roots by the addition of 100 mM mannitol to the medium,

the Tw1/2 of cortical cells in the wild-type plants increased

up to ~226 s, whereas those in the 35S::PIP2;5 and

35S::PIP1;4 transgenic lines increased to ~80 s and ~120 s

(Table 2), respectively, which indicates that cortical cells

in the 35S::PIP2;5 and 35S::PIP1;4 plants lost water much

faster than those in the wild-type plant under an osmotic

stress condition. The differences in the Tw1/2 of cortical

cells were specifically caused by dehydration stress; when

high salinity stress was applied to the roots by the addition

of 50 mM NaCl to the medium, the Tw1/2 of cortical cells

in the wild-type, 35S::PIP2;5, and 35S::PIP1;4 plants in-

creased to ~44 to 55 s with no significant differences (data

not shown). This result, together with the observation that

overexpression of PIP1;4 or PIP2;5 had no impact on

germination and seedling growth of Arabidopsis and to-

bacco plants under salt stress (data not shown), indicate

that overexpression of PIP1;4 or PIP2;5 does not alter plant

response to salt stress. The effect of PIP1;4 or PIP2;5

overexpression on water transport under osmotic stress was

also investigated by sap flow measurements. When osmotic

stress was imposed to the roots by the addition of 200 mM

mannitol to the medium, sap flow in the transgenic plants

decreased much faster and to a lower level than that ob-

served in the wild-type plant (Fig. 4A). It was apparent that

sap flow in the 35S::PIP2;5 plant decreased much faster

than that in the 35S::PIP1;4 plant under osmotic stress.

Overexpression of PIP1;4 or PIP2;5 contributes to

enhanced water flow under cold stress

Because cold stress greatly increased the expression of

PIP2;5 (Jang et al. 2004), it was expected that PIP2;5

could contribute to the enhancement of plant growth and

water transport under cold stress. We tested this hypothesis

by comparing germination, seedling growth, and water

transport of cortical cells of the transgenic plants with those

of wild-type plants under cold stress. At normal growth

temperature (23�C), germination of the wild-type and

transgenic Arabidopsis plants was initiated at day 1 and

completed at day 2 with no noticeable difference (data not

shown). However, when the seeds were incubated at a low

temperature (10�C), the 35S::PIP1;4 and 35S::PIP2;5

plants germinated earlier than wild-type plants; the wild-

0

5

10

15

20

)h/g( wolf paS

Wild type

1;4-1

2;5-1200 mM mannitol

(A)

0

5

10

15

20

)h/g( wolf paS

Wild type

1;4-1

2;5-1

(B)10οC

9:00 10:00 11:00 12:00 13:00 14:00

Time

22οC

Fig. 4 Effect of dehydration or cold stress on sap flow of the wild-

type and transgenic tobacco plants. Sap flows were measured on the

40-day-old wild-type and transgenic (1;4-1 and 2;5-1) tobacco plants

subjected to (A) 200 mM mannitol and (B) 10�C treatments

Plant Mol Biol (2007) 64:621–632 627

123

type seeds had not germinated on day 3, while approxi-

mately 5% and 13% of 35S::PIP1;4 and 35S::PIP2;5 plants

germinated on day 3, respectively. All of the transgenic

plants had germinated by day 5, whereas ~80% of wild-

type plants had germinated by the same day (Fig. 5A).

Although PIP1;4- or PIP2;5-overexpressing plants dis-

played earlier germination under cold stress, no significant

difference in seedling growth was observed between the

wild-type and transgenic Arabidopsis plants under cold

stress (Fig. 5B). Similar patterns of earlier germination and

no differences in seedling growth were also observed for

the transgenic tobacco plants compared with wild-type

plants under cold stress (data not shown). It was apparent

that overexpression of PIP1;4 or PIP2;5 affects seed ger-

mination of Arabidopsis and tobacco plants under cold

stress, but does not contribute to seedling growth of the

plants under cold stress. No significant differences in sto-

matal resistance and transpiration were observed between

the wild-type and transgenic tobacco plants upon cold

stress treatment (Table 3).

Cell pressure probe measurements were conducted on

the transgenic tobacco plants under cold stress. Exposure of

the roots to cold stress (10�C) drastically inhibited the

water permeability of cortical cells in the wild-type tobacco

plants, as revealed by the increase of Tw1/2 from ~1.4 s to

~8.0 s. In contrast, cortical cells in 35S::PIP1;4 and

35S::PIP2;5 transgenic plants had showed only a marginal

increase of Tw1/2 when subjected to the same cold stress

treatment (Table 3). The decreased water permeability of

the cells of the wild-type plants observed under cold stress

was recovered to the original value when the temperature

was increased back to 22�C (data not shown). These results

suggest that the water permeability of cortical cells in the

wild-type plants was decreased by cold stress, whereas

cortical cells in 35S::PIP1;4 and 35S::PIP2;5 transgenic

plants still maintained high levels of water permeability

under cold stress. To better understand the effect of PIP1;4

or PIP2;5 overexpression on water transport under cold

stress, water transport through stems in the wild-type and

transgenic tobacco plants was investigated by sap flow

measurements under cold stress. As shown in Fig. 4B, the

amount of water transport at normal growth temperature at

a light intensity of 150 lE m–2 s–1 was similar between the

wild-type and transgenic plants. However, when the tem-

perature of the growth medium was lowered to 10�C, sap

flow in the wild-type plants decreased much faster and to a

lower level than those in the transgenic plants. It was

evident that the transgenic tobacco plants overexpressing

either PIP1;4 or PIP2;5 maintained much higher water

transport ability than the wild-type plants under cold stress.

Effect of PIP1;4 or PIP2;5 overexpression on the

transcript levels of endogenous PIP genes in

Arabidopsis plants under stress conditions

It is likely that constitutive overexpression of a specific

aquaporin in a given plant may disturb the natural

expression patterns of endogenous aquaporin genes, which,

in turn, influences the different responses of transgenic

plants to various abiotic stresses. We therefore examined

whether the transcript levels of 13 PIP genes are modulated

by the overexpression of PIP1;4 or PIP2;5 in the transgenic

Arabidopsis plants under normal and stress conditions. As

shown in Fig. 6, the expression of PIPs was altered in

different manners by the overexpression of PIP1;4 or

PIP2;5 in Arabidopsis plants under different stress condi-

tions. Transcript levels of the 13 PIPs were not noticeably

varied in the transgenic plants grown in normal MS med-

ium; the expression of the PIPs in the transgenic plants was

PIP1;4 Col-0 PIP2;5

(A)

(B)

0

20

40

60

80

100

120

0 1 2 3 4 5 6Days

)%( noitani

mreG

Col-01;4-11;4-22;5-12;5-2

0

0.5

1

1.5

2

0 3 6 9Days

)mc( htgnel too

R

Col-01;4-11;4-22;5-12;5-2

Fig. 5 Cold sensitivity of the transgenic plants expressing either

PIP1;4 or PIP2;5. (A) Germinations of the wild-type (Col-0) and

transgenic (1;4-1, 1;4-2, 2;5-1, and 2;5-2) Arabidopsis plants were

measured following incubation at 10�C. (B) Root length was

measured at the indicated days, and a representative photograph of

the seedlings incubated in a vertical orientation was taken at 7th day

after transfer to the 10�C condition. Values are means ± SE obtained

from five independent experiments (n = 20–25)

628 Plant Mol Biol (2007) 64:621–632

123

not varied more than 1.5-fold compared to the wild-type

plants (Fig. 6A). Because the nucleotide sequences of the

primers used in real-time RT-PCR analysis correspond to

the 3-UTR of PIP1;4 and PIP2;5 as described previously

(Jang et al. 2004), the expression levels of PIP1;4 and

PIP2;5 seem to be similar in the wild-type and overex-

Table 3 Effect of cold stress on water permeability, stomatal resistance, and transpiration in the wild-type and transgenic tobacco plants

Temperature (�C) Plant (Tw1/2) (s) Stomatal resistance (cm s–1) Transpiration (lg cm–2 s–1)

22 Wild type 1.4 ± 0.4a 1.83 ± 0.52d 4.83 ± 1.60g

PIP1;4-1 1.0 ± 0.3a 1.65 ± 0.59d 4.90 ± 1.68g

PIP1;4-3 1.4 ± 0.3a 1.70 ± 0.65d 5.47 ± 2.64g

PIP2;5-1 1.1 ± 0.3a 1.23 ± 0.12d 6.32 ± 0.62g

PIP2;5-3 1.2 ± 0.4a 1.60 ± 0.46d 5.65 ± 1.86g

10 Wild type 8.0 ± 1.0b 2.69 ± 0.76df 3.34 ± 1.08gh

PIP1;4-1 2.0 ± 0.5a 1.74 ± 0.62d 5.23 ± 1.53g

PIP1;4-3 2.9 ± 0.7b 1.81 ± 0.77d 5.82 ± 1.40g

PIP2;5-1 1.8 ± 0.5a 1.49 ± 0.56d 6.53 ± 1.50g

PIP2;5-3 2.3 ± 0.8b 1.55 ± 0.18d 6.36 ± 0.69g

Half-times of water exchange (Tw1/2), stomatal resistance, and transpiration were measured at 22�C, and the temperature of the bath solution was

then gradually lowered to 10�C over the course of approximately 30 min. Values are means ± SD (n = 6), and the different letters in each column

indicate statistically significant differences (P £ 0.05)

0

1

2

3

11 12 13 14 15 21 22 23 24 25 26 27 28 actin

)lortnoc dlof( noisserpxE

Col-0 1;4-1 1;4-2 2;5-1 2;5-2

(A)

* * * ** * * **

*

(B)

(C)

0

1

2

3

11 12 13 14 15 21 22 23 24 25 26 27 28 actin

)lortnoc dlof( noisserpxE

Col-0 1;4-1 1;4-2 2;5-1 2;5-2

** ** *** **

***

***** ***

* *

* ***

0

1

2

3

11 12 13 14 15 21 22 23 24 25 26 27 28 actin

)lortnoc dlof( noisserpxE

Col-0 1;4-1 1;4-2 2;5-1 2;5-2

**** **

* ***

* ** **** ****

*

Fig. 6 Effect of PIP1;4 or PIP2;5 overexpression on the transcript

levels of 13 PIP genes in Arabidopsis plants under stress conditions.

The wild-type (Col-0) and transgenic (1;4-1, 1;4-2, 2;5-1, and 2;5-2)

Arabidopsis plants were grown in MS medium for 7 days followed by

(A) 12-h of further incubation in MS medium, (B) 12-h of further

incubation at 4�C, and (C) 12-h of further incubation in MS medium

supplemented with 200 mM mannitol. The expression of 13 PIP

genes was measured by quantitative real-time RT-PCR, and the plots

represent the relative expressions (fold) of each gene in the transgenic

plants compared with the expression in wild-type plants. The 11, 12,

13, etc, in x-axis represent PIP1;1, PIP1;2, PIP1;3, etc, respectively.

Values are means ± SE obtained from three independent experiments.

Asterisks above the columns indicate values that are statistically

different from control Col-0 values (P £ 0.05)

Plant Mol Biol (2007) 64:621–632 629

123

pression transgenic plants. However, overexpression of

PIP1;4 and PIP2;5 in the transgenic plants was evident

(Fig. 1). When the transgenic plants were subjected to cold

stress at 4�C for 12 h, transcript levels of several PIP genes

were marginally influenced in that the expression of

PIP1;4, PIP2;5, PIP2;6, and PIP2;7 in the 35S::PIP1;4

lines and PIP1;4, PIP1;5, PIP2;6, and PIP2;7 in the

35S::PIP2;5 lines increased slightly upon cold stress

treatment, whereas PIP2;2 was down regulated in the

transgenic plants compared with wild-type plants

(Fig. 6B). However, it was evident that transcript levels of

several PIP genes showed a much larger variation in the

transgenic Arabidopsis plants when subjected to osmotic

stress at 200 mM mannitol for 12 h. Expression of PIP1;5

and PIP2;8 increased, whereas transcript levels of PIP2;3

and PIP2;6 decreased in the transgenic plants compared

with wild-type plants under osmotic stress (Fig. 6C).

Similar patterns of PIP expression were observed when the

Arabidopsis plants were subjected to cold stress at 4�C for

24 h or osmotic stress at 200 mM mannitol for 24 h (data

not shown). No significant changes were observed in the

transcript level of Actin (Fig. 6), thereby indicating that our

experimental conditions and real-time RT-PCR analysis

were valid, and had allowed us to adequately monitor the

changes in transcript levels in the samples.

Discussion

Despite the rapidly expanding field of literature on the

isolation, sequence determination, and regulation of aqu-

aporins by environmental stimuli in various plant species,

reports demonstrating the functions of individual aquaporin

isoforms in plants under stress conditions are severely

limited. In the present study, we demonstrated that the

transgenic Arabidopsis and tobacco plants overexpressing

an aquaporin respond differently to various stress condi-

tions. It was apparent that constitutive overexpression of

PIP1;4 or PIP2;5 delays seed germination and seedling

growth, and hampers sap flow under osmotic stress, while it

facilitates seed germination, sap flow, and water transport

under cold stress. Some controversial findings on the roles

of aquaporins under stress conditions were obtained using

transgenic Arabidopsis or tobacco plants expressing dif-

ferent types of aquaporins. Siefritz et al. (2002) demon-

strated a beneficial effect of aquaporin on plants under

water stress. In contrast, Aharon et al. (2003) showed a

negative role of aquaporin during drought stress and a

positive effect of aquaporin on plant growth under favor-

able growth conditions. We showed here that overexpres-

sion of PIP1;4 or PIP2;5 had a negative effect on plant

growth under drought stress, but had no effect on plant

growth under favorable growth conditions (Figs. 2 and 3).

The observed drought-sensitive phenotypes of the

35S::PIP1;4 and 35S::PIP2;5 plants were closely correlated

with the water transport ability of aquaporins in plants

under stress conditions. We showed here that, under

dehydration stress, transgenic plants overexpressing PIP1;4

or PIP2;5 transferred less water, as deduced from their

lower transpiration, higher stomatal resistance, and lower

sap flow (Fig. 4A and Table 2). This reduced water status

during drought stress is closely related with the shorter

osmotic Lp of cortical cells, as indicated by shorter Tw1/2,

which suggests that the roots of the transgenic plants lost

water much faster than those of the wild-type plants under

dehydration stress. The relationship between the deleteri-

ous effect of PIP1;4 or PIP2;5 overexpression on plants

under drought stress and the natural function of this protein

is not simple, because the expression of PIP1;4 and PIP2;5

was stimulated by drought stress (Jang et al. 2004). It is

possible that the Arabidopsis PIP1;4 and PIP2;5 genes have

spatial and temporal patterns of expression and that their

induced expressions under drought stress are important,

specifically in the cells and developmental stages in which

they are expressed naturally. Since transgenic 35S::PIP1;4

and 35S::PIP2;5 plants express PIP1;4 and PIP2;5 consti-

tutively, irrespective of their natural regulation, it is likely

that enhanced water transport via the plasma membranes of

cells may be deleterious under water stress. This result

appears to support the previous proposition that a general

increase in water transport in most plant tissues and cells is

harmful under drought stress (Aharon et al. 2003). How-

ever, it is noteworthy that overexpression of PIP1;4 or

PIP2;5 modulated the transcript levels of several other PIP

isoforms in the transgenic plants under osmotic stress

(Fig. 6C). The expressions of PIP1;5 and PIP2;8 that were

down regulated in Arabidopsis plants under dehydration

stress (Jang et al. 2004) increased in the transgenic plants

compared with wild-type plants under dehydration stress,

and the transcript levels of PIP2;3 and PIP2;6 that were

down regulated in Arabidopsis plants under dehydration

stress (Jang et al. 2004) decreased in the transgenic plants

compared with wild-type plants under dehydration stress.

The complex expression pattern of different aquaporins in

plants under water stress implies that maintenance of a

reasonable water status under drought stress requires both

increased water transport via aquaporins in some cells and

tissues and reduced water transport via aquaporins in other

cells and tissues as suggested by Comparot et al. (2000). In

addition to the interactive role of PIP1;4 and PIP2;5 in

modulating the expression of other PIP-type aquaporins in

Arabidopsis plants under dehydration stress, it is also

possible that overexpression of PIP1;4 or PIP2;5 influences

other transport activities in plasma membrane of cells,

which regulates aquaporin activity under stress conditions.

Cytosolic pH regulates gating of aquaporins (Tournaire-Roux

630 Plant Mol Biol (2007) 64:621–632

123

et al. 2003), and it is likely that H+-ATPases (AHA) play

roles in regulating cytosolic pH under stress conditions. In

our analysis, it was noted that, among the 12 AHAs in

Arabidopsis, the expression of AHA1, AHA3, AHA10, and

AHA11 was noticeably modulated by PIP1;4 or PIP2;5 in

Arabidopsis plants under dehydration stress but not under

cold stress (Supplemental Fig. S1). It is, therefore, pro-

posed that the expression of a single aquaporin isoform

such as PIP1;4 and PIP2;5 influences the transcript levels

of other PIP-type aquaporins and H+-ATPases, and this

integrated regulation results in altered water status in

transgenic plants under dehydration stress.

The observed cold-resistant phenotypes of the

35S::PIP1;4 and 35S::PIP2;5 plants were also closely

correlated with the water transport ability of aquaporins in

plants under stress conditions. It was evident that, under

cold stress, the transgenic plants overexpressing PIP1;4 or

PIP2;5 transported more water, as deduced from shorter

Tw1/2 of cortical cells and higher sap flow (Table 3 and

Fig. 4B). It is believed that water fluidity decreases at low

temperatures, which results in lower water transport across

aquaporins. Therefore, it is likely that overexpression of

aquaporins helps the cells or tissues transport more water

under cold stress, which supports the previous notion that

aquaporins are needed for water flow during cold stress

(Sakr et al. 2003). Our observation that overexpression of

PIP2;5, the expression of which is highly stimulated in the

roots and aerial parts of Arabidopsis plants under cold

stress (Jang et al. 2004), had a positive effect on seed

germination and water transport under cold stress suggests

an important role of aquaporin in the water statuses of

plants in a low temperature condition. Overexpression of

PIP1;4, the expression of which is slightly up regulated in

the roots and down regulated in the aerial parts, also had a

positive effect, although not as significant as PIP2;5, on

water transport of tobacco plants under cold stress (Table 3

and Fig. 4B). Since we applied cold stress to the roots of

tobacco plants during sap flow and cell pressure probe

measurements, this result seems to correlate with the

expression pattern of PIP1;4, which shows slight up-regu-

lation in the roots of Arabidopsis plants under cold stress.

However, it would be premature to come to a definitive

conclusion regarding the effect of PIP1;4 or PIP2;5 over-

expression on cold stress because overexpression of PIP1;4

or PIP2;5 affected only germination and not seedling

growth of Arabidopsis and tobacco plants under cold stress.

It was noted that sap flow in the wild-type plants decreased

to a much lower level than that observed in the transgenic

tobacco plants during the early stage of cold treatment

(Fig. 4B), and sap flow in the wild-type plants was

recovered to higher level when the plants were maintained

for 24 h at low temperature (data not shown). These results

led us to propose that overexpression of an aquaporin

facilitates water transport and contributes to the mainte-

nance of a proper water status during the early stage of cold

stress. It is not clear at this stage whether every aquaporin

isoform plays a similar role in water transport during cold

stress. Further analyses on other aquaporins such as PIP1;1,

PIP1;2, PIP1;5, PIP2;2, PIP2;3, and PIP2;4, the expression

of which was highly down regulated by cold stress (Jang

et al. 2004), are needed to completely understand the roles

and involvement of aquaporins in the plant response to cold

stress.

In conclusion, the present work provided novel infor-

mation to increase our knowledge about the responses of

transgenic plants overexpressing an aquaporin to different

abiotic stress conditions. The observed drought-sensitive

and cold-resistant phenotypes of the transgenic plants are

closely correlated with the water transport ability of aqu-

aporins in plants under stress conditions. Although it is

premature to conclude that these responses of transgenic

plants to different stress conditions are directed specifically

by PIP1;4 or PIP2;5, the present results emphasize the

importance of aquaporin-mediated water transport in re-

sponse to environmental stresses, and provide a basis to

better understanding of the integrated functions of aqu-

aporins under various physiological conditions.

Acknowledgements We thank Dr. M. Maeshima for anti-PAQs

antibody. This work was supported by the SRC program of MOST/

KOSEF (R11-2001-092-04002-0) to the Agricultural Plant Stress

Research Center of Chonnam National University.

References

Aharon R, Shahak Y, Wininger S, Bendov R, Kapulnik Y, Galili G

(2003) Overexpression of a plasma membrane aquaporin in

transgenic tobacco improves plant vigor under favorable growth

conditions but not under drought or salt stress. Plant Cell

15:439–447

Alexandersson E, Fraysse L, Sjovall-Larsen S, Gustavsson S, Fellert

M, Karlsson M, Johanson U, Kjellbom P (2005) Whole gene

family expression and drought stress regulation of aquaporins.

Plant Mol Biol 59:469–484

Bechtold N, Pelletier G (1998) In planta Agrobacterium-mediated

transformation of adult Arabidopsis thaliana plants by vacuum

infiltration. Methods Mol Biol 82:259–266

Blumwald E (2000) Sodium transport and salt tolerance in plants.

Curr Opin Cell Biol 12:431–434

Bohnert HJ, Nelson DE, Jensen RG (1995) Adaptation to environ-

mental stress. Plant Cell 7:1099–1111

Boursiac Y, Chen S, Luu DT, Sorieul M, van den Dries N, Maurel C

(2005) Early effects of salinity on water transport in Arabidopsisroots. Molecular and cellular features of aquaporin expression.

Plant Physiol 139:790–805

Chaumont F, Barrieu F, Wojcik E, Chrispeels MJ, Jung R (2001)

Aquaporins constitutes a large and highly divergent protein

family in maize. Plant Physiol 125:1206–1215

Comparot S, Morilon R, Badot PM (2000) Water permeability and

revolving movement in Phaseolus vulgaris L. Plant Cell Physiol

41:114–118

Plant Mol Biol (2007) 64:621–632 631

123

Cooper AJ (1975) Crop production in recirculating nutrient solution.

Sci Hort 3:251–258

Ding X, Iwasaki I, Kitagawa Y (2004) Overexpression of a lily PIP1

gene in tobacco increased the osmotic water permeability of leaf

cells. Plant Cell Environ 27:177–186

Gallois P, Marinho P (1995) Leaf disk transformation using

Agrobacterium tumefaciens-expression of heterologous genes

in tobacco. Methods Mol Biol 49:39–48

Hachez C, Zelazny E, Chaumont F (2006) Modulating the expression

of aquaporin genes in planta: a key to understand their

physiological functions? Biochim Biophys Acta 1758:1142–

1156

Jang JY, Kim DG, Kim YO, Kim JS, Kang H (2004) An expression

analysis of a gene family encoding plasma membrane aquaporins

in response to abiotic stresses in Arabidopsis thaliana. Plant Mol

Biol 54:713–725

Jauh GY, Thomas EP, Rogers JC (1999) Tonoplast intrinsic protein

isoforms as markers for vacuolar functions. Plant Cell 11:1867–

1882

Javot H, Lauvergeat V, Santoni V, Martin-Laurent F, Guclu J, Vinh J,

Heyes J, Franck KI, Schaffner AR, Bouchez D, Maurel C (2003)

Role of a single aquaporin isoform in root water uptake. Plant

Cell 15:509–522

Johanson U, Karlsson M, Johansson I, Gustavsson S, Sjovall S,

Fraysse L, Weig AR, Kjellbom P (2001) The complete set of

genes encoding major intrinsic proteins in Arabidopsis provides

a framework for a new nomenclature for major intrinsic proteins

in plants. Plant Physiol 126:1358–1369

Johansson I, Karlsson M, Johanson U, Larsson C, Kjellbom P (2000)

The role of aquaporins in cellular and whole plant water balance.

Biochim Biophys Acta 1465:324–342

Kaldenhoff R, Grote K, Zhu J-J, Zimmermann U (1998) Significance

of plasmalemma aquaporins for water transport in Arabidopsisthaliana. Plant J 14:121–128

Katsuhara M, Koshio K, Shibasaka M, Hayashi Y, Hayakawa T,

Kasamo K (2003) Over-expression of a barley aquaporin

increased the shoot/root ratio and raised salt sensitivity in

transgenic rice plants. Plant Cell Physiol 44:1378–1383

Kim JS, Kim YO, Ryu HJ, Kwak YS, Lee JY, Kang H (2003)

Isolation of stress-related genes of rubber particles and latex in

fig tree (Ficus carica) and their expressions by abiotic stress or

plant hormone treatments. Plant Cell Physiol 44:412–419

Lee SH, Chung GC, Steudle E (2005a) Gating of aquaporins by low

temperature in roots of chilling-sensitive cucumber and -tolerant

figleaf gourd. J Exp Bot 56:985–995

Lee SH, Chung GC, Steudle E (2005b) Low temperature and

mechanical stress differently gate aquaporins of root cortical

cells of chilling-sensitive cucumber and -resistant figleaf gourd.

Plant Cell Environ 28:1191–1202

Lian HL, Yu X, Ye Q, Ding X, Kitagawa Y, Kwak SS, Su WA, Tang

ZC (2004) The role of aquaporin RWC3 in drought avoidance in

rice. Plant Cell Physiol 45:481–489

Mariaux JB, Bockel C, Salamini F, Bartels D (1998) Desiccation- and

abscisic acid-responsive genes encoding major intrinsic proteins

(MIPs) from the resurrection plant Craterostigma plantagineum.

Plant Mol Biol 38:1089–1099

Martre P, Morillon R, Barrieu F, North GB, Nobel PS, Chrispeels MJ

(2002) Plasma membrane aquaporins play a significant role

during recovery from water deficit. Plant Physiol 130:2101–2110

Maurel C, Javot H, Lauvergeat V, Gerbeau P, Tournaire C, Santoni V,

Heyes J (2002) Molecular physiology of aquaporins in plants. Int

Rev Cytol 215:105–148

Murashige T, Skoog F (1962) A revised medium for rapid growth and

bioassays with tobacco tissue culture. Physiol Plant 15:473–497

Murata K, Mitsuoka K, Hirai T, Walz T, Agre P, Heymann JB, Engel

A, Fujiyoshi Y (2000) Structural determinants of water perme-

ation through aquaporin-1. Nature 407:599–605

Ohshima Y, Iwasaki I, Suga S, Murakami M, Inoue K, Maeshima M

(2001) Low aquaporin content and low osmotic water perme-

ability of the plasma and vacuolar membranes of a CAM plants

Graptopetalum paraguayense: Comparison with radish. Plant

Cell Physiol 42:1119–1129

Oquist G, Wass R (1988) A portable, microprocessor operated

instrument for measuring chlorophyll fluorescence kinetic in

stress philology. Physiol Plant 73:211–217

Quigley F, Rosenberg JM, Shachar-Hill Y, Bohnert HJ (2001) From

genome to function: the Arabidopsis aquaporins. Genome Biol

3:1–17

Sakr S, Alves G, Morillon R, Maurel K, Decourteix M, Guilliot A,

Fleurat-Lessard P, Julien J-L, Chrispeels MJ (2003) Plasma

membrane aquaporins are involved in winter embolism recovery

in walnut tree. Plant Physiol 133:630–641

Sakurai J, Ishikawa F, Yamaguchi T, Uemura M, Maeshima M (2005)

Identification of 33 rice aquaporin genes and analysis of their

expression and function. Plant Cell Physiol 46:1568–1577

Sambrook J, Fritsch EF, Maniatis T (1989) Molecular cloning. A

laboratory manual. 2nd edn. Cold Spring Harbor Laboratory

Press, Cold Spring Harbor

Shulze ED, Hall AE, Landge OL, Walz H (1982) A portable steady

state porometer for measuring the carbon dioxide and water

vapour exchanges of leaves under natural conditions. Oecologia

53:141–145

Siefritz F, Tyree MT, Lovisolo C, Schubert A, Kaldenhoff R (2002)

PIP1 plasma membrane aquaporins in tobacco: from cellular

effects to function in plants. Plant Cell 14:869–876

Smart LB, Moskal WA, Cameron KD, Bennett AB (2001) MIP genes

are down-regulated under drought stress in Nicotiana glauca.

Plant Cell Physiol 42:686–693

Steudle E, Peterson CA (1998) How does water get through roots?. J

Ex Bo 49:775–788

Suga S, Komatsu S, Maeshima M (2002) Aquaporin isoforms

responsive to salt and water stresses and phytohormones in

radish seedlings. Plant Cell Physiol 43:1229–1237

Tournaire-Roux C, Sutka M, Javot H, Gout E, Gerbeau P, Luu D-T,

Bligny R, Maurel C (2003) Cytosolic pH regulates root water

transport during anoxic stress through gating of aquaporins.

Nature 425:393–397

Tyerman SD, Niemietz CM, Bramley H (2002) Plant aquaporins:

multifunctional water and solute channels with expanding roles.

Plant Cell Environ 25:173–194

Yu Q, Hu Y, Li J, Wu Q, Lin Z (2005) Sense and antisense expression

of plasma membrane aquaporin BnPIP1 from Brassica napus in

tobacco and its effects on plant drought resistance. Plant Sci

169:647–656

Zhu C, Schraut D, Hartung W, Schaffner AR (2005) Differential

responses of maize MIP genes to salt stress and ABA. J Exp Bot

56:2971–2981

632 Plant Mol Biol (2007) 64:621–632

123