the minimal duplex dna sequence required for site-specific

Volume 14 Number 12 1986 Nucleic Acids Research

The minimal duplex DNA sequence required for site-specific recombination promoted by the FLPprotein of yeast in vitro

Gerald Proteau, Deborah Sidenberg and Paul Sadowski

Department of Medical Genetics, University of Toronto, Toronto, M5S 1A8, Canada

Received 9 April 1986; Revised and Accepted 21 May 1986

ABSTRACTThe 2-micron p i i r a i d of tho yeast Saccharomvces c e r e v l s i a e code* for a

s i te-speci f ic reconbinase ('FLP') that ef f ic ient ly catalyses recombinationacross the plasmid's two 599 bp repeats both jjj vivo and .is vitro. We haveused the partially purified FLP protein to define the minimal duplex DNAsequence required for intra- and intermolecular recombination J_£j vitro.Previous DNase footprinting experiments had shown that FLP protected 50 bpof DNA around the recombination s i t e . We made BAL31 deletions and syntheticFLP s i tes to show that the minimal length of the s ite that was able toreconbine with a wild-type site was 22 bp. The site consists of two 7 bpinverted repeats surrounding an 8 bp core region. We also showed that thedeleted s i tes recombined with themselves and that one of three 13 bprepeated elements within the FLP target sequence was not necessary forefficient recombination _in vitro. Mutants lacking this redundant 13 bpelement required a lower Mount of FLP reconbinase to achieve naxinal yieldof recombination than the wild type s i t e . Finally, we discuss the structureof the FLP site in relation to the proposed function of FLP recombination incopy number amplification of the 2-micron pi aim id in vivo.

INTRODUCTION

S i t e - s p e c i f i c recombination has been implicated in the control of gene

express ion in several prokaryotic organisms (1-5) and i s a l so thought to

play an important ro le in express ion of antibody d i v e r s i t y (6) and d i v e r s i t y

of genes for T-ce l l receptors (7 , 8 ) . A d i rec t approach to understanding

the mechanisms of s i t e - s p e c i f i c recombination i s to purify prote ins involved

in reconbination and to study the ir i n t e r a c t i o n s with the s i t e s at which

recombination events occur.

In v i t r o s i t e - s p e c i f i c recombination systems have been developed for

several prokaryotic recombination events (5, 9, 10, 1 1 ) . Such a de ta i l ed

ana lys i s i s currently being performed on the eukaryotic s i t e - s p e c i f i c

recombinase encoded by the 2 micron c i r c l e DNA of yeast (12, 13, 1 4 ) . This

6318 bp plaamid has two precise 599 bp inverted repeats which divide the

c i r c l e into two unique regions (15 ) . i s v ivo , e f f i c i e n t recombination

© IR L Press Limited, Oxford, England. 4787

Downloaded from https://academic.oup.com/nar/article-abstract/14/12/4787/1136315by gueston 12 April 2018

Nucleic Acids Research

occurs icrot i these repeated sequences generating two isomers (A and B

forms) of 2 micron pi aim id DNA. These forms differ froo one another in the

relative orientation of the two unique regions. Broach and his coworkers

(16, 17) have shown that this recombination event requires an intact FLP

gene, the largest open reading frame on the plasoid, as well as a 65 bp

region within the large 599 bp inverted repeats.

The FLP gene has been cloned into both Saccharomvoes cerevisiae and

Etcherichia col i expression vectors (12, 13, 14, 18). Subsequently, assays

were developed that demonstrated efficient _in vitro recombination and

allowed the purification of the FLP recombinase (12, 14, 19).

The FLP recombinase protects approximately 50 bp of duplex DNA from

digestion with pancreatic DNase (20). This region contains an 8 bp core

sequence surrounded by three 13 bp symmetry elements (Figure 1) . The two

symmetry elements surrounding the 8 bp core are in inverse orientation

(elements 'a' and 'b ' . Figure 1) . The third element is in direct

orientation with one of these two elements (element 'c' to the le f t in

Figure 1 ) . The FLP enzyme introduces single strand breaks at the margins of

the core (vertical arrows in Figure 1) and these breaks are the presumed

sites of strand exchange.

One of the important questions regarding the FLP sequence is the sixe

of the Minimal duplex DNA required for efficient recombination.

Gronostajski and Sadowski (21) used exonuclease digestion to carry out an

analytical study that defined the minimal duplex requirement for

recombination (boxed region in Figure 1) . These studies made use of

exonuclease s that degraded a single strand of the duplex DNA from a unique

Nucleate Protected Region

5 ' ,T- b

QCTTTGAAGTTCCTATTCCGIAAGTTCCTATTCTCTAGAAAGTATAGIGAACTTCAG 3'

3,CQAAACTTCAAGQATAAGGCTTCAAQ)GATAAQAQATCTTTCATATqCTTGAAGTC5.

i t F L P Cleavage sites — 1 3 b p Repeats f^J Minimal Duplex DNA Sequence

Figure 1. DNA sequences involved in FLP-aediated recombination.The braoket above the sequence shows the region of the s ite protected

from DNase digestion in the presenoe of FLP (20). The thiok horixontalarrows denote the three 13 bp symmetry elements surrounding the 8 bp core.They are labelled 'a ' , 'b' and 'c ' from right to l e f t . The thin verticalarrows at the margins of the core indicate the FLP-mediated cleavage s i tes(20) . The boxed sequence represents the minimal DNA sequence required forFLP—mediated recombination (21) as defined by exonuclease digestion.

4788



PGP25, pQP45:two dHI«r*nt B-E

bt*«f1s tn pOCO

B

PGP10: B-B Insert

mpuce

P G P 7 O : B - B kuart+ H-H m»rt

!pGP72: B-x hurt

*H p<>£\pGPOGA, pQPATA:ytoo dllt.r.nl 3-8

Mftt lii pUC9

| pOSGi pOPOQA+ H-H Fn^rt

POSA6: pQPAT*

Figure 2. Construction of the plasmids containing the recombination s i tesof interest.

A. Plasmids pGP25 and pGP43 consist of the BanHI-EcoRI fragmentcontaining the BAL31-deleted FLP s i tes from pGPll and pGP20 respectively(20) which were cloned into the BamHI-EcoRI s i tes of the poly 1 later of pUC9(see Table 1, l ines 3 and 4 ) .

B. A synthetic oligoaer which contained a FLP half -s i te bounded by aBamHI sticky end on the le f t and an i t s I sticky end on the right was clonedinto plasmid pBAlll that had been cut with BamHI and Xt§I to give pGPl/2(see Table 1, line 5 ) . A 912 bp Hindlll fragnent containing the entire 599bp repeat region of 2 micron DNA was then cloned into the Hindlll s i te ofpGPl/2 in both direct (pGP72) and inverse orientations (pGP73) .

C. A 32 bp synthetic FLP si te having BamHI sticky ends was cloned intothe BaaHI s i te of the polylinker of pCC9 to give pi am id pGPIO (see Table 1,line 6 ) . The 912 bp fragment used in the previous construction was clonedinto this plasmid in direct orientation to generate plasmid pGP70.

D. Synthetic oligoaers having Sail sticky ends were oloned into theSail s i te of the polylinker of pUC9 to generate pGPGGA and pOPATA (see Table1, lines 7 and 8 ) . The 912 bp fragment was then cloned in directorientation into each of these plasmids to give plasmids pDSG2 and pDSA6.

The arrow indicates the direction of the FLP s i t e . Restriction enxymes i t e s : B - BamHI. E = fitflRI, X - Jfeal, P - P_i_tl, H - Hindlll and S - Sail .

terminus (J£. col i exonuclease III and T7 gene 6 exonuclease). Hence the

recombination substrate consisted of a duplex DNA with a single stranded

t a i l . In order to corroborate these studies using fully duplex DNA, BAL31

exonuclease deletions of the FLP site and fully art i f ic ia l FLP s i tes using

synthetic oligonucleotides were made. In this study, we have tested the

abil i ty of these s i tes to function as substrates for FLP-mediated

recombination. We also address the possible function of the third 13 bp

symmetry element (element 'c') in regulation of the recombination reaction.

4789



MATERIALS AND METHODS

Str»in»

E. c o l i HB101 ( r k ~ , m^, recA") «nd I . c o l i JM83 (a£a, lac . -pro , .Hr. A,

t h i . 8Odlac Z M15 (22) were obtained from J. F r i e s e n .

Plaamid c o n i t r n c t i o n

BAL31 n u c l e a s e - d e l e t e d p lasmids , pGPll and pGP20 were generated as

p r e v i o u s l y deacribed (20) aaing pi i raid pGP40 which has two wi ld type

recombinat ion a i t e t in d irec t o r i e n t a t i o n . The BamHI - EcoKI fragnenta from

pCPll and pGP20 were transferred i n t o the BamHI - gc_o.RI s i t e s of the pUC9

p o l y l i n i e r (23) to y i e l d the plasmids c a l l e d pGP25 and pGP45, r e s p e c t i v e l y

(Figure 2 ) .

The two strands of the ha l f s y n t h e t i c s i t e were purchased at p u r i f i e d

ol igomers from the 01 igonuc leot ide S y n t h e s i s Laboratory, Department of

Biochemiatry, Queen's U n i v e r s i t y , Kingston, Ontario , Canada. The other

o l i g o n u c l e o t i d e s were purchased from the Ontario Cancer I n a t i t u t e . The

p r o t e c t i n g groups were c leaved from the o l i g o n e r by concentrated ammonia

treatment . The s o l u t i o n was then t r a n s f e r r e d to Eppendorf tubes , f r o i e n in

dry ice and evaporated in a Speed-Vac apparatus (Savant) overn ight .

01 igonucleotides were then purified by aeparation on polyacrylamide gels

followed by overnight elution of the cut out gel band in ammonium acetate

(24). All ol igonucleotides were paaaed through a Sep-Pak C18 column as the

last step in the purification. The fractions containing the

oligonucleotides were frozen in dry ice and evaporated in a Speed-Vac. They

were resuspended in water to a concentration of 10-20 picoaoles per |iL.

Duplex DNA fragments were then made by annealing pairs of corresponding

purified ol igonucleotides at 65'C and slowly cooling to room teaperature.

The solution waa placed on ice and used the same day or stored at -20*C for

later use. The synthetic FLP recombinase s i tes were cloned into the

polylinier of plasaid pUC9 (Figure 2 ) . The synthetic half -s i te which has a

5' protruding BamHI end and a 5' protruding Xbal end was cloned in the BamHI

- Jfcal s i t e s of pi inn id pBAlll (20) to give pi aim id pOPl/2. The 912 bp

Hindlll fragment of 2-micron plaanid containing an entire S99 bp repeat waa

cloned in both direot and inverse orientations into the Hjndlll s i te of

pCPl/2 (Figure 2 ) . After ligation, the molecules were transformed into E..

coli JMS3 or £. col i HB101. The sequences of the various constructs are

shown in Table 1.

Assays

Intramolecular inversion and excision assays were done as previously

4790



described (19, 25) using linear 3'- 3 2P end-labeled plasmid substrate* (see

Figure 3 ) . Twenty ng of substrate was incubated with FLP recombinase at

30°C for 30 min as indicated in the figure legends. Reactions were stopped

by addition of 0.25 volume of a solution containing 1% SDS, 0.5% bromophenol

blue, 40% glycerol, and 200 mH EDTA to an aliquot of the reaction mixture

which was then heated at 65°C for 10 min before analysis on agarose gels .

Another aliquot was used to check for inversion by restrict ion endonuolease

digestion and agarose gel electrophoresis. Autoradiography was done on the

dried ge ls . The internolecular integration assay was essential ly done as

previously described (25). The 3' end-labelled DMA substrate (20 ng) was

incubated with unlabelled circular DNA substrate in the presence of

FLP recombinase as indicated in the figure legends. The reaction was

stopped and analysed as for the intramolecular reactions.

Preparation of the FLP reconbinase

The FLP recombinase was purified as previously described (19).

Fractions from the f irst or second Bio Rex column were used and were free of

exonuclease and endonuclease act iv i ty .

Other aethods

Agarose gel electrophoresis and transformation of £. poll strains were

performed according to standard procedures (26) . Protein concentrations

were deternined as described by Bradford (19) and DNA sequences were

determined as described by Maiam and Gilbert (27) .

Plttsmid preparation

Bacteria harbouring plasmids were grown in LB medium at 37°C in the

presence of 20 ug/ml tuple i l l in and anplified with chloramphenicol (200

ug/ml). Plasmids were isolated by Triton X-100 lys i s (19).

Enxvmes

Restriction enzymes were purchased fron New England Biolabs, BEL, or

Boehringer Mannheim. Polynucleotide kinase, T4 DNA ligase were from New

England Biolabs. Avian myeloblastosis virus reverse transcriptase was from

Life Sciences.

RESPLTS

Determination of the minimal DNA sequence required for intramolecular

recombination.

(A) BAL31 exonnclease deletion mutants One approach to define the minimal

DNA sequence required for FLP mediated s i t e - spec i f i c recombination was to

make BAL31 deletions in one of the FLP s i tes on a plasnid containing two

4791



TABLE 1 . Saquencei of the FLP S i t e s Died i s tho Recombination As<aj>.

1. 43 (N) HjAAGTTCCrATI XOAMTTCCrArATCTAQAAAA'ATACGAACrTC-(N)751. 2 0 (N) MJAACTTCCrATTCCGAACTTCCTATTCTCTAGAAAOTATAOCAACTTC- (N) 43 . tot»oii.tociiCGAAGTrCCTATTCTCTAGAAAETATAOOAACTTC-(N)754 . «ntct«ctntccnAOTrCCrATTCTCTAOAAACTATAOGAACrrc-(N)7S5 . ttnctii;»llt<li«ct.«TCCTATTCTCTAGAAAOTATAOCAACrTC-(N)736. ctnoiltoncmtcoTrCCTATTCTCTACAAAGTATAOCAAlttt7 . cntcttiictic«tgtct»CCTATTCTCTAGAAAOTATAaG»ot«ct8. i » i c t tnc t io» i i t cnc» iTAlTClCTAOAAAGTATAtta tcnc

Site

pBAlllpBA112pGP25pGP4JpGPl /2pGPIOpOPGGApOPATA

Dir«ot

pGP40pBA126pOPllpGP20pGP72pGP70pDSO2pDSAi

Invent

PGP73

The arrows above the sequence indicate the 13 bp s j v a e t r j eleaients asin Figure 1. The notat ions (N)43, N(75), N(20) and N(4) indioate that 43,75, 20 and 4 base pairs of the normal 2-nicron sequence e x i s t beyond thesequence indicated. PI a said pDC9 or 1 inker sequences are represented aslover case l e t t a r s . Ths nanes of the pi aSBids containing a s ing le s i t e arel i s t e d under the heading ' s i t e ' . The entr ie s under the headings ' d i r e c t ' or' inverse' indicate that a wild type s i t * as well as the sequence indicatedi s present in the plasaid in direot or inverse or ientat ion r e s p e c t i v e l y (seeFigure 2) . In each saquenc* th« 8 bp core region i s underlined. Not* that5 addit ional base pairs to the l e f t of the s i t e in pGPl/2 are under 1 ined(1 in* 5) . While derived frosa p lasa id 1 inker sequences, these are ident i ca lto those found at similar pos i t i ons in aleaient ' o ' ( l ine 1 ) .

B

oxclslon inversion integration

Figure 3. Principle of the FLP tis iys.A. The excision m i ; .A 3' end labelled »ub«tr«te (*) containing two FLP recombination »ites

in direct orientation (arrows) is incubated with the FLP protein. Ifrecombination occurs, the products will be an onlabelled circular moleculeundetectable by autoradiography and a shortened labelled linear moleculewhich can be detected by antoradiography.

B. The inversion assay.A 3' end labelled substrate containing two FLP recombination s i tes in

as inverse orientation will undergo FLP-mediated inversion of the DNAbetween the s i t e s . The inversion of the DNA can be deteoted by digestionwith a restriction enzyme that has a recognition sequence positionedasymmetrically between the two FLP s i t e s .

C. The integration assay.A linear 3' end labelled molecule recombines with an unlabelled

circular substrate. The product is a linear molecule containing two FLPsites. Multiple integration events generate higher order multimericproducts (see Figures S and 7).

4792



A B C

1 2 3 4 1 2 3 4 1 2 3 4

Figure 4. The intramolecular recombination of BAL31 deleted FLP s i tes witha wild type l i t e .

ficjjRI linearized 3' end-labelled substrate (20 ng) was inoubated in thepresence of increasing amounts of FLP recombinase at 30°C as described inMaterials and Methods. Reactions were stopped after 30 min, aliquot! of thereactions were electrophoresed on a 0.8% agarote gel, the gel was dried andanalysed by autoradiography.

A. An antoradiogram of the assay using plasmid pGP40 (containing twointact s i tes) as a positive control showing the substrate (S) and produot(P) of the FLP-mediated excision.Lane 1, no FLP protein, lane 2, 0.5 ug FLP protein, lane 3, 1.0 ug FLPprotein, lane 4, 2.0 ug FLP protein.

B. FLP-nediated recombination using plasaid pGPll as substrate. Theconditions and enzyme concentrations were the same as in A.

C. FLP-mediated recombination using plasaid pGP20 as substrate. Theconditions and enzyme concentrations were the same as in A.

s i tes in direct orientation. The recombination between the deleted and

intact recombination s i tes was detected by incubating the end-labelled

substrate and observing the appearance of the shortened linear recombination

product (see Materials and Methods and Figure 3A). The results of such an

experiment are shown in Figure 4.

The parent plasmid pGP40 (20, Table 1) containing two intact sites in

direct orientation served as a positive control for excision. With

increasing concentrations of FLP recombinase, more recombination product was

observed. Plasmid pGPll (Table 1) which lacks the entire 'c ' symmetry

element recombined well with a wild type site on the same molecule (Figure

4793



c b a b a

P- t

S-i

1 2 3 4 5 6 7 8 9 10 11Figure 5. Influence of symmetry element 'c' on FLP—mediated recombination.

Reaction mixtures (100 fil) contained 25 mM Tri«-Cl, pH 7.4, 10 mH«|Cl2, 5 ng of 3 ' , 32p-l»bellod plasmid and 5 ng of unlabelled plasmid asfollows: Lane 1 no FLP; lanes 2 and 7 - 240 ng, lanes 3 and 8 - 480 ng,lines 4 and 9 - 720 ng, lanes 5 and 10 - 960 ng, lanes 6 and 11 - 1.4 ngLanes 1-6 - reactions contained 32p-lin e»r pBA112 plasmid and unlabelledpBA112 plasmid (wild-type FLP s i te ; see diagram above lanes)Lanes 7-11 - reactions contained 32p-linear pGP25 plasmid and unlabelledpGP25 plasmid (FLP site lacks symmetry element ' c ' , see diagram abovelanes). Since these plasaids differ in length by less than 1%, they arepresent in essential ly eqnimolar mounts. Note that maximal extent ofrecombination with pGP2J (lane 8) is reached with one-half as much FLP asneeded for plasmid pBA112 (lane 5 ) . Plasmid pGP2S then undergoes markedinhibition of recombination with increasing FLP concentration (lanes 9-11).

4, panel B) . Plasmid pGP20 which has an additional deletion extending 2 bp

into symmetry element 'b' to the l e f t of the 8 bp core (Table 1, and Figures

1 and 2) also recombines well with a wild type site on the same molecule

(Figure 4, panel C). In fact, careful examination of the experiment shown

in Figure 4 showed the maximal yield of recombinant product (P) was sl ightly

higher for the BAL31 deletions than for the intact site (compare lane A3

with lane B3 and C3) . Furthermore, plasmid pGP20 has been shown by DNase

footprinting experiments (20) to be protected and cleaved by the FLP

4734



B

123 123 123 123 123

Figure 6. Intramolecular recombination of synthetic oligoaeric FLP t i t e i .Reaction condition* were the same as in Figure 4. The two FLP t i t e i on

the molecule were in direct orientation. Lane 1, no protein, lane 2, 12 ngprotein, lane 3, 24 ng protein.

A. f i ld type control, pi»mid pBA126 containing two intact s i te* .B. Linear pGP70 containing one intact and one deleted FLP s i t e .C. Linear pGP72 containing one intact and one deleted FLP s i t e .D. Linear pDSG2 containing one intact and one synthetic FLP s i t e .£. Linear pDSA6 containing one intact and one synthetic FLP s i t e .S - substrate, P - excision product. See sequences of s i tes in Table 1.

reconbinase as well as the wild type recombination s i t e . The studies

presented here show that the third symnetry element ('c') (Figure 1) is not

essential for intramolecular recombination .in vitro.

To exanine the role of element 'c' more carefully, a detailed t i trat ion

of the yield of recoobinant product as a function of FLP concentration was

carried out. This experiment assayed internoleoular reoombination between

linear, end-labeled substrate containing a single FLP site and a similar

cold circular molecule (see Figure 3, panel C). In the experiment shown in

Figure 5 we compared a wild-type site with a s i te that lacked the 'c'

symmetry element. Two observations emerge from this experiment. The f irst

is that the maximal yield of recombinant product is attained at a lower

level of FLP with the deleted substrate than when the wild-type s ite is used

(Figure 5 ) . Secondly, recombination between the deleted FLP s i tes begins to

be inhibited at a lower level of FLP than recombination between the

molecules containing the wild-type s i te . We showed previously that excess

4795



B

1 2 3 4 5 6 7 8 1 2 3 4 5 6 7 8

IPIP

Figure 7. Intermolecular recombination of the deleted FLP recombinationsites.

EcoRI linearized 3' end-labelled substrate (20 ng) was incubated with10 ng of cold circular pi a an id containing only one FLP recombination site inthe presence of FLP recombinase (320 ng protein) at 30°C for 30 min asdescribed in Materials and Methods. Aliquots of the reactions wereelectrophoresed, the gel was dried, and autoradiographed.The order of cold circular substrate is lane 1, none; lane 2, pBA112;lane 3, pGP25; lane 4, pGP45; lane 5, pGPl/2; lane 6, pGPIO; lane 7,pGPGGA; lane 8, pGPATA.

A. Linear pBA112 was used as the end labelled substrate.B. Linear pGPIO was used as the end labelled substrate.

S = substrate

IP - integration products.

FLP actually inhibits the recombination reaction (25). Thus it seems that

while the third 13 bp symmetry element is not needed for efficient

recombination, it may play a role in regulating the stoichiometry of the

recombination reaction. The possible function of the third symmetry element

will be dealt with in the Discussion.

(B) Synthetic oligomers Another approach taken to define accurately the

minimal duplex DNA sequence required for recombination was to construct

4796



shortened synthetic oligomers of the FLP recombination s i t e . These

synthetic s i tes vere cloned into ptJC9 in direct orientation with respect to

a complete 599 bp repeat sequence (see Figure 2 and Table 1) and assayed in

vitro by the ezcisive recombination assay (Figure 3, panel A). The results

of this experiment are shown in Figure 6. The wild type control plasmid

pBA126 (panel A) which contains two intact sites excises well (Table 1 ) .

Plasmids pGP70 (panel B), pGP72 (panel C) and pDSG2 (panel D) with their

progressively greater deletions also produced excision products. The mutant

with the largest deletion, pDSA6 (panel E) did not produce excision product

under the conditions of this experiment. Therefore, the smallest site that

recombined eff iciently was a 22 bp FLP s i t e , containing the 8 bp core region

surrounded by two 7 bp inverted sequences (Figure 6, panel D). No

recombination was detected when 2 additional bp were deleted on both ends of

the FLP site (Figure 6, panel E). Similar results were obtained for

inversion substrates (data not shown). These results are in good agreement

with previous analytical studies (21) and define the minimal sequence

necessary for efficient intramolecular recombination as 22 bp.

In order to examine the abi l i ty of two mutated FLP s i tes to re combine

with one another, we used the intermolecular recombination assay to detect

recombination between linear end-labelled and circular unlabelled substrates

(see Figure 3, panel C). The assay was used to detect recombination between

pairwise combinations of deletion mutation and wild type s i t e s . The results

of two such assays are presented in Figure 7. In panel A, labelled pBA112

whioh has a single wild type s ite (20) was recombined pairwise with cold

plasmids containing a wild type s ite (lane 2) or the deletion mutations

(lanes 3-8) . Panel B shows results obtained when labelled deletion mutant

DNA from plasmid pGPIO was incubated with cold plasmids containing the wild

type site (lane 2) or the other deletion mutations (lanes 3-8). Lane 1 in

both panels is a negative control of the labelled substrate; no

integration is detected in the absence of cold oircular substrate. Vhere

recombination occurred, it was detected regardless of which substrate was

labelled. Recombination between a deleted and wild-type site was similar to

that observed between two identical mutant s i tes (panel A, lane 6 and panel

B, lane 6) . The overall pattern of recombination between any labelled

linear substrate and all cold oircular substrates as seen in Figure 7 was

similar. Plasmid pGPl/2 has consistently shown better recombination than

pGP25 or pGP45. A possible reason is suggested below. The FLP site

containing 22 bp (pGPGGA, Table 1) was the smallest site capable of

4797



recombining. The even smaller s i te (18 bp) pGPATA (Table 1) vat unable to

re combine (Figure 7, lane 8, panels A and B) . Thus while there are some

quantitative differences between the various mutations, there is generally

good agreement between the results obtained with the intramolecular and

intermolecular assays. It can therefore be concluded that intra- and

intermolecular recombination require the same minimal duplex DNA sequence.

DISCUSSION

In this paper, we have reported further characteriiation of the target

sequence of the FLP site-specif ic recombinase of yeast. The enzyme had

previously been shown to protect a region of about 50 bp containing three 13

bp symmetry elements surrounding an 8 bp core region (see Figure 1) .

However the third symmetry element (element 'c') has been shown not to be

needed for recombination ^j vitro or _iri vivo (20, 28, 29 and this work).

Seneooff and Cox (J. Biol. Chan., in press) have shown that the third

symmetry element ('c') does not mediate directionality of the FLP reaction.

Rather directionality is dotemined by the inherent asymmetry of the 8 bp

core sequence.

If this third symmetry element is not needed for recombination, then

what sight i t s function be? We have shown that FLP forms three stable

protein:DNA complexes with a fragment of DNA containing a ooaplete FLP site

(B. Andrews si Ml- manuscript submitted). The three complexes are l ikely

formed by the binding of 1, 2 or 3 protomers of FLP protein and each

symmetry element comprises a single binding domain. Hence i t is likely that

this third symmetry element can bind a molecule of FLP. We have previously

shown that excess FLP protein inhibits FLP-mediated recombination. Our

findings here show that a complete FLP s i te (containing 3 symmetry elements)

is l e ss susoeptible to inhibition by an excess of FLP protein than a site

that lacka one symmetry element (Figure S) . Thus i t appears that the

function of this third synaetry element may be to sequester excess FLP and

thus to prevent i t from) inhibiting FLP—mediated recombination.

How might this third symmetry element function i g vivo? Futcher (32)

has proposed a model whereby the FLP recombinase i s involved in

amplification of the copy number of the 2-micron pi a so id. Basically his

model postulates that soon after replication of one of the 599 bp inverted

repeats, FLP promotes recombination between one of the newly replicated FLP

sites and the unreplicated FLP s i t e . The result of this event is to invert

one of the two replication forks of the circle with respect to the other.

4798



Figure 8. Futcher model for involvement of FLP-mediated recombination incopy number amplification (32).

1. Bidirectional replication of 2-nicron pi amid begins at originadjacent to the bottom inverted repeat and toon replicates through a FLPs i t e . The molecule now has three FLP s i tes (op«n arrows) one of which isnewly replicated (dotted l i n e s ) . The thin arrows indicate the direction oftravel of the replication forks.

2. FLP-mediated recombination occurs between the top (unreplioated)FLP site and the replicated one on the bottom. The result i s that the tworeplication forks are now proceeding in the l u e direction, following oneanother around the c irc le .

3. This can be appreciated by rearranging the molecule in 2 byrotating portions C and D with respect to sequences A and B as indicated bythe arrows. As the two forks, which now are dear ly proceeding in the samedirection, continue around the circle the result wil l be the formation ofnultimers of the 2-micron circle (not shown) which can then be resolved tononomer c irc les by FLP-mediated recombination. For further details see(32).

The two forks now follow one another around the circle and this 'rolling

circ le ' mechanism generates multimers of the pi asm id (see Figure 8 ) .

We suppose that as more nultimers are made, more FLP protein would be

synthesized and if too high a concentration is reached, perhaps FLP-mediated

recombination would be inhibited. The Futcher model also postulates that

FLP-mediated recombination resolves the multimeric structure into noncner

units. Hence if too much FLP resulted in premature inhibition of FLP

recombinase, then the multimers night not get resolved. Therefore we

suggest that the extra symmetry element functions to modulate the

stoichiometry of the reaction by acting as a 'sink' for excess FLP and

thereby preventing untimely inhibition of the FLP reaction.

In this paper we have also further refined the determination of the

minimal duplex DNA sequence needed for FLP-mediated recombination. Our

4799



previous analytical studies Bade use of exonucleolytic digestion to define

the ninimal duplex DNA requirement (21). Our present results confirm and

eitend these observations: the smallest duplex sequence that is able to

undergo recombination jjj vitro comprises an 8 bp core sequence surrounded by

two 7 bp inverted symmetry elements. Removal of two further bp from each

end abolishes recombination. Since our previous studies suggested that

removal of an additional base pair from either end of the FLP site might

s t i l l allow recombination (21), one cannot exclude the poss ibi l i ty that a 20

bp FLP site might exhibit recombination _ifl vitro. A further minor

discrepancy between the present study and our previous results (21) is that

the latter work suggested that an additional 5 bp of the top strand in

symmetry element 'b' are needed for recombination (see boxed sequence.

Figure 1 ) . This may have been due to the fact that the FLP site being

deleted by the exonuclease was located at the end of the recombination

substrate. Alternately, it could have been due to the contacts of the FLP

protein with the top strand that are more important than those on the bottom

strand of this symmetry element. While we find that a 22 bp site is

competent to perform intramolecular recombination with a wild-type site

(Figure 6, panel C), it does require a somewhat higher level of FLP to

aohieve 50* excision. Ve have shown that this 22 bp sequence binds FLP

poorly as measured by a gel retardation assay or a Uillipore f i l t e r binding

assay (B. Andrews, manuscript submitted). It is thus somewhat surprising

that intermolecular recombination between two 22 bp target sequences is

detectable at a l l . We are investigating the poss ibi l i ty of cooperative

interactions between a wild-type site and a truncated one.

We consistently observe that the FLP-site contained in pGPl/2 (Table 1,

line 5) recombines more effectively than all other truncated FLP s i tes (see

Figure 7 ) . Inspection of the sequences in Table 1 ( l ines 1 and 5) reveals

that fortuitously five of the thirteen base pairs in pGPl/2 correspond to

those in the same positions of symmetry element ' o ' . Moreover four of these

btse pairs constitute olose contaots for the FLP protein (B. Andrews,

unpublished; R. Bruckner and M. Cox, personal communication). Thus i t is

conceivable that these sequences might constitute a binding domain for the

FLP protein that increases the efficiency of recombination.

Jayaram (28) has shown that l a vivo, a shortened synthetic FLP site was

sble to recombine with endogenous 2-micron plasmid but with reduced

efficiency. However since this assay involves an equilibrium between

intermolecular recombination and intramolecular recombination and since the

4800



latter event would score at negative in thi« titty, it it difficult to

compare the i c vivo and the _i_n vitro retultt. Since we find that

intranolecnltr recombination it more efficient than intermolecular

recombination _in vitro, it it pottible that the i s vivo attay underestimate!

the frequency of FLP-meditted recombination.

Thit work vat tupported by the Medical Research Council of Canada.

P. S. i t a Career Inve t t iga tor of the tane agency. We thank Janice Reid for

her pat ient preparation of the manotcript. We thank Dr. Michael Cox for

communicating r e t u l t t in advance of p u b l i c a t i o n .

REFERENCES1 . Zieg, J . , Silverman, M., Hilmen, H. and Simon, M. (1977) . Science

124:170-172 .2 . lamp, D. , Choir, L.T. , Broker, T.R., Kir oh, D. , Zipter , D. and Kahmann, R.

(1979) . Cold Spring Harbor Symp. Quant. B i o l . 41:1159-1167.3 . I ida , S. , Meyer, J . , Kennedy, H.E. and Arber, W. (1982) . EMBO J .

1:1445-1453.4 . P la t terk , R.H.A. and van de Putte , P. (1984) . Biochim. Biophyt. Acts .

242.: 111-119.5. Nath, H.A. (1981) . Ann. Rev. Genet. 15.: 143-167.6 . Tonegawa, S. (1983) . Nature Ifl2.: 575-581.7. Clark, S .P. , Tothikai , Y., Taylor, S . , Siu, G., Hood, L. and Mak, T.W.

(1984) . Nature 111:387-389 .8. Gatcoigne, M.R.J., Chien, Y., Becker, D.M., Kavaler, J. and Davi t , M.M.

(1984) . Nature H f i : 3 8 7 - 3 9 1 .9 . Abremtki, K., Hoett, R. and Sternberg, N. (1983) . Cell 12.: 1301-1311.10. Abrentki, K. and Hoe i t , R.H. (1984) . J. B i o l . Chen. 212.: 1509-1514.1 1 . Weitberg, R.A. and Landy, A. (1983) . In Lambda I I , Hendrix, R.W.,

Roberta, J.W., Stahl , F.W. and Weitberg, R.A., edt . pp.211-250. ColdSpring Harbor Laboratory, Cold Spring Harbor, New York.

12 . Vetter , D . , Andrewt, B . J . , Robertt-Beatty , L. and Sadowtki, P.D. (1983) .Proc. Nat l . Aoad. S c i . USA £P_: 7284-7288.

1 3 . Sadowtki, P.D. , Lee, D.D. , Andrew•, B .J . , Babineau, D. , Beatty , L . ,Morte, M.J., Proteau, G. and Vet ter , D. (1984) . Cold Spring HarborSymp. ftuant. B i o l . 42 :789-794 .

14 . Meyer-Leon, L . , Senecoff, J . F . , Bruckner, R.C. and Cox, M.M. (1984) .Cold Spring Harbor Synp. ftuant. B i o l . 4_£: 798-804.

15. Hartley, J .L. andDonelson, J .E . (1980) . Nature 2fi£: 860-865.16 . Broach, J.R. and Hickt , J .B . (1980) . Cell 21 :501-508 .17. Broach, J.R. and Guaratcio, V.R. and Jayaram, M. (1982) . Cell

22 :227-234 .18. Cox, M.M. (1983) . Proc. Nat l . Aoad. Soi . USA fi0_: 4223-4227.19. Babineau, D., Vet ter , D . , Andrewt, B .J . , Gronostajtki , R.M., Proteau,

G.A., Beatty, L.G. and Sadowtki, P.D. (1985) . J. B i o l . Chen.2 M : 12313-12319.

20 . Andrewt, B . J . , Proteau, G.A., Beatty, L.G. and Sadowtki, P.D. (1985) .Cell 1ft:795-803.

2 1 . Gronottajtki , R.M. and Sadowtki, P.D. (1985) . J. B i o l . Chora.: 12320-12327.

4801



J. B i o l . Chan.

2 2 . Meaaing, J. (1979) . NIH Pnbl icat iona , No. 79-99 ( 2 ) : 4 3 - 4 8 .2 3 . Vio ira , J. and Meaaing, J. (1982) . Gene 19_:259-268.2 4 . Sanchez-Peacador, R. and Urdea, M.S. (1984) . DNA 3_: 339-343.2 5 . Gronoatajaki, R.M. and Sadowaki, P.D. (1985),

2 M : 12328-12335.2 6 . Maniatia, T . , Fr i tach , E.F. and Sambrook, J. (1982) . 'Molecular

Cloning, a Laboratory Manual', Cold Spring Harbor Laboratory, ColdSpring Harbor, Ne» York.

27 . Maxam, A.M. and Gi lbert , V. (1980) . Meth. Eniynol . £5_: 499-560.28 . Jayaraa. M. (1985) . Proc. Natl . Acad. Sc i . USA j£2_:5875-5879.29 . Seneooff, J . F . , Bruckner, R.C. and Cox, M.M. (1985) . Proc. Nat l . Acad.

S c i . USA 8 .: 7270-7274.30 . Mizuuchi, E . , Teiaberg, R., Enquitt, L. , Mizuuchi, M., Buraczynaka, M.,

F u e l l e r , C , Hau, P . -L . , Roaa, ». and Landy, A. (1981) . Cold SpringHarbor Symp. Quant. Bio l . 4£:429-437.

3 1 . Hoeaa, R.H. and Abreaaki, E. (1985) . J. Mol. B i o l . 181:351-362.32 . Futcher, A.B. (1986) . J. Theor. B i o l . ( i n p r e a a ) .

4802


the minimal duplex dna sequence required for site-specific

Documents