tomato research report - citrus · supported by the florida tomato committee tomato research report...

Supported by the Florida Tomato Committee

Tomato Research Report2011-2012

Contents

Research supported by the Florida Tomato Committee 2011-2012 IFAS Research Report

Page Title Investigator

Variety Development

1 Breeding Tomatoes for Florida John W. ScottSamuel F. HuttonGary E. Vallad

5 Genetic Improvement and Hybrid Development of Tomatoes for Florida Production

Samuel F. HuttonJohn W. Scott

Crop Protection Technologies

11 A Photocatalytic Treatment for Management of Bacterial Spot of Tomatoes Mathews L. ParetGary E. ValladDevron R. AverettJeffrey B. JonesStephen M. Olson

17 Identification of Possible New Strains of Tomato yellow leaf curl virus in Florida

Jane E. Polston

Tomato Research Report 2011-2012 1

Breeding Tomatoes for FloridaJohn W. Scott Samuel F. Hutton Gary E. Vallad University of Florida, IFAS Gulf Coast Research & Education Center-Balm 14625 CR 672 Wimauma, FL 33598

AbstractFla. 8611 and Fla. 8835 are plum tomato inbreds

with bacterial spot tolerance that will be released in 2012. Fla. 8611 had better flavor than other plums it was compared to in a sensory panel. Inbred Fla. 8000, a parent in hybrid Fla. 8314, has been transformed with the Bs2 gene from pepper and Bs2 transformants of both the parent and hybrid yielded significantly more than their non-transformed counterparts and Florida 47 in fall and spring trials. Fla. 8872 is an inbred that has outstanding fruit size and a strong vine; it is a parent in several hybrids that yielded well in a spring trial. As seed becomes available the best hybrids will be tested on grower farms for possible release. Fla. 8735, Fla. 8736, and Fla. 8869 are heat-tolerant inbreds that have performed well in multiple yield trials and hybrids with each are being tested. New jointless inbreds with compact growth habits (CGH) appear to have commer-cial potential; Fla. 8916 in particular has concentrated set of large, firm, smooth fruit. Four CGH inbreds will be tested on grower farms in the 2012-2013 season.

Introduction Varieties with improvements in yield, pest resis-

tance, and fruit quality are needed to keep the Florida tomato industry competitive. Florida’s geography offers many challenges for tomato improvement, since high temperatures limit fruit set and are conducive to dis-ease and insect problems. Although private companies have tomato breeding programs that develop varieties for Florida, these companies do not handle many of the long term, high risk projects that could prove valuable in the future. The University of Florida tomato breed-ing program aims at such projects and works in part-nership with the private companies to deliver improved varieties of benefit to the Florida tomato industry.

Much of the groundwork for the development of heat-tolerant varieties was done at the University of Florida (Scott et al., 1986). ‘Solar Set’ (Scott et al., 1989) was an important commercial, heat-tolerant variety for 11 years after it was released. However, there is still

a need to develop improved heat-tolerant (HT) variet-ies as existing varieties are not suited to main season production. It is hypothesized that if HT varieties with better blossom-end smoothness and graywall toler-ance are developed, they will set marketable fruit more reliably under cool and other stress conditions encoun-tered during the yearly growing seasons. Fusarium wilt race 3 resistant varieties are available because of the introgression of a resistance gene discovered in a wild species by this program in the 1980’s (Scott and Jones, 1989; Scott and Jones, 1995). However, we have found that race 3 varieties are extra sensitive to bacterial spot (Hutton, 2010). Incorporation of two bacterial spot Quantitative Trait Loci (QTL) and a non-blighting (NB) trait has overcome this problem and one of our goals is to develop new race 3 lines with bacterial spot toler-ance. Developing varieties with tolerance to bacterial spot races T3 and T4 continues to be a breeding priority since this is the most ubiquitous disease problem for Florida tomatoes. Identification of molecular mark-ers linked to resistance genes is being done for bacte-rial spot, bacterial wilt and graywall. Breeding lines with Fusarium crown and root rot resistance were released in 1999 (Scott and Jones, 2000) and UF breed-ing lines are in commercial varieties ‘Sebring’, ‘Soraya’, and ‘Crown Jewel’. With the impending loss of methyl bromide, soil borne pathogens could become more widespread. Other diseases such as bacterial wilt and spotted wilt occur in Florida, but cause far more dam-age in other regions of the world. If these diseases be-come more prevalent here, resistant varieties will prove beneficial. Tomato yellow leaf curl virus (TYLCV) is a serious threat to Florida tomato production (Polston et al., 1999) and some crops have sustained severe losses in past years. Commercial companies have released TYLCV resistant varieties, but none have yet been widely accepted by Florida growers. Our project has been ongoing since 1990 utilizing different resistance genes derived from the wild species Solanum chilense. Previously we identified two resistance genes Ty-3 (Ji et al., 2007) and Ty-4 (Ji et al., 2009) and in the last year identified another gene “Ty-6” along with a marker linked to Ty-5 from ‘Tyking’ (Hutton et al., 2012); this allows for marker assisted selection (MAS) to be used to expedite development of TYLCV resistant varieties. Fine mapping of Ty-3 and Ty-1 has resulted in breeding lines with tiny introgressions that appear to be rid of the foliar disease susceptibility and fruit set problems (linkage drag) associated with Ty-3 breeding lines with larger introgressions. Markers linked to resistance genes have been made available to private company tomato breeding programs.


Shipping tomatoes have long met with dissatis-faction in the marketplace and this has been recently expounded on in the book “Tomatoland” by Barry Estabrook (2011). Although this book takes a distorted, negative slant on many aspects of the Florida industry, it has prompted unfavorable newspaper reports and overall conveys a negative perception of shipping to-mato quality. Essentially, any problems with fruit flavor relate to compromises that are made in providing fruit that will ship well. Solutions to this problem are not simple. Research is needed to provide tomatoes that will be more acceptable to consumers. On the bright side, Nugyen and Swartz, (1999) and others have shown that lycopene, the red pigment in tomato, has strong antioxidant properties that reduce several cancers. Work in the breeding program has been ongoing for 30 years with the crimson gene (ogc) that improves inter-nal tomato color and increases lycopene content. Seven breeding lines with this gene have been released to seed companies over the last 15 years. Crimson varieties may be a boon to the Florida industry in the near future and the crimson hybrid Tasti-Lee® provides an avenue for Florida growers to gain back supermarket market share from the greenhouse industry. Whereas vine ripe harvesting of Tasti-Lee® requires more labor than is used for mature-green harvesting, labor savings would result with the adoption of jointless, compact growth habit (CGH) varieties that don’t require staking and can be machine harvested. This production system may prove to be important for future production in Florida. Objectives of this project were:

1. To develop tomato varieties or breeding lines with resistance to soil-borne pathogens.

2. To develop inbreds and hybrids with tolerance to bacterial spot.

3. To develop improved heat-tolerant tomato in-breds and hybrids.

4. To develop commercially acceptable tomato breeding lines and hybrids resistant to TYLCV or TSWV.

5. To improve fruit quality, postharvest character-istics, and plant type

Objective 1

MethodsSeedlings of hundreds of lines are inoculated with

fusarium wilt races 2, fusarium crown rot, verticillium wilt, and bacterial wilt to select resistant plants for field evaluation. A molecular marker is now used for fusarium wilt race 3 screening. The lines showing the

most promise are tested in yield trials at Gulf Coast Research and Education Center (GCREC) and some are tested at North Florida Research and Education Center (NFREC) or Dade County. The best of these are crossed to test hybrids for commercial release. The hybrids are evaluated at GCREC (stage 1) and the best ones are advanced to replicate trials at GCREC (stage 2). The best of these hybrids are then tested off station at IFAS trials and on grower farms (stage 3). A large experiment was conducted to identify molecular markers linked to bacterial wilt resistance in spring 2012.

ResultsFla. 8872 is a parent line with huge fruit size and

several of its hybrids have done well in stage 2 testing. Some have strong vines with tolerance to bacterial spot. Fla. 8872 came out of the bacterial wilt project but does not have significant bacterial wilt resistance. The data from the bacterial wilt molecular marker experi-ment are not yet analyzed, but if successful, should facilitate developing resistant varieties in the future. A group of inbreds with resistance to fusarium crown rot have been developed and hybrids derived from these have been in phase 2 testing. Some should be in phase 3 testing in the next year. QTL’s for bacterial spot toler-ance are being incorporated into fusarium wilt race 3 inbreds. Fla. 630 has race 3 resistance and two QTLs for tolerance to bacterial spot along with NB that we con-tinue to incorporate into advanced inbreds. Leaves of NB lines retain their green color despite foliar disease infection and are slow to become necrotic. Locating molecular markers linked to NB will facilitate breed-ing of this trait and NB would be a boon to any future tomato variety releases.

Objective 2

MethodsBacterial spot breeding lines and experiments are

inoculated in the field, but natural infections often provide enough disease pressure. Breeding lines with better attributes are tested in stage 2 inbred trials and crossed to assess hybrid parent potential. Plum breeding lines were evaluated for possible release in the spring and fall. Resistant and susceptible popula-tions from resistant accession PI 114490 were evaluated to locate any undiscovered QTL’s in order to provide improved resistance. Cooperative trials with the Two Blades Foundation were conducted in fall and spring to evaluate UF breeding lines and hybrids transformed with the Bs2 gene from pepper.


ResultsThe decision was made to release plum inbreds

Fla. 8611 and Fla. 8835 as breeding lines and this will be done in 2012. They will provide private breeders mate-rial to develop bacterial spot tolerant plum hybrids. Fla. 8611 had better flavor in a fall 2011 taste panel. In order to locate additional resistance QTL, numerous confirming disease ratings on F4 and F5 selections were made in populations derived from PI 114490. Seven genomic regions were associated with resistance and the role of these regions now needs to be confirmed. A large number of NB selections (see objective 1) were also made in the fall and spring. These will be back-crossed to the parents again this fall. The Bs2 trans-formed versions of inbred Fla. 8000 and hybrid Fla. 8314 were doubled over their untransformed counter-parts and Florida 47 in the fall trial. In the spring, Bs2 provided excellent bacterial spot resistance and yields were enhanced but to a lesser extent than in the fall.

Objective 3

MethodsHeat-tolerant (HT) fruit setting ability is being

incorporated into all phases of the breeding program. For instance many lines being developed with bacterial spot tolerance have heat- tolerance as well. Key selec-tion in this project is done for early fruit setting abil-ity in fall crops when there is high temperature stress. Otherwise procedures are similar as those described under objective 1.

ResultsHybrids with Fla. 8735 have shown some potential

in stage 2 testing and will be tested further for possible release after grower testing. The main drawback has been that 8735 is quite susceptible to bacterial spot. Breeding lines Fla. 8736 and Fla. 8869 have done well in phase 2 testing and hybrids with these are being tested. Fall 2011 had very good heat stress as some known heat-tolerant breeding lines did not set real well early. There were 150 F2 selections made and 172 F3 selections were made in the spring. This fall the resulting F4s will be tested and it is anticipated that some should make outstanding parent lines.

Objective 4

MethodsBegomovirus resistance. We now have located molec-

ular markers linked to all our known resistance genes

and can fully employ MAS. This work is described in the grant with Sam Hutton as the lead. Four back-crosses using the Ty-3 short introgression donor have already been made with over 40 elite breeding lines. A small number of lines were inoculated with TYLCV and evaluated in the field.

Spotted wilt resistance. Selection for Sw-5 and Sw-7 resistance genes is now done with molecular mark-ers that eliminate the need to screen with thrips and potentially spread the virus in the west coast growing region. As new inbreds are developed that show hor-ticultural promise they are crossed and the resulting hybrids are tested for commercial acceptability. Pre-liminary data suggested that fruit blotch was reduced or eliminated in Sw-7 varieties versus Sw-5 varieties but this needs to be verified. Thus, several hybrids with each gene have been grown recently to evaluate the incidence of fruit blotch. There were 70 recombinant inbred lines tested at NFREC for resistance in a repli-cated trial in spring 2012.

ResultsBegomovirus resistance. Reliable fruit setting and

susceptibility to foliar diseases have been problems in this program. Future hybrids with Ty-1 or Ty-3 genes should have better horticultural attributes since the linkage drag problems have been removed in the short introgression donor parents. Furthermore, backcross-ing of other genes is progressing more rapidly by MAS. The status of this work is described in Sam Hutton’s grant report.

Spotted wilt resistance. Fla. 8822 is being tested as a parent in several hybrids. Fla. 8817 looked good in Homestead and hybrids will be made this fall. Both have Sw-5. Inbreds with Sw-7 are getting closer to parental potential and some test crossing is underway. Both genes are being backcrosssed into elite inbreds as described in the Sam Hutton grant. Unfortunately there was inadequate fruit blotch to obtain any useful data for the third year in a row.

Objective 5:

Methods Fruit quality and shelf-life are emphasized in all

breeding projects. One aspect of fruit quality is the development of high lycopene varieties by using the crimson (ogc) gene. This gene is widely distributed in the various breeding projects. New inbreds and hybrids are continually being made and evaluated. Another aspect is the incorporation of high sugars from a cherry line into large-fruited lines and in developing improved


cherry/grape breeding lines. We are backcrossing the desirable fruity/floral note into the parents of Tasti-Lee® to further improve the flavor. This is challenging because expression of this note is subject to environ-mental variation and only a few lines are stable for good expression. The most interesting lines from all flavor work are tested in flavor trials with USDA coop-erator Dr. Elizabeth Baldwin.

A project has been underway for a number of years to develop a superior crimson, good-flavored, joint-less tomato cultivar or hybrid especially well-suited for Dade County growing conditions. A hybrid trial was conducted on a grower farm in Dade County last win-ter with the goal to find a hybrid that competes with ‘Sanibel’.

Another project is to develop CGH tomatoes that do not require staking by use of the brachytic (br) gene that reduces plant height and increases side shoots. Here we emphasize jointless tomatoes that can be me-chanically harvested. Selections take place at GCREC and in Dade County on a grower farm.

ResultsThe fruity/floral backcrossing has been difficult

as we have had problems getting expression in the F2s that have been tested. Increased numbers of plants have not helped so far. In the future we may use gas chromatography to help with the selection process. Of the jointless hybrids tested recently, Fla. 8759 had excellent yield in Dade County, but the fruit were not firm enough once they became table ripe. New hybrids were advanced to stage 2 testing in the spring. In the CGH project it now appears that some commercial quality jointless lines have been developed and four will be tested on grower farms in the 2012-2013 season. This testing will help determine the utility of this type of variety under various growing conditions. One line in particular, Fla. 8916, has very large fruit and a con-centrated setting pattern. It is susceptible to graywall but it is being crossed with other CGH parents that are resistant so the hybrids should be better for that trait. Hybrids between the best inbreds will be tested start-ing in fall 2012 at GCREC and elsewhere as seed quan-tity permits.

Literature CitedEstabrook, Barry. 2011. Tomatoland: How modern

industrial agriculture destroyed our most alluring fruit. Andrews McMeel Publishing. Kansas City, MO. 240 p.

Hutton, Sam and Jay Scott. 2010. Susceptibility to bacterial spot race T4 (Xanthomonas perforans) is associated with resistance to Fusarium wilt race 3 (Fusarium oxysporum Schlecht. F. sp. lycopersici) in tomato. Proc 25th Annual Tomato Disease Work-shop, Wimauma, FL p24

Hutton, Samuel F., Jay W. Scott, and David J. Schuster. 2012. Recessive resistance to Tomato yellow leaf curl virus from the tomato cultivar Tyking is located in the same region as Ty-5 on chromosome 4. Hort-Science 47(3):324-327.

Ji, Yuanfu, David J. Schuster, and Jay W. Scott. 2007. Ty-3, a begomovirus resistance locus near the Tomato yellow leaf curl virus resistance locus Ty-1 on chromosome 6 of tomato. Molecular Breeding 20:271-284.

Ji, Yuanfu, Jay W. Scott, David J. Schuster, and Doug-las P. Maxwell. 2009. Molecular Mapping of Ty-4, a New Tomato Yellow Leaf Curl Virus Resistance Locus on Chromosome 3 of Tomato.

J. Amer. Soc. Hort. Sci. 134(2):281–288.

Nguyen, M.L. and S.J. Schwartz. 1999. Lycopene: Chemical and biological properties, Food Technol. 53(2): 38-45.

Polston, J.E., R.J. McGovern, L.G. Brown. 1999. Intro-duction of Tomato yellow leaf curl virus in Florida and implications for the spread of this and other geminiviruses of tomato. Plant Dis. 8384-988.

Scott, J. W., and J. P. Jones. 1989. Monogenic resistance in tomato to Fusarium oxysporum f. sp. lycopersici race 3. Euphytica 40:49-53.

Scott, J. W., and John Paul Jones. 1995. Fla. 7547 and Fla. 7481 tomato breeding lines resistant to Fu-sarium oxysporum f. sp. lycopersici races 1, 2, and 3. HortScience 30(3):645-646.

Scott, J. W., and John Paul Jones. 2000. Fla. 7775 and Fla. 7781: Tomato breeding lines resistant to Fusari-um crown and root rot. HortScience 35(6):1183-1184.

Scott, J. W., S. M. Olson, J. J. Bryan, T. K. Howe, P. J. Stoffella, and J. A. Bartz. 1989. Solar Set: A heat tol-erant, fresh market tomato hybrid. Fla. Agric. Expt. Sta. Circ. S-359 10p.

Scott, J. W., R. B. Volin, H. H. Bryan, and S. M. Olson. 1986. Use of hybrids to develop heat tolerant to-mato cultivars. Proc. Fla. State Hort. Soc. 99:311-314


Genetic Improvement and Hybrid Development of Tomatoes for Florida ProductionSamuel F. Hutton John W. Scott University of Florida, IFAS Gulf Coast Research & Education Center-Balm 14625 CR 672 Wimauma, FL 33598

AbstractThe tomato yellow leaf curl virus (TYLCV) resis-

tance locus, “Ty-6,” was identified, and six different alleles are now used by the UF breeding program for developing resistance to this disease. Smaller Ty-1 and Ty-3 introgressions, apparently lacking the typi-cally associated linkage drag, are being used in the program. Two strong QTL for bacterial spot tolerance were identified through a genetic study with PI 114490. Crosses will be made in Fall 2012 for confirmation of these results and to incorporate resistance into horti-culturally-superior material. Progress is being made in the parallel backcrossing project, and several advanced parent x trait combinations have been used to develop hybrid test-crosses and will be evaluated in Fall 2013. Such advanced combinations are also beginning to be utilized in crosses to develop the next generation of inbred lines. The re-initiation of a late-summer trial in 2011 is aiding tremendously in the identification of materials having heat-tolerant fruit setting ability.

IntroductionThe University of Florida tomato breeding program

has had a long history in developing improved parents and hybrids adapted to Florida’s subtropical environ-ment. General areas of focus have involved making yield, disease and pest resistance, and quality improve-ments. Many of the program’s objectives are similar to those of private companies (e.g. improved yield and horticultural characteristics, and resistance to diseases such as fusarium wilt, fusarium crown and root rot, tomato spotted wilt virus, and tomato yellow leaf curl virus); but many objectives focus more on long-term, high-risk projects (e.g. jointless pedicels, machine-har-vestable plant architecture, bacterial spot resistance, and flavor). Over the years, growers have benefited from a number of the UF breeding program’s accomplish-

ments, including improvements in heat tolerant setting ability (Scott et al., 1986; Scott et al., 1989), resistance to fusarium wilt race 3 (Scott and Jones, 1989; Scott and Jones, 1995), and resistance to fusarium crown and root rot (FCR) (Scott and Jones, 2000).

The past two decades have seen a major push by the program to introgress resistance to tomato yellow leaf virus (TYLCV) from wild relatives of tomato and develop TYLCV resistant varieties. Multiple TYLCV resistance genes have now been incorporated and are presently being utilized in the UF program. Ty-3 and Ty-4 were both identified through the programs’ ef-forts (Ji et al., 2007; Ji et al., 2009); and it was recently determined that the ty-5 locus identified by Anbinder et al. (2009) is also an important resistance gene in the program (Hutton et al., 2012). However, despite twenty years of efforts by the UF program and by private companies, not all of the important resistance loci have been identified; moreover, many of the TYLCV-resistant varieties available to growers in Florida com-promise on the yield and horticultural characteristics, and producers generally choose to grow susceptible varieties instead. Probably the main reason for the underperformance of resistant varieties has to do with linkage drag associated with some of the resistance. The Solanum chilense introgressions containing Ty-1 and Ty-3, two of the more widely used genes in com-mercial hybrids, each typically have undesirable effects on varieties’ performance. Recent research efforts at UF have resulted in the fine mapping of these loci and the development of advanced materials with no appar-ent linkage drag. These materials are being used in the breeding program and will soon be available to seed companies for the development of improved TYLCV-resistant cultivars.

As an example of a long-term, high-risk project not likely to be undertaken by private companies, the UF breeding program has striven for the past three de-cades to develop bacterial spot resistance. Significant progress was made over the years, but the emergence of mutant strains of Xanthomonas spp. repeatedly over-came the mechanisms of resistance and forced breed-ers to go back to square one. Efforts have since shifted from breeding for high levels of race-specific resistance, to developing an acceptable level of broad-spectrum re-sistance that will be effective against multiple strains of the pathogen. Recent research identified several QTL for broad-spectrum resistance in various backgrounds, including an important chromosome 11 QTL (Hutton et al., 2010). It has also been determined that greater susceptibility to bacterial spot is associated with the I-3 locus, which confers resistance to fusarium wilt race 3


(Hutton and Scott, 2010). The inbred Fla. 630 emerged in spring 2009 and has an attractive level of bacterial spot tolerance, even though it carries the I-3 locus; additionally, Fla. 630 displays a “non-blighting” pheno-type, which contributes to a reduced level of yellowing/necrosis under conditions of infection by foliar patho-gens such as bacterial spot and early blight. The major-ity of the program’s efforts are now seeking to advance these characteristics into improved backgrounds, but the S. lycopersicum var. cerasiforme accession PI 114490 is also being used as a source for novel resistance loci.

Each season, the program’s latest inbreds and hy-brids of promise are evaluated in yield trials and com-pared with commercial varieties. Categories of hybrids typically include jointless pedicel, and tolerances to hot set, bacterial spot, bacterial wilt, fusarium crown and root rot and/or TYLCV. Oftentimes, several parental combinations are significantly better in yield than the commercial standards, but most often the conclusion about such hybrids—and therefore attributable to the parents—is that they do not carry some of the newer, important resistances (e.g. resistance to TYLCV and Fusarium Crown Rot (FCR). Molecular markers linked to the genes controlling many of these traits are avail-able or can be developed, making the incorporation of such traits into inbred lines by marker assisted selec-tion (MAS) an attractive approach to addressing this issue. Objectives of this project were:

1. The systematic development and deployment of TYLCV resistance in horticulturally-superior backgrounds.

2. The development of inbreds and hybrids with tolerance to bacterial spot.

3. Trait Integration.

4. To develop improved inbreds and hybrids with disease resistance and heat-tolerance.

Objective 1

Methods Six different TYLCV resistance alleles are currently

used in the breeding program. Ty-1 and Ty-3 have been fine mapped, and materials have been developed which contain these genes within shortened introgressions with no apparent linkage drag; Ty-2 was recently fine mapped and incorporated into the program. Ty-4 fine mapping is being funded through a BARD grant. The ty-5 gene was recently identified and has no apparent linkage drag. A population segregating for “Ty-6” was phenotyped in the program and genotyping was done

through the SolCAP research initiative.

Results Genotyping of the population segregating for “Ty-

6” resulted in the mapping of this locus to a precise region on chromosome 10. Confirmation populations will be evaluated in Fall 2012, and “Ty-6” will be added to the Trait Integration project and is beginning to be utilized by MAS in the general breeding program. MAS is also being used to select for the minimal Ty-3 intro-gression, and for Ty-5 in the general breeding program.

Objective 2

MethodsBreeding line Fla. 630 was used as a donor of

bacterial spot tolerance and “non-blighting” resis-tance. Ph.D. student, Jian Li, with funding through the Molecular Plant Breeding Initiative, is backcrossing various chromosome 11 recombination events into a common background for further mapping of this locus; I-3 recombinant inbred lines developed by Dr. David Jones at the Australian National University are being used by Mr. Li to seek to break the linkage between I-3 and bacterial spot susceptibility. PI 114490 was crossed to two susceptible breeding lines, and F2 progeny were evaluated for bacterial spot disease severity; the most resistant and most susceptible progeny were selected and advanced, and phenotypic evaluations were re-peated the following season; this process was repeated through 4 seasons of evaluations to ensure confidence in the phenotype, and 90 highly resistant or susceptible selections were genotyped with more than 2500 poly-morphic molecular markers through a collaborative effort with DNA Landmarks.

ResultsFla. 630 was crossed to a range of susceptible in-

breds, and non-blighting F2 individuals were selected. After three seasons of evaluations, more than 80 selec-tions have been advanced and will be backcrossed to their respective susceptible parents. Progress is being made with the chromosome 11 QTL: backcrossing is nearing completion, and evaluations should begin in Fall 2013. The first series of crosses have also been made with the I-3 recombinants. Genotyping results from the PI 114490 populations identified as many as 7 different genomic regions that were significantly as-sociated with resistance by single-marker analysis, the strongest of which were found on chromosomes 3 and 10. Crosses will be made in Fall 2012 to develop popula-tions for QTL confirmation, and to advance resistance


loci into more horticulturally-acceptable backgrounds.

Objective 3

MethodsMarker-assisted backcross breeding is being used

to incorporate the following resistances into a panel of approximately 45 parent lines: TYLCV resistance genes Ty-1 through Ty-5, Frl (FCR resistance), Sw-5 and Sw-7 (Tomato Spotted Wilt Virus (TSWV) resistance), and Ph-2 and Ph-3 (late blight resistance—funded through a USDA grant); Pto (bacterial speck resistance) was also incorporated into two parents.

ResultsSignificant progress has been made towards devel-

oping “value-added” near-isogenic versions of many parent lines (Table 1). As an example, Ty-1 has been advanced to the BC4 (four backcrosses) in 10 different backgrounds; proportionally speaking, each of these re-sulting lines should be 97% genetically identical to the original parent, but also contain Ty-1. Likewise, Ty-3 has been advanced to the BC3 to BC4 in many of those same backgrounds, and backcrossing continues for this trait in other parents in the panel. Frl backcrossing is complete for several parents (BC6 or greater).

Objective 4

Methods In the general breeding program, marker assisted

selection has replaced seedling inoculations to screen for and select plants that carry desirable traits men-tioned in Objective 3. This screening is occasionally begun in the F1 if parents are not fixed for the respec-tive gene, but are more often carried out in the F2 and subsequent generations until a homozygous selection is made. Selections are advanced on the basis of per-formance in field trials, and inbreds/hybrids showing the most promise are tested in yield trials at Gulf Coast Research and Education Center (GCREC) and off-site.

ResultsIn an effort to increase the program’s emphasis

on developing plum-type varieties, the plum-shaped breeding lines Fla. 8083, 8611, 8835 and 8878 have all been added to the parallel backcrossing project (objec-tive 3, above). Additionally, F2 selections were made from some commercial hybrids and from some bacteri-al spot tolerant materials in the program. Several plum hybrids were evaluated in Fall 2011 and out-yielded controls, but fruit size of these was too small for com-

mercial potential. Several compact growth habit (CGH) inbreds performed well in Spring 2012; Fla. 8916 was one of these and was added to the parallel backcross-ing project along with Fla. 8872—a large-fruited inbred out of the bacterial wilt project that showed very good parent potential in the Spring 2012 hybrid trial. Some of the most advanced parent x trait combinations from the parallel backcrossing project were used in crosses in Spring 2012, and these test-cross hybrids will be evalu-ated in Fall 2012 in the yield trial. Advanced combina-tions will be more heavily utilized in crosses in Fall 2012, both to generate test-crosses of hybrids that have proven field performance, and for development of the next generation of inbreds. Fall 2011 saw the revival of the late-summer heat-tolerance screening program, and many selections were made during that window. This summer screening effort will continue into the future, and crosses made in Fall 2012 between heat-tol-erant parents and advanced materials from the paral-lel backcrossing project will allow the simultaneous selection for heat-tolerance and necessary resistances among F2s in Fall 2013.

Literature CitedAnbinder, I., M. Reuveni, R. Azari, I. Paran, S. Nahon,

H. Shlomo, L. Chen, M. Lapidot, and I. Levin. 2009. Molecular dissection of Tomato leaf curl virus resistance in tomato line TY172 derived from Sola-num peruvianum. Theor. Appl. Genet. 119:519–530.

Hutton, Sam and Jay Scott. 2010. Susceptibility to bacterial spot race T4 (Xanthomonas perforans) is associated with resistance to Fusarium wilt race 3 (Fusarium oxysporum Schlecht. F. sp. lycopersici) in tomato. Proc 25th Annual Tomato Disease Work-shop, Wimauma, FL p24

Hutton, S.F., J.W. Scott, and D.J. Schuster. 2012. Re-cessive resistance to tomato yellow leaf curl virus from the tomato cultivar Tyking is located in the same region a Ty-5 on chromosome 4. HortScience 47:324-327

Hutton, S.F., J.W. Scott, W. Yang, S. Sim, D.M. Francis, and J.B. Jones. 2010. Identification of QTL associ-ated with resistance to bacterial spot race T4 in tomato. Theor. Appl. Genet. 121:1275-1287.

Ji, Yuanfu, David J. Schuster, and Jay W. Scott. 2007. Ty-3, a begomovirus resistance locus near the Tomato yellow leaf curl virus resistance locus Ty-1 on chromosome 6 of tomato. Molecular Breeding 20:271-284.


Ji, Yuanfu, Jay W. Scott, David J. Schuster, and Doug-las P. Maxwell. 2009. Molecular Mapping of Ty-4, a New Tomato Yellow Leaf Curl Virus Resistance Locus on Chromosome 3 of Tomato. J. Amer. Soc. Hort. Sci. 134(2):281–288.

Scott, J. W., and J. P. Jones. 1989. Monogenic resistance in tomato to Fusarium oxysporum f. sp. lycopersici race 3. Euphytica 40:49-53.

Scott, J. W., and John Paul Jones. 1995. Fla. 7547 and Fla. 7481 tomato breeding lines resistant to Fu-sarium oxysporum f. sp. lycopersici races 1, 2, and 3. HortScience 30(3):645-646.

Scott, J. W., and John Paul Jones. 2000. Fla. 7775 and Fla. 7781: Tomato breeding lines resistant to Fusari-um crown and root rot. HortScience 35(6):1183-1184.

Scott, J. W., S. M. Olson, J. J. Bryan, T. K. Howe, P. J. Stoffella, and J. A. Bartz. 1989. Solar Set: A heat tol-erant, fresh market tomato hybrid. Fla. Agric. Expt. Sta. Circ. S-359 10p.

Scott, J. W., R. B. Volin, H. H. Bryan, and S. M. Olson. 1986. Use of hybrids to develop heat tolerant to-mato cultivars. Proc. Fla. State Hort. Soc. 99:311-314

Table 1 Summer 2012 status of the parallel backcrossing in the UF tomato breeding program.Gene1

Parent Ty-1 Ty-2 Ty-3 Ty-4 Ty-5 Frl Sw-5 Sw-7 Ph-2 Ph-3

7770 1 2 3 1 2 0 0 1 1

7776 4 2 4 3 1 0 3 3 2 2

7781 4 1 3 2 1 n/a 2 2 2 2

7804 4 1 3 3 1 7 3 3 2 2

7907B 4 1 3 3 1 2 0 0 0 0

7946 1 2 5 1 2 3 3 1 1

7949B 1 1 3 1 1 2 2 1 1

7987 1 2 3 1 2 3 3 1 1

8000 4 1 3 3 1 2 0 0 2 2

8021 2 2 1 1 2 3 3 1 1

8044 1 2 3 1 2 3 3 1 1

8059 4 1 3 0 2 3 3 3 2 2

8083 4 2 3 2 1 2 2 2 2 2

8111B 4 1 3 2 1 2 3 3 2 2

8124C 4 1 1 0 1 7 n/a 2 1 1

8208 1 2 5 1 2 2 2 0 0

8249 4 0 3 3 0 2 3 3 2 2

8283 1 2 3 1 2 3 3 1 1

8293 4 1 3 1 1 0 0 0 2 2

8296 1 2 1 1 2 3 3 1 1

8297 1 2 2 1 1 3 3 1 1

8436B 2 2 2 1 2 3 3 1 1

8490B 1 2 0 1 3 3 1 1

8495 1 2 1 0 2 3 3 2 2

8499 2 2 4 1 n/a 3 3 1 1

8589 1 2 2 1 2 3 3 2 2

8590 1 2 2 1 0 3 3 1 1

8591 1 2 3 1 2 3 3 1 1


8592 1 2 2 1 n/a 3 3 1 1

8599 1 2 1 0 2 3 3 1 1

8608 4 2 2 2 1 6 3 3 2 2

8611 1 0 2 0 2 3 3 0 0

8620 1 2 3 1 2 2 1 1

8623 2 1 3 1 3 3 1 1

8646 0 2 2 1 2 3 3 1 1

8653B 1 2 1 1 1 3 3 2 2

8735 1 2 1 1 2 3 3 0 0

8776 1 1 0 1 n/a 0 0 0 0

8820 1 2 1 1 2 2 n/a 1 1

8834 1 2 2 1 7 3 3 1 1

8835 1 2 1 0 2 3 3 1 1

8877 0 1 0 0 1 1 1 0 0

8878 0 1 0 0 2 0 0 0 01Numbers indicate status of backcrossing, where 0 = the first cross has been made between the donor of the gene and the parent; 1 = BC1, the first backcross has been made; 2 = BC2, the second backcross has been made; etc. A blank indicates that no crosses have yet been made. “n/a” = not applicable, because the parent already contains the specific trait.


–A Photocatalytic Treatment for Management of Bacterial Spot of TomatoesMathews L. Paret University of Florida, IFAS North Florida REC-Quincy 155 Research Road Quincy, FL 32351

Gary E. Vallad University of Florida, IFAS Gulf Coast Research & Education Center-Balm 14625 CR 672 Wimauma, FL 33598

Devron R. Averett Chief Scientific Officer EcoActive Surfaces, Inc. 2529 Newport Avenue Cardiff by the Sea, CA 92007

Jeffrey B. Jones Plant Pathology Department University of Florida, IFAS Gainesville, FL 32611

Stephen M. Olson University of Florida, IFAS North Florida REC-Quincy 155 Research Road Quincy, FL 32351

AbstractProtection of crops from bacterial diseases presents

a continuing challenge, mandating the development of novel agents and approaches. Photocatalysis is a process where chemically reactive oxygen species are catalytically generated by certain minerals in the pres-ence of light. These reactive oxygen species have the capacity to destroy organic molecular structures criti-cal to pathogen viability. In our studies, the antibacte-rial potential of photocatalytic nanoscale TiO2 doped with zinc (TiO2/Zn; AgriTitan™) against Xanthomonas perforans, the causal agent for bacterial spot disease of tomato was evaluated. The use of TiO2/Zn at ~500-800 ppm (1:10 dilution) significantly reduced disease incidence in three of the four trials compared to un-treated and copper (Kocide® 3000) control; and compa-rable/better than the grower standard; copper (Kocide®

3000) + mancozeb (Penncozeb® 75DF). The treatments did not cause any adverse effects on tomato yield in any of the field trials. However, in two of the four trials, we noticed leaf phytotoxicity (~2-10% of leaf area) starting at the 6-8th spray. This is likely due to the deposition of too much photocatalytic nanoparticles on single points on surface of the plants over multiple applica-tions using a conventional sprayer. Our study in spring 2012 using an electrostatic sprayer for application of TiO2/Zn did not cause any phytotoxicity after the 8th spray at ~500-800 ppm compared to a phytotoxicity of ~5% in plots sprayed using a conventional sprayer. Weekly sprays of TiO2/Zn using electrostatic sprayer significantly reduced bacterial spot severity compared to the untreated control; the bacterial spot severity was comparable to the grower standard. The total volume of TiO2/Zn used per application at full growth stage of tomatoes using an electrostatic sprayer was <60% of the volume when sprayed by a conventional sprayer.

IntroductionFresh market tomato is an important vegetable

crop in Florida and is grown on over 31,000 acres and valued at over 564 million dollars. Florida production accounts for nearly 28% and 45% of United States pro-duction and market value, respectively. Bacterial spot caused by Xanthomonas perforans leads to significant reduction in crop yield, and is one of the major bacteri-al diseases affecting tomato in commercial fields world-wide. A recent estimate shows that the monetary losses due to bacterial spot in southwest Florida alone were $3,090 per acre based on 2007-08 production costs and market values. Disease management using cul-tural practices and disease tolerant varieties has given mediocre results in tropical and subtropical regions, where the climatic conditions favor infection and the spread of the disease. Chemical control using the anti-biotic streptomycin was successfully used in the 1950s. However, strains resistant to streptomycin developed in due course that made the antibiotic ineffective (Thayer and Stall, 1961). The disease has been man-aged using copper (Cu) bactericides for many decades. The effectiveness of Cu bactericides is enhanced when used in combination with ethylenebis-dithiocarbamate (EBDC) fungicides such as maneb or mancozeb due to increased availability of free Cu ions. Unfortunately, widespread use has led to Cu tolerance, and currently most of the strains isolated from Florida are tolerant to Cu reducing the effectiveness of this standard disease control treatment. Alternative disease management technologies such as bacteriophages and systemic acquired resistance (SAR) inducers have been under


investigation as alternatives to Cu bactericides. Aciben-zolar-S-methyl (ASM) is an SAR inducer that activates plant defense systems by increasing the transcription of stress related genes. ASM has been shown to in-crease resistance of tomato to bacterial spot compared to untreated controls. Bacteriophages also have shown promise as a biological alternative to conventional Cu bactericides. However, ensuring efficacy of bacterio-phage is challenging in field conditions due to the short time that phage remain viable and their specific envi-ronmental requirements for multiplication.

The primary objective of this study was to find a suitable alternative to copper bactericides with the use of a photocatalytic antimicrobial compound TiO2/Zn. The studies included assessment of the effectiveness of TiO2/Zn nanoparticles against bacterial spot disease in tomato field production, and evaluation of the effect of TiO2/Zn nanoparticle treatment on tomato fruit yield.

Materials and MethodsField experiments from fall 2010 - fall 2011. Four

field trials were conducted in Florida during 2010 and 2011. Three of these trials were conducted at the Uni-versity of Florida North Florida Research and Educa-tion Center (NFREC) in Quincy, FL during the fall of 2010, spring of 2011, and fall of 2011. Soil type was Norfolk sandy loam with pH 6.3. One trial was con-ducted at the University of Florida Gulf Coast Research and Education Center (GCREC) in Wimauma, FL during the fall of 2011. Soil type was Myakka fine sand with pH 6.8. Experimental plots at Quincy locations consisted of fumigated raised beds covered with black polyethylene mulch for spring plantings and white polyethylene mulch for fall plantings. At the Wimauma location black polyethylene mulch was used for fall planting. Bed dimensions at both locations were 12.7 cm tall by 76.2 cm wide. Beds were spaced 1.8, and 1.2 m apart at Quincy and Wimauma respectively. Plants were spaced 50.8 cm and 45.7 cm within the row at re-spective locations. Inorganic fertilizers were applied to experimental plots based on soil test results and coop-erative extension recommendations. Seedlings of ‘BHN 602’ (BHN Seed, Immokalee, FL) were transplanted on 11 August 2010, 27 March 2011, and 4 August 2011 in Quincy, Florida; and ‘SecuriTy 28’ (Harris Moran Seed Company, Modesto, CA) on 12 September 2011 in Wimauma, FL. Each entry consisted of 4 replications in Quincy, and 6 replications in Wimauma with 18 and 14 plants respectively in each replication. All experiments were arranged as randomized complete block design. The treatments of TiO2/Zn included 1:10, 1:20, 1:40, 1:60, 1:80, and 1:100 dilutions for fall 2010, and spring

2010 trials. The fall 2011 trial in Quincy, FL included nanoparticles at 1:10, 1:20 and 1:40 dilutions. The fall 2011 trial in Wimauma, FL included 1:10, 1:20, and 1:40 dilutions. Copper (Kocide® 3000), copper + mancozeb (Penncozeb® 75DF), and untreated plots were kept as controls in each trial at Quincy and copper + man-cozeb and untreated plots at Wimauma. The plants were sprayed in the early morning at weekly intervals (8 times) starting from 2nd week after transplanting. Disease severity was rated at monthly intervals using the Horsfall-Barratt scale, to assess the percentage of canopy affected by bacterial spot. Values were con-verted to mid-percentages and used to generate Area Under Disease Progression Curve (AUDPC) based on the formula ∑ ([(xi+xi-1)/2](ti-ti-1)) where xi is the rating at each evaluation time and (ti-ti-1) is the time between evaluations. Plots were maintained throughout the sea-son using standard fertility, irrigation, and crop protec-tion practices recommended for commercial tomato production in Florida. Twelve plants from the center of each plot were marked, and fruit was harvested from these plants 2 to 3 times during the trial at a mature green/early breaker stage typical of tomato production in Florida and graded based on USDA Grades.

Field experiments in spring 2012 for delivery of TiO2/Zn using electrostatic spraying. A trial was conducted at NFREC, Quincy to test the use of elec-trostatic sprayer for minimizing the chances of phyto-toxicity from application of TiO2/Zn. The experiment was set-up as described above. The treatments included TiO2/Zn sprayed at 1:10 and 1:20 dilution at weekly intervals using a conventional sprayer and an electro-static sprayer. Each treatment had 5 replications and the plots were arranged in a randomized block design. AUDPC data were analyzed as described above, and the field data are currently being analyzed. A trial was also conducted at GCREC, Wimauma in spring 2012 and the data are currently being analyzed.

Statistical analysis. Field studies were set-up in a randomized complete block design. The data was ana-lyzed using ANOVA. The means were compared using least significant difference. The analysis was performed with SAS (SAS version 9.1, SAS Institute Inc., Cary, NC).

ResultsEfficacy of TiO2/Zn nanoparticle on bacterial

spot disease severity in field trials. In the fall 2010 field trial conducted at Quincy, the application of nanoparticles of TiO2/Zn at 1:10 caused a significant reduction of bacterial spot disease incidence compared to copper, copper + mancozeb and untreated control as indicated by the AUDPC data (Table 1). This protection


declined as the concentration of applied TiO2/Zn was reduced. In this experiment, the tomato fruit yield for the TiO2/Zn treatments of 1:10 dilution (67,191 kg/ha), 1:20 dilution (63,394 kg/ha), 1:40 dilution (60,620 kg/ha) and 1:60 dilution (65,478 kg/ha) was greater than copper (53,392 kg/ha), copper + mancozeb (57,859 kg/ha) and untreated control (54,364 kg/ha); however this was not statistically significant. None of the TiO2/Zn treatments had any adverse effect on tomato fruit yield in this trial.

In the spring 2011 field trial conducted at Quincy, the application of nanoparticles of TiO2/Zn at 1:10 dilution caused a significant reduction of bacterial spot disease incidence compared to copper, and untreated control as indicated by the AUDPC data (Table 2). There was no statistical difference between the bacteri-al spot incidence of TiO2/Zn at 1:10 dilution and copper + mancozeb control. The activity of TiO2/Zn declined with increased dilution rates. Tomato yield data from this field experiment was not collected due to a hail-storm that caused extensive damage to the crop one week prior to harvest.

In the fall 2011 field trial conducted at Quincy, the application of nanoparticles of TiO2/Zn at 1:10 caused a significant reduction of bacterial spot disease incidence compared to copper, and untreated control as indicated by the AUDPC data (Table 3). There was no statisti-cal difference between the bacterial spot incidence of TiO2/Zn at 1:10 dilution and copper + mancozeb con-trol. TiO2/Zn at 1:20 and 1:40 dilutions had statistically similar bacterial spot incidence compared to TiO2/Zn at 1:10 dilution, but lesser bacterial spot incidence com-pared to the untreated control. TiO2/Zn treatments did not have any adverse effect on tomato fruit yield.

In the fall 2011 field trial conducted at Wimauma, there was no significant difference in bacterial spot incidence between the treatments (Table 4). There were no adverse effects on tomato fruit yield from the ap-plication of TiO2/Zn.

In two of the four trials with conventional sprayer, we noticed leaf phytotoxicity (~2-10% of leaf area) starting at the 6-8th spray. Our study in spring 2012 used an electrostatic sprayer for application of TiO2/Zn did not cause any phytotoxicity after the 8th spray at ~500-800 ppm compared to a phytotoxicity of ~5% in plots sprayed using a conventional sprayer. In this trial weekly sprays of TiO2/Zn using electrostatic sprayer significantly reduced bacterial spot severity compared to the untreated control; the bacterial spot severity was comparable to the grower standard; copper (Kocide® 3000) + mancozeb (Penncozeb® 75DF) (Table 5). The

total volume of TiO2/Zn used per application at full growth stage of tomatoes using an electrostatic sprayer was <60% of the volume when sprayed by a convention-al sprayer (data not shown).

DiscussionBacterial spot of tomato is both a commercially

important disease and also a valuable experimental system to evaluate the potential of bactericides in agri-culture. Crop diseases that arise from epiphytic bacte-ria have a large negative impact worldwide, and their prevention with an ecologically friendly technology of photocatalysis is a new approach in plant disease man-agement. Although this potential was suggested by a report published while our work was in progress using a macro-particulate form of TiO2 in ornamental crops, the macro-particulate form of TiO2 requires spraying a large quantity of the material. Numerous experiments conducted by our group are indicating that TiO2/Zn exhibits significant improvements in photocatalysis compared to macro form TiO2 (data not shown).

The leaf phytotoxicity observed in our studies is likely due to the deposition of too much photocatalytic nanoparticles on single points on surface of the plants over multiple applications using a conventional sprayer. Our latest study in spring 2012 at Quincy using an electrostatic sprayer did not cause any phytotoxicity. We hypothesize that with the electrostatic sprayer the particles are evenly distributed on the plant surface thereby limiting the chances of phytotoxicity compared to accumulation of the nanoparticles at single points on plant surface leading to higher chances of phyto-toxicity when a conventional sprayer is used. Further studies are in progress to evaluate the threshold for maximum application of TiO2/Zn using small and commercial-scale electrostatic sprayers and efficacy in disease management. Studies on integration of TiO2/Zn with a SAR inducer will be conducted in fall 2012 at Quincy and Wimauma.

AcknowledgmentsWe acknowledge Jackie Snell, Laura Ritchie, Hank

Dankers and the farm crew at NFREC, Quincy, and the farm crew at GCREC, Balm for the technical sup-port in conducting field trials. Funding for this work comes from the University of Florida Opportunity Seed Grant 2010-2012 (Project no. 00094414), and the Florida Tomato Committee Grant 2011-2012 (Project no. 00098359).


Publication being submitted from the project.

Paret ML, Vallad GE, Averett DR, Jones JB, Olson SM. Light activated antimicrobial TiO2/Zn for man-agement of bacterial spot on tomato. Phytopathology (To be submitted by July 31st, 2012)


Table 1 Effect of TiO2/Zn on the incidence of bacterial spot on tomato cultivar ‘BHN 602’, shown as average area under the disease progress curve (AUDPC), and the yield of tomato. The field trial was conducted during fall 2010 in Quincy, FL.

Yield (kg/ha)

Treatment Dilutionw Medium Large Extra Large Total Marketable

AUDPCy

TiO2/Zn 1:10 10,047 ax 18,581 a 38,563 a 67,191 a 800.6 c

1:20 8,702 a 16,070 ab 38,622 a 63,394 a 950.3 bc

1:40 9,248 a 18,779 a 32,594 a 60,620 a 1,000.1 b

1:60 8,397 a 16,980 ab 40,102 a 65,478 a 1,033.4 ab

1:80 6,393 a 16,392 ab 32,446 a 55,231 a 933.6 bc

1:100 8,457 a 18,319 a 35,091 a 61,867 a 1,050.0 ab

Copper 7,744 a 13,642 b 32,006 a 53,392 a 1,050.0 ab

Copper + 7,653 a 14,549 b 35,656 a 57,859 a 1,033.4 ab

Mancozeb

Untreated 6,312 a 15,293 ab 32,670 a 54,364 a 1,181.3 a

LSD nsz 3,336 ns ns 145.5

P > F 0.4286 0.0343 0.6950 0.4379 0.0019wRepresents the diluted formulation of TiO2/Zn.xColumn means indicated with the same letters are not significantly different (P ≤ 0.05) based on Least Significant Difference (LSD).yDisease severities were rated using the Horsfall-Barratt scale, a non-dimensional 12-point scale, to assess the percentage of canopy affected by bacterial spot. Values were converted to mid-percentages and used to generate AUDPC.zns- not significant

Table 2 Effect of TiO2/Zn on the incidence of bacterial spot on tomato cultivar ‘BHN 602’, shown as average area under the disease progress curve (AUDPC) in a field trial conducted during spring 2011 in Quincy, FL.

Treatment Dilutionx AUDPCy

TiO2/Zn 1:10 583.6 dz

1:20 741.1 abc

1:40 724.5 bc

1:60 752.5 abc

1:80 757.8 abc

1:100 806.8 ab

Copper 864.5 ab

Copper + 642.3 cd

Mancozeb

Untreated 892.9 a

LSD 107.5

P > F <0.0001xRepresents the diluted formulation of TiO2/Zn. yDisease severities were rated using the Horsfall-Barratt scale, a non-dimensional 12-point scale, to assess the percentage of canopy affected by bacterial spot. Values were converted to mid-percentages and used to generate AUDPC. zColumn means indicated with the same letters are not significantly different (P ≤ 0.05) based on Least Significant Difference (LSD). Yield data could not be taken due to significant hail damage on tomatoes one week before the first harvest date.


Table 3 Effect of TiO2/Zn on the incidence of bacterial spot on tomato cultivar ‘BHN 602’, shown as average area under the disease progress curve (AUDPC), and the yield of tomato in a field trial conducted during fall 2011 in Quincy, FL.

Yield (kg/ha)


AUDPCy

TiO2/Zn 1:10 4,518 ax 7,512 a 15,251 a 27,281 a 995.8 c

1:20 4,966 a 6,994 a 11,200 a 23,161 a 1,073.6 bc

1:40 4,210 a 7,900 a 17,409 a 29,519 a 1,089.4 bc

Copper 4,532 a 6,986 a 11,258 a 22,776 a 1,306.4 ab

Copper + 3,909 a 8,202 a 14,933 a 27,044 a 816.4 c

Mancozeb

Untreated 5,449 a 7,093 15,159 a 27,700 a 1,410.5 a

LSD nsz ns ns ns 277.3

P > F 0.7194 0.9652 0.4146 0.7845 0.0037wRepresents the diluted formulation of TiO2/Zn. xColumn means indicated with the same letters are not significantly different (P ≤ 0.05) based on Least Significant Difference (LSD). yDisease severities were rated using the Horsfall-Barratt scale, a non-dimensional 12-point scale, to assess the percentage of canopy affected by bacterial spot. Values were converted to mid-percentages and used to generate AUDPC. zns- not significant

Table 4 Effect of TiO2/Zn on the incidence of bacterial spot on tomato cultivar ‘BHN 602’, shown as average area under the disease progress curve (AUDPC), and the yield of tomato in a field trial conducted during fall 2011 in Wimauma, FL.

Yield (kg/ha)


AUDPCx

TiO2/Zn 1:10 4,394 a 4,717 a 11,113 aby 20,223 a 754.3 a

1:20 4,264 a 4,652 a 11,049 ab 19,965 a 688.9 a

1:40 4,652 a 4,943 a 11,824 a 21,419 a 795.1 a

Copper + 4,329 a 4,781 a 10,015 b 19,125 a 743.8 a

Mancozeb

Untreated 4,135 a 5,104 a 11,889 a 21,128 a 733.3 a

LSD nsz ns 1,636.3 ns ns

P > F 0.8476 0.9281 0.1192 0.2914 0.6846wRepresents the diluted formulation of TiO2/Zn. xDisease severities were rated using the Horsfall-Barratt scale, a non-dimensional 12-point scale, to assess the percentage of canopy affected by bacterial spot. Values were converted to mid-percentages and used to generate AUDPC. yColumn means indicated with the same letters are not significantly different (P ≤ 0.05) based on Least Significant Difference (LSD). zns- not significant


Table 5: Effect of electrostatic spraying of TiO2/Zn on bacterial spot on cultivar ‘BHN 602’ shown as AUDPC in a field trial conducted during spring 2012 in Quincy. Yield not available as tomatoes from this trial is currently being picked.

Treatment Dilutionx AUDPCy

TiO2/Zn (Conventional sprayer) 1:101:20

668.8 bz

660.1 b

TiO2/Zn (Electrostatic sprayer) 1:101:20

677.6 b629.3 b

Copper + MancozebUntreated

501.2 b899.2 a

LSDP > F

177.40.005

xRepresents the diluted formulation of TiO2/Zn. yDisease severities were rated using the Horsfall-Barratt scale, a non-dimensional 12-point scale, to assess the percentage of canopy affected by bacterial spot. Values were converted to mid-percentages and used to generate AUDPC. zColumn means indicated with the same letters are not significantly different (P ≤ 0.05) based on Least Significant Difference (LSD).


Identification of Possible New Strains of Tomato Yellow Leaf Curl Virus In FloridaJane E. Polston University of Florida, IFAS Plant Pathology Department Gainesville, FL 32611

AbstractData from a previous metagenomic study suggested

that there might be more than one strain of Tomato yellow leaf curl virus (TYLCV) in Florida. This study 1) analyzed those data collected in 2009 in more detail, 2) obtained full length clones of TYLCV isolates collected from tomato fields in 2012 (Miami-Dade and Lee Coun-ties) and screened those clones for variants by restric-tion analysis, and 3) obtained complete sequences of selected full length TYLCV genomes and compared them with TYLCV-FL sequences from 1997, TYLCV sequences from GenBank, and sequences obtained from the whiteflies in 2009. While we are still work-ing on the third part of this project, the data we have support several conclusions already. We found that the metagenomic study was correct, and that there is a variant of TYLCV in Florida that differs from the isolate first reported in 1997. The variant is present in 2012 in tomato fields in both Miami-Dade and Lee Co., so tomato plants in Florida can be infected with either variant of TYLCV. The new TYLCV variant is more similar to TYLCV isolates reported from Arizona, Texas, Mexico and Grenada. The TYLCV variant has a 29 nucleotide deletion in an important regulatory region that the TYLCV first reported from Florida does not. The significance of this deletion in terms of effects on pathogenicity, replication or competitive abilities will require further research.

Detailed Results1. Analysis of TYLCV DNA fragments identified

in whiteflies collected from Homestead, FL in 2009 obtained during a metagenomic study.

Eleven partial TYLCV sequences were obtained from the previous study (Ng et al. 2011) and compared to the genome of TYLCV reported from Florida (TY-LCV-FL) in 1997. While one sequence appears to be an artifact of the assembly process, the other 10 sequences clearly come from the intergenic region of TYLCV and are 97-99% identical to the TYLCV isolate reported in

1997 (Figure 1). That difference in sequence identity is due mostly to a stretch of DNA that is present in the 1997 isolate but missing in all these partial sequences. That deletion is 29 nucleotides in size and is located in a region that is important for replication.

We compared these sequences with the deletion to TYLCV sequences in the GenBank and discovered that there were isolates of TYLCV with this same deletion reported from Arizona, Texas, Mexico and Grenada (Bañuelos Hernández et al 2012, Idris et al 2007, Isakeit et al 2007). Figure 2 shows a comparison of the partial sequences of TYLCV obtained from the whiteflies with the sequence of TYLCV-FL obtained in 1997 and that of TYLCV from Texas (TYLCV-TX). The location of the deletion is between the iterons (shown in blue) and the hairpin (shown in yellow) – two sequences which are very important for regulating the replication of TY-LCV. In addition, these 29 nucleotides contain ethylene responsive elements that may play a role in infectivity through interaction with host transcription factors. If that is the case, the deletion strains may exhibit differ-ences in their infectivity or pathogenicity. In summary, these data suggest that a variant of TYLCV character-ized by a 29 nucleotide deletion in the intergenic region was present in Miami-Dade Co. at the time the white-flies were collected.

2. Comparison of clones obtained from whiteflies with that of TYLCV from tomato plants in the field.

We wanted to determine if the TYLCV deletion variant can still be found in infected tomato plants in Florida production fields. We analyzed 42 tomato samples collected in spring 2012 from tomato fields in Miami-Dade and Lee Counties for the presence of this deletion variant of TYLCV. We designed a rapid method for the detection of the deletion variant using PCR to amplify a region of the TYLCV genome where the deletion is located followed by restriction with the enzyme BsrDI which only cuts the TYLCV sequence when the full sequence is present. Those sequences with the deletion remain uncut.

We found both variants of TYLCV in the field in Lee Co. but only the deletion variant in Miami-Dade Co. So we now know that the deletion variant is not restricted to Miami-Dade Co. While we found both variants in Lee Co. we found no evidence of mixed infections of the two variants in the same plant. This is unexpected, but might be due to the small number of plants analyzed rather than the ability of one to out compete the other. In summary, the TYLCV dele-tion variant is still present in Florida, can be found in


infected plants, and is present in at least Miami-Dade and Lee Co. in Florida.

3. Full Genomic Sequences of TYLCV isolates from Florida

To understand the diversity of TYLCV isolates in Florida in greater detail, we obtained full length clones of TYLCV from eight field samples which contained the deletion, sequenced them completely, and then compared those sequences to TYLCV sequences in the GenBank and with TYLCV isolates from 1997 and one in culture at UF. While we waited for the full sequenc-es, we made a comparison of the number of restriction sites using four enzymes to get an early assessment of diversity (restriction sites are a rough indicator of differences in sequence). This analysis shows that none of the TYLCV isolates are identical to either isolate of TYLCV-FL, as expected. However, none of them are identical to the TYLCV-TX isolate nor are they all iden-tical to each other. Sample no. 12-15 seems to be differ-ent from the others. Full sequences will help clarify the extent of the differences.

We are in the process of obtaining the full se-quences and currently have 67% of the genome of each sample from Miami-Dade and Lee Co. Preliminary analysis of those partial sequences is shown in Table 3. A comparison of all the isolates with each other shows that each clone is unique; no two are 100% identical. Some of the isolates from Miami-Dade and Lee Co. are very similar to each other (ex. 12-14 and 12-41) so there were no obvious regional differences. While there are variations in the sequence among the different isolates, all of them are more similar to the isolate from Texas (TYLCV-TX) than they are to the isolate originally de-scribed from Florida in 1997 (TYLCV-FL). Identity with TYLCV-TX ranged from 98.7 to 99.4, while the range of identity with TYLCV-FL ranged from 97.2 to 97.4.

In summary, there is some sequence variation among isolates in addition to the 29 nucleotide dele-tion. The deletion variant appears to be more similar to the isolate from Texas than it is to the TYLCV first described from Florida in 1997.

DiscussionTMore accurate comparisons will be possible once

the full sequences are obtained. We will also be se-quencing field isolates which don’t have the deletion to see what kind of variability exists within these isolates and how they compare to the deletion variants. While there was one study that compared sequences from around the world that were present in the GenBank (Duffy and Holmes 2007), this is the first study of its

kind – a description of the diversity of TYLCV among multiple field samples from a tomato production region where TYLCV was an introduction.

It is possible that the deletion variant represents multiple introductions of TYLCV into Florida. It is also possible that this variant arose after the introduction of TYLCV into the Western Hemisphere. This deletion variant has never been reported from the Mediter-ranean, the original source of TYLCV, but has been found in other parts of the US, Mexico and Grenada.

It is possible, due to the nature of the sequence deleted, that one or the other variant may have a com-petitive advantage. The lack of variation in the Miami-Dade Co. samples and the lack of mixed infections of variants in Lee Co. suggest that this might be the case. Further biological studies will be needed to determine what role the deletion plays in the replication and pathogenicity of TYLCV, and the effect of these on host resistance genes.

Literature CitedBañuelos-Hernández B, Mauricio-Castillo JA, Carde-

nas-Conejo Y, Guevara-González RG, Arguello-As-torga GR (2012) A new strain of tomato severe leaf curl virus and a unique variant of tomato yellow leaf curl virus from Mexico. Arch Virol. 2012 Jun 10 [Epub ahead of print] PubMed PMID: 22684489

Duffy S, Holmes EC (2007) Multiple introductions of the Old World begomovirus Tomato yellow leaf curl virus into the New World. Appl Environ Mi-crobiol. 73:7114-117

Idris AM, Guerrero JC, Brown JK (2007) Two distinct isolates of Tomato yellow leaf curl virus threaten tomato production in Arizona and Sonora, Mexico. Plant Dis. 91:910

Isakeit T, Idris A, Sunter G, Black MC, Brown J (2007) Tomato yellow leaf curl virus in tomato in Texas, originating from transplant facilities. Plant Dis. 91: 466

Ng TF, Duffy S, Polston JE, Bixby E, Vallad GE, Breit-bart M (2011) Exploring the diversity of plant DNA viruses and their satellites using vector-enabled metagenomics on whiteflies. PLoS One 6:e19050


Table 1. Prevalence of TYLCV and the TYLCV deletion variant in samples collected from Miami-Dade and Lee Counties in Spring 2012.

Location No. Plants Infected with TYLCV

No. Samples Infected with TYLCV without deletion

No. Samples Infected with TYLCV deletion variant

Miami-Dade Co. 5 0 5

Lee Co. 12 9 3

TYLCV-FL (1997) -- 1 0

TYLCV-FL (in culture at UF)

-- 1 0

Full length TYLCV clones from whiteflies

In progress In progress In progress

Table 2. Restriction analysis of TYLCV deletion isolates from Miami-Dade and Lee Co. compared to isolates from Texas and Florida (from 1997 and the TYLCV isolate in culture at UF)

Location Sample Ident. No. No. of Sites Generated Per Enzyme

HpaI NcoI SalI

Miami-Dade Co. 12-1 1 1 0





Lee Co. 12-15 2 1 0

Lee Co. 12-22 1 1 0

Lee Co. 12-41 1 1 0

GenBank Sequence TYLCV-TX 0 1 0

TYLCV-FL 1997 sequence

TYLCV-FL 0 1 1

TYLCV-FL (in culture at UF)

TYLCV-FL 0 1 1

Table 3. Comparison of partial sequences obtained from cloned TYLCV genomes from field samples that contain the 29 nucleotide deletion with that of TYLCV-FL and TYLCV-TX

Percent Nucleotide Identity

TYLCV-FL TYLCV-TX 12-1 12-11 12-13 12-14 12-22

TYLCV-FL 100

TYLCV-TX 97.4 100

12-1 97.4 98.9 100

12-11 97.2 99.3 98.8 100

12-13 97.3 98.8 99.2 98.8 100

12-14 97.4 99.4 98.9 99.7 98.9 100

12-22 97.2 98.7 99.1 98.8 99.0 98.9 100

12-41 97.4 98.9 99.1 98.9 99.1 99.0 99.1


AV2CP1

30HnHw_B12_F

30HnHw_G09_F

30HnHw_E12_F

30HnHw_B01_F

30HnHw_D08_F

30Hx_A05_F

30Hx_A04_F

30Hx_B08_F 100*

30Hx_C08_F

30Hx_D07_F

30Hx_H06_F

99

99

98

98

98

98

98

100*

99

97

99

99

99

97

99

98

99

99

9998

RepAC4TrAP

REn

Sequence Posi6on and percentage of sequence iden6ty rela6ve to the TYCLV-‐FL genome

Figure 1. Location and percent identity of the TYLCV fragments detected in whiteflies collected in Miami-Dade Co in 2009 (data from Ng et al. 2011).

TYLCV-FL(1997) ATCGGTGTATCGGTGTCTTACTAATACCTCGACACCTAATGGCAATTTGGTAATTTCATAAATGTTCATTGCAATTCAAAATTCAAAATTCAAAAATCAAATCATTAAAGCGGTCATCCGTATAATATTACCGTYLCV-TX ATCGGTGTATCGGTGTCT TATTTATACCTCGACACCTAATGGCAATT-----------------------------AAAATTCAAAATTCAAAAATCAAATTATTAAAGCGGTCATCCGTATAATATTACCG30HnHw_B01_F ATCGGTGTATCGGTGTCT TATTTATACCTCGACCCTTAATGGCAATT-----------------------------AAAATTCAAAATTCAAAAATCAAATCATTAAAGCGGTCATCCGTATAATATTACCG30Hx_A05_F ATCGGTGTATCGGTGTCT TATTTATACCTCGACCCTTAATGGCAATT-----------------------------AAAATTCAAAATTCAAAAATCAAATCATTAAAGCGGTCATCCGTATAATATTACCG30Hx_H06_F ATCGGTGTATCGGTGTCT TATTTATACCTCGACCCTTAATGGCAATT-----------------------------AAAATTCAAAATTCAAAAATCAAATCATTAAAGCGGTCATCCGTATAATATTACCG30HnHw_B12_F ATCGGTGTATCGGTGTCT TATTTATACCTCGACCCTTAATGGCAATT-----------------------------AAAATTCAAAATTCAAAAATCAGATCATTAAAGCGGTCATCCGTATAATATTACCG30Hx_C08_F ATCGGTGTATCGGTGTCT TATTTATACCTCGACCCTTAATGGCAATT-----------------------------AAAATTCAAAATTCAAAAATCAAATCATTAAAGCGGTCATCCGTATAATATTACCG30HnHw_G09_F ATCGGTGTATCGGTGTCT TATTTATACCTCGACCCTTAATGGCAATT-----------------------------AAAATTCAAAATTCGAAAATCAAATCATTAAAGCGGTCATCCGTATAATATTACCG30Hx_A04_F ATCGGTGTATCGGTGTCT TATTTATACCTC-ACACATAATGGCAATT-----------------------------AAAATTCAAAATTCAAAAATCAAATTATTAAAGCGGTCATCCGTATAATATTACCG30Hx_D07_F ATCGGTGTATCGGTGTCT TATTTATACCTC-ACACATAATGGCAATT-----------------------------AAAATTCAAAATTCAAAAATCAAATTATTAAAGCGGTCATCCGTATAATATTACCG30HnHw_E12_F ATCGGTGTATCGGTGTCT TATTTATACCTC-ACACATAATCGCAATT-----------------------------CAAAATTCAAA-TCAAAAATGAAATTATTAAAGCGGTCATCCGTATAATATTACCG30HnHw_D08_F ATTGGTGTATCGGTGTCT TATTTATACCTCGACCCTTAATGGCAATT-----------------------------AAAATTCAAAATTCAAAAATCAAATCATTAAAGCGGTCATCCGTATAATATTACCG

29 nucleo*de dele*on

Figure 2. Partial sequences of TYLCV obtained from whiteflies (Miami-Dade Co. 2009) that appeared in the initial metagenomic analysis which suggested the presence of another strain or variant of TYLCV. All of these sequences contained a deletion in a section between the iterons (shown in blue), and the stem loop structure (shown in yellow) which is essential for transcription of the Rep protein.

tomato research report - citrus · supported by the florida tomato committee tomato research report...

Documents