tolerance of bacteruria after urinary diversion is linked to antimicrobial peptide activity

8/10/2019 Tolerance of Bacteruria After Urinary Diversion is Linked to Antimicrobial Peptide Activity

1/14

RUSH: Urology article for proofing [URL_15771] _______________________ Dear Author: The proof of your article to be published by Elsevier in Urology, is available as a PDF file at the followingURL: http://rapidproof.cadmus.com/RapidProof/retrieval/index.jsp Login: your e-mail addressPassword: jaHM7jG7QSCJ Also attached are instructions on the annotation of PDF files, as well as a Query Form if we have any

questions regarding your article. Proof corrections can now be annotated on-screen, which allows you to indicate your correction directly onthe PDF proof. Annotating and returning your PDF proof as an email attachment will ensure quick andaccurate publication of your article. To read these files and annotate the electronic proof with correctionsyou will need the latest version of Adobe Reader, which is available for free at:http://www.adobe.com/products/acrobat/readstep.html. Please also see the accompanying instructions forfurther information. If PDF annotations are not feasible, please consider one of the following methods of returning proof corrections: * List the corrections (including replies to any author queries) in an e-mail and return to me [email protected] or simply use the Reply button. Using this option, please refer to the line numbers onthe proof.* Mark corrections and any other comments (including replies to any author queries) on a printout of thePDF file and fax it to Einav Keet (fax # 215-239-3388).* If none of the above options are possible, please express mail a marked up copy of your article to theaddress below. After accessing the PDF proof, please:

* carefully proofread the entire article, including tables, equations, figure legends, and references;* confirm that all references, tables, and figures match up correctly with their citations in text;* ensure accuracy and spelling of affiliations, addresses, and author names;* check that any Greek letters (such as "mu") have been translated correctly;* verify scientific notations, drug dosages, and manufacturer names and locations;* be sure permission has been procured for any reprinted materials; and* answer all author queries completely (these are listed on the last page).

Changes that significantly alter the content of the article, such as new figures and tables or rewrittensections, will only be considered at this stage with the Editor's approval. It is important that all of your

corrections are sent back to us in one communication. Please check your proof carefully before replying, asinclusion of any subsequent corrections cannot be guaranteed and there will be no further opportunity toproofread your article.

UrologyCopy of e-mail Notification url7340


2/14


3/14

P-annotatePDF-v8.1

INSTRUCTIONS ON THE ANNOTATION OF PDF FILES

To view, print and annotate your article you will need Adobe Reader version 7 (or higher). This program is freelyavailable for a whole series of platforms that include PC, Mac, and UNIX and can be downloaded fromhttp://www.adobe.com/products/acrobat/readstep2.html. The exact system requirements are given at the Adobe site:http://www.adobe.com/products/acrobat/acrrsystemreqs.html#70win .

PDF ANNOTATIONS (for this you will need Adobe Reader version 7 or 8; to use version 9 see below)

To make annotations in the PDF file, go to the main Adobe toolbar and change the cursor from a hand symbol to the

normal cursor by clicking on the Select button in the menu bar at the top. When you open the PDF fileusing Adobe Reader, the Commenting toolbar should be displayed automatically; if not, click on Tools, selectCommenting (or Comment & Markup), then click on Commenting toolbar (or Show Comment & Markuptoolbar in Acrobat Reader 8, or Show Commenting bar on the Mac). If these options are not available in your AdobeReader menus then it is possible that your Adobe version is lower than version 7 or the PDF has not been prepared

properly.

(PC, Adobe version 7)

(PC, Adobe version 8, right-click on title bar (Comment & Markup) to show additional icons)

(Mac)

PDF ANNOTATIONS (Adobe Reader version 9)

The default for the Commenting toolbar is set to off in version 9. To change this setting select Edit | Preferences,then Documents (at left under Categories), then select the option Never for PDF/A View Mode see next page(the Commenting toolbar is the same as in version 8).


4/14

(Changing the default setting, Adobe version 9)

PLEASE DO NOT ATTEMPT TO EDIT THE ARTICLE TEXT ITSELF

TO INDICATE INSERT, REPLACE, OR REMOVE TEXT

Insert text

Click the Text Edits button on the Commenting toolbar. Click to set the cursor location in thetext and simply start typing. The text will appear in a commenting box. You may also cut-and-paste text fromanother file into the commenting box. Close the box by clicking on x in the top right-hand corner. It can bedeleted by right clicking (for the PC, ctrl-click on the Mac) on it and selecting Delete.

Replace text

Click the Text Edits button on the Commenting toolbar. To highlight the text to be replaced,click and drag the cursor over the text. Then simply type in the replacement text. The replacement text will appearin a commenting box. You may also cut-and-paste text from another file into this box. To replace formatted text(an equation for example) please Attach a file (see below).

Remove text

Click the Text Edits button on the Commenting toolbar. Click and drag over the text to bedeleted. Then press the delete button on your keyboard. The text to be deleted will then be struck through.


5/14

HIGHLIGHT TEXT / MAKE A COMMENT

Click on the Highlight button on the Commenting toolbar. Click and drag over the text. To make a comment,double click on the highlighted text and simply start typing.

ATTACH A FILE

Click on the Attach a File button on the Commenting toolbar. Click on the figure, table or formatted text to be replaced. A window will automatically open allowing you to attach the file. To make a comment, go to Generaland then Description in the Properties window. A graphic will appear indicating the insertion of a file.

LEAVE A NOTE / COMMENT

Click on the Note Tool button on the Commenting toolbar. Click to set the location of the note on thedocument and simply start typing. Do not use this feature to make text edits.

REVIEW

To review your changes, click on the Show button on the Commenting toolbar. Choose Show

Comments List. Navigate by clicking on a correction in the list. Alternatively, double click on any mark-up to openthe commenting box.

UNDO / DELETE CHANGE

To undo any changes made, use the right click button on your mouse (for PCs, Ctrl-Click for the Mac). Alternativelyclick on Edit in the main Adobe menu and then Undo. You can also delete edits using the right click (Ctrl-click onthe Mac) and selecting Delete.

SEND YOUR ANNOTATED PDF FILE BACK TO ELSEVIER

Save the annotations to your file and return as an e-mail attachment using the reply button to the original mail.Before returning, please ensure you have answered any questions raised on the Query form and that you have insertedall corrections: later inclusion of any subsequent corrections cannot be guaranteed.

Note: Comprehensive instructions are provided within your PDF file: to access these instructions please click on theComments and Markup menu in the main tool bar, or click on Help.

FURTHER POINTS

Any (grey) halftones (photographs, micrographs, etc.) are best viewed on screen, for which they are optimized,and your local printer may not be able to output the greys correctly.

If the PDF files contain colour images, and if you do have a local colour printer available, then it will be likelythat you will not be able to correctly reproduce the colours on it, as local variations can occur.

If you print the PDF file attached, and notice some non-standard output, please check if the problem is also present on screen. If the correct printer driver for your printer is not installed on your PC, the printed output will be distorted.


6/14

BNAME: AUTHOR QUERIES PAGE: 1 SESS: 3 OUTPUT: Mon Sep 27 13:24:26 2010praid3/url url/url url/url99908/url7340w08z

AQ1 Please give temperature meant for T in the phrase 10 seconds at TC.

AQ2 Graphic for figures 1-4 was supplied as poor quality. Okay as is or supply new figures.

AQ3 Author affiliations will appear differently in the print and online versions of your paper.The PDF shows how the affiliations will present following journal style, whereas thesearchable online version will present as follows in order to provide complete unabridgedaffiliations. Please check the accuracy of the affiliation(s) of each author and make changes asappropriate.a

Institute for Cell and Molecular Biosciences, Newcastle University, Newcastle upon Tyne,United Kingdom b Institute of Cellular Medicine, Newcastle University, Newcastle upon Tyne, United Kingdomc Department of Urology, Newcastle Upon Tyne Hospitals National Health Service FoundationTrust, Newcastle Upon Tyne, United Kingdom

AUTHOR QUERIES

AUTHOR PLEASE ANSWER ALL QUERIES


7/14

Basic and Translational Science

Tolerance of BacteruriaAfter Urinary Diversion Is Linked

to Antimicrobial Peptide ActivityClaire L. Townes, Ased Ali, Wendy Robson, Robert Pickard, and Judith HallOBJECTIVES To compare the cationic antimicrobial peptide gene expression proles and urinary cationic

antimicrobial activities of patients after urinary diversion according to the urinary tract infection(UTI) status. Ileal conduit urinary diversion joins the bacterial-tolerant ileal epithelium andintolerant urothelium. After this procedure, one quarter of patients develop repeated symptom-atic UTIs. Such development might reect the altered innate immune mechanisms centered onepithelial expression and urinary activity of cationic antimicrobial peptides, such as defensins.

METHODS Ileal and ureteral biopsy specimens from ileal conduit subjects with (n 18) and without (n18) recurrent symptomatic UTIs were assessed for cationic antimicrobial peptide gene expressionusing quantitative reverse transcriptase polymerase chain reaction. Overnight urine collectionswere analyzed for antimicrobial activity against a laboratory Escherichia coli strain, and infectingorganisms were isolated from individual subjects.

RESULTS Overall, the ureteral epithelium showed increased expression of human -defensin 5 anddecreased expression of the human -defensin 1 after urinary diversion ( P .05). No signicantchanges were seen for the ileal epithelium. The expression levels of both defensins also did notdiffer signicantly according to UTI status. Urinary cationic activity against infecting bacterialisolates from the individual subjects was signicantly greater in those with symptomatic UTI(P .001), and the activities against the laboratory E. coli strain were similar.

CONCLUSIONS The changes in the human -defensin 1 and human -defensin 5 expression proles and the linkbetween symptomatic infection and high urinary antimicrobial activity suggest that innatemechanisms play signicant roles in balancing bacterial tolerance and killing after ileal conduiturinary diversion. Future work needs to determine whether these changes can be therapeuticallymodulated to benet the patients. UROLOGY xx: xxx, xxxx. 2010 Published by Elsevier Inc.

I leal urinary conduit formation creates a functionalparadox in which enteric epithelium tolerant to com-mensal bacteria is joined to urothelium, which seeksto maintain a sterile environment. One consequence of this surgery is persistent bacteriuria, typically with Esch-erichia coli.1 For most patients, this infection is asymp-tomatic; however, approximately one quarter developrepeated symptomatic urinary tract infections (UTIs)that aff ect their well-being and require antibiotic treat-ment. 1 The reasons for the differing individual suscepti-bility to UTIs are unknown, but they might include

bacterial virulence, immune effectiveness, and adapta-tion of the conjoined epithelia. 2-4

Synthesis of cationic antimicrobial peptides (CAMPs)is a key element of epithelial protection. 5 In humans,these molecules function as a rst-line antimicrobial de-fense causing bacterial cell death by membrane disrup-tion and inactivation of intracellular targets. 6 CAMPs,particularly defensins, also enhance cytokine production

and chemotaxis of immune-competent cells, linking in-nate and adaptive responses and accelerating bacterialclearance. 7,8 Human -defensins, such as human de-fensin 1 (hBD-1) and -defensins, such as human -de-fensin 5 (HD-5) are constitutively expressed by entericepithelium, 9 where they maintain the epithelial barrierand regulate ileal microora. 10 In contrast, the urinarytract is normally kept sterile, despite frequent bacterialcontamination by bowel and genital ora from the peri-neum. Emerging evidence has suggested that CAMP ac-tivity helps maintain this state. 11,12 hBD-1 is expressedby renal tubular epithelium, 13 and HD-5 has been local-ized to the female genital tract 14 and male urethral se-

This study was supported by funding from the Newcastle Hospitals Healthcare Charityand the Urostomy Association, UK. A Ali was supported by a Wellcome Trust ClinicalTraining Fellowship.

From the Institute for Cell and Molecular Biosciences and Institute of CellularMedicine, Newcastle University, Newcastle upon Tyne, United Kingdom; and Depart-ment of Urology, Newcastle Upon Tyne Hospitals National Health Service FoundationTrust, Newcastle Upon Tyne, United Kingdom

Reprint requests: Judith Hall, B.Sc., Ph.D., Institute for Cell and MolecularBiosciences, Newcastle University Faculty of Medical Sciences, Framlington Place, Newcastle Upon Tyne NE2 4HH, UK. E-mail: [email protected]

Submitted: May 10, 2010, received (with revisions): August 14, 2010

2010 Published by Elsevier Inc. 0090-4295/xx/$34.00 1.e1doi:10.1016/j.urology.2010.08.019
mailto:[email protected]:[email protected]


8/14

cretions ,15 with evidence suggesting that both peptideshelp eradicate local infection. HD-5 has also previouslybeen detected in urine immedi ate ly after bladder recon-struction with bowel segments. 16

We hypothesized that the epithelial adaption balanc-ing innate CAMP activity might determine whether apatient develops symptomatic recurrent UTIs after diver-sion. To address this, we rst identied and measured theexpression proles of constitutive CAMPs in the ilealand ureteral epithelium and, second, compared the uri-nary cationic antimicrobial activity in patients with andwithout recurrent UTIs.

MATERIAL AND METHODS

Subject ProlesAfter ethical committee and institutional approval, 37 subjects(21 women and 16 men), who had undergone ileal conduiturinary diversion surgery at a median of 11 years previously,were recruited to the present study. Of the 37 patients, 3subsequently withdrew. Of the 34 patients completing the

study, 17 (median age 68 years, range 36-78) had had persistentasymptomatic UTIs and 17 (median age 63 years, range 36-79)had had recurrent symptomatic UTIs. Asymptomatic UTI wasdened as a pure growth of 2 uropathogens on 2 previousoccasions not accompanied by fever and symptomatic UTI wasdened as 2 previous episodes annually of a pure growth of 2uropathogens accompanied by fever 38C. None of the sub-jects had had clinical signs of UTI and were not taking antibi-otics at specimen collection. Microbiologic analysis of the urineobtained by aseptic catheterization of the conduit at recruit-ment showed that 5 of the asymptomatic subjects (29%) and 3of the symptomatic subjects (18%) had a pure culture of 2uropathogens ( 104 colony-forming units/mL), characterized

as either E. coli (n 6), non- E. coli coliforms (n 2), Proteussp. (n 2), or Enterococcus faecalis (n 4) by color differen-tiation on chromogenic agar and stored. The remaining 26subjects had a mixed bacterial population of 2 organisms( 103 to 104 colony-forming units/mL), which were notconsidered to represent active infection according to the Cen-ters for Disease Control and Prevention criteria.

Urine and Tissue SamplesMultiple supercial biopsy specimens of the ileal conduit anddistal ureter were obtained using exible endoscopy with thepatient under local anesthesia and stored in a preserving solu-tion (RNAlater, Ambion, Austin, TX). Overnight urine col-

lections ( 1 L) from each patient were stored at 80C untilprocessing. Biopsy segments were also taken from the distalureter and ileal segment at surgery from a separate group of 10subjects (women and 4 men) with median age of 70 years (range54-80) who had undergone cystectomy. The samples were fro-zen at 80C until analysis.

Reverse Transcriptase-Polymerase Chain ReactionRNA was extracted from homogenized tissues using Trizolreagent (Invitrogen, Paisley, UK). RNase inhibitor (Promega,Southampton, UK) was added to each sample (1 U/ g of RNA)before storage at 80C. Reverse transcriptase-polymerasechain reaction (PCR) of DNase-treated samples was performedas previously described. 17 The products were resolved by elec-

trophoresis and veried by DNA sequencing. Controls withoutreverse transcriptase excluded genomic DNA contamination.

Quantitative Real-Time PCRFor hBD-1 gene quantication, a PCR mix of 1- L primer-probe mix at a nal concentration of 1 M, 5 L of Lightcycler480 probes master mix (Roche, Welwyn Garden City, UK), and2.5 L of reverse transcriptase was used. For HD-5, 5 L of Sybrgreen master mix (Roche) was used. The primers and annealing

temperatures were as follows: HBD-1, F: GTCAGCTCAGC-CTCCAAAGGA, and R: CGCCGGTAGGAAGTTCT-CATGGCG at 60C; and HD-5, F: GCCATCCTTGCTGC-CATTC, and R: GATTTCACACACCCCGGAGA at 55C.The amplication conditions included a preincubation step of 2minutes at 50C, 2 minutes at 95C, and 45 cycles of 5 secondsat 94C, 10 seconds at TC, and 10 seconds at 72C. Thetranscripts were quantied relative to a standard curve derivedfrom dilutions of a cloned gene copy. The reactions wereperformed in 96-well plates using Lightcycler 480 (Roche). Negative controls without reverse transcriptase excluded DNAcontamination. The data were normalized to 18S ribosomalRNA internal control, and all analyses were performed withoutknowledge of the patients identity.

ImmunocytochemistryThe ureter and ileum specimens were stored embedded inparafn. Cut sections (4 m) were mounted on SuperFrost Plusmicroscope slides (VWR International, Lutterworth, UK) andallowed to dry at 56C. The sections were dewaxed in xylene,rehydrated, and incubated for 10 minutes in 0.5% hydrogenperoxide. Blocking with goat serum diluted 1:5 with phosphate-buffered saline (PBS) for 10 minutes preceded overnight incu-bation with anti-HD-5 at a dilution of 1:1000 (ileum) or 1:500(ureter) or anti-hBD-1 at a dilution of 1:500 at 4C (Abcam,Cambridge, UK). Primary antibody binding was detected using

biotinylated goat anti-mouse antibody (Dako, Cambridge, UK)and visualized using diaminobenzidine. The slides were washedusing Tris-buffered saline at pH 7.6 between each step.

Urine Antimicrobial ActivityPatient urine samples from the overnight collection werethawed, centrifuged at 7500 g for 10 minutes at 4C to removemucus and cellular debris, and ltered using a 0.2- m vacuumltration system (VWR International). CAMPs were extractedfrom 1 L of the ltered urine sample using C18 chromatographycolumns (Thames Restek, Saunderton, UK) and 10% acetonitrilein 0.15% triuoracetic acid buffer. The elutants were lyophilizedunder nitrogen at 55C and resuspended in 200 L of PBS.

Time-Kill Antimicrobial AssaysThe time-kill assay method, using the laboratory uropathogenicE. coli (UPEC) strain NCTC10418 and clinical isolates fromthe urine specimens taken from individual subjects at recruit-ment, was adapted from a previous study. 17 A 20- L aliquot of each culture was diluted to 2 mL in PBS. Samples (10 L) of subjects urine extract or PBS were added to 90 L of thisdiluted culture, vortexed, and incubated for 3 hours at 37C.The suspensions were sequentially diluted to 10 4 in PBS, andeach dilution was plated onto LB agar. All plates were incu-bated overnight at 37C and the colonies counted. Controlexperiments with PBS substituted for urine extract were used tostandardize the bacterial numbers between the assays. The results

1.e2 UROLOGY xx (x), xxxx

AQ: 1

4

67


9/14

were normalized to the respective subjects urinary creatinine con-centration. All urinary antimicrobial activity determinations wereconducted without knowledge of the patients identity.

Bacterial Invasion FrequencyThe bladder epithelial cell line RT4 18 was maintained in cellculture medium comprising Roswell Park Memorial Institute1640 medium (HEPES modication), 2 mM glutamine, and10% fetal calf serum (Sigma, Poole, UK). For the bacterialchallenge experiments, RT4 cells were seeded onto 30-mmdiameter, 6-well plates at a density of 10 4 cells/well, and cul-tured in 2 mL medium at 37C and 5% carbon dioxide untilconuent. Before the challenge, the cells were washed in PBSand incubated in 1 mL of medium for 1 hour at 37C with 5%carbon dioxide. Bacterial cells were harvested from an over-night culture, washed, and resuspended in PBS to 10 4 colony-forming units/mL. Each well of RT4 cells was inoculated with100- L bacteria, the plates centrifuged for 2 minutes at 250 g and incubated at 37C and 5% carbon dioxide for 90 minutes.After washing with PBS, the cells were incubated for another90 minutes in 1 mL of medium containing 200 g/mL genta-micin, washed, and lysed using 0.1% Triton. Recovered intra-cellular bacteria were serially diluted onto LB agar plates andincubated overnight at 37C, and the colonies were counted.The invasion frequency was calculated by the total output fromthe cells divided by the total input and multiplied by 100.

Hemolysis AssayBacterial strains were cultured from glycerol stocks, streakedonto LB agar plates containing 5% debrinated horse blood(Oxoid, Basingstoke, UK), and incubated overnight at 37C.Hemolysis was dened by the presence of a clear halo surround-ing individual colonies.

Statistical AnalysisThe comparative data were not normally distributed, and thestatistical analyses were performed using the Kruskal-Wallis testfollowed by Dunns comparison. A difference with a P valueof .05 was considered statistically signicant, and values areexpressed as the median and interquartile range (IQR).

RESULTS

Identication of ConstitutiveCAMPs Expressed in Both Ureter and IleumThe paired ureter and ileal samples obtained from 4patients at urinary diversion were screened for CAMPgene expression using reverse transcriptase PCR. Thecandidate genes were human cathelicidin (hCAP-18/LL-37), hepcidin (LEAP-1), liver expressed antimicrobialpeptide 2 (LEAP-2), hBD-1 and hBD-2, and HD-5.hBD-1 and HD-5 were constitutively expressed in theileum and ureter from all 4 patients and selected for

Figure 1. Ureteral and ileal CAMP gene expression and immunohistochemical localization. Endpoint PCR gene expressionproles obtained in paired samples of ureter and ileum from 4 patients. Expression panel consisted of marker (M),

cathelicidin (LL-37; hCAP-18), hepcidin (Hep; LEAP-1), liver expressed antimicrobial peptide-2 (LP-2; LEAP-2), human-defensin 1 (BD1), human -defensin 2 (BD2), human -defensin 5 (HD5), and 18S ribosomal RNA internal control (18S)and presented in (A) ileum and (B) ureter. Primers and annealing temperatures used were LL37, F: 5 = CATGAAGACCCAAAGG-GATG3= , R: 5 = CACACTAGGACTCTGTCCTG3= (55C); Hep, F: GTCACCAGTGGCTCTGTTTTC, R: GTCTTGCAGCACATCCCACAC(58C); LP-2, F: CAAGATGTGTGGCACCTCAAAC, R: GCATTGTCGGAGGTGACTG (58C); BD1, F: CCATGAGAACTTCCTACCTTC, R:GTCACTCCCAGCTCACTTG (58C); BD2, F: GTGAAGCTCCCAGCCATCAG, R: GATTGCGTATCTTTGGACACC (58C); HD5, F:GCCATCCTTGCTGCCATTC, R: GATTTCACACACCCCGGAGA (58C). (C) Table showing number of ileal and ureteral samples inwhich expression of each gene was detected. (D-F) Immunohistochemical image of ileal and ureter mucosa. (Di) Localiza-tion of human -defensin 5 (HD-5; 1:1000) to ileal crypt Paneth cells; (Dii) no primary antibody control seen. (Ei) Localizationof HD-5 (1:500) to ureteral epithelial cells; (Eii) no primary antibody control seen. (Fi) Localization of hBD-1 (1:500) toureteral epithelium cells; (Fii) no primary antibody control seen. All images at 400 magnication.

UROLOGY xx (x), xxxx 1.e3

2

4

67

4

67

4

67

4

67

4

67

4


10/14

additional study ( Fig. 1A-C). The expected presence of hBD-1 within the ureteral epithelium and HD-5 in theintestinal crypts of Lieberkhn was conrmed using im-munocytochemistry. Identication of HD-5 gene expres-sion in the ureteral epithelium was novel, and immuno-histochemistry showed that the peptide was localized inthe supercial layers of the urothelium ( Fig. 1D-F).

Changes in HD-5 and hBD-1Expression After Urinary DiversionExpression of HD-5 and hBD-1 was measured by quan-titative real-time PCR in the ileal conduit and ureteralbiopsy specimens from the 34 patients who had under-gone urinary diversion and compared with control tissueobtained from the 10 patients just before diversion. Themedian HD-5 gene expression in the ileal epithelium didnot change signicantly after diversion (median 4.2 AU,IQR 0.9-11.8, n 9; vs median 6.9 AU, IQR 0.1-33.7,n 30; P NS). In contrast, ureteral HD-5 gene expres-sion was signicantly increased after urinary diversion (me-dian 0 AU, IQR 0-0.4, n 9; vs median 5.7 AU, IQR1.1-65.9, n 29; P .05; Fig. 2A). For hBD-1, again, nosignicant change was found in ileal expression afterurinary diversion (median 0.9, IQR 0.1-2.0, n 10; vsmedian 2.7 AU, IQR 0.6-26.5, n 27; P NS); how-ever, the expression had decreased signicantly in the ure-teral epithelium (median 4.4 AU, IQR 1.0-48.1, n 9; vsmedian 0.1 AU, IQR 0.03-1.8, n 27; P .05; Fig. 2B).The individual gene expression data showed marked vari-

ability, and we excluded the outlying data values (n 0-6)from the statistical analyses.

Differences in Expression of HD-5 and

hBD-1 According to UTI Status and GenderWe next compared the HD-5 and hBD-1 expression inthe ileal and ureteral tissue from the 34 subjects with anexisting urinary diversion according to whether they hadhad recurrent symptomatic UTIs. The expression of bothgenes showed high interindividual variability, and, althoughtrends toward greater expression of HD-5 were seen in bothtissues for those subjects with UTIs, the changes did notreach statistical signicance ( Fig. 3A,B). Regarding the gen-der differences, a trend toward greater ileal and ureteralHD-5 expression in the women was observed but, again, didnot reach statistical signicance ( Fig. 3C,D).

Differences in UrinaryAntimicrobial Activity With UTI StatusThe urinary cationic antimicrobial activity of the pa-tients with and without a history of recurrent symptom-atic UTIs was initially investigated using a time-killassay and the laboratory uropathogenic E. coli strain NCTC10418, but no clear difference was found ( Fig.4A). We next measured the urinary antimicrobial activ-ity in those subjects with pure growth isolates at urinesampling against their respective infecting organisms.Virulence testing of the 6 clinical E. coli isolates showedthat those isolated from the subjects with symptomatic

Figure 2. Differences in expression of HD-5 and hBD-1 before and after urinary diversion. Quantication of HD-5 and hBD-1gene expression in samples of ileum and ureteral tissue obtained from separate groups of subjects recruited before andafter ileal conduit urinary diversion. (A) Expression of HD-5. (B) Expression of hBD-1. Vertical axes broken to accommodateoutlying data points. Respective summary statistics used for nonparametric testing tabulated below each graph, *Statis-tically signicant ( P .05).


F1

F2

F3

F4

67

4

67

4

67

4

67

4

67

4

67


11/14

UTIs (n 2) had greater invasion frequency and hemo-lysis activity than those isolated from asymptomatic pa-tients (n 4; Fig. 4B). The individual urinary CAMPactivity against the paired bacterial isolate ( Fig. 4C)was signicantly greater in the samples from the symp-tomatic group than in to the urine samples fromasymptomatic patients (15.0% 5.3% vs 81.4%

4.0% bacterial survival; P .001). The urine samplesfrom the subgroup of patients with a history of symp-tomatic UTIs and a current pure isolate also showedgreater activity against the UPEC NCTC10418 strainthan the urine samples from those with a history of asymptomatic UTIs (12.8% 6.5% vs 70.2% 8.1%bacterial survival; P .05; Fig. 4D).

Figure 3. Differences in expression of HD-5 and hBD-1 according to UTI status and gender in subjects with existing urinary diversion. (A,B) HD-5 and hBD-1 gene expression according to UTI status (recurrent symptomatic UTI vs asymptomaticbacteriuria). (C,D) HD-5 and hBD-1 gene expression according to gender. Respective summary statistics used for nonpara-metric testing tabulated below each graph. Vertical axes broken to accommodate outlying data points.


4

67

4

67

4

67

4

67

4

67

4

67


12/14

COMMENTIncreasing evidence has indicated that innate immunitycentered on cationic peptides is important as the initialdefense against infection in humans; however, the clin-ical correlates concerning UTI are lacking. 12 The aim of the present study was to investigate whether differencesin CAMP gene expression and urine cationic antimicro-bial activity are associated with susceptibility to symp-tomatic UTI after ileal conduit urinary diversion. Wefound signicant upregulation of HD-5 and downregula-tion of hBD-1 in ureteral epithelium after anastomosis tothe ileal segment. Markedly increased antimicrobial activ-ity was present against the infecting organisms in the urinesamples from those with a history of symptomatic UTIscompared with those with asymptomatic bacteriuria. Takentogether, these ndings suggest a more aggressive innateimmune response is linked to symptomatic UTI.

Reverse transcriptase PCR expression screening usinghealthy tissue samples obtained just before diversionshowed hBD-1 was constitutively expressed by both ure-teral and ileal epithelium, in line with previous re-ports. 13,19,20 Localization of HD-5 to the ileal crypts of Lieberkhn has also been previously well established;however, our nding of consistent gene expression inureteral tissue and localization to the supercial urothe-lium is novel and suggests a possible antimicrobial role forthis peptide in the urinary tract to add to those proposedin the vagina and male urethra. 14,15 We did not explorefurther other candidate CAMPs, given their inconsistentexpression; however, it is possible that some, particularly

hBD-2, might be induced by active infection and con-tribute to defense. 21

The increased ureteral HD-5 expression after reroutinginto an ileal conduit is intriguing, and additional study isrequired to identify the triggering factors. Previous his-tologic studies have not suggested any structural changesto the urothelium, 4 and although changes to urinarysolutes have been shown to alter CAMP activity, 22 noevidence of any effect on gene expression is available.Moreover, our clinical data showed little variation in theelectrolyte concentration or pH and no correlation of these physical characteristics with HD-5 expression (datanot shown). Concerning the hormonal inuences, ananalysis of our quantitative expression data suggested atrend toward greater HD-5 expression in women with uri-nary diversion compared with men. Hormonal changeshave previously been implicated in the variation of HD-5expression in the female genital tract 14 ; however, theprecise mechanism is unknown and perhaps had a lowerinuence in our predominantly postmenopausal patientgroup. The signicance of bacterial colonization andHD-5 gene expression remains unclear. Although notobserved in the gut, HD-5 upregulation has been docu-mented in women presenting with genital tract inam-mation, 14 and HD-5 peptide concentrations have beenelevated in the v aginal secretions from women withbacterial vaginosis, 23 supporting a role for bacteria ininuencing HD-5 gene expression. Recent evidence hasimplicated the Wnt signaling pathway in the control of ileal HD-5 expression, 24 and it is possible that increasedureteral Wnt activity related to greater epithelial turn-

Figure 4. Cationic antimicrobial activity of urine extracts. (A) UPEC survival according to patient infection history. (B)Invasion and hemolytic properties of E. coli isolates puried from asymptomatic (patients 1 and 4-6) and symptomatic(patients 2 and 3) patients. (C) Clinical isolate and (D) NCTC10418 survival after incubation with urine cationic peptideextract from respective subjects with existing urinary diversion.


4

67

4

67

4

67

4

67

4

67

4

67


13/14

over is involved in the changes to urinary tract HD-5expression identied by the present study.

The changes in hBD-1 expression were more complex,with a nonsignicant increase in the ileum and signi-cant downregulation in the ureter. hBD-1 expression hasbeen tho ught to be exclusively constitutive in manyepitheli a,25,26 although modest induction was seen ingastritis27 and in colonic epithelial cells challenged withlive bacteria. 28 In the urinary tract, increased hBD-1expression and secretion has been report ed in response toeither infection 29 or cytokine challenge 30 ; thus, the im-munologic advantage of reduced hBD-1 levels requiresexplanation. We can only speculate that in transposedtissues, the modications in hBD-1 and HD-5 expressionfunction to encourage bacterial tolerance in the sterileureteral epithelium and, in contrast, provide increasedsurveillance in the more distal ileal mucosa, discouragingbacterial overgrowth.

A comparison of urinary cationic antimicrobial activ-ity between the subjects with a history of symptomaticUTI and those with asymptomatic bacteriuria against astandard laboratory UPEC strain showed no clear differ-ence, probably reecting our sampling protocol, withurine collected from subjects in different phases of theinfection cycle. This was supported by the results frompatients with clearly identiable infecting organisms. Inthe subjects whose epithelia were exposed to a specicbacterial challenge at urine sampling, a strong link wasfound among a history of symptomatic infection, highurinary antimicrobial activity, and bacterial virulence.The urine samples from symptomatic subjects showedefcient killing of both the specic infecting organismsand the laboratory UPEC strain, and the urinary cationicantimicrobial activity was limited in subjects with asymp-tomatic bacteriuria. For this initial study, we chose not tofurther characterize the urine that showed a mixed bac-terial population. It would be useful in the future toperform a more in-depth microbiologic study to separatetrue colonizers from transient contaminants in such cul-tures and then to test their individual sensitivity toendogenous CAMP activity.

CONCLUSIONSTo explain our ndings, we propose that in the asymp-tomatic group, the ureteral urothelium adapted to a bac-teria-tolerant phenotype, typical of the ileum, after urinarydiversion, and thereby allowing bacterial colonization.Those with recurrent symptomatic UTIs retained an ag-gressive antimicrobial response typical of the normalurinary tract and associated with the development of virulence factors by the invading bacteria. This responseis highly efcient in terms of clearing the offendingorganisms but leads to typical systemic infective symp-toms. The trend toward greater ileal and ureteral HD-5expression in subjects with symptomatic UTI is support-ive of a novel role of this peptide in modulating thisresponse. Additional work will require comparative anal-ysis of the HD-5 urinary content on a longitudinal basis

to relate the levels to the phase of infection and to denethe potential therapeutic use in controlling such infec-tions.

Acknowledgment. To John Perry, Freeman Hospital, New-castle Upon Tyne, UK, who provided the clinical isolates; Natasha Rigas, who provided the RT-4 cells; and KieranOToole, Northern Institute Cancer Research, who performedthe immunocytochemistry.

References

1. Madersbacher S, Schmidt J, Eberle JM, et al. Long-term outcome of ileal conduit diversion. J Urol. 2003;169:985-990.

2. Deane AM, Woodhouse CR, Parkinson MC. Histological changesin ileal conduits. J Urol. 1984;132:1108-1111.

3. Keegan SJ, Graham C, Neal DE, et al. Characterization of Esche-richia coli strains causing urinary tract infections in patients withtransposed intestinal segments. J Urol. 2003;169:2382-2387.

4. Wullt B, Bergsten G, Carstensen J, et al. Mucosal host responses tobacteriuria in colonic and ileal neobladders. Eur Urol. 2006;50:1065-1072.

5. Zasloff M. Antimicrobial peptides of multicellular organisms. Na-ture. 2002;415:389-395.

6. Brogden KA. Antimicrobial peptides: pore formers or metabolicinhibitors in bacteria? Nat Rev Microbiol. 2005;3:238-250.

7. Brown KL, Hancock RE. Cationic host defense (antimicrobial)peptides. Curr Opin Immunol. 2006;18:24-30.

8. Nijnik A, Hancock RE. The roles of cathelicidin LL-37 in immunedefences and novel clinical applications. Curr Opin Hematol. 2009;16:41-47.

9. Bevins CL, Martin-Porter E, Ganz T. Defensins and innate hostdefence of the gastrointestinal tract. Gut. 1999;45:911-915.

10. Wehkamp J, Salzman NH, Porter E, et al. Reduced Paneth cellalpha-defensins in ileal Crohns disease. Proc Natl Acad Sci USA.2005;102:18129-18134.

11. Ali AS, Townes CL, Hall J, Pickard RS. Maintaining a sterile urinarytract: the role of antimicrobial peptides. J Urol. 2009;182:21-28.

12. Zasloff M. Antimicrobial peptides, innate immunity, and the nor-mally sterile urinary tract. J Am Soc Nephrol. 2007;18:2810-2816.

13. Valore EV, Park CH, Quayle AJ, et al. Human beta-defensin-1: anantimicrobial peptide of urogenital tissues. J Clin Invest. 1998;101:1633-1642.

14. Quayle AJ, Porter EM, Nussbaum AA, et al. Gene expression,immunolocalization, and secretion of human defensin-5 in humanfemale reproductive tract. Am J Pathol. 1998;152:1247-1258.

15. Porter E, Yang H, Yavagal S, et al. Distinct defensin proles in Neisseria gonorrhoeae and Chlamydia trachomatis urethritis revealnovel epithelial cell-neutrophil interactions. Infect Immun. 2005;73:4823-4833.

16. Porter EM, Poles MA, Lee JS, et al. Isolation of human intestinaldefensins from ileal neobladder urine. FEBS Lett. 1998;434:272-276.

17. Townes CL, Michailidis G, Nile CJ, et al. Induction of cationicchicken liver-expressed antimicrobial peptide 2 in response toSalmonella enterica infection. Infect Immun. 2004;72:6987-6993.

18. Masters JR, Hepburn PJ, Walker L, et al. Tissue culture model of transitional cell carcinoma: characterization of twenty-two humanurothelial cell lines. Cancer Res. 1986;46:3630-3636.

19. ONeil DA, Porter EM, Elewaut D, et al. Expression and regulationof the human beta-defensins hBD-1 and hBD-2 in intestinal epi-thelium. J Immunol. 1999;163:6718-6724.

20. Schnapp D, Reid CJ, Harris A. Localization of expression of humanbeta defensin-1 in the pancreas and kidney. J Pathol. 1998;186:99-103.

21. Taylor K, Barran PE, Dorin JR. Structure-activity relationships inbeta-defensin peptides. Biopolymers. 2008;90:1-7.

22. Porter EM, van Dam E, Valore EV, et al. Broad-spectrum antimi-crobial activity of human intestinal defensin. 5. Infect Immun.1997;65:2396-2401.


4

67

4

67

4

67

4

67

4

67

4

6


14/14

23. Fan SR, Liu XP, Liao QP. Human defensins and cytokines invaginal lavage uid of women with bacterial vaginosis. Int J GynecolObstet. 2008;103:50-54.

24. Wehkamp J, Wang G, Kubler I, et al. The Paneth cell: alpha-defensin deciency of ileal Crohns disease is linked to Wnt/Tcf-4. J Immunol. 2007;179:3109-3118.

25. Ramasundara M, Leach ST, Lemberg DA, et al. Defensins andinammation: the role of defensins in inammatory bowel disease. J Gastroenterol Hepatol. 2009;24:202-208.

26. Zhao C, Wang I, Lehrer RI. Widespread expression of beta-defen-

sin hBD-1 in human secretory glands and epithelial cells. FEBSLett. 1996;396:319-322.

27. Bajaj-Elliott M, Fedeli P, Smith GV, et al. Modulation of hostantimicrobial peptide (beta-defensins 1 and 2) expression duringgastritis. Gut. 2002;51:356-361.

28. Ou G, Baranov V, Lundmark E, et al.Contributionof intestinal epithelialcells to innate immunity of the human gutstudies on polarized mono-layers of colon carcinoma cells. Scand J Immunol. 2009;69:150-161.

29. Hiratsuka T, Nakazato M, Ihi T, et al. Structural analysis of humanbeta-defensin-1 and its signicance in urinary tract infection. Nephron. 2000;85:34-40.

30. Lehmann J, Retz M, Harder J, et al. Expression of human beta-

defensins 1 and 2 in kidneys with chronic bacterial infection. BMCInfect Dis. 2002;2:20.


070809101112131415161718192021222324252627282930313233343536373839

40414243444546474849505152535455565758596061626364

404040414141414141414141414242424242424242424243434343434343434343

44444444444444444444454545454545454545454646464646