Research ArticleTracking the Origin and Deciphering the PhylogeneticRelationship of Porcine Epidemic Diarrhea Virus in Ecuador

Maritza Barrera1 Ana Garrido-Haro2 Mariacutea S Vaca2 Danilo Granda2

Alfredo Acosta-Batallas3 and Lester J Peacuterez4

1Facultad de Ciencias Veterinarias Universidad Tecnica de Manabı Ave Urbina y Che Guevara Portoviejo Manabı Ecuador2Laboratorio de Biologıa Molecular Agencia Ecuatoriana de Aseguramiento de Calidad del Agro (Agrocalidad)Av Interoceanica Km 145 La Granja MAGAP Tumbaco Pichincha Ecuador3Laboratorio de Epidemiologia y Bioestadistica Veterinaria Universidad de Sao Paulo Sao Paulo SP Brazil4Dalhousie Medicine New Brunswick (DMNB) Saint John NB Canada E2L 4L5

Correspondence should be addressed to Lester J Perez lesterjosuegmailcom

Received 28 July 2017 Revised 12 October 2017 Accepted 29 October 2017 Published 12 December 2017

Academic Editor Yu-Chang Tyan

Copyright copy 2017 Maritza Barrera et alThis is an open access article distributed under the Creative Commons Attribution Licensewhich permits unrestricted use distribution and reproduction in any medium provided the original work is properly cited

In 2010 new Chinese strains of porcine epidemic diarrhea virus (PEDV) clinically more severe than the classical strains emergedThese strains were spread to United States in 2013 through an intercontinental transmission from China with further spreadingacross the world evidencing the emergent nature of these strains In the present study an analysis of PEDV field sequences fromEcuador was conducted by comparing all the PEDVS gene sequences available in theGenBank database Phylogenetic comparisonsand Bayesian phylogeographic inference based on complete S gene sequences were also conducted to track the origin and putativeroute of PEDV The sequence from the PED-outbreak in Ecuador was grouped into the clade II of PEDV genogroup 2a togetherwith other sequences of isolates from Mexico Canada and United States The phylogeographic study revealed the emergence ofthe Chinese PEDV strains followed by spreading to US in 2013 from US to Korea and later the introduction of PEDV to CanadaMexico and Ecuador directly from the US The sources of imports of live swine in Ecuador in 2014 were mainly from Chile andUS Thus this movement of pigs is suggested as the main way for introducing PEDV to Ecuador

1 Introduction

Porcine epidemic diarrhea (PED) is an acute and highlycontagious disease which causes severe enteritis vomitingwatery diarrhea dehydration and high mortality rates inpigs [1] PED was first described in 1971 in United Kingdomaffecting fattening pigs [2] and the etiological agent wasidentified in Belgium as a new coronavirus which was desig-nated as PED virus (PEDV) [3] PEDV belongs to the genusAlphacoronavirus of the family Coronaviridae subfamilyCoronavirinae and order Nidovirales PEDV genome con-sists of 28 kb long single-stranded RNAwith positive polarityand includes seven known open reading frames (ORFs) Twolarge ORFs 1a and 1b occupying two-thirds of the genomeencode two nonstructural polyproteins (pp1a and pp1b) thatdirect genome replication and transcription The remainingone-third of the genome encodes four structural proteinsspike (S) envelope (E) membrane (M) and nucleocapsid

(N) and one hypothetical accessory protein encoded by theORF3 gene [4] Of all viral proteins the PEDV S proteinhas a pivotal function regulating interactions with specifichost-cell receptor glycoproteins to mediate viral entry [5]Therefore PEDV S protein has been often used to understandthe genetic relationships between different PEDV strains andthe epidemiological status of PEDV in the field (reviewedin [4]) Other genes including ORF3 E M or N havebeen also utilized for phylogenetic inference [6ndash9] and somestudies have included PEDV full genome sequences to getbetter phylogenetic resolution [10 11] However realisticallysequencing the full genome of PEDV is still expensive fromboth computational and laboratory perspectives Moreoverfor many computationally intensive analyses utilizing thefull genome is unfeasible It would be therefore beneficialto use only those genomic regions that contain the highestphylogenetic signal to reduce cost without losing valuableinformation [12] In fact phylogenetic markers together

HindawiBioMed Research InternationalVolume 2017 Article ID 2978718 7 pageshttpsdoiorg10115520172978718

2 BioMed Research International

with powerful Bayesian phylogenetic approaches have beensuccessfully applied to track the origin of important viraloutbreaks [13 14] and establishmolecular epidemiology linksamong different viral strains including coronavirus members[15] For PEDV it was recently shown that the S and nsp3genes contain the lowest phylogenetic noise therefore bothare the highest recommended for phylogenetic analysis andmolecular characterization studies [11]

In 2010 new Chinese strains of PEDV clinically moresevere than the classical strains emerged [16] These strainswere spread to United States in 2013 through an interconti-nental transmission from China [17] with further spreadingto Canada [18] Mexico and other countries into the Ameri-can continent including Colombia and Dominican Republic(reviewed in [1]) Moreover in Europe the recent reports inGermany [19] France [20] and Belgium [21] of PED-out-breaks caused by strains closely related to the variants identi-fied in China and the United States evidence the emergentnature of these strains The epidemiological situation regard-ing PEDV turned more complicated since in December 2013a second PEDV strain OH851 (later named as S-INDELstrain) emerged in the US [22] This new PEDV strain wasalso reported in spring 2014 in Germany [19 23] as a con-sequence of a probable single or simultaneous introduction[24] and with later reports in other European countriesincluding France [20] Belgium [21] Italy [25] Austria [26]and Spain [27] Even though the PEDV S-INDEL strains haveshown lower virulence in the field [28] the clinical mani-festations of the disease in the European countries affectedhave been very variable with ranges of mortality between 0and 70 (reviewed in [29]) This recent global reemergenceof PED requires urgent attention and deeper understandingof PEDV epidemiological links driving the changes in viralpathogenicity Therefore this report was conducted usingthe complete sequence of the S gene and powerful Bayesianphylogeographic reconstructions to clarify the putative originof PEDV in Ecuador revealing the wide expansion of theemergent PEDV strains which caused the first PEDV out-break in this country

2 Material and Methods

21 Ethics Statement International standards for animal wel-fare were used for all animal samples collected following theregulations for animal sampling of the article number 134 ofAnimal Welfare Law included into the National Constitutionof the Republic of Ecuador

22 Collection Selection and Processing of Samples On July2014 a clinical outbreak with epidemiological characteristicscompatible with PEDV was reported in a pig farm located inthe province of Cotopaxi Ecuador In detail the commercialfarm contained a total of 10909 animals from which 1341animals were affected showing clinical signs compatible withPED 1043 died as a consequence of the disease and 1401were slaughtered as controlmeasure To avoid further spread-ing of the disease a National Contingency Plan was appliedincluding restrictions on the animal movement increasingthe biosafety measures and establishment of epidemiological

surveillance at national level From the PED-outbreak a viralisolation was obtained and named PEDVCotopaxi2014 Atotal of five fragments of ileum from three different diar-rheic pigs were taken together with the viral isolate PEDVCotopaxi2014 for total RNA isolation from mucosal scrap-ings and cell supernatant respectively RNA isolation wasperformed using TRIzol reagent (Invitrogen) following themanufacturerrsquos directions withmodifications to ensure a highRNA yield and quality

23 Amplification and Sequencing of Complete S Gene ofPEDV A total of thirteen primers were designed using thePrimer 3Plus software [32] to amplify five overlapping frag-ments of the S gene (Table 1) covering the complete S gene218 bases before the start codon and 213 bases after the termi-nation codon of strain TC PC170-P2 virus PEDUnited States(accession number GenBank KM392227) All segments wereamplified using SuperScript III One-Step RT-PCR HighFidelity System with Platinum Taq DNA Polymerase (Invit-rogen) following the manufacturerrsquos directions The ampli-cons were visualized in agarose gel and purified by Pure LinkKit Quick Gel Purification (Invitrogen) following the manu-facturerrsquos instructionsThe resulting products were submittedto bidirectional DNA sequencing using BigDye Terminatorcycling conditions by an external laboratory (MacrogenKorea) Consensus sequences were generated using the soft-ware Sequencher version 61 2014 (Code Gene Corporation)Nucleotide BLAST analysis (httpswwwncbinlmnihgovblastBlastcgi) was initially used to verify the identity of thesequences obtained

24 Sequence and Phylogenetic Analyses To perform se-quence comparison analyses and to establish the phyloge-netic relationships of PEDV sequence from Ecuador align-ments using the consensus sequence of complete S gene avail-able at GenBank database (Supplementary Information TableS1) were conducted by the algorithm ClustalW included inthe program BioEdit Sequence Alignment Editor [33] Toremove sequences with a possible recombinant event fromthe alignment datasets searches for recombinant sequencesand crossover regions were performed using Geneconv RDPMaxChi Chimera BootScan SiScan 3Seq and LARD allimplemented in RDP3 Beta 469 as previously described inAlfonso-Morales et al [12] The software jModelTest 20 [34]was used to estimate the best-fit model using the Akaike(AIC) and Bayesian information criteria (BIC) The best-fit models for the complete S gene were selected Phyloge-netic analyses were performed by Bayesian Inference (BI)Neighbour-Joining (NJ) and Maximum Likelihood (ML)methodologies as described elsewhere in [35] All topologiesobtained were compared as described by Alfonso-Morales etal [12] To visualize the structure of S protein and denoteamino acids changes a model of the S protein was kindlyprovided by Professor Douglas Marthaler from Departmentof Veterinary Population Medicine College of VeterinaryMedicine University of Minnesota St Paul MN USA andrecreated using Chimera software package (httpwwwcglucsfeduchimera)

BioMed Research International 3

Table 1 Primers used for amplification of whole S gene and sequencing of PEDVCotopaxi2014

Primer Sequence 51015840-31015840 Nucleotide positionlowast Tm∘C Purpose Product size (bp)S5F TCTTCTGGCGTAATTCCACA 20408ndash20427 5686 Amplification (fragment 1) 1216S1220R TGAGCCTTCAGCAAGAATGA 21623ndash21604 5713S621F GGCCCCACTGCTAATAATGA 21024ndash21043 5734 Amplification (fragment 2) 1399S2019R TGGTACAGGCACTAGCCAAA 22422ndash22403 5894S1441F TCAATGGGTTTGGATACTTGC 21844ndash21864 5649 Amplification (fragment 3) 1391S2831R TCCATCACCATTAAACGAACT 23234ndash23214 5522S2219 F TTCTAGCTTTTTGGCAGGTG 22622ndash22641 5624 Amplification (fragment 4) 1409S3627R CATCACCACCACAAAAACCA 24030ndash24011 5673DPS3045 F GGTGTTGTTGACGCTGAGAA 23448ndash23467 587 Amplification (fragment 5) 1377DP4421R TGACAACTGTGTCAATCGTGT 24824ndash24804 581426R GGCCAGCACAGTACCAAGTT 20829ndash20810 587 Sequencing -1220R TGAGCCTTCAGCAAGAATGA 21623ndash21604 6054 Sequencing -3045F GGTGTTGTTGACGCTGAGAA 23448ndash23467 5713 Sequencing -lowastThe position of nucleotide corresponding to PED strain GenBank accession number KM392227

25 Phylogeographic Analysis A discrete phylogeographicanalysis (DPA) was conducted using a standard continuous-time Markov chain (CTMC) model with Bayesian stochasticsearch variable selection (BSSVS) to model the geographictransmission of PEDV from the selected sequence of thedataset (SupplementaryMaterial Table S1 sequences denotedby asterisk) as described by Alfonso-Morales et al [14]Briefly the Bayesian Markov chain Monte Carlo (MCMC)analysis was performed in two independent runs The result-ing maximum clade credibility (MCC) phylogenetic treewas obtained by TreeAnnotator and summarized using theSPREAD software [36] A Keyhole Markup Language (KML)file was generated to identify the major routes of geographicdiffusion The Bayes factor (BF) test was used to select themost probable routes of transmissionThe resultingKMLfilesfrom SPREADwith a nonzero expectancy that showed a BF gt5 were visualized by Google Earth (available at httpsearthgooglecom)

3 Results and Discussion

After the PEDV outbreak in the United States in 2013followed by the fast spreading of the virus to CanadaMexicoKorea and Taiwan an important turn in PED research hastaken place [1] Thus a relevant increase of studies about theepidemiology genetic structure and characteristics of PEDVhas occurred to get a better understanding of this diseasewhich is currently the most fatal in pigs and one of theeconomic concerns for the pig industry [4]

In the present study an analysis of PEDV field sequencesfrom Ecuador was conducted by comparison with all thePEDV S gene sequences available in the GenBank databaseIn addition phylogenetic comparisons and Bayesian phylo-geographic inference based on complete S gene sequenceswere conducted to track the origin and putative route ofPEDV The S gene of PEDV has more than 4000 nucleotidesand encodes the S protein which constitutes the spikesof the viral envelope responsible for its high variabilityThe PEDV S glycoprotein is known to be an appropriate

viral gene for determining the genetic relatedness amongPEDV isolates [4] The sequences obtained from the animalsselected and the viral isolate PEDVCotopaxi2014 wereassembled yielding a final fragment of 4414 nt of lengthfor each one all of them containing the 4160 nt of thecomplete S gene The identity of the sequences obtained was100 between them therefore to avoid redundant entries atGenBank database the sequences were submitted as a singleentry under the accession number KT336490 The geneticidentity of the sequence KT336490 (thereafter mentioned asPEDVCotopaxi2014) was initially inferred from BLASTnanalysis sharing 99 with more than 94 isolates or strainsof PEDV from US and Korea The sequence of the PEDVUSAColorado2013 isolate (accession number KF272920)was selected to compare the sequence PEDVCotopaxi2014since it showed the highest score from the BLASTnanalysis Thus the sequence PEDVCotopaxi2014 showedfour nucleotide changes 1093AxG 2454CxT 3051CxT and3607CxT when both sequences were compared Only two ofthese mutations led to amino acid changes when the deducedsequence was analyzed The sequence PEDVCotopaxi2014showed the changes 360SxG and 1203LxF compared with thesequence of PEDV isolate USAColorado2013 These muta-tions were not located at the neutralizing epitopes (SS2 SS6or 2C10) [37] Therefore associations with possible adaptiveadvantages caused by escaping to the immune response of thehost cannot be suggested The mutation 360SxG was locatedinto the N-terminal domain (NTD) of S1 (Figure 1) Eventhough this domain has not been directly linked to PEDVtropism and functionality as in transmissible gastroenteritisvirus and murine hepatitis virus [38] it is recognized thatit can influence virus infectivity [30] Therefore a mutationof serine in this domain could lead to an increase of theinfectivity of the viral strains with this mutation since serineis recognized as a catalytic residue of the trypsin (enzymeinvolved in the entry of the virus into the host cell in thedigestive tract) Nevertheless further virulence studieswill berequired to verify this role

4 BioMed Research International

S1 domain360SxG

S2 domain

Figure 1 3D-Representation of the monomermodel of the PEDV S proteinThemodel was kindly provided byDrMarthaler published in Jarviset al [30] Chimera software v162 was used for visualization Domains S1 (orange) and S2 (blue) are denotedThe C-terminal RBD of the S1-domain is represented in pink N-terminal RBD of S1 domain is highlighted in yellow The mutation 360SxG found in PEDVCotopaxi2014is denoted and represented in red

= 11317

GTR + G

075

085

093

065

065

070

068

090

097

099

100

100

100100

100

100

Outgroup20

1b

1a

2b

R

R

CII

CI

2a

KF468754__Isolate_IA2_USA_Iowa_2013KF468752__MN_Minesota_2013KJ588063__KUIDL_PED_2014_002_Korea_2014KJ645700_Strain_MEX_124_2014

KJ645645__USA_Texas39_2013KJ539153__Strain_K13JA11_4_Korea_2013KJ662670__KNU_1305_S_Korea_2013

KJ645694__USA_Iowa103_2013KF650372__Isolate_ISU13_19338E_IN_9P_USA_Iowa_2013

KM392227__TC_PC170_P2_USA_2013KJ645689__USA_Illinois97_2013

KJ645698__USA_Ohio120_2014KJ767196__Strain_OhioVBS2_USA_2014KJ645707__USA_Minnesota84_2013

gbKM052365_PEDv_2013_p10_USA_2013ECU_Cotopaxi_2014

KM189366__Isolate_ON_007_Canada_Ontario_2014KJ645703__Strain_USA_Minnesota127_2014KF272920__USA_Colorado_2013

KJ645686__Strain_USA_Minnesota94_2013KJ645662__Strain_USA_NorthCarolina66_2013

KJ645688__USA_Iowa96_2013KJ645708__Strain_MEX_104_2013

KJ645638__USA_Colorado30_2013KF468753__IA1Iowa_2013

KJ645692__USA_Missouri101_2013KF452322__USA_Iowa_16465_2013

KC196276__Strain_CH_ZMDZY_CHINA_2011KC210145__AH2012_China_2012

JN825712_Isolate_BJ_2011_1_CHINA_2011KC210147__Strain_JS_HZ2012_CHINA_2012JX088695__Strain_GD_B_CHINA_2012

JX524137__Strain_ZJCZ4_CHINA_2012KC140102__CH_FJZZ_9_CHINA_2012

JX489155___Variant_Strain_LC_CHINA_2012JX188454__Strain_AJ1102_CHINA_2012JX261936__Strain_CHGD_01_CHINA_2012

JX647847__Strain_GD_1_CHINA_2012JX112709__Strain_GD_A_CHINA_2012

JQ282909__Strain_CH_FJND_3_CHINA_2011KJ645702__USA_Ohio126_2014KJ399978__Strain_OH851_Ohio_2014JN547228__Strain_CH_S_CHINA_1986

US INDEL strainsGU937797__Isolate_SM98_KOREA_2010EF185992__Strain_LZC_China_2006

AF353511__Strain_CV777_Belgica_1978JQ023161__Strain_virulent_DR13_KOREA_2011

KC210146__StrainJS2008_CHINA2012KC109141__Isolate_JS2008_RECOMBINANT_STRAIN_CHINAJQ023162_Strain_attenuated_DR13_KOREA_2011

KC189944_CHINA_2012JX560761__strain_SD_M_CHINA_2012

DQ648856_Bat_coronavirus

KM052365_NPL-PEDv_2013_p10_USA_2013

Figure 2 Phylogenetic tree of PEDV based on complete S geneThe best-fit model and the shape parameter of the gamma distribution (alpha)for the tree are indicated in the upper-left sideThe numbers at a node are posterior probability values estimated All different genogroups aredenoted the different clades CI and CII previously described by Vlasova et al [28] into the genogroup 2a are also denoted The sequence ofPEDVCotopaxi2014 is highlighted in red Blue rectangles denote PEDV strains previously classified as 2a in Zhang et al [31] (see Figure 1Bin Zhang et al [31] the strains were clearly grouped into genogroup 2b but were denoted as 2a)The US INDEL sequences were also denoted

The phylogenetic relationships among the PEDV strainswere reconstructed based on complete S gene by meansof NJ ML and BI analyses All algorithms yielded con-gruent results showing the same topologies which wassupported by moderate to high confidence values givenby the bootstrap percentage and the posterior probability(Supplementary Material Figure S1) Even though the treeyielded by BI was the best the statistical support for this

tree was not significantly different from the NJ or ML trees(Supplementary Material Table S2) Thus all topologiesobtained showed two highly divergent genogroups (2aand 2b) (Supplementary Material Figure S1) For a bettervisualization of the results a short tree obtained from 60PEDV strains representative of all genogroups or cladeswas built by BI (Figure 2) Thus the short tree showed thesame distribution than the full tree (Supplementary Material

BioMed Research International 5

(a) (b)

(c) (d)

Figure 3 Temporal dynamics of spatial PEDV diffusion Temporal distribution of PEDV only rates supported by a BF of gt5 were consideredsignificant The map was directly taken from the output file of the spread software and visualized using Google Earth (whole video includedas Video S1) The emergence of the PDEV strains in China is represented in panel (a) the arrival to US in 2013 is shown in panel (b) and theposterior distribution of the PEDV strains-like US is represented in panels (c) and (d)

Figure S1 and Figure 2) In Figure 2 two clades belonging tothe PEDV genogroups 2a and 2b can be clearly observed Inaddition from the genogroup 2a two main clades (I and II)previously described by Vlasova et al [28] were also obtained(Figure 2) The sequence from the PED-outbreak in EcuadorPEDVCotopaxi2014 was grouped into the clade II of PEDVgenogroup 2a together with other sequences of isolates fromMexico Canada and United States (Figure 2) This groupwas highly supported by 093 posterior probability value(Figure 2) After the PED US outbreak the virus rapidlyspread to Canada and Mexico [4] Whilst contaminatedfood by spray-dried porcine plasma positive to PEDVgenome is pointed out as a possible way for introducingPEDV from US to Canada [18] the legal movement ofpigs is suggested as the source of introduction to Mexico(httpwwwthepigsitecomswinenews36693mexico-reports-83-outbreaks-of-pedv-to-oie) In the group of sequencesin which PEDVCotopaxi2014 was included the nearestcountry to Ecuador is Mexico indicating that the movement(legal or illegal) of animals between Mexico and Ecuadorcould be a possible source of introduction of the virus toEcuador However evidence about this possible link hasnot been found Phylogeographic reconstruction identifieda specific location for the root of the tree with posteriorprobabilities for state sp = 081 for the locality of China(Supplementary Material Figure S2) The phylogeographicstudy revealed the emergence of the Chinese PEDV strainsfollowed by spreading to US in 2013 (Figures 3(a) and3(b) Supplementary Material Video S1) Huang et al[17] previously observed this result describing the USPED-outbreak as an intercontinental transmission of the

Chinese strains After introducing the Chinese PEDV strainsto US the virus spread from US to Korea (Figure 3(c)Supplementary Material Video S1) S Lee and C Lee [39]reported the circulation of new PEDV strains in South Koreathat were genetically like PEDV strains that affected UnitedStates during 2013 This result suggested that the recentstrains from South Korea might have been originated in theUnited States caused by the importation of pig breedingstock during or after the sudden emergence of PEDV in theUnited States [39] During 2010-2011 more than one-third ofthe total pig population in South Korea was slaughtered ascontrol measure to foot-and-mouth disease outbreaks thusa huge importation of breeding pigs from US was carried outwithout a proper implementation of a vaccination policy [39]The phylogeographic study also revealed the introductionof the virus in Canada Mexico and Ecuador directly fromthe US (Figure 3(d) and Supplementary Material VideoS1) This result frames the most probable route of entry ofPEDV to Ecuador from US The sources of imports of liveswine in Ecuador in 2014 were mainly from Chile and US(httpdatatrendeconomycomtradeEcuadorImportcom-modity=0103) Thus this movement of pigs is suggested asthe principal way for introducing PEDV to Ecuador

Because this is the first introduction of PEDV in Ecuadorswine herds a fast spread of the virus throughout the countryis expected especially because a vaccination policy againstPEDV has not been implemented yet Therefore additionalstudies to decipher how the virus will be disseminated inEcuador and to other South American countries will berequired

BioMed Research International 5

(a) (b)

(c) (d)

Figure 3 Temporal dynamics of spatial PEDV diffusion Temporal distribution of PEDV only rates supported by a BF of gt5 were consideredsignificant The map was directly taken from the output file of the spread software and visualized using Google Earth (whole video includedas Video S1) The emergence of the PDEV strains in China is represented in panel (a) the arrival to US in 2013 is shown in panel (b) and theposterior distribution of the PEDV strains-like US is represented in panels (c) and (d)

Figure S1 and Figure 2) In Figure 2 two clades belonging tothe PEDV genogroups 2a and 2b can be clearly observed Inaddition from the genogroup 2a two main clades (I and II)previously described by Vlasova et al [28] were also obtained(Figure 2) The sequence from the PED-outbreak in EcuadorPEDVCotopaxi2014 was grouped into the clade II of PEDVgenogroup 2a together with other sequences of isolates fromMexico Canada and United States (Figure 2) This groupwas highly supported by 093 posterior probability value(Figure 2) After the PED US outbreak the virus rapidlyspread to Canada and Mexico [4] Whilst contaminatedfood by spray-dried porcine plasma positive to PEDVgenome is pointed out as a possible way for introducingPEDV from US to Canada [18] the legal movement ofpigs is suggested as the source of introduction to Mexico(httpwwwthepigsitecomswinenews36693mexico-reports-83-outbreaks-of-pedv-to-oie) In the group of sequencesin which PEDVCotopaxi2014 was included the nearestcountry to Ecuador is Mexico indicating that the movement(legal or illegal) of animals between Mexico and Ecuadorcould be a possible source of introduction of the virus toEcuador However evidence about this possible link hasnot been found Phylogeographic reconstruction identifieda specific location for the root of the tree with posteriorprobabilities for state sp = 081 for the locality of China(Supplementary Material Figure S2) The phylogeographicstudy revealed the emergence of the Chinese PEDV strainsfollowed by spreading to US in 2013 (Figures 3(a) and3(b) Supplementary Material Video S1) Huang et al[17] previously observed this result describing the USPED-outbreak as an intercontinental transmission of the

Chinese strains After introducing the Chinese PEDV strainsto US the virus spread from US to Korea (Figure 3(c)Supplementary Material Video S1) S Lee and C Lee [39]reported the circulation of new PEDV strains in South Koreathat were genetically like PEDV strains that affected UnitedStates during 2013 This result suggested that the recentstrains from South Korea might have been originated in theUnited States caused by the importation of pig breedingstock during or after the sudden emergence of PEDV in theUnited States [39] During 2010-2011 more than one-third ofthe total pig population in South Korea was slaughtered ascontrol measure to foot-and-mouth disease outbreaks thusa huge importation of breeding pigs from US was carried outwithout a proper implementation of a vaccination policy [39]The phylogeographic study also revealed the introductionof the virus in Canada Mexico and Ecuador directly fromthe US (Figure 3(d) and Supplementary Material VideoS1) This result frames the most probable route of entry ofPEDV to Ecuador from US The sources of imports of liveswine in Ecuador in 2014 were mainly from Chile and US(httpdatatrendeconomycomtradeEcuadorImportcom-modity=0103) Thus this movement of pigs is suggested asthe principal way for introducing PEDV to Ecuador

Because this is the first introduction of PEDV in Ecuadorswine herds a fast spread of the virus throughout the countryis expected especially because a vaccination policy againstPEDV has not been implemented yet Therefore additionalstudies to decipher how the virus will be disseminated inEcuador and to other South American countries will berequired

6 BioMed Research International

4 Conclusion

In this study a rigorous measurement of the global phylo-geographic approach for PEDV strains was performed basedon complete S gene sequences The present work is the firststudy providing evidences that PEDV strains are circulat-ing into Ecuador swine herds and revealing the molecularcharacteristic of the PEDV isolate in the South Americanregion The spatial analyses suggested that these strains wereintroduced to Ecuador by an importation from US

Conflicts of Interest

The authors declare that they have no conflicts of interest

Acknowledgments

This work was supported by the Prometeo Project ofSENESCYT andAGROCALIDAD fromMinistry of Agricul-ture Livestock Aquaculture and Fisheries of Ecuador Theauthors wish to thankDr DouglasMarthaler andMatthewCJarvis from Department of Veterinary Population MedicineCollege of Veterinary Medicine University of MinnesotaSt Paul MN USA for providing the S protein model andvaluable information The authors would also like to thankMS LiliamRios andDr StacyGrieve fromUniversity ofNewBrunswick for the critical revision of the manuscript

Supplementary Materials

Table S1 PEDV sequences of the complete S gene used inthe current study (xls) Table S2 Comparison of topologiesobtained for the complete S gene using ML NJ and BImethods Figure S1 Phylogenetic tree obtained from thecomplete S gene and all sequences collected (Table S1)(TIFF) Figure S2 Maximum credibility phylogeographictree The posterior probabilities for state were denoted(TIFF) Video S1 Dynamics of spatial PEDV diffusion Themost probable temporal distribution of PEDV is providedonly rates supported by a BF of gt5 were considered signifi-cant (Supplementary Materials)

References

[1] D Song H Moon and B Kang ldquoPorcine epidemic diarrhea areview of current epidemiology and available vaccinesrdquo Clinicaland Experimental Vaccine Research vol 4 no 2 p 166 2015

[2] E NWood ldquoAn apparently new syndrome of porcine epidemicdiarrhoeardquoVeterinary Record vol 100 no 12 pp 243-244 1977

[3] M B Pensaert and P de Bouck ldquoAnew coronavirus-like particleassociated with diarrhea in swinerdquo Archives of Virology vol 58no 3 pp 243ndash247 1978

[4] C Lee ldquoErratum Porcine epidemic diarrhea virus An emerg-ing and re-emerging epizootic swine virus (Virology Journal(2015) 12 (193))rdquoVirology Journal vol 13 no 1 article 465 2016

[5] S Park S Kim D Song and B Park ldquoNovel porcine epidemicdiarrhea virus variant with large genomic deletion Southkoreardquo Emerging Infectious Diseases vol 20 no 12 pp 2089ndash2092 2014

[6] G Temeeyasen A Srijangwad T Tripipat et al ldquoGeneticdiversity of ORF3 and spike genes of porcine epidemic diarrheavirus inThailandrdquo Infection Genetics and Evolution vol 21 pp205ndash213 2014

[7] X Chen L Zeng J Yang et al ldquoSequence heterogeneity of theORF3 gene of porcine epidemic diarrhea viruses field samples infujian China 2010-2012rdquo Viruses vol 5 no 10 pp 2375ndash23832013

[8] F-F Ge D-Q Yang H-B Ju et al ldquoEpidemiological survey ofporcine epidemic diarrhea virus in swine farms in ShanghaiChinardquoArchives of Virology vol 158 no 11 pp 2227ndash2231 2013

[9] W Yang G Li Y Ren S Suo and X Ren ldquoPhylogeny andexpression of the nucleocapsid gene of porcine epidemic diar-rhoea virusrdquo Acta Veterinaria Hungarica vol 61 no 2 pp 257ndash269 2013

[10] F-I Wang M-C Deng Y-L Huang and C-Y Chang ldquoStruc-tures and functions of pestivirus glycoproteins Not simplysurface mattersrdquo Viruses vol 7 no 7 pp 3506ndash3529 2015

[11] M-H Sung M-C Deng Y-H Chung et al ldquoEvolutionarycharacterization of the emerging porcine epidemic diarrheavirus worldwide and 2014 epidemic in Taiwanrdquo InfectionGenetics and Evolution vol 36 pp 108ndash115 2015

[12] A Alfonso-Morales L Rios O Martınez-Perez et al ldquoEval-uation of a phylogenetic marker based on genomic segmentB of infectious bursal disease virus Facilitating a feasibleincorporation of this segment to the molecular epidemiologystudies for this viral agentrdquo PLoS ONE vol 10 no 5 Article IDe0125853 2015

[13] L J Perez C L Perera L Coronado et al ldquoMolecular epidemi-ology study of swine influenza virus revealing a reassorted virusH1N1 in swine farms in Cubardquo Preventive Veterinary Medicinevol 119 no 3-4 pp 172ndash178 2015

[14] A Alfonso-Morales O Martınez-Perez R Dolz et al ldquoSpa-tiotemporal Phylogenetic Analysis and Molecular Characteri-sation of Infectious Bursal Disease Viruses Based on the VP2Hyper-Variable Regionrdquo PLoS ONE vol 8 no 6 Article IDe65999 2013

[15] N Martinez P E Brandao S P de Souza et al ldquoMolecular andphylogenetic analysis of bovine coronavirus based on the spikeglycoprotein generdquo Infection Genetics and Evolution vol 12 no8 pp 1870ndash1878 2012

[16] W Li H Li Y Liu et al ldquoNew variants of porcine epidemicdiarrhea virus China 2011rdquo Emerging Infectious Diseases vol18 no 8 pp 1350ndash1353 2012

[17] Y-W Huang A W Dickerman P Pineyro et al ldquoOrigin evo-lution and genotyping of emergent porcine epidemic diarrheavirus strains in the united statesrdquomBio vol 4 no 5 2013

[18] J Pasick Y Berhane D Ojkic et al ldquoInvestigation into theRole of Potentially Contaminated Feed as a Source of the First-Detected Outbreaks of Porcine Epidemic Diarrhea in CanadardquoTransboundary and Emerging Diseases vol 61 no 5 pp 397ndash410 2014

[19] J Stadler S Zoels R Fux et al ldquoEmergence of porcine epidemicdiarrhea virus in southernGermanyrdquoBMCVeterinary Researchvol 11 no 1 article 142 2015

[20] B Grasland L Bigault C Bernard et al ldquoComplete genomesequence of a porcine epidemic diarrhea S gene indel strainisolated in France in December 2014rdquoGenome Announcementsvol 3 no 3 Article ID e00535-15 2015

[21] S Theuns N Conceicao-Neto I Christiaens et al ldquoCompletegenome sequence of a porcine epidemic diarrhea virus from

BioMed Research International 7

a novel outbreak in Belgium January 2015rdquoGenome Announce-ments vol 3 no 3 Article ID e00506-15 2015

[22] L Wang B Byrum and Y Zhang ldquoNew variant of porcine epi-demic diarrhea virus United States 2014rdquo Emerging InfectiousDiseases vol 20 no 5 pp 917ndash919 2014

[23] D Hanke M Jenckel A Petrov et al ldquoComparison of porcineepidemic diarrhea viruses from germany and the united states2014rdquo Emerging Infectious Diseases vol 21 no 3 pp 493ndash4962015

[24] D Hanke A Pohlmann C Sauter-Louis et al ldquoPorcine Epi-demic Diarrhea in Europe In-Detail Analyses of DiseaseDynamics and Molecular Epidemiologyrdquo Viruses vol 9 no 7p 177 2017

[25] M B Boniotti A Papetti A Lavazza et al ldquoPorcine epidemicdiarrhea virus and discovery of a recombinant swine entericcoronavirus Italyrdquo Emerging Infectious Diseases vol 22 no 1pp 83ndash87 2016

[26] A Steinrigl S R Fernandez F Stoiber J Pikalo T Sattlerand F Schmoll ldquoFirst detection clinical presentation andphylogenetic characterization of Porcine epidemic diarrheavirus in Austriardquo BMC Veterinary Research vol 11 no 1 article310 2015

[27] (EFSA) ldquoCollection and review of updated scientific epidemio-logical data on porcine epidemic diarrhoeardquo EFSA Journal vol14 no 2 2016

[28] A N Vlasova D Marthaler Q Wang et al ldquoDistinct charac-teristics and complex evolution of pedv strains North americaMay 2013-february 2014rdquo Emerging Infectious Diseases vol 20no 10 pp 1620ndash1628 2014

[29] M B Pensaert and P Martelli ldquoPorcine epidemic diarrhea Aretrospect from Europe and matters of debaterdquo Virus Researchvol 226 pp 1ndash6 2016

[30] M C Jarvis H C Lam Y Zhang et al ldquoGenomic and evolu-tionary inferences between American and global strains of por-cine epidemic diarrhea virusrdquo Preventive Veterinary Medicinevol 123 pp 175ndash184 2016

[31] X Zhang Y Pan D Wang X Tian Y Song and Y CaoldquoIdentification and pathogenicity of a variant porcine epidemicdiarrhea virus field strain with reduced virulencerdquo VirologyJournal vol 12 no 1 article 88 2015

[32] A Untergasser I Cutcutache T Koressaar et al ldquoPrimer3-newcapabilities and interfacesrdquo Nucleic Acids Research vol 40 no15 p e115 2012

[33] T A Hall ldquoBioEdit a user-friendly biological sequence align-ment editor and analysis program for Windows 9598NTrdquoNucleic Acids Symposium Series 41 pp 95ndash98 1999

[34] D Darriba G L Taboada R Doallo and D Posada ldquoJMod-elTest 2 more models new heuristics and parallel computingrdquoNature Methods vol 9 no 8 p 772 2012

[35] L J Perez H D De Arce M Cortey et al ldquoPhylogenetic net-works to study the origin and evolution of porcine circovirustype 2 (PCV2) in Cubardquo Veterinary Microbiology vol 151 no3-4 pp 245ndash254 2011

[36] F Bielejec A RambautMA Suchard andP Lemey ldquoSPREADSpatial phylogenetic reconstruction of evolutionary dynamicsrdquoBioinformatics vol 27 no 20 Article ID btr481 pp 2910ndash29122011

[37] J Hao C Xue L He Y Wang and Y Cao ldquoBioinformaticsinsight into the spike glycoprotein gene of field porcine epi-demic diarrhea strains during 2011-2013 in Guangdong ChinardquoVirus Genes vol 49 no 1 pp 58ndash67 2014

[38] J Reguera C Santiago GMudgal D Ordono L Enjuanes andJ M Casasnovas ldquoStructural Bases of Coronavirus Attachmentto Host Aminopeptidase N and Its Inhibition by NeutralizingAntibodiesrdquo PLoS Pathogens vol 8 no 8 Article ID e10028592012

[39] S Lee and C Lee ldquoOutbreak-related porcine epidemic diarrheavirus strains similar to US strains South Korea 2013rdquo EmergingInfectious Diseases vol 20 no 7 pp 1223ndash1226 2014

Submit your manuscripts athttpswwwhindawicom

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Anatomy Research International

PeptidesInternational Journal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporation httpwwwhindawicom

International Journal of

Volume 201

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Molecular Biology International

GenomicsInternational Journal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

The Scientific World JournalHindawi Publishing Corporation httpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

BioinformaticsAdvances in

Marine BiologyJournal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Signal TransductionJournal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

BioMed Research International

Evolutionary BiologyInternational Journal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Biochemistry Research International

ArchaeaHindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Genetics Research International

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Advances in

Virolog y

Hindawi Publishing Corporationhttpwwwhindawicom

Nucleic AcidsJournal of

Volume 2014

Stem CellsInternational

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Enzyme Research

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

International Journal of

Microbiology

Submit your manuscripts athttpswwwhindawicom

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Anatomy Research International

PeptidesInternational Journal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporation httpwwwhindawicom

International Journal of

Volume 201

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Molecular Biology International

GenomicsInternational Journal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

The Scientific World JournalHindawi Publishing Corporation httpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

BioinformaticsAdvances in

Marine BiologyJournal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Signal TransductionJournal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

BioMed Research International

Evolutionary BiologyInternational Journal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Biochemistry Research International

ArchaeaHindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Genetics Research International

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Advances in

Virolog y

Hindawi Publishing Corporationhttpwwwhindawicom

Nucleic AcidsJournal of

Volume 2014

Stem CellsInternational

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Enzyme Research

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

International Journal of

Microbiology