thomas r. insel, m.d. director, nimh rethinking mental illness: how research will change practice...

43
Thomas R. Insel, M.D. Thomas R. Insel, M.D. Director, NIMH Director, NIMH Rethinking Mental Rethinking Mental Illness: How Research Illness: How Research Will Change Practice Will Change Practice October 22, 2008

Upload: helen-unsworth

Post on 19-Jan-2016

219 views

Category:

Documents


2 download

TRANSCRIPT

Page 1: Thomas R. Insel, M.D. Director, NIMH Rethinking Mental Illness: How Research Will Change Practice October 22, 2008

Thomas R. Insel, M.D.Thomas R. Insel, M.D.

Director, NIMHDirector, NIMH

Rethinking Mental Illness: Rethinking Mental Illness: How Research Will Change How Research Will Change

PracticePractice

October 22, 2008

Page 2: Thomas R. Insel, M.D. Director, NIMH Rethinking Mental Illness: How Research Will Change Practice October 22, 2008

500

400

300

200

100

50 55 60 65 70 75 80 85 90 95 00

Death

s p

er

10

0,0

00

Year

~ 514,000 ActualDeaths in 2000

~ 1,329,000 ProjectedDeaths in 2000

63% decrease in mortality

~ 1 million early deaths averted per year

$2.6 trillion in economic return

New, effective treatments and prevention strategies

Impact of Research on Heart Disease

Page 3: Thomas R. Insel, M.D. Director, NIMH Rethinking Mental Illness: How Research Will Change Practice October 22, 2008

For the first time in recorded history, annual cancer deaths in the United States have fallen

10 million survivors

Mill

ions

of

People

1971 1986 1990 2003

9

6

3

Number of Survivors

Impact of Research on Cancer

Page 4: Thomas R. Insel, M.D. Director, NIMH Rethinking Mental Illness: How Research Will Change Practice October 22, 2008

Impact of Research on Mental Illness

Diagnosis is by observation, detection is late, prediction is poor.

Etiology is unknown; prevention is empirical and not well-developed for most disorders.

Treatment is trial and error – no cures, no vaccines.

Bottom line: Prevalence has not decreased for any illness. Mortality has not decreased for any illness.

Page 5: Thomas R. Insel, M.D. Director, NIMH Rethinking Mental Illness: How Research Will Change Practice October 22, 2008

Source: WHO World Health Report 2002

0 5 10 15 20 25 30 35

Mental Illness*

Injuries, including self-inflicted

Alcohol and drug use

Malignant neoplasms (cancer)

Cardiovascular disease

Respiratory disease

Musculoskeletal disease

Sense organ disease

Digestive disease

Burden of Disease (DALYs) U.S., Canada, and Western Europe 15-44 years old

Page 6: Thomas R. Insel, M.D. Director, NIMH Rethinking Mental Illness: How Research Will Change Practice October 22, 2008

Source: WHO World Health Report 2002

Burden of Disease by Specific Illness – DALYsUnited States, Canada, and Western Europe

15-44 years old

0 2 4 6 8 10 12 14 16 18 20 22

Unipolar depression

Alcohol use

Road traffic accidents

Drug use

Self-inflicted injuries

Bipolar disorder

Migraine

Schizophrenia

Hearing loss

COPD

Page 7: Thomas R. Insel, M.D. Director, NIMH Rethinking Mental Illness: How Research Will Change Practice October 22, 2008

Mental Illnesses:Why the high morbidity?

Prevalent (6% U.S. - serious)

Disabling (largest population on SSI, SSDI)

Chronic disorders of young people

Page 8: Thomas R. Insel, M.D. Director, NIMH Rethinking Mental Illness: How Research Will Change Practice October 22, 2008

• Over 30,000 suicides per year (in the U.S.)

- 90% related to mental illness

Mental Disorders: Mortality

• For context:

• 18,000 homicides

• 20,000 AIDS deaths

• only 3 forms of cancer > 30,000

Page 9: Thomas R. Insel, M.D. Director, NIMH Rethinking Mental Illness: How Research Will Change Practice October 22, 2008

Public Health Impact:Early Mortality in Individuals with

Major Mental Illness (MMI)

0

5

10

15

20

25

30

35

Average Arizona Missouri Oklahoma RhodeIsland

Texas Utah

Ye

ars

of

Po

ten

tia

l Lif

e L

os

t

Adapted from Colton and Manderscheid, 2006, Prev Chronic Dis

• Data from outpatient and inpatient clientsdiagnosed with MMI

• Average age at time of death : 56 years

• Increased likelihood of dying from suicide

• Decreased likelihoodof dying from cancer

Page 10: Thomas R. Insel, M.D. Director, NIMH Rethinking Mental Illness: How Research Will Change Practice October 22, 2008

Disruptive InnovationsDisruptive InnovationsIn Mental HealthIn Mental Health

Mental disorders are brain disorders.

Mental disorders are developmental disorders.

Current treatments may be necessary but not sufficient for recovery.

Mental disorders result from complex genetic risk plus experiential factors.

Page 11: Thomas R. Insel, M.D. Director, NIMH Rethinking Mental Illness: How Research Will Change Practice October 22, 2008

Affect in Subgenual Cingulate (BA25)

Mayberg et al. Am J Psych 156:675-82 1999

increasedCBF/Met’b

decreasedCBF/Met’b

Depressed Affect

R

Cg25

Prefrontal 9

Cg25

Cg25

Depression Recovery

Cg25

Prefrontal 9

Page 12: Thomas R. Insel, M.D. Director, NIMH Rethinking Mental Illness: How Research Will Change Practice October 22, 2008

Non-Responders

FluoxetineResponders

Is Cg25 change necessary for antidepressant efficacy?

F9

Cg25

F9

hc

Cg25

hc

hchc

Cg25

pCg31F9

p

pCg31

Mayberg, 2006

Page 13: Thomas R. Insel, M.D. Director, NIMH Rethinking Mental Illness: How Research Will Change Practice October 22, 2008
Page 14: Thomas R. Insel, M.D. Director, NIMH Rethinking Mental Illness: How Research Will Change Practice October 22, 2008

oF11pACC24

mF9/10

PCCMCC

PF9/46 Par40PM6

sACC25

hth bstema-ins

amg mb-vta

hc

na-vst thal

SalienceMotivation

MoodstateSelf-awareness

insight

Cognition(attention-appraisal-action)

Interoception(drive-autonomic-circadian)

Defining Depression CircuitsResponse Pathways

Br Med Bul 65:193-207, 2003Arch Gen Psych 61:34-41-2004

CBT

PF

MF

MCC

MedsPF

P

Cg25

PCC

BS

MEDS

Page 15: Thomas R. Insel, M.D. Director, NIMH Rethinking Mental Illness: How Research Will Change Practice October 22, 2008

Disruptive InnovationsDisruptive InnovationsIn Mental HealthIn Mental Health

Mental disorders are brain disorders.

Mental disorders are developmental disorders.

Current treatments may be necessary but not sufficient for recovery.

Mental disorders result from complex genetic risk plus experiential factors.

Page 16: Thomas R. Insel, M.D. Director, NIMH Rethinking Mental Illness: How Research Will Change Practice October 22, 2008

Source: J Giedd, NIMH

Developmental Regression in the Brain

Page 17: Thomas R. Insel, M.D. Director, NIMH Rethinking Mental Illness: How Research Will Change Practice October 22, 2008

Schizophrenia as a Developmental Disorder

Page 18: Thomas R. Insel, M.D. Director, NIMH Rethinking Mental Illness: How Research Will Change Practice October 22, 2008

10 15 20 25

Age

# ofCortical

Synapses

Normal Development

Based on McGlashan and Hoffman (2000)

A Developmental Brain Model for Schizophrenia

Psychosis Threshold

Possible Paths to

Schizophrenia

Intervention

Page 19: Thomas R. Insel, M.D. Director, NIMH Rethinking Mental Illness: How Research Will Change Practice October 22, 2008

Genetic riskUnusual thought contentSuspicion/paranoiaSocial impairmentHistory of substance abuse

68-80% prediction

Arch Gen Psych, 2008

Schizophrenia: A Developmental Brain Disorder

Page 20: Thomas R. Insel, M.D. Director, NIMH Rethinking Mental Illness: How Research Will Change Practice October 22, 2008

Progressive Brain Structural Changes Mapped as Psychosis Develops in “At Risk” Individuals

Sun et al, Schiz Res., 2008

Page 21: Thomas R. Insel, M.D. Director, NIMH Rethinking Mental Illness: How Research Will Change Practice October 22, 2008

Schizophrenia TrajectoryStage 1: Presymptomatic, Risk factors,

Cognitive deficit with challenge [< Age 15]

Stage 2: Prodrome, cognitive deficits emerging, minor disability

Stage 3: Psychosis, acute disability,

family costs [Age 18 – 24]

Stage 4: Chronic illness, medical

complications, social costs [> Age 24]

1988

20082020

[Age 15 – 18]

Page 22: Thomas R. Insel, M.D. Director, NIMH Rethinking Mental Illness: How Research Will Change Practice October 22, 2008

Disruptive InnovationsDisruptive InnovationsIn Mental HealthIn Mental Health

Mental disorders are brain disorders.

Mental disorders are developmental disorders.

Current treatments may be necessary but not sufficient for recovery.

Mental disorders result from complex genetic risk plus experiential factors.

Page 23: Thomas R. Insel, M.D. Director, NIMH Rethinking Mental Illness: How Research Will Change Practice October 22, 2008
Page 24: Thomas R. Insel, M.D. Director, NIMH Rethinking Mental Illness: How Research Will Change Practice October 22, 2008

The Genomics Revolution

Human Genome Project (2003)Mapped 3 billion bases of DNA in human genome

…CTAGGCTTAAGCGGACCTGCTCTAGGTCAGTC….

Human HapMap Project (2005)Mapped all the common variations in the human genome

…CTAGGCTTAAGCGTACCTGCTCTAGCTCAGTC….3 million common Single Nucleotide Polymorphism (SNP)

Structural Variations in the Genome (2007)

…CTAGGCTTAGGCTTAGGCTTAGGCTTAAGCG

GACCTGCTCTAGGTCAGTC….

Page 25: Thomas R. Insel, M.D. Director, NIMH Rethinking Mental Illness: How Research Will Change Practice October 22, 2008

200520062007 first quarter2007 second quarter2007 third quarter2007 fourth quarterFirst quarter 2008 Second quarter 2008

Manolio, Brooks, Collins, J Clin Invest 2008; 118:1590-625.

Page 26: Thomas R. Insel, M.D. Director, NIMH Rethinking Mental Illness: How Research Will Change Practice October 22, 2008

Autism Genes: What do we know from association studies?

• CNTNAP2

• Neuroligins/Neurexins

• Shank3

• Wnt2

• GABA-B3• SLC25A12 (mit asp/glut carrier)

• MET (7q31)

Phenotype?

Page 27: Thomas R. Insel, M.D. Director, NIMH Rethinking Mental Illness: How Research Will Change Practice October 22, 2008

Autism as a Synaptic Disorder

AJHG 2008

Page 28: Thomas R. Insel, M.D. Director, NIMH Rethinking Mental Illness: How Research Will Change Practice October 22, 2008

Genomes Vary in Structure as well as Sequence

From Scherer et al, Nature 2007

Page 29: Thomas R. Insel, M.D. Director, NIMH Rethinking Mental Illness: How Research Will Change Practice October 22, 2008

Pathways to Pathophysiology

Meyer-Lindenberg & Weinberger, Nature Rev Neurosci, 2007

Page 30: Thomas R. Insel, M.D. Director, NIMH Rethinking Mental Illness: How Research Will Change Practice October 22, 2008

Disruptive InnovationsDisruptive InnovationsIn Mental HealthIn Mental Health

Mental disorders are brain disorders.

Mental disorders are developmental disorders.

Current treatments may be necessary but not sufficient for recovery.

Mental disorders result from complex genetic risk plus experiential factors.

Page 31: Thomas R. Insel, M.D. Director, NIMH Rethinking Mental Illness: How Research Will Change Practice October 22, 2008

Current Treatments: How Good?

CATIE (chronic schiz)

STEP-BD (Bipolar)

STAR*D (MDD)

Real world setting

Recovery of function

Practical questions

10,000 patients, 200 sites, 3 diseases, practical trials

Page 32: Thomas R. Insel, M.D. Director, NIMH Rethinking Mental Illness: How Research Will Change Practice October 22, 2008

• Schizophrenia: 74% discontinuation of anti-psychotics, limited access to psychosocial Rxs

• Depression: 31% remitted at 14 weeks, 67% at 1 year, limited access to CBT

• Bipolar: 21% stable for 8 weeks in first 6 months, high rates of medical co-morbidity

• Childhood disorders: dx prevalence increase 10-fold for autism, 40-fold for bipolar, no selective meds and few proven behavioral approaches

Current Treatments: How Good?

Page 33: Thomas R. Insel, M.D. Director, NIMH Rethinking Mental Illness: How Research Will Change Practice October 22, 2008

Practical Trials – What Did We Learn?

• We can optimize care in real world settings

• With optimized care, outcomes are not optimal

• Current treatments help too few people get better and very few get well

Page 34: Thomas R. Insel, M.D. Director, NIMH Rethinking Mental Illness: How Research Will Change Practice October 22, 2008

NIMH MissionTo transform the understanding and treatment of mental illnesses

through basic and clinical research, paving the way for

prevention, recovery, and cure.

Page 35: Thomas R. Insel, M.D. Director, NIMH Rethinking Mental Illness: How Research Will Change Practice October 22, 2008

NIMH Strategic Plan•Strategic Objective #1: Promote Discovery in the Brain and Behavioral Sciences to Fuel Research on the Causes of Mental Disorders

•Strategic Objective #2: Chart Mental Illness Trajectories to Determine When, Where and How to Intervene

•Strategic Objective #3: Develop New and Better Interventions for Mental Disorders that Incorporate the Diverse Needs and Circumstances of People with Mental Illness

•Strategic Objective #4: Strengthen the Public Health Impact of NIMH-Supported Research

Page 36: Thomas R. Insel, M.D. Director, NIMH Rethinking Mental Illness: How Research Will Change Practice October 22, 2008

NIMH Strategic Plan

•Strategic Objective #1: Promote Discovery in the Brain and Behavioral Sciences to Fuel Research on the Causes of Mental Disorders

Genes to circuits to behavior cycleGenomics and epigenomicsDevelopmental neuroscience

Page 37: Thomas R. Insel, M.D. Director, NIMH Rethinking Mental Illness: How Research Will Change Practice October 22, 2008

Strategic Objective #2: Chart Mental Illness Trajectories to Determine When, Where and How to Intervene

NIMH Strategic Plan

Predictive biosignatures

Longitudinal designs

Individual risk

Page 38: Thomas R. Insel, M.D. Director, NIMH Rethinking Mental Illness: How Research Will Change Practice October 22, 2008

NIMH Strategic PlanStrategic Objective #3: Develop New and Better Interventions for Mental Disorders that Incorporate the Diverse Needs and Circumstances of People with Mental Illness

Rational therapeutics

Preemptive and personalized interventions

Moderator trials

Page 39: Thomas R. Insel, M.D. Director, NIMH Rethinking Mental Illness: How Research Will Change Practice October 22, 2008

NIMH Strategic PlanStrategic Objective #4: Strengthen the Public Health Impact of NIMH-Supported Research

Participatory research

Impact on practice

Health disparities

Page 40: Thomas R. Insel, M.D. Director, NIMH Rethinking Mental Illness: How Research Will Change Practice October 22, 2008

NIMH Strategic Plan•Strategic Objective #1: Promote Discovery in the Brain and Behavioral Sciences to Fuel Research on the Causes of Mental Disorders

•Strategic Objective #2: Chart Mental Illness Trajectories to Determine When, Where and How to Intervene

•Strategic Objective #3: Develop New and Better Interventions for Mental Disorders that Incorporate the Diverse Needs and Circumstances of People with Mental Illness

•Strategic Objective #4: Strengthen the Public Health Impact of NIMH-Supported Research

Page 41: Thomas R. Insel, M.D. Director, NIMH Rethinking Mental Illness: How Research Will Change Practice October 22, 2008

Yes, but this year the answers are completely different.

But Professor Einstein, these are the same questions you used on last year’s exam?

Page 42: Thomas R. Insel, M.D. Director, NIMH Rethinking Mental Illness: How Research Will Change Practice October 22, 2008

www.nimh.nih.govwww.nimh.nih.gov

Paving the Way for Prevention, Recovery, and Cure

Page 43: Thomas R. Insel, M.D. Director, NIMH Rethinking Mental Illness: How Research Will Change Practice October 22, 2008

Then (1998)

Mechanism: Chemical imbalance

Treatment: First generation

Diagnosis: Unitary

Now (2008)

Diagnosis: Categorical but co-morbid

Mechanism: Brain circuit dysfunction

Treatment: Second generation

Imagine (2018)

Diagnosis: Dimensional

Mechanism: Genes to behavior

Treatment: Personal & pre-emptive

RE

SEA

RC

H