title page differential regulation of hepatic oct1...

JPET #205369

1

TITLE PAGE

Differential Regulation of Hepatic Oct1, Oatp1a4, Bsep, and Mrp2 Transporter Expression in

Lymphocyte-deficient Mice Associates with IL-6 Production

Connor E. Bodeman, Anika L. Dzierlenga, Catherine M. Tally, Ryan M. Mulligan, April D. Lake,

Nathan J. Cherrington, and Susan C. McKarns

University of Missouri School of Medicine, Center for Cellular and Molecular Immunology,

Department of Surgery, Columbia, MO 65212 (RMM, CMT, CEB, SCM)

University of Missouri School of Medicine, Department of Microbiology and Immunology,

Columbia, MO 65212 (SCM)

University of Arizona, Department of Pharmacology and Toxicology, Tucson, Arizona 85721

(ALD, ADL, NJC)

JPET Fast Forward. Published on August 8, 2013 as DOI:10.1124/jpet.113.205369

Copyright 2013 by the American Society for Pharmacology and Experimental Therapeutics.

This article has not been copyedited and formatted. The final version may differ from this version.JPET Fast Forward. Published on August 8, 2013 as DOI: 10.1124/jpet.113.205369

at ASPE

T Journals on June 26, 2018

jpet.aspetjournals.orgD

ownloaded from

http://jpet.aspetjournals.org/

JPET #205369

2

RUNNING TITLE PAGE

Running Title: Lymphocytes on hepatic cytokines and transporters

Address correspondence and reprint requests to Susan C. McKarns, University of Missouri

School of Medicine, Department of Surgery, M616 Medical Sciences Building, Columbia, MO

65212. 573-884-1722 (office), 573-882-4287 (fax) E-mail address:

[email protected]

No. of text pages: 29

No. of tables: 2

No. of figures: 5

No. of references: 54

No. of words in the Abstract: 248

No. of words in the Introduction: 749

No. of words in the Discussion: 1475

Abbreviations: ANOVA, analyses of variance; BA, bile acid; bDNA, branched DNA; bili, bilirubin;

BS, bile salt; Bsep, bile-salt export pump; BW, body weight; CAR, constitutive androstane

receptor; cMoat, canalicular multispecific organic anion transporter; CTL, cytotoxic T

lymphocytes; DAMPs, danger-associated molecular patterns; FoxP3, forkhead box P3; FXR,

farnesoid X receptor; GR, glucocorticoid receptor; GSH, glutathione; HNFα , hepatocyte nuclear

factor alpha; IFN-, interferon gamma; IL, interleukin; KO, knockout; LPS, lipopolysaccharide;


at ASPE



ownloaded from

mailto:[email protected]


JPET #205369

3

Mrp, multidrug resistance-associated protein; MU, University of Missouri; Na, sodium; NF-B,

nuclear factor of the B enhancer; NK, natural killer; NKT, natural killer T; Ntcp, Na+-

taurocholate cotransporting polypeptide; OA, organic anion; Oatp, organic anion-transporting

polypeptide; OC, organic cation; Oct, organic cation transporter; PAMPs, pathogen-associated

molecular patterns; PB, phenobarbital; PFIC-2, progressive familial intrahepatic cholestasis 2;

PPARα, peroxisome proliferator-activated receptor alpha; PXR, pregnane X receptor; Rag,

recombination-activating gene; RARα, retinoic acid receptor alpha; RLU, relative light unit; RXR,

retinoid X receptor; SHP, short heterodimer partner; SPGP, sister of P-glycoprotein; TCR, T cell

receptor; Tg, transgenic; TH, T helper; TLR, toll like receptor; TNF-α, tumor necrosis factor-alpha;

Tregs, T regulatory cells; VDR, vitamin D receptor; WT, wild-type

Recommended section assignment: Gastrointestional, Hepatic, Pulmonary, and Renal


at ASPE



ownloaded from


JPET #205369

4

ABSTRACT

Cholestasis results from interrupted bile flow and associates with immune-mediated liver

diseases. It is unclear how inflammation contributes to cholestasis. The aim of this study was

to determine whether T and B cells contribute to hepatic transporter expression under basal

and inflammatory conditions. C57BL/6J wild-type (WT) mice or strains lacking T, B, or both T

and B cells were exposed to lipopolysaccharide (LPS) or saline, and the livers were collected 16

h later. Branched DNA signal amplification was used to assess mRNA levels of organic anion-

transporting polypeptides (Oatp) 1a1, 1a4, and 1b2, organic cation transporter (Oct) 1,

canalicular bile salt export pump (Bsep), multidrug resistance-associated proteins (Mrp) 2 and

3, and the sodium-taurocholate co-transporting polypeptide (Ntcp). Real-time polymerase

chain reaction analyses was used to correlate changes of transporter expression with

interleukin (IL)-1b, IL-6, IL-17A, IL-17F, tumor necrosis factor (TNF)-and interferon (IFN)-

expression in the liver. LPS treatment inhibited Bsep and Oct1 mRNA expression, and this was

abrogated with a loss of T cells but not B cells. In addition, the absence of T cells increased

Mrp2 mRNA expression; whereas, B cell deficiency attenuated Oap1a4 mRNA in LPS treated

mice. Oatp1a1, Oatp1b2, Ntcp, and Mrp3 were largely unaffected by T or B cell deficiency.

Lymphocyte deficiency altered basal and inflammatory IL-6, but not TNF- or IL-1b, mRNA

expression. Taken together, these data implicate lymphocytes as regulators of basal and

inflammatory hepatic transporter expression and suggest that IL-6 signaling may play a critical

role.


at ASPE



ownloaded from


JPET #205369

5

INTRODUCTION

The liver is a critical immunological and metabolic organ and is strategically positioned to

receive blood that is rich in bacterial and food-derived antigens from the gut via the portal vein.

Immune-mediated liver diseases are usually progressive and associate with significant

morbidity and mortality. Cholestasis can result from either a functional defect in bile formation

or from interrupted bile flow and is commonly associated with human liver diseases (Hirschfield

and Heathcote, 2009; Hirschfield et al., 2010). Genetic and environmental factors, including

infections and xenobiotics, can contribute to cholestasis. A major consequence of acute

cholestasis is the development of severe liver injury. Hepatocyte and cholangiocyte

proliferation that occurs in response to injury, in turn, leads to periductular fibrosis, biliary

fibrosis, and cirrhosis (Hirschfield et al., 2010). The mechanisms by which inflammation

contribute to the pathophysiology of cholestasis-mediated liver injury remain unclear.

Bile acids are synthesized in the liver from cholesterol, secreted into the bile, and are actively

transported to the gut and then back to the liver via enterohepatic circulation. Enterohepatic

bile flow is essential for the emulsification of dietary fat, fat soluble vitamin absorption, and

elimination of toxic compounds and is regulated through a coordinated hepatobiliary sinusoidal

(basolateral) and canalicular (apical) transport system (Merritt and Donaldson, 2009). Organic

cation transporter (Oct)1 is the major hepatic uptake transporter for small cations

ncreased expression of Mrp) provides and i multidrug resistance-associated protein ( 3

an alternative route for efflux during periods of bile acid and/or xenobiotic overload At the .

hepatic canalicular membrane, the ATP-dependent bile salt export pump (Bsep) and Mrp2

function as the primary hepatic bile acid exporters, reviewed in (Klaassen and Aleksunes, 2010).


at ASPE



ownloaded from


JPET #205369

6

In concert, the sodium-taurocholate co-transporting polypeptide (Ntcp) is the predominant

mechanism of bile acid uptake at the sinusoidal membrane. The organic anion (OA)

transporting polypeptides (Oatp) 1a1, 1a4, and 1b2 transport conjugated bile acids, organic

acids, and xenobiotics. Disruption of transporter function results in cholestasis (Ricciardi et al.,

2001).

Lipopolysaccharide (LPS) is a common cause of inflammation–induced cholestasis in humans

and is widely used in experimental animal models to initiate cholestasis, presumably by

increasing synthesis of cytokines such as tumor necrosis factor-alpha (TNF-α), interleukin (IL)-6,

and IL-1b in response to toll-like receptor (TLR) 4-dependent nuclear factor of the B enhancer

(NF-B) activation in Kupffer cells. This model predicts that pro-inflammatory cytokines, in turn,

signal through their respective membrane receptors to suppress transporter expression and

function (Geier et al., 2006; Lickteig et al., 2007; Mulder et al., 2009). While the underlying

mechanisms remain unclear, LPS-induced alteration of transporter function appears to be

immune-mediated and the direct cause of cholestasis. Thus, LPS-induced cholestasis provides a

valuable experimental tool to study mechanisms of hepatic transporter regulation directly,

rather than secondarily in response to the accumulation of bile constituents resulting from

biliary obstruction.

The liver receives approximately 70% of its blood supply from the intestine through the portal

circulation and is thus exposed to potential gut-derived immune modulators including bile acids

and bacteria. Accordingly, the liver is selectively enriched in a large number of innate and

adaptive immune cells for protection against harmful pathogens and autoreactive self-antigens


at ASPE



ownloaded from


JPET #205369

7

from foodstuffs and commensal l bacteria. Lymphocyte subpopulations in normal human livers

are comprised of approximately 35% T cells, 30% natural killer (NK) T cells, 20% NK cells, and

10% B cells (Dong et al., 2007). TLRs are widely expressed by immune cells, including

conventional CD4+ T helper cells, cytotoxic T lymphocytes, B cells, natural forkhead box P3

(FoxP3)+ regulatory T cells, and NKT cells. This enables responsiveness to microbes through

pathogen-associated molecular patterns (PAMPs) or cell injury via danger-associated molecular

patterns (DAMPs) for cytokine production during LPS-induced cholestasis. Substantial evidence

has recently implicated that TLR4 signaling contributes to the activation of T cells, B cells, and

NKT cells (Kim et al., 2012; Pone et al., 2010; Reynolds et al., 2012). Importantly, while some

cytokines, e.g., TNF- and IL-1b are thought to be pro-inflammatory and detrimental, others

including IL-6 are also anti-inflammatory and suppress liver injury (Sun et al., 2004). The

objective of this study was to test the hypothesis that lymphocytes contribute to the expression

of hepatic transporter expression under basal and acute inflammatory conditions.

METHODS

Animal Models

Male adult C57BL/6J wild type (WT) and homozygous T cell-deficient B6.129S2-Tcratm1Mom

(TCRα KO), B cell-deficient B6.129S2-Ighmtm1Cgn (µMT), and T and B cell-deficient B6.129S7-

Rag1tm1Mom (Rag1 KO) mice (8-10 weeks of age) were purchased from The Jackson Laboratory

(Bar Harbor, ME). B10.A 5C.C7 T cell receptor (TCR) transgenic (Tg) Rag2 KO mice (Seder et al.,

1992) were obtained from the National Institute of Allergy and Infectious Diseases (NIAID)

contract facility (Taconic Farms, Germantown, NY). All mice were acclimated to the housing

conditions for at least 14 days prior to use. Groups for LPS-induced cholestasis studies were


at ASPE



ownloaded from


JPET #205369

8

designated WT (n = 6), TCRα KO (n = 6), µMT (n = 6), and Rag1 KO (n = 6). Groups for sex-

preference expression studies were designated C57BL/6J (n = 3) and B10.A TCR Rag2 KO (n = 3).

All mice were maintained in 12 h light/dark cycles and allowed water and standard chow ad

libitum. All animals were used according to the guidelines of the University of Missouri Animal

Care and Use Committee and in accordance with the U.S. National Institutes of Health and the

American Association for Laboratory Animal Care International.

LPS Model of Cholestasis

Four groups (WT, TCRα KO, µMT, and Rag1 KO) of adult (8-10 weeks old) age-matched male

mice (22–31 g) underwent treatment. LPS (4 mg/kg in a volume of 5 l/g) or sterile saline

vehicle was administered to mice by i.p. injection. Livers were excised 16 h after LPS

administration, snap-frozen in liquid nitrogen, and stored at -80oC until RNA isolation. Mice

were maintained under specific pathogen-free conditions in University of Missouri (MU) animal

facilities that are accredited by the Association for Assessment and Accreditation of Laboratory

Animal Care International. All protocols were approved by the MU Animal Care and Use

Committee. Mice were monitored for signs of distress during the study (abdominal distention,

respiratory difficulty).

Chemicals

LPS (from Escherichia coli serotype 055:B5) and all other chemicals, unless otherwise indicated,

were purchased from Sigma-Aldrich (St. Louis, MO). 1 mg LPS was added to 0.5 ml sterile saline

to create stock solutions and frozen (-20oC) prior to use.

RNA Preparations


at ASPE



ownloaded from


JPET #205369

9

Total RNA was isolated from mouse liver using RNAzol B reagent (Tel-Test Inc., Friendswood,

TX) per the manufacturer's recommendations. RNA concentrations were determined by UV

spectrophotometry, and the integrity of the RNA was confirmed by ethidium bromide staining

after agarose gel electrophoresis.

Branched DNA (bDNA) Assay

Specific oligonucleotide probes for Oatp 1a1, 1a4, 1b2, Oct1, Ntcp, Bsep, Mrp-2 and 3 genes

(Augustine et al., 2005) were diluted in lysis buffer supplied by the Quantigene HV Signal

Amplification Kit (Panomics, Fremont, CA). The substrate solution, lysis buffer, capture

hybridization buffer, amplifier, and label probe buffer used in the analysis were all obtained

from the Quantigene Discovery Kit (Panomics). The assay was performed in 96-well format with

10 μg of total RNA added to the capture hybridization buffer and 50 μl of the diluted probe set.

The total RNA was then allowed to hybridize to the probe set overnight at 53°C. Hybridization

steps were performed per the manufacturer's protocol on the following day. Luminescence of

the samples was measured with a Quantiplex 320 bDNA luminometer interfaced with

Quantiplex Data Management Software (version 5.02).

Real time RT-PCR

Real-time quantification of IL-1b, IFN-, TNF-, IL-6, IL-17A, and IL-17F relative to β-actin mRNA

was performed using SYBR Green PCR master mix (Applied Biosystems) and an ABI PRISM

7900HT sequence detector. Total RNA (5 μg) was reverse-transcribed to cDNA using

SuperScript™ III and random hexamer primers (Invitrogen) in a 20 μL reaction. PCR was

performed using the following primers: IL-1β, 5’-GAAAGCTCTCCACCTCAATG and 5’-


at ASPE



ownloaded from


JPET #205369

10

GCCGTCTTTCATTACACAGG, IFN- primers 5’-CTGCCACGGCACAGTCATTG and 5’-

TGCATCCTTTTTCGCCTTGC, TNF-α primers 5’-GACCCTCACACTCAGATCATCTTCT and 5’-

CCACTTGGTGGTTTGCTACGA, IL-6 primers 5’-TGTCTATACCACTTCACAAGTCGGAG and 5’-

GCACAACTCTTTTCTCATTTCCAC, IL-17A primers 5’-GCTCCAGAAGGCCCTCAGACT and 5’-

CCAGCTTTCCCTCCGCATTGA, IL-17F primers 5’-CTGGAGGATAACACTGTGAGAGT and 5’-

TGCTGAATGGCGACGGAGTTC, and β-actin primers 5’-ATGGTGGGAATGGGTCAGAA and 5’-

CCATGTCGTCCCAGTTGGTAA. PCR reactions incorporated 5 pmol forward and reverse primer

and used the following cycling conditions: 95°C for 10 min, 95°C for 15 s, and 60°C for 60 s

followed by dissociation curve analysis. For the negative controls, the reverse-transcriptase

step was omitted and PCR was performed directly from the RNA. The normalized threshold

cycle (Ct) values were subtracted from the target Ct values of each sample (ΔCt). Relative levels

of target mRNA were calculated as 2−ΔΔCt.

Statistical Analysis

Statistical analysis was performed using InStat 3 (GraphPad, La Jolla, CA) software. Data are

shown as mean + standard error (S.E.). The Mann-Whitney, Wilcoxon matched pairs test or

unpaired two-tailed t-test were applied to compare 2 groups; the one-way ANOVA with

Bonferroni’s multiple comparisons test was used to compare three or more means. Best fit of

correlation was measured by the root mean square. All p values <0.05 were considered

statistically significant. In the figures and tables, p values are displayed according to the

following scheme: **<0.01; *<0.05.

RESULTS


at ASPE



ownloaded from


JPET #205369

11

A genetic loss of function approach was used to determine the regulatory role of lymphocytes

on hepatic transporter steady-state mRNA expression prior to and after LPS treatment. Uptake

and efflux transporters investigated in this study were chosen on the basis that they encompass

sinusoidal and canalicular membrane localization and respond to inflammation. Given that

transporter and cytokine expression are sex-dependent and adult female responses are likely

influenced by estrous cycle (Klaassen and Aleksunes, 2010; Kwekel et al., 2010), male mice were

used. Hepatic transporter expression has also been shown to be age-dependent (Fu et al.,

2012); therefore, despite C57BL/6J Rag1 KO mice being smaller in size relative to WT, TCRα KO,

and µMT mice (p < 0.01), age-matched mice were studied (Fig. 1). Unfasted body weights (BW)

were recorded during the acclimatization period (days -14, -10, and -5), on the day of treatment

(day 1), and at necropsy (16 h post treatment). The administration of LPS resulted in a loss of

BW in WT, TCRα KO, and µMT, but not Rag1 KO, mice, amounting to 12.97 + 1.86 % (p < 0.05),

16.22 + 0.99 % (p < 0.01), 13.36 + 1.05 % (p < 0.01), and 8.44 + 1.18 % (p > 0.05) of saline

controls, respectively (Fig. 1). Overall, these results suggest that mice lacking T and B cells likely

respond differently to acute LPS exposure.

Consistent with previous studies (Klaassen and Aleksunes, 2010), basal steady-state mRNA

expression of sinusoidal Oatp 1a1, 1a4, 1b2, Ntcp, Oct1, and Mrp3 and canalicular Mrp2 and

Bsep transporters were readily detected (Table 1). Oatp1a4 expression was reduced in TCRα KO

mice relative to WT mice (p < 0.05). Although not significant, basal Oct1 expression was

reduced in Rag1 KO mice. In comparison, basal Mrp3, Mrp2, and Bsep expression was lower in

TCRα KO, µMT, and Rag1 KO mice compared to WT mice. Meanwhile, basal Oatp1a1, Oatb1b2,

and Ntcp expression were unaffected by lymphocyte deficiency. Of the transporter genes


at ASPE



ownloaded from


JPET #205369

12

studied, Oatp1a4 mRNA was uniquely down-regulated in the absence of T cells, but not B cells

or the combined deficiency of T and B cells (Table 1) to suggest that B cells, in a T cell-

independent manner, may augment Oatp1a4 expression. In summary, these data demonstrate

that T and B cells contribute to the maintenance of steady-state mRNA expression levels of

selective transporters in the liver of adult male C57BL/6J mice in the absence of inflammation,

infection, or autoimmunity.

We next investigated the effect of T cell and B cell deficiency on transporter mRNA expression

during inflammation. Fig. 2 demonstrates augmented Mrp2 mRNA and a loss of LPS-induced

suppression of Bsep mRNA in TCRα KO mice following acute LPS exposure. We further

investigated the potential for lymphocytes to impact hepatic sinusoidal transporter expression

following LPS treatment. Fig. 3 shows that LPS treatment did not alter Oatp1b2, Ntcp, or Mrp3

mRNA in any of the genotypes. In contrast, Oatp1a1 mRNA was reduced in response to LPS

treatment in all four genotypes. Meanwhile, LPS-induced inhibition of Oct1 and Oatp1a4 was

observed only in WT and B cell-deficient mice, respectively (Fig. 3). Overall, these data

demonstrate that lymphocytes contribute to differential regulation of hepatic transporter

expression in a transporter- and inflammation-dependent manner.

TNF-α, IL-1b, and IL-6 likely contribute to the regulation of hepatic drug transporters during

injury. Given that these cytokines are produced by multiple cell types, including lymphocytes,

we next asked whether T and B cells influence the expression of these soluble mediators in the

liver. For these studies, RT-PCR analyses were performed on liver homogenates from LPS or

saline treated WT, TCR KO, MT, and Rag1 KO mice. We demonstrate decreased basal IL-6


at ASPE



ownloaded from


JPET #205369

13

mRNA in TCR- KO and MT mice and exacerbated LPS-induced IL-6 expression in Rag1 KO

mice (Fig. 4). In contrast, alterations in IL-1b and TNF- mRNA were modest as shown by

tempered up-regulation during inflammation. Noteworthy, selective B cell loss lessened hepatic

TNF-, IL-1b, and IL-6 mRNA levels in LPS treated mice (Fig. 4). IL-6 mRNA levels were increased

in MT and Rag1 KO mice following LPS treatment. Meanwhile, IL-17A and IL-17F mRNA was

only slightly detectable (Ct = 38-42) and these levels did not differ with loss of T and/or B cells

(data not shown). Hepatic IFN-expression was below the level of detection in all samples

tested (data not shown). Overall, these results suggest that T and B cells contribute to basal and

acute inflammatory IL-6 production in the liver.

NKT cells represent a population of unconventional T lymphocytes that can mediate both

innate and adaptive immune responses and are abundant in the liver (Duwaerts and Gregory,

2011; Eberl et al., 1999; Parker and Picut, 2012). In the mouse, NKT cells represent

approximately 0.5% of the total T cell population in the blood, peripheral lymph nodes, and

spleens. In striking contrast, almost 30% of total hepatic T cells have the NKT phenotype (Eberl

et al., 1999) and the majority of these cells, like conventional T cells and NK cells, are localized

in the sinusoids (Geissmann et al., 2005). Therefore, we further investigated the contribution of

NKT cells on the regulation of sex-biased expression of hepatic bile acid transporters (Buist and

Klaassen, 2004; Cheng et al., 2007; Klaassen and Aleksunes, 2010; Maher et al., 2005). For these

experiments, male and female WT C57BL/6J and B10.A TCR Tg Rag2 KO mice were utilized to

determine the influence of combined genetic deficiency of CD8+, B, NKT, and natural CD4+ T

regulatory (Treg) cells on hepatic transporter expression. We first compared WT C57BL/6J and

CD8+, B, NKT, and natural Treg cells deficient (henceforth referred to as NKT-deficient) males


at ASPE



ownloaded from


JPET #205369

14

and females (Table 2). Although hepatic transporter mRNA expression was unaltered in NKT-

deficient males, increased Mrp3 mRNA (p < 0.01) and modestly decreased Oatp1a4 mRNA was

observed in NKT-deficient female mice relative to WT controls (Table 2).

We next determined whether NKT-deficiency influenced the gender predominance of

transporter mRNA expression. First, Oatp1a1 and Oatp1b2 mRNA was male-predominant in WT

mice (p < 0.01) and this sex bias was exacerbated in NKT-deficient mice. Second, Oatp1a4 (p <

0.05), Mrp3 (p > 0.05), Ntcp (p < 0.05), Oct1 (p > 0.05), and Bsep (p > 0.05) expression was

greater in WT females than males, and the magnitude of the female-predominance was either

unchanged or exacerbated with NKT deficiency. Mrp2 mRNA expression in WT mice was

comparable between males and females. Mrp3 mRNA expression was female-predominant in

WT as well as NKT-deficient mice (Table 2). In summary, the above analyses provide evidence

that lymphocytes may further function in a sex-bias manner to modulate hepatic transporters.

DISCUSSION

The possibility that lymphocytes may control hepatic transporter expression has not been

addressed until now. Using a genetic loss-of-function approach, we now provide evidence

suggesting that T and B cells contribute to the regulation of hepatic Mrp2, Bsep, Oct1, and

Oatp1a4 transporter expression. We further associate elevated IL-6 production during

conditions of T cell deficiency with abrogated suppression of Bsep and Oct 1 expression during

acute inflammation. In addition, we provide evidence that lymphocyte-mediated regulation of

hepatic transporter expression is sex-biased. Given that transporters can be significantly

affected by drug-drug interactions or genetic polymorphisms and the immune system has been

linked to sex bias human liver disorders, the contribution of lymphocytes to changes in drug


at ASPE



ownloaded from


JPET #205369

15

transporter activity warrants further attention. These findings contribute novel insights to the

cellular basis of cytokine production in the liver and to the mechanisms of inflammation-

induced liver diseases.

Previous studies demonstrating that altered hepatic transporter expression in response to LPS

have implicated that Kupffer cells directly respond to LPS through TLR4-dependent signaling to

up-regulate TNF-α, IL-6, and IL-1b transcription (Augustine et al., 2005; Cherrington et al., 2004;

Green et al., 1996; Kim et al., 2000; Kubitz et al., 1999; Li et al., 2004; Li and Klaassen, 2005). In

theory, these presumed pro-inflammatory cytokines, in turn, signal through their respective

receptors to repress transcription of genes encoding hepatic transporters causing bile acid

accumulation and cholestatic liver disease. We now demonstrate that T and B cells play

substantial, yet differential, roles in IL-6, but not IL-1b and TNF- production during basal and

acute inflammatory conditions. IL-6 has been implicated in both pro-inflammatory and anti-

inflammatory responses (Scheller et al., 2011) and most studies have investigated pro-

inflammatory contributions by IL-6. However, our data illustrating down- and up-regulated IL-6

in WT and T cell-deficient mice, respectively, are consistent with recent reports suggesting that

B cell-induced production of IL-6 prevents down-regulation of hepatic transporters to reduce

liver injury associated with acute inflammation (Klein et al., 2005; Taub, 2003). The molecular

mechanisms by which IL-6 protects in the liver are not well understood and this is further

confounded by a poor understanding of how T cells propagate hepatic inflammation. None the

less, it is well established that IL-6 binds the membrane-bound IL-6 receptor α (gp80) and

heterodimerizes with gp130 to form a signaling complex and activates downsteam STAT1,

STAT3, and SHP2-RAS-MAPK signaling pathways (Ishihara and Hirano, 2002). A lack of gp130


at ASPE



ownloaded from


JPET #205369

16

expression in hepatocytes has previously been shown to promote liver injury (Streetz et al.,

2003). Thus, it is unclear whether B cell induced IL-6 production directly targets T cells or

hepatocytes to modulate transporter expression. Given that IL-6-gp130-STAT3 in T cells

promotes IL-17 producing CD4 T cells (Camporeale and Poli, 2012), we were surprised by the

low levels of IL-17 expression in LPS treated Rag1 KO mice. However, these results suggest that

hepatocytes may be the critical recipient of the IL-6 signaling during acute TLR4-mediated

inflammation.

Although not well-appreciated, recent evidence has established that T, B, and NKT cells also

express TLR4 (Gururajan et al., 2007; Kim et al., 2012; Meyer-Bahlburg et al., 2009). Thus,

lymphocytes also retain the capacity to rapidly respond to endotoxin and other microbes

including commensal bacteria (Godfrey and Rossjohn, 2011; Reynolds et al., 2012; Tough et al.,

1997). Little is known about TLR4 signaling in lymphocytes, and it remains to be determined

whether TLR4 signaling pathways differ between lymphocytes and macrophages, particularly

with regards to the requirement for CD14, MyD88, and TRIF. Given the abundance of T, B, and

NKT cells in the liver and their capacity to propagate pro-inflammatory, but also anti-

inflammatory, cytokine production, we have utilized a genetic loss of function approach to test

the hypothesis that lymphocytes contribute to the regulation of genes encoding uptake and

efflux transporters in mouse liver. Our results are in agreement with previous studies

demonstrating down-regulation of sinusoidal and canalicular transporters in response to LPS as

previously reviewed (Klaassen and Aleksunes, 2010).


at ASPE



ownloaded from


JPET #205369

17

Regarding the role of lymphocytes in regulating transporter expression, our findings do, in fact,

support our hypothesis that lymphocytes contribute to the transcriptional control of hepatic

bile acid transporters. Given that most lymphocytes including T and B, NK, and NKT cells are

thought to provide critical defense against invading pathogens and modulate liver injury by

circulating through hepatic sinusoids (Geissmann et al., 2005), it was somewhat unexpected

that the efflux transporters positioned on the apical membrane were most affected by

lymphocyte deficiency. None the less, it is well accepted that migration through hepatic

sinusoids enables lymphocytes to come in close contact to antigens displayed by endothelial

cells, Kupffer cells, and microbial pathogens undergoing enterohepatic circulation. Since altered

Mrp3 and Bsep mRNA expression in response to lymphocyte deficiency was evident only during

inflammation, we speculate that lymphocytes likely gain access, via direct contact or through

the secretion of soluble mediators, to hepatocytes at times when the vasculature in the liver is

inflamed as the sinusoidal endothelium is highly fenestrated and lacks a basement membrane.

In agreement, the sinusoidal membrane has previously been identified as a unique means by

which liver is able to differentially regulate immune-mediated responses (Crispe, 2012; Parker

and Picut, 2012). This line of reasoning is also consistent with our observation that lymphocytes

retain the capacity to modulate efflux transporters that are located on the apical membrane,

i.e., Mrp3, in the absence of LPS-induced inflammation.

Without doubt, hepatic transporter expression is critical for effective elimination of conjugated

bilirubin and bile acids as well as xenobiotics and their metabolites to maintain metabolic

homeostasis and simultaneous removal of toxic waste. However, it is also appreciated that

transient repression of hepatic efflux transporter function during acute inflammation, such as


at ASPE



ownloaded from


JPET #205369

18

sepsis or gallstones, offers protection to the liver by enhancing the retention of antioxidants

such as glutathione (Kong et al., 2012; Roeb et al., 2003). Thus, it is the sustained disruption of

these efflux pumps, in combination with uptake transporters, which exacerbates pathology in

liver diseases. It is appreciated that administration of LPS in experimental mouse models

reproduces the common clinical features of sepsis including down-regulation of transporter

mRNA. So, is altered hepatic transporter expression in response to lymphocyte deficiency

pathogenic or protective? This is a particularly important question given the liver provides a

unique environment that favors immunological tolerance. Of particular importance, CD4+

FoxP3+ Tregs are mediators of immune tolerance, express toll like receptors including TLR4,

exert enhanced suppressor function in response to LPS treatment, and have previously been

shown to contribute to extrahepatic cholestasis (Caramalho et al., 2003; Katz et al., 2011).

Additional studies to identify which lymphocytes are involved and gain a better understanding

of their mechanism(s) of action during acute and chronic exposure are required to

appropriately address this question. Here, we have clearly determined that hepatic

transporters are sensitive to modulation by lymphocyte activity. Importantly, while we and

others propose that LPS-induced cytokines directly target hepatocytes and ductal epithelial

cells to alter hepatic transporter mRNA, it has also been established that transporters, in

particular ABC transporters, are expressed on lymphocytes. Therefore, given that lymphocytes

also express TLR4, we cannot ignore the possibility that alteration of lymphocyte transporter

expression may contribute to inflammation in the liver, as has been previously suggested

(Giraud et al., 2010; van de Ven et al., 2009; Verbrugge et al., 2012).


at ASPE



ownloaded from


JPET #205369

19

As hepatic bile acid transporter expression and immune response in other liver diseases are

both sex-dependent, a second aspect of this study involved elucidating whether lymphocytes

contribute to the sex-biased basal expression of hepatic transporters. Exacerbated basal Mrp3

expression in only female mice suggests that lymphocytes may contribute to sex-biased hepatic

transporter expression and implicate a particular important role for CD4+ T cells. Consistent

with this, conventional CD4+ T cells rapidly produce IL-2 upon activation. IL-2 receptor signaling

is predominantly mediated through STAT5a and STAT5b signaling pathways (Liao et al., 2013;

Lin et al., 2012), and hepatocytes respond to IL-2 signaling (Sunman et al., 2004). A role for

STAT5 signaling in gender-specific hepatic transporter expression has been identified for Ntcp

(Clodfelter et al., 2006; Clodfelter et al., 2007; Zhang et al., 2012). Thus, it is plausible that

cytokine signaling crosstalk with bile acid-induced nuclear receptor activation also contributes

to gender-specific regulation of hepatic transporters. Alternatively, gender discrepancy could

be the result of other divergent sex-dependent immune responses. For example, women have

higher absolute numbers of total CD4+ T cells and produce higher levels of IFN-.

In conclusion, the present study implicates that T and B cells regulate hepatic transporters (Fig.

5). In addition, we further implicate a protective role for IL-6 and identify lymphocytes as

modulators of sex-biased hepatic transporter expression. Given that targeted therapies that

affect lymphocyte function could adversely affect bile flow, it is critical that further work be

done to identify the lymphocytes that regulate transporter function.


at ASPE



ownloaded from


JPET #205369

20

AUTHORSHIP CONTRIBUTIONS

Participated in Research design: Cherrington, McKarns

Conducted experiments: Tally, Bodeman, Dzierlenga, Lake, McKarns

Performed data analysis: Tally, Bodeman, Dzierlenga, Cherrington, McKarns

Wrote or contributed to the writing of the manuscript: Mulligan, Tally, Dzierlenga, Cherrington,

McKarns


at ASPE



ownloaded from


JPET #205369

21

REFERENCES

Augustine, L. M., Markelewicz, R. J., Jr., Boekelheide, K., and Cherrington, N. J. (2005).

Xenobiotic and endobiotic transporter mRNA expression in the blood-testis barrier. Drug Metab

Dispos 33, 182-189.

Buist, S. C., and Klaassen, C. D. (2004). Rat and mouse differences in gender-predominant

expression of organic anion transporter (Oat1-3; Slc22a6-8) mRNA levels. Drug Metab Dispos

32, 620-625.

Camporeale, A., and Poli, V. (2012). IL-6, IL-17 and STAT3: a holy trinity in auto-immunity? Front

Biosci 17, 2306-2326.

Caramalho, I., Lopes-Carvalho, T., Ostler, D., Zelenay, S., Haury, M., and Demengeot, J. (2003).

Regulatory T cells selectively express toll-like receptors and are activated by lipopolysaccharide.

J Exp Med 197, 403-411.

Cheng, X., Buckley, D., and Klaassen, C. D. (2007). Regulation of hepatic bile acid transporters

Ntcp and Bsep expression. Biochem Pharmacol 74, 1665-1676.

Cherrington, N. J., Slitt, A. L., Li, N., and Klaassen, C. D. (2004). Lipopolysaccharide-mediated

regulation of hepatic transporter mRNA levels in rats. Drug Metab Dispos 32, 734-741.

Clodfelter, K. H., Holloway, M. G., Hodor, P., Park, S. H., Ray, W. J., and Waxman, D. J. (2006).

Sex-dependent liver gene expression is extensive and largely dependent upon signal transducer

and activator of transcription 5b (STAT5b): STAT5b-dependent activation of male genes and

repression of female genes revealed by microarray analysis. Mol Endocrinol 20, 1333-1351.


at ASPE



ownloaded from


JPET #205369

22

Clodfelter, K. H., Miles, G. D., Wauthier, V., Holloway, M. G., Zhang, X., Hodor, P., Ray, W. J., and

Waxman, D. J. (2007). Role of STAT5a in regulation of sex-specific gene expression in female but

not male mouse liver revealed by microarray analysis. Physiol Genomics 31, 63-74.

Crispe, I. N. (2012). Migration of lymphocytes into hepatic sinusoids. J Hepatol 57, 218-220.

Dong, Z., Wei, H., Sun, R., and Tian, Z. (2007). The roles of innate immune cells in liver injury and

regeneration. Cell Mol Immunol 4, 241-252.

Duwaerts, C. C., and Gregory, S. H. (2011). Targeting the diverse immunological functions

expressed by hepatic NKT cells. Expert Opin Ther Targets 15, 973-988.

Eberl, G., Lees, R., Smiley, S. T., Taniguchi, M., Grusby, M. J., and MacDonald, H. R. (1999).

Tissue-specific segregation of CD1d-dependent and CD1d-independent NK T cells. J Immunol

162, 6410-6419.

Fu, Z. D., Csanaky, I. L., and Klaassen, C. D. (2012). Effects of aging on mRNA profiles for drug-

metabolizing enzymes and transporters in livers of male and female mice. Drug Metab Dispos

40, 1216-1225.

Geier, A., Fickert, P., and Trauner, M. (2006). Mechanisms of disease: mechanisms and clinical

implications of cholestasis in sepsis. Nat Clin Pract Gastroenterol Hepatol 3, 574-585.

Geissmann, F., Cameron, T. O., Sidobre, S., Manlongat, N., Kronenberg, M., Briskin, M. J.,

Dustin, M. L., and Littman, D. R. (2005). Intravascular immune surveillance by CXCR6+ NKT cells

patrolling liver sinusoids. PLoS Biol 3, e113.


at ASPE



ownloaded from


JPET #205369

23

Giraud, C., Manceau, S., Decleves, X., Goffinet, F., Morini, J. P., Chappuy, H., Batteux, F.,

Chouzenoux, S., Yousif, S., Scherrmann, J. M., et al. (2010). Influence of development, HIV

infection, and antiretroviral therapies on the gene expression profiles of ABC transporters in

human lymphocytes. J Clin Pharmacol 50, 226-230.

Godfrey, D. I., and Rossjohn, J. (2011). New ways to turn on NKT cells. J Exp Med 208, 1121-

1125.

Green, R. M., Beier, D., and Gollan, J. L. (1996). Regulation of hepatocyte bile salt transporters

by endotoxin and inflammatory cytokines in rodents. Gastroenterology 111, 193-198.

Gururajan, M., Jacob, J., and Pulendran, B. (2007). Toll-like receptor expression and

responsiveness of distinct murine splenic and mucosal B-cell subsets. PLoS One 2, e863.

Hirschfield, G. M., and Heathcote, E. J. (2009). Cholestasis and cholestatic syndromes. Curr Opin

Gastroenterol 25, 175-179.

Hirschfield, G. M., Heathcote, E. J., and Gershwin, M. E. (2010). Pathogenesis of cholestatic liver

disease and therapeutic approaches. Gastroenterology 139, 1481-1496.

Ishihara, K., and Hirano, T. (2002). Molecular basis of the cell specificity of cytokine action.

Biochim Biophys Acta 1592, 281-296.

Katz, S. C., Ryan, K., Ahmed, N., Plitas, G., Chaudhry, U. I., Kingham, T. P., Naheed, S., Nguyen,

C., Somasundar, P., Espat, N. J., et al. (2011). Obstructive jaundice expands intrahepatic


at ASPE



ownloaded from


JPET #205369

24

regulatory T cells, which impair liver T lymphocyte function but modulate liver cholestasis and

fibrosis. J Immunol 187, 1150-1156.

Kim, J. H., Kim, H. S., Kim, H. Y., Oh, S. J., and Chung, D. H. (2012). Direct engagement of TLR4 in

invariant NKT cells regulates immune diseases by differential IL-4 and IFN-gamma production in

mice. PLoS One 7, e45348.

Kim, P. K., Chen, J., Andrejko, K. M., and Deutschman, C. S. (2000). Intraabdominal sepsis down-

regulates transcription of sodium taurocholate cotransporter and multidrug resistance-

associated protein in rats. Shock 14, 176-181.

Klaassen, C. D., and Aleksunes, L. M. (2010). Xenobiotic, bile acid, and cholesterol transporters:

function and regulation. Pharmacol Rev 62, 1-96.

Klein, C., Wustefeld, T., Assmus, U., Roskams, T., Rose-John, S., Muller, M., Manns, M. P., Ernst,

M., and Trautwein, C. (2005). The IL-6-gp130-STAT3 pathway in hepatocytes triggers liver

protection in T cell-mediated liver injury. J Clin Invest 115, 860-869.

Kong, B., Csanaky, I. L., Aleksunes, L. M., Patni, M., Chen, Q., Ma, X., Jaeschke, H., Weir, S.,

Broward, M., Klaassen, C. D., et al. (2012). Gender-specific reduction of hepatic Mrp2

expression by high-fat diet protects female mice from ANIT toxicity. Toxicol Appl Pharmacol

261, 189-195.

Kubitz, R., Wettstein, M., Warskulat, U., and Haussinger, D. (1999). Regulation of the multidrug

resistance protein 2 in the rat liver by lipopolysaccharide and dexamethasone.

Gastroenterology 116, 401-410.


at ASPE



ownloaded from


JPET #205369

25

Kwekel, J. C., Desai, V. G., Moland, C. L., Branham, W. S., and Fuscoe, J. C. (2010). Age and sex

dependent changes in liver gene expression during the life cycle of the rat. BMC Genomics 11,

675.

Li, N., Choudhuri, S., Cherrington, N. J., and Klaassen, C. D. (2004). Down-regulation of mouse

organic anion-transporting polypeptide 4 (Oatp4; Oatp1b2; Slc21a10) mRNA by

lipopolysaccharide through the toll-like receptor 4 (TLR4). Drug Metab Dispos 32, 1265-1271.

Li, N., and Klaassen, C. D. (2005). Lipopolysaccharide-induced down-regulation of organic anion

transporting polypeptide 4 (Oatp4; Slc21a10) is independent of tumor necrosis factor-alpha,

Interleukin-1beta, interleukin-6, or inducible nitric oxide synthase. Toxicol Sci 83, 197-203.

Liao, W., Lin, J. X., and Leonard, W. J. (2013). Interleukin-2 at the crossroads of effector

responses, tolerance, and immunotherapy. Immunity 38, 13-25.

Lickteig, A. J., Slitt, A. L., Arkan, M. C., Karin, M., and Cherrington, N. J. (2007). Differential

regulation of hepatic transporters in the absence of tumor necrosis factor-alpha, interleukin-

1beta, interleukin-6, and nuclear factor-kappaB in two models of cholestasis. Drug Metab

Dispos 35, 402-409.

Lin, J. X., Li, P., Liu, D., Jin, H. T., He, J., Ata Ur Rasheed, M., Rochman, Y., Wang, L., Cui, K., Liu,

C., et al. (2012). Critical Role of STAT5 transcription factor tetramerization for cytokine

responses and normal immune function. Immunity 36, 586-599.


at ASPE



ownloaded from


JPET #205369

26

Maher, J. M., Slitt, A. L., Cherrington, N. J., Cheng, X., and Klaassen, C. D. (2005). Tissue

distribution and hepatic and renal ontogeny of the multidrug resistance-associated protein

(Mrp) family in mice. Drug Metab Dispos 33, 947-955.

Merritt, M. E., and Donaldson, J. R. (2009). Effect of bile salts on the DNA and membrane

integrity of enteric bacteria. J Med Microbiol 58, 1533-1541.

Meyer-Bahlburg, A., Bandaranayake, A. D., Andrews, S. F., and Rawlings, D. J. (2009). Reduced

c-myc expression levels limit follicular mature B cell cycling in response to TLR signals. J

Immunol 182, 4065-4075.

Mulder, J., Karpen, S. J., Tietge, U. J., and Kuipers, F. (2009). Nuclear receptors: mediators and

modifiers of inflammation-induced cholestasis. Front Biosci 14, 2599-2630.

Parker, G. A., and Picut, C. A. (2012). Immune functioning in non lymphoid organs: the liver.

Toxicol Pathol 40, 237-247.

Pone, E. J., Zan, H., Zhang, J., Al-Qahtani, A., Xu, Z., and Casali, P. (2010). Toll-like receptors and

B-cell receptors synergize to induce immunoglobulin class-switch DNA recombination:

relevance to microbial antibody responses. Crit Rev Immunol 30, 1-29.

Reynolds, J. M., Martinez, G. J., Chung, Y., and Dong, C. (2012). Toll-like receptor 4 signaling in T

cells promotes autoimmune inflammation. Proc Natl Acad Sci U S A 109, 13064-13069.

Ricciardi, R., Schaffer, B. K., Shah, S. A., Quarfordt, S. H., Banner, B. F., Wheeler, S. M., Donohue,

S. E., Meyers, W. C., and Chari, R. S. (2001). Bosentan, an endothelin antagonist, augments


at ASPE



ownloaded from


JPET #205369

27

hepatic graft function by reducing graft circulatory impairment following ischemia/reperfusion

injury. J Gastrointest Surg 5, 322-329.

Roeb, E., Purucker, E., Gartung, C., Geier, A., Jansen, B., Winograd, R., and Matern, S. (2003).

Effect of glutathione depletion and hydrophilic bile acids on hepatic acute phase reaction in rats

with extrahepatic cholestasis. Scand J Gastroenterol 38, 878-885.

Scheller, J., Chalaris, A., Schmidt-Arras, D., and Rose-John, S. (2011). The pro- and anti-

inflammatory properties of the cytokine interleukin-6. Biochim Biophys Acta 1813, 878-888.

Schenten, D., and Medzhitov, R. (2011). The control of adaptive immune responses by the

innate immune system. Adv Immunol 109, 87-124.

Seder, R. A., Paul, W. E., Davis, M. M., and Fazekas de St Groth, B. (1992). The presence of

interleukin 4 during in vitro priming determines the lymphokine-producing potential of CD4+ T

cells from T cell receptor transgenic mice. J Exp Med 176, 1091-1098.

Streetz, K. L., Wustefeld, T., Klein, C., Kallen, K. J., Tronche, F., Betz, U. A., Schutz, G., Manns, M.

P., Muller, W., and Trautwein, C. (2003). Lack of gp130 expression in hepatocytes promotes

liver injury. Gastroenterology 125, 532-543.

Sun, R., Tian, Z., Kulkarni, S., and Gao, B. (2004). IL-6 prevents T cell-mediated hepatitis via

inhibition of NKT cells in CD4+ T cell- and STAT3-dependent manners. J Immunol 172, 5648-

5655.


at ASPE



ownloaded from


JPET #205369

28

Sunman, J. A., Hawke, R. L., LeCluyse, E. L., and Kashuba, A. D. (2004). Kupffer cell-mediated IL-2

suppression of CYP3A activity in human hepatocytes. Drug Metab Dispos 32, 359-363.

Taub, R. (2003). Hepatoprotection via the IL-6/Stat3 pathway. J Clin Invest 112, 978-980.

Tough, D. F., Sun, S., and Sprent, J. (1997). T cell stimulation in vivo by lipopolysaccharide (LPS).

J Exp Med 185, 2089-2094.

van de Ven, R., Oerlemans, R., van der Heijden, J. W., Scheffer, G. L., de Gruijl, T. D., Jansen, G.,

and Scheper, R. J. (2009). ABC drug transporters and immunity: novel therapeutic targets in

autoimmunity and cancer. J Leukoc Biol 86, 1075-1087.

Verbrugge, S. E., Assaraf, Y. G., Dijkmans, B. A., Scheffer, G. L., Al, M., den Uyl, D., Oerlemans,

R., Chan, E. T., Kirk, C. J., Peters, G. J., et al. (2012). Inactivating PSMB5 mutations and P-

glycoprotein (multidrug resistance-associated protein/ATP-binding cassette B1) mediate

resistance to proteasome inhibitors: ex vivo efficacy of (immuno)proteasome inhibitors in

mononuclear blood cells from patients with rheumatoid arthritis. J Pharmacol Exp Ther 341,

174-182.

Zhang, Y., Laz, E. V., and Waxman, D. J. (2012). Dynamic, sex-differential STAT5 and BCL6

binding to sex-biased, growth hormone-regulated genes in adult mouse liver. Mol Cell Biol 32,

880-896.


at ASPE



ownloaded from


JPET #205369

29

FOOTNOTES

This work was supported in part by the National Institutes of Health National Institute of Allergy

and Infectious Diseases Extramural Activities [Grant AI083927]; the National Institutes of Health

Eunice Kennedy Shriver National Institute of Child Health and Human Development [Grant

HD062489] (to N.J.C.) and the National Institute of Environmental Health Science Toxicology

Training [Grant, ES007091] to A. D. L.


at ASPE



ownloaded from


JPET #205369

30

LEGENDS FOR FIGURES

Figure 1. The influence of LPS treatment of body weight. The body weights of 16-week old

male WT, TCRα KO, µMT, and Rag1 KO mice (n = 3 mice per experimental group) were obtained

one day prior to and 16 h following LPS administration (4 mg/kg in a volume of 5 l/g; i.p.) or an

equal volume of sterile saline (vehicle control). The BW (g) for individual mice before and after

saline (top) or LPS (bottom) treatment is shown. Open and closed circles represent prior to and

after treatment **<0.01; *<0.05.

Figure 2. Steady-state mRNA levels of hepatic canalicular efflux transporters in response to

LPS. Male WT, TCRα KO, µMT, or Rag1 KO mice (22–31 g) were administered LPS (4 mg/kg in a

volume of 5 µl/g) or sterile saline vehicle by injection (i.p.). Livers were excised 16 h after LPS

administration, collected, snap-frozen in liquid nitrogen, and stored at -80oC until RNA isolation

(n = 3 mice per experimental group). Livers were evaluated for steady-state mRNA levels of

Bsep and Mrp2 as determined by the bDNA assays. Data are expressed as mean relative light

units (RLU)/ 10 g total RNA + S.E **<0.01; *<0.05.

Figure 3. Steady-state mRNA levels of hepatic sinusoidal transporters in response to LPS. Male

WT, TCRα KO, µMT, or Rag1 KO mice (22–31 g) were administered LPS (4 mg/kg in a volume of

5 µl/g) or sterile saline vehicle by injection (i.p.). Livers were excised 16 h after LPS

administration, collected, snap-frozen in liquid nitrogen, and stored at -80oC until RNA isolation

(n = 3 mice per experimental group). Livers were evaluated for steady-state mRNA levels of the

hepatic bile acid transporters Oatp1a1, Oatp1a4, Oatp1b2, Ntcp, Oct1, and Mrp3 as determined


at ASPE



ownloaded from


JPET #205369

31

by branched DNA analyses. Data are expressed as mean RLU/ 10 g total RNA + S.E **<0.01;

*<0.05.

Figure 4. The influence of T and B cell deficiency on basal and LPS-induced hepatic cytokine

gene expression. Male WT, TCRα KO, µMT, or Rag1 KO mice were administered LPS (4 mg/kg in

a volume of 5 µl/g) or sterile saline vehicle by injection (i.p.). Livers were excised 16 h after LPS

administration, collected, snap-frozen in liquid nitrogen, and stored at -80oC until RNA isolation.

Gene expression was quantified by RT- PCR using SYBR green PCR master mix and the ABI Prism

7900HT sequence detection system. Fold change was calculated as 2−ΔΔCt using -actin as

endogenous control. The results shown are normalized to WT vehicle (saline) controls.

Quantification was calculated as vehicle versus LPS-treated cells. Data are mean ± S.E. of three

mice.

Figure 5. Schematic depicting differential regulation of hepatic transporter expression by T

and B cells. Bsep and Mrp2 transporters are expressed on hepatocyte canalicular membranes

and export monovalent tauro- and glyco-conjugated (conj.) hepatic bile acids (BAs) and divalent

sulphated (sulpho-) or glucuronidated (glucurono-) BAs amidated with a taurine or a glycine,

organic anions (OAs), reduced glutathione (GSH), and bilirubin (bili) out of the hepatocyte into

the bile canaliculi. Mrp3, like Mrp2, is an ATP-binding cassette transporter, but unlike Mrp2, is

localized on hepatocyte basolateral surfaces and functions to efflux bile and organic acids

during periods of BA overload, e.g., gallstones or dysfunctional Mrp2 and/or Bsep. Ntcp,

Oatp1a1, Oatp1a4, and Oatp1b2 are positioned at the basolateral membrane and facilitate

enterohepatic cycling of BAs and OAs. Oct1 is also expressed at the basolateral membrane and


at ASPE



ownloaded from


JPET #205369

32

functions in a similar manner, except it transports conj. BAs and organic cations (OCs) from the

portal vein.


at ASPE



ownloaded from


Table 1. Basal Transporter Gene Expression in Liver Isolated from male WT mice and mice lacking T cells (TCRα KO), B cells (µMT), or both T and B cells (Rag1 KO)a.

Transporter Human Gene Accession

#

Nuclear

Receptorb Ligandc WT TCR KO MT Rag1 KO

Oatp1a1 (Oatp1)

OATP1A2 Slco1a1 NM_013797 FXR, RXR, SHP, HNF4α, GR

BA (↑) 69.56 + 7.78 74.09 + 13.39 63.43 + 8.85 64.26 + 4.16

Oatp1a4 (Oatp2)

OATP1B1 Slco1a4 NM_030687 FXR, SHP, HNF4α

SHP (↓) 5.81 + 0.88 0.90 + 0.41* 6.03 + 0.61 5.03 + 0.92

Oatp1b2 (Oatp4)

OATP2B2 (OATP1B3)

Sclo1b2 NM_020495 FXR BA (↑) 82.27 + 17.96 88.53 + 19.38 63.80 + 3.33 85.07 + 7.10

Ntcp (lx1)

NTCP Slc10a1 NM_011387 FXR, RXR, SHP, HNFα, GR,

RAR

Retinoids (↑)

SHP (↓)

64.04 + 11.80 57.95 + 2.83 76.06 + 8.80 80.73 + 18.80

Oct1 OCT1 Slc22a1 NM_009202 PXR, PPAR, HNF1α

OC (↑) 192.93 + 29.88 124.42 + 20.75 151.48 + 30.08 104.84 + 3.80

Mrp3 MRP3 Abcc3 NM_029600 CAR, PXR, VDR BS, BIli, PB, phytoestrogens (↑)

15.21 + 3.58 11.24 + 4.80 11.89 + 3.13 5.56 + 1.00

Mrp2 MRP2, cMoat

Abcc2 NM_013806 PXR, CAR, FXR BA, Bili, GSH, Xenobiotics(↑)

29.87 + 8.59 20.40 + 1.91 13.13 + 3.27 14.55 + 3.65

Bsep BSEP, SPGP, PFIC-2

Abcb11 NM_021022 FXR, RXR BA (↑) 50.48 + 8.52 21.81 + 4.35 31.27 + 0.38 38.67 + 15.93

aResults represent the mean RLU/10 g total RNA + SE (n = 3). *p < 0.05 relative to WT.

bReviewed in (Beuers et al, 2001; Chandra & Brouwer, 2004; Halilbasic et al, 2013; Hofmann, 2007; Hofmann, 2009; Shu et al, 2008; Tirona & Kim, 2005; Trauner & Boyer, 2003).

cReviewed in (Beuers et al, 2001; Chandra & Brouwer, 2004; Halilbasic et al, 2013; Shu et al, 2008).

BA, bile acid; Bili, bilirubin; BS, bile salts; BSEP, bile salt export pump; CAR, constitutive androstane receptor; cMOAT, canalicular multi-organic anion transporter; FXR, farnesoid X receptor; GSH, glutathione; GR, glucocorticoid receptor; HNFα, hepatocyte nuclear factor alpha; MRP, multidrug resistance associated protein; NTCP, sodium-taurocholate cotransporting polypeptide; OATP, organic anion transporter; OC, organic cation; OCT,

organic cation transporter; PB, phenobarbital; PFIC-2, progressive familial intrahepatic cholestasis; PPAR, peroxisome proliferator-activated

receptor alpha; PXR, pregnane X receptor; RAR retinoid acid receptor alphaRXR, retinoid X receptor; SHP, short heterodimer partner; SPGP, sister of P-glycoprotein; VDR, vitamin D receptor; ↑, increases transporter expression; ↓, decreases transporter expression.


at ASPE



ownloaded from


Table 2. Sex-dependent differences in constitutive hepatic transporter gene expression in WT mice and mice genetically-deficient in NKT, CD8+, B, and natural FoxP3+ regulatory T cellsa

.

Transporter Males Females

WT TCRα Tg Rag2 KO WT TCRα Tg Rag2 KO

Oatp1a1 89.07 + 26.73 100.32 + 17.10 37.87 + 22.75 4.41 + 1.93

Oatp1a4 6.80 + 1.30 5.09 + 1.11 44.53 + 5.91 27.09 + 3.15

Oatp1b2 91.75 + 8.18 93.07 + 3.75 61.29 + 14.74 50.60 + 20.58

Ntcp 64.49 + 12.90 97.89 + 10.96 146.58 + 21.35 163.08 + 4.55

Oct1 128.78 + 26.81 154.74 + 14.71 182.76 + 56.49 254.43 + 49.54

Mrp3 6.31 + 0.53 7.22 + 1.98 9.30 + 0.97 17.46 + 3.07**

Mrp2 28.95 + 3.17 25.71 + 4.91 24.38 + 13.87 41.69 + 5.16

Bsep 74.97 + 12.99 60.70 + 1.32 128.67 + 56.47 102.47 + 9.06

aResults represent the mean RLU/10 g total RNA + SE (n = 3). **, p < 0.01, comparing gender-

specific WT and TCR Tg Rag2 KO mice.


at ASPE



ownloaded from


WT TCR KO MT Rag1 KO

15

25

35

0 h Saline

16 h Saline


15

25

35

0 h LPS

16 h LPS

*** **B

ody W

eig

ht (g

)

McKarns_JPET #205369_Figure 1


at ASPE



ownloaded from


WT TCR KO MT Rag1 KO0

30

60

90 Mrp2

*

Saline

LPS


30

60

90 Bsep

*

**

mR

NA

(R

LU

/ 10 µ

g tota

l R

NA

)



at ASPE



ownloaded from


0

40

80

120 Oatp1a1

** ***

*


5

10

15Oatp1a4

**

0

75

150

225Oatp1b2

LPS

Saline


50

100

150Ntcp

0

100

200

300 Oct1*


8

16

24Mrp3

mR

NA

(R

LU

/ 10 µ

g tota

l R

NA

)



at ASPE



ownloaded from


Rela

tive m

RN

A e

xpre

ssio

n 0

2

4

6

8IL-1b

*

Saline

LPS

0.0

0.5

1.0

1.5

2.08

1012

IL-6

*

**


10

20

30TNF-

**

**



at ASPE



ownloaded from


Bile canaliculus

Hepatocyte Portal Vein

GSH-

Tauro- & glyco-conj. BA

OA, sulpho- and glucurono- conj. BA

Sinusoidal (Basolateral) Membrane

Canalicular (Apical) Membrane

BSEP

MRP3

Na+

OATP1A1

OCT1

OATP1B2

NTCP

UPTAKE EFFLUX

MRP2

Conj. BA, OC

Enterohepatic Circulation

GSH-

OA-

OA-

OATP1A4 OA-

Bili, GSH, OA, glucurono- and sulpho- conj. BA

Tauro- and glyco- conj. BA

A loss of T cells in combination with the presence of B cells promotes Mrp2 expression during inflammation

Absence of T cells prevents down-regulation of Bsep during inflammation

T cells suppress Oct1 expression during inflammation

T cells are essential for basal Oatp1a4 expression, but suppress its expression during inflammation



at ASPE



ownloaded from


title page differential regulation of hepatic oct1...

Documents