the parish community of the annunciation b.v.m. · dent recipient of the scholarship or allow us to...
TRANSCRIPT
The Parish Community of the Annunciation B.V.M. Merged with St. Rita of Cascia Parish
(Partnered with St. Nicholas of Tolentine Parish) Staffed by the Augustinians
1511 South 10th Street, Philadelphia, PA 19147
Rectory: 215-334-0159 Fax: 215-462-5065
WEB: www.annunciationbvmchurch.org www.stnicksphila.com
Pastor: Rev. Nick Martorano, O.S.A.
Parochial Vicars: Rev. Robert Terranova, O.S.A.
Rev. Juan Alberto Cardenas Ruiz, O.S.A. Temporary Parish Secretary
Frank Franzini Schedule: Confession
Saturday: 4:30-5:00 PM Or anytime by Appointment
Masses:
Saturday Vigil: 5:00 PM
Sunday: 11:00 AM (English)
9:00 AM & 4:00 PM (Spanish) HOLY DAYS:
7:30 & 9:00 AM & 7:00 PM
Sacramental Information: Baptism:
Arrangements in Rectory Office (Baptism Instruction Required)
Marriage: Six Months Preparation
Call Rectory Office for Arrangements
(Pre-Cana Classes Required)
Rectory Hours: Mon-Wed: 9AM-2PM
Thurs: 9AM-1PM Fri: 9AM-12Noon
127 page 1
March 14, 2021 – Fourth Sunday of Lent “Annunciation BVM is a faith-filled Catholic Community fostering hope and practicing charity.” We welcome all new parishioners and encourage you to join our faith community by registering at the Rectory Office
Saturday 03/13 5:00 p.m. Elaine Piselli - Given with Love, the Piselli Family Sunday 03/14 Fourth Sunday of Lent 9:00 a.m. Spanish
11:00 a.m. Dawn Ioven - America Flores & Anibal Ayala 4:00 p.m. Spanish Monday 03/15 7:30 a.m Ernie Ferrigno - Family 7:00 p.m. Spanish (Upper Church) Tuesday 03/16 7:30 a.m. Margaret Feoli - Cathy Sampere
Wednesday 03/17 St. Patrick, Bishop 7:30 a.m. Carmella Cappello & Margaret Feoli - Cappello Family 7:00 p.m. Stations Thursday 03/18 St. Cyril of Jerusalem, Bishop & Doctor 7:30 a.m. Rose Pantalone - Terri Mangini & Theresa 4:00 p.m. Spanish (Upper Church) Friday 03/19 St. Joseph, Spouse of Blessed Virgin Mary 7:30 a.m. Joseph Zungolo - Daughter, Sue & Son, Joseph Saturday 03/20 5:00 p.m. Larry Piselli - Given with Love, the Piselli Family Sunday 03/21 Fifth Sunday of Lent 9:00 a.m. Spanish 11:00 a.m. Barbara Fanelli - Family 4:00 p.m. Spanish
FROM TODAY’S GOSPEL READING
For God so loved the world that God gave His only Son, so that everyone who believes in Him might not perish, but might have eternal life. ***********************************************************************************************************************************************************
Malvern Retreat Center in Malvern, PA is hosting a Retreat—Grief to Grace: Healing the Wounds of Abuse from March 21st through March 26th, 2021. The program offers a very unique proc-ess for helping victims of abuse in childhood and adolescence to grieve the past and discover spiritual healing and transformation. Grief to Grace provides professional therapeutic staff. All treatment is based on a firm Christian Foundation as well as sound medical and psychological principles and an understanding of trauma. Visit www.grieftograce.org for more info or call 610-427-1187. **************************************************************************************************************************************************************
Spiritual Getaway Weekend-Marianist Family Retreat Center in Cape May Point, NJ will host a retreat from March 26 to MarcH 28. This retreat is an opportunity to create your own spiritual ex-perience. You can walk the beaches and nature trails or just sit out on the porch to read and reflect. Daily Mass and all meals are pro-vided, otherwise your time will be your own. Cost: $140/pp (single rooms only). For more info, please call Anthony Fucci, Center Di-rector at 609-884-3829 or visit our website at www.capemaymarianists.org or email us at [email protected]
MARCH 14, 2021
PLEASE PRAY FOR OUR SICK AND MILITARY:
PERSONS SERVING OUR COUNTRY: If you know anyone who is serving our country, please call the Rectory so we can add them to the prayer list.
OUR LIST: Larry DeLizio, Daniel McGowan, Julio Pontes, Midge Enrico-Caruso, Andrew Longo, Tom Hart, Gabarella Nigro,USN, Peter R. Amato, Dale Cardile, Sal Cardile, April Di Giovanni, Patricia Iraci, Rose Nardo, Brian Anderson, Susan Valtri, Kevin Sullivan, Tony Greco, Fran Mc Cal-lion, Patricia Cara, Renee Gibson, Walt Harrington, Angie Deasey, Theresa Scelsa, Patti Taronni, Alfie Morrone, Cynthia Cozenza, Amanda Lutek (Armed Forces), Cathy Sampere, Kathleen Taylor, Anna Grubb, Charlie Moore, Teddie Bottos, Anna Sponheimer, Charles Matthew Solo-mon (Army), Ellen Thorn, Josephine Zampirro, Jean Hill, Bob Veneziano, Dinah White, Dawn Marie Hirsch, Rev. Orlando Cardona C.M., Diana Palamone, Rebecca Miller, Mary Di Arenzo, Dolores Di Sabatino, Carol Shipley, Paula Ferrazzano, June Lawrence, Nina Darlene, Stephanie Liberi, Cathy D’Alfonso, Tim Mulvenna, Domenic Galiano D”Ettore, Rose Fawcett, Rita Colella, Michael Colella, Robert Colella, Denise & Bob Berg, Joe Romano, Bernadette Faragalli, Kathy Maldonado, Joseph Giordano, M.D., Leonard and Joanne Di Pietro, J.R. Castaldi, Richard Lanzillotti, Inez D’Amore, Jean Braccili, Eileen Massarella, Louis Ragusa family. Also, please pray for those seeking jobs. Please call the Rectory to add or remove a name on this list.
127 page 2
**************************************************************************************************************************
ST. ANTHONY OF PADUA REGIONAL CATHOLIC SCHOOL 913 Pierce St., Philadelphia, PA 19148 215-468-0353 WE ARE ACCEPTING REGISTRATIONS FOR 2021-2022 NOW!
For Pre-K, Kindergarten, and new Registrants VISIT OUR WEBSITE!! www.stanthonyofpaduarcs.org or call the above school phone number Find us on Facebook & Instagram ************************************************************************************************************************************************************************
ANNUNCIATION BVM CLOTHING DRIVE
Annunciation BVM parish will be hosting a Clothing Drive on Tuesday, March 30th from 9AM to 1PM. Please place your donations of usable men’s, women’s and children’s clothing in plastic bags or boxes. Household items such as: kitchenware, games/toys, small appliances under 30 pounds, electronics, sporting goods, books, CD’s and videos are also accepted. Furniture, large appliances, TV’s, or computer moni-tors cannot be accepted. A GreenDrop truck and driver will be near the church to help you with your donations. ******************************************************************************************************************************************************************************
DYNAMIC CATHOLIC-BEST LENT EVER! Sign up for this free program beginning Ash Wednesday and continuing all 40 days of Lent. You’ll receive a daily email with a short video to help you reconnect with yourself and with God. This year’s “Best Lent Ever” will journey through Mat-thew Kelly’s book, “ I Heard God Laugh.”Go to [email protected] to sign up for this program. ****************************************************************************************************************************************************************************** FORMED-CATHOLIC FAITH FORMATION
Start watching for free today. This is our Parish gift to you. Visit Formed.org and register using our Parish Code e7760b. You will be amazed at what is available to you free for your spiritual/religious en-richment. Programs, Books, Movies and Audios. Don’t hesitate any longer!! You can watch all year round! ***************************************************************************************************************************************************************************** FORMED-DAILY LENTEN REFLECTION
This Lent, we invite you to journey with Dr. Tim Gray by signing up for FORMED Daily Lenten Reflections at formed.org/lent. Each day, you will receive in your inbox a short video which features Dr. Gray com-menting on the daily Mass readings, explaining the Scriptures, and providing you with concrete ideas on how to apply them to your Chris-tian life. Sign up today for free by visiting formed.org/lent! ****************************************************************************************************************************************************************************
*WEEKLY SUNDAY COLLECTION TOTAL-Mar.7-$ 2,881.00
Your continued support of our parish is greatly appreciated!
PARISH & COMMUNITY NEWS STATIONS OF THE CROSS
Stations of the Cross will be in the Chapel on Wednesdays dur-ing Lent at 7PM. Confessions will be heard after stations. ******************************************************************************************************************************************************* Watch Weekly Sunday Mass!
Please use the St. Nicholas of Tolentine website which is on the front of the bulletin, www.stnicksphila.com, to see videos made for Weekly masses which were taped in the ABVM church or at St. Nicholas of Tolentine. ******************************************************************************************************************************************************
TEMPORARY MASS SCHEDULE:
SATURDAY English 5PM SUNDAY Spanish 9AM
English 11AM
Spanish 4PM
Thank you for your kindness and look for more information as it becomes available. We are happy to be able to worship together, but always remember that safety for yourself and others is es-sential. God Bless you. Fr. Nick ********************************************************************************************************************************************************** BEGIN DATE: 03/13/2021 END DATE: 03/19/2021
SACRED HEART CANDLE IN CHURCH
IN LOVING MEMORY OF ANTOINETTE LAUER
FROM: GINA HEIMAN ************************************************************************************************************************************************************** OUR DECEASED PARISHIONERS AND LOVED ONES Please remember in your prayers our deceased parishioners and loved ones who have passed this year. May they rest in Peace.
Christopher J. Polidoro All those from the CoronaVirus **************************************************************************************************************************************************************
Mother Boniface Spirituality Center invites you to a Women’s Morning of Prayer on Zoom on Saturday, March 20,2021 from 9:30-11:00AM as we look at the Stations of the Cross through the Eyes of the Women Who Were There. How can we prepare our hearts to participate fully in the final days of Lent—Passiontide and Holy Week? Our traditional way is to make the Stations of the Cross. So this morning, we will contemplate the Stations through the eyes of the women who were there. This interactive prayer experience is a free will offering program. *************************************************************************************************************************************************************
THE YEAR OF ST. JOSEPH-ARCHDIOCESAN NOVENA TO ST. JOSEPH will take place from March 19,2021 through November 19, 2021 after the 7:30 AM mass. The praying of this Novena is to unite everyone in the Archdiocese of Philadelphia on the 19th of each month, from March through November, 2021 in a single petition of confident prayer to the Lord through the heavenly intercession of St. Joseph. Please keep in mind the monthly Archdiocesan intention which, for March 19 is: For the local Church in the Archdiocese of Philadelphia and for a greater fidelity to the demands of the Gospel on the part of all. ******************************************************************************************************************************************************************
ARCHDIOCESAN NOVENA TO ST. JOSEPH-MARCH 19-NOVEMBER 19 The Novena to St. Joseph can be prayed in any setting especially before or after Mass, but not part of Mass; and also in the family home. [When prayed apart from Holy Mass; Leader: We read in the Holy Gospel Matthew 1:16, 18-21,24a)
Jacob was the father of Joseph, the husband of Mary. Of her was born Jesus Who is called the Christ.
Now this is how the birth of Jesus Christ came about. When His mother, Mary was betrothed to Joseph, but before they lived together, she was found with child through the Holy Spirit. Joseph, her husband, since he was a righteous man, yet unwilling to expose her to shame, decided to divorce her quietly. Such was his intention when, behold, the angel of the Lord appeared to him in a dream and said, “Joseph, son of David, do not be afraid to take Mary, your wife, into your home. For it is through the Holy Spirit that this child has been conceived in her. She will bear a son and you are to name Him Jesus, because He will save His people from their sins.” When Joseph awoke, he did as the angel of the Lord had commanded him and took his wife into his home.
Leader: The Gospel of the Lord. All: Praise to you, Lord Jesus Christ.]
Leader: Let us pray.
O Saint Joseph, Spouse of the Blessed Virgin Mary and Foster Father of the Divine Child, Jesus, you were entrusted as the protective guard-ian of the Holy Family in Nazareth. Give today this same protection to the family of the Church in the Archdiocese of Philadelphia.
Intercede with Christ before the Father of us all: For the clergy and faithful; for married couples and single men and women; for all those in the consecrated life; for families and young peo-ple; for the poor, the lonely and neglected; for all the sick, suffering and dying. For a deepening of our spiritual life; for a strengthening of the moral life; for a bolder witness to the truth of the Gospel.
For all of us, St. Joseph, with you as our firm example, may we remain confident in the plan of the Father for us, with lives of faith rooted in the saving death and resurrection of His Son and ever faithful to the de-mands of the Christian life with the grace of the Holy Spirit. Through Christ our Lord.
All: Amen.
Leader: St. Joseph, patron and protector of the Universal Church. All: Pray for us!
If circumstances permit, the Litany of St. Joseph may be added to the Novena Prayer. LITANY OF ST. JOSEPH
Leader: Lord, have mercy/Christ, have mercy/Lord, have mercy All: Lord, have mercy/Christ, have mercy/Lord, have mercy
Leader: God our Father in Heaven/God the Son, Redeemer of the world/ God the Holy Spirit/Holy Trinity, one God
All: Repeat “have mercy on us” after each of the above.
Leader: Holy Mary/St. Joseph/Noble son of the House of David/ Light of patriarchs/ Husband of the Mother of God/ Guardian of the Virgin/Foster father of the Son of God/ Faithful guard- ian of Christ/Head of the holy family/Joseph, chaste and just/ Joseph, prudent and brave/ Joseph, obedient and loyal/ Pattern of patience/Lover of poverty/Model of workers/ Example to parents/Guardian of virgins/Pillar of family life/ Comfort of the troubled/Hope of the sick/Patron of the dying/ Terror of evil spirits/Protector of the Church
All: Repeat “pray for us” after each of the above.
127 page 3
ROMAN CATHOLIC HIGH SCHOOL SPRING OPEN HOUSE
Attention all 6th, 7th, and 8th grade boys! Roman Catholic High School will be holding an in-person Open House on Sunday, March 21 from 11:00 AM-1:00 PM. Come join us to discover all that Roman has to offer in academics, athletics, and other extracurricular activi-ties. Because of COVID precautions, PRE-Registration is required-we are not able to accommodate walk-ins for this event: https://romancatholichscom.finalsite.com/admissions/important-dates If you have any questions, please contact our Director of Admissions and Communication Tom Bottoms ’10 [email protected] **************************************************************************************************************************************************************
TO YOU, O BLESSED JOSEPH
To you, O blessed Joseph, do we come in our afflictions, and having implored the help of your most holy Spouse, we confidently invoke your patronage also. Through that charity which bound you to the Immaculate Virgin Mother of God, and through the paternal love with which you embraced the Child Jesus, we humbly beg you graciously to regard the inheritance which Jesus Christ has purchased by His Blood, and with your power and strength, to aid us in our necessities. O most watchful guardian of the Holy Family, defend the chosen chil-dren of Jesus Christ; O most loving father, ward off from us every contagion of error and corrupting influence; O our most mighty pro-tector, be kind to us, and from heaven, assist us in our struggle with the power of darkness. As once you rescued the Child Jesus from deadly peril, so now protect God’s Holy Church from the snares of the enemy and from all adversity; shield too each one of us by your constant protection, so that, supported by your example and your aid, we may be able to live piously, to die in holiness, and to obtain eternal happiness in heaven. Amen.
BOLETIN EN ESPAÑOL
127 page 4
127 - Annunciation BVM, Philadelphia, PA INSIDE (Rte. C) John Patrick Publishing Company • 1-800-333-3166 • www.jppc.net
Private & Public Healthcare - Law Enforcement, Public Safety - Offi cers & First Responders - Food & Agri-culture - Energy Sector - Waste & Waterwaste - Transportation & Logis-tics - Public Works & - Infrastructure - Communications & Information Technology Workers - Community & Government Workers - Critical Man-ufacturing - Chemical & Hazardous Materials Financial Services - Defense Industrial Base - Commercial Facili-ties Workers - Residential & Shelter Services & Facilities - Hygiene Prod-ucts & Services - Private & Public Healthcare - Law Enforcement, Public Safety - Offi cers & First Responders - Food & Agriculture - Energy Sec-tor - Waste & Waterwaste - Trans-portation & Logistics - Public Works & - Infrastructure - Communications & Information Technology Workers - Community & Government Work-ers - Critical Manufacturing - Chemi-cal & Hazardous Materials Financial Service - Private & Public Healthcare - Law Enforcement, Public Safety - Of-fi cers & First Responders - Food & Agriculture - Energy Sector - Waste & Waterwaste - Transportation & Logis-tics - Public Works & - Infrastructure - Communications & Information Technology Workers - Community & G W k C i i l M
To all those essential workers keeping us safe,
yourservice is
invaluable & appreciated.
afety --- OffiOffiOffiOffiOffiOffiOffiOffiOffiOffiOffiOffiOffiOffiOf cercercercercececeFirst Responders - Food & d & d & d &d &d &d &d &d &d d d d d d AgAgAAAAgAgAgAgrAgrAgrAgAgAgrAg
y Sector - WaWaWaWaWaWaWaWaWaWaWaWaWaWaWastestestestestesteteestestestestestestest &Waterwaste - Transportatatatttttttttion ionion ionioionion ioniononion onion & L& L& L& L& L& L& L& Lo& L& L& L& L& & gis
cs - Public Works & - Infrnfrnfrnfrnfrnfrnfnfnfnfnfrnfrnfrnfrnfrastructuucucucucucucuc rCommunications & IIIIIIIIIIIIIIInfornfornfornfornfornfornfornfonfornfornfornfornfornfornformatimammmmmmammmmmm o
echnology Workers - ComComComComComComComComComComComComComComCommunimumumummmmmmm ty &Workers -s -s -s -s -s -s -s -s -s -s --- CriCriCriririririiiiriiticacaticacacaticaticaticaticaticaticaticaticaticatical Ml Ml Ml Ml Ml Ml Ml Ml Ml Ml Mal l Ml M n
acturing - Chemical &&&&&&&&&&&l & l & l &l & HazaHazaHazaHazaHazaHazaHazaHazaHazaHazaHHHH rdourdrdrdrdrdrdrrdrdrdrdncial Services - DDDDDDDDDefeeeeeeefefens
dustrial Base - Commercial Faciles Workerssrssssss - RResidesidesidesidesidesidesidesididesidesidesidesideentientientientientientientientientiential &aaaaaaaa Shelteervices & FFFFFFFFFFFFFFFaciaciacilacilacilacilacilacilacilcilaciacilacilacilacilitieitieitieitieitieitietieitietieitieies -s -s - - - - - HyHyHygiHyHyHyHyHyHyHyHyHH ene Prodcts & Services es esesesesesesesesessss - Pr- Pr- Pr- Pr- Pr- Pr- Pr- Pr- Pr- Pr- Pr- Pr- Priiiiivivivivivivivaivaivativ e & Publiealthcare - Lawawawawawawawawawaw EnfEnfEnfnfnfnffnfnffffffforcorcorcorcorcorcorcorcorcorcorcorceorc ment, Publiafety - Officercercercercerererercercers &&&s &s &s &s &s &s &s &s &s &s &s &s & FiFiFiFFirsFFFFFFFFF t ResponderFood & Agrgrgrgrrrrriculiculiculiculiculiculiculiculiculiculicuiculiculicic turturturturturturureturturturturturtutut - Energy Secr - Waste e eee ee & Wa& Wa& Wa& Wa& Wa& Wa& Wa& Wa& Wa& Wa& Wa& Wa& Wa& Wa& ttttterwtttettt aste - Trans
ortation &&&&& & & & & &&&&&& LogiLogiLogiLogiLogiogiogiogiLogiLogLogLogiLogLogLog stististststststisticststststsss s - Public Work- Infrastrtrrrrrrrrrrrrrrucucucucucuctctctuucucucucuctucuc re -e e e ee e CommunicationInformatioatioatioiooooooioooooonnn Tn Tn Tn Tn Tn Tn Tn Tn Tn Tn Tn Tn Technology Worker
CoCoCoCoCoCoCoCoCoCoCoCoCoCoCommunmmunmmunmmunmmunmmunmmunmmunmmunmmunmmunmmunmmunmmunmmunity ity ity ity ity ity ity ity ity ity ity ity ityityity & Go&&&&&&&&&&& vernment Works - CrCrCrCrCrCrCrCrCrCrCrCrCrCrCriticiticiticticiticiticticiticiticticiiticiticiticitical al Mal Mal Mal Mal Mal Mal Mal a anufacturing - Cheml l ll & Ha& Ha& H& H& H& H& H& H& H& H&&&&& zardzardzardzardzardzardardardardardardardzardardardooooooous ooooooo Materials Financia
ervrvrvvvvice ice ice ice ice iceicicice icicicicicic - P- Pr- Pr- P- P- P- P- - - P- - - - ivativaivivvvvvvv e & Public HealthcarLaw EnEEE forcforcforcffforcforcforforcforcforcforceement, Public Safety - O
To all those nforcement, Public Sanforcement, Public Sa
essentiallture - Energylture - EnergyWater aste TraWater aste Tra
workerscs - Public Wors - Public WorCommunicatioCommunicatio
keeping echnology Wochnology Woovernment Wovernment W
us safe,acturing Caterials Finanaterials Finan
yournicationnicationWorkerWorke
service isovernment Workovernment Workacturing Chemacturing Chem
invaluable &us Materials Financiaus Materials Financiae & Public Healthcare & Public Healthcar
ment, Public Safety - OSafety - Othan
k yo
u
g gyWatateatttatatatattaaaaaa rwaswaswawaswwaswwwwaswwaswwwwasswasawawaw ste -tettttttetttee Transportation & Log
cccscccccc - PPPPPPPPPPPPPPPubliubliubliubliublililublibubbliubuubuuubu c c WoWoc WoWWWoWoWoWWoWWWoWc oc WoWWc Woc WWc WWWWccc rks rksrrksrkskrrkkkkrrk & - & -& -&& -&& -&&&&&&& --&&&& -&&& -&&& InfrInfInfrnfrInfInfrnfrII ffI ffInI fnfI fInfnfInnfnfn astructuCCoCoCoCoCoCoCCoCCoCCCCoooCCCCCCC mmunmmunmmmmmmunmm nmmmm nmmmmm nmmmm nnm nm nmmmm nicaticacaticaticatcatcatcatcattcatcatcatcattcatcatcatccacatcccatcc ionsionsionsnsionononsonsiooionssonsonsonsionoonoooon & I&&& I&& I&&& I& II& I& I& I&& nfornfornfornfornfornforforfornfornfoforfnfnfornfornfornfornforfofornfornforrrrnnffforrrmatimatimatmatmatiamatimatmattimatiatitimatiattatmatmatimattattmattmmmati
echhhhhhhhhnolonononoonnoloonolonnoln lonnolonooolonolonolonnnn on oonoo ggy Wgggg orkers - Community
Local, trusted, proven, effective, supportive, referrals, relationships, affordable, repetitious, versatile, lasting.
This describes the power of...
Placing an ad in the parish bulletin supports the parish while building your business - THAT’S A WIN WIN!
Call 1.800.333.3166 TODAY!
RIDESHAREZONES
A
M
I#WHATSMYNAME
toptop
sksk
atchatch
nformnform
Advertise Your Business Here800-333-3166
ext. 161or visit
www.jppc.net
Support Our Advertisers!
SHOP LOCAL • EAT LOCAL • ENJOY LOCAL
Support Our Advertisers!
127 - Annunciation BVM, Philadelphia, PA BACK (Rte. C) John Patrick Publishing Company • 1-800-333-3166 • www.jppc.net
JEFCO Since 1950Windows • AWNINGS • DoorsFor Your Home or BusinessDistinctive Doors & Windows
Drapes • Shades • BlindsFREE ESTIMATES
5000 Paschall Ave., Philadelphia215-334-3220
jefcoawnings.com
"A face you can recognize with a reputation for excellence"
2237-41 S 3rd St.Philadelphia, PA 19148
Murphyruffenachfuneralhome.com
215-334-1578
Brian W. DonnellySupervisor
Winner of the "Civilian of the Year" by the Veterans Advisory Commission.
Voted best of Philly 2018.
Se Hablo Español.
2509 South 4th Street Philadelphia
215-271-1080www.stmcrehab.org
Physical, Occupational & Speech Th erapyShort & Long Term Care
Beautiful On-Site Chapel with Daily MassRespite Stay Available
We Care and It Shows
We AcknowledgeWe Appreciate $350
OffAny New Stairlift
With This Ad• FREE in home
evaluations
• Family owned & operated for more
than 20 years
1.888.900.8883www.Tri-StateStairlifts.com
Mallory’s Army FoundationUnited Together In The Fight Against Bullying...
Don’t Just Teach Kindness... BE KINDNESS!www.MallorysArmy.com
(973) 440-8657 • [email protected] It’s easy to join our mailing list! Just send
your email address by text message: Text MALLORYSARMY to 22828 to get started.
Message and data rates may apply.
Connecting businesses to customers in realtime!