LEBANESE AMERICAN UNIVERSITY

The Mechanism of Action of Kefir and its Effect on the

Motility of Breast and Colorectal Cancer Cells

By

Nathalie El Khoury

A thesis submitted in partial fulfilment of the

requirements for the degree of Master of Science in

Molecular Biology

School of Arts and Sciences

May 2013

ii

iii

iv

v

THESIS COPYRIGHT RELEASE FORM

LEBANESE AMERICAN UNIVERSITY NON-EXCLUSIVE DISTRIBUTION LICENSE

By signing and submitting this license, you (the author(s) or copyright owner) grants to

Lebanese American University (LAU) the non-exclusive right to reproduce, translate (as

defined below), and/or distribute your submission (including the abstract) worldwide in

print and electronic format and in any medium, including but not limited to audio or

video. You agree that LAU may, without changing the content, translate the submission

to any medium or format for the purpose of preservation. You also agree that LAU may

keep more than one copy of this submission for purposes of security, backup and

preservation. You represent that the submission is your original work, and that you have

the right to grant the rights contained in this license. You also represent that your

submission does not, to the best of your knowledge, infringe upon anyone's copyright. If

the submission contains material for which you do not hold copyright, you represent that

you have obtained the unrestricted permission of the copyright owner to grant LAU the

rights required by this license, and that such third-party owned material is clearly

identified and acknowledged within the text or content of the submission. IF THE

SUBMISSION IS BASED UPON WORK THAT HAS BEEN SPONSORED OR

SUPPORTED BY AN AGENCY OR ORGANIZATION OTHER THAN LAU, YOU

REPRESENT THAT YOU HAVE FULFILLED ANY RIGHT OF REVIEW OR

OTHER OBLIGATIONS REQUIRED BY SUCH CONTRACT OR AGREEMENT.

LAU will clearly identify your name(s) as the author(s) or owner(s) of the submission,

and will not make any alteration, other than as allowed by this license, to your

submission.

Name: Nathalie El Khoury

Signature:

Date: 14/05/2013

Date: May 28, 2013

vi

PLAGIARISM POLICY COMPLIANCE STATEMENT

I certify that I have read and understood LAU’s Plagiarism Policy. I understand that failure

to comply with this Policy can lead to academic and disciplinary actions against me. This

work is substantially my own, and to the extent that any part of this work is not my own I

have indicated that by acknowledging its sources.

Name: Nathalie M. El-Khoury

Signature:

Date: 14/05/2013

Date: May 28, 2013

vii

ACKNOWLEDGEMENTS

I would like to express my gratitude to both of my advisors, Dr. Sandra Rizk for

her continuous support, encouragement, and trust, and Dr. Mirvat El-Sibai for her

continuous guidance, advices, and for everything she has have taught me.

My appreciation extends to the entire faculty that have taught me especially Dr.

Roy Khalaf and the committee members Dr. Brigitte Wex and Dr. Mohammad Mroueh.

Their acceptance for being part of my thesis committee is of high appreciation.

Furthermore, I would like to acknowledge with much appreciation the role of my

friends at LAU with whom I share a lot of unforgettable memories especially Perla

Zgheib, Anita Nasrallah, and Bechara El Saykali.

Last but not least, my deepest gratitude goes to my family, my mom and dad, who

always support and trust me with every step that I take.

viii

The Mechanism of Action of Kefir and its Effect on the Motility of

Breast and Colorectal Cancer Cell Lines

Nathalie M. El-Khoury

ABSTRACT

Kefir which is a fermented milk product originating from the Caucasus

Mountains is gaining increasing popularity due to its attribution in preventing or curing

many chronic diseases among them cancer. Previous studies have focused on the anti-

tumoral activity of kefir in vivo yet not extensive studies have been performed to

elucidate its mechanism of action. Till now kefir is known to modulate intestinal

microbiota, modulate the activity of immune system cells, and suspected to induce

apoptosis in cancer cells in vivo. Recent studies have focused on the direct effect of kefir

cell-free fractions on cancer cells in vitro. Earlier work in our lab has shown that cell-

free fractions of kefir have anti-proliferative and pro-apoptotic effect on Caco-2 and HT-

29 colorectal adenocarcinoma cells. In this study, we aim to determine a possible

mechanism of action of kefir and to study its effect on the motility of colorectal and

breast cancer cell lines. Results from the reverse-transcription PCR experiment have

shown that kefir decreases the expression of TGF-α and TGF-β1 in HT-29 cells in a dose

dependent manner. An increase in the production of both cytokines is usually associated

with neoplastic transformation. Western blot assay results confirmed the previously

observed increase in apoptosis as it showed an increase in Bax:Bcl-2 expression upon

kefir treatment. Also an increase in p53 independent-p21 expression was observed in

HT-29 cells upon kefir treatment which would explain the anti-proliferative effect of

kefir. Furthermore, results from the time-lapse movies, wound-healing, and invasion

assays showed no effect on the motility of colorectal (Caco-2 and HT-29) as well as

breast (MCF-7 and MB-MDA-231) cancer cells upon kefir treatment.

Keywords: Colorectal Cancer, Breast Cancer, Kefir, Proliferation, Apoptosis, Cell

Motility, Cell Invasion.

ix

TABLE OF CONTENTS

List of Figures………………………………………………………………..viii

List of abbreviations………………………………………………………..ix-xi

1. Literature Review …………………………………………………… 1-14

1.1. Colorectal cancer…………………………………………………..…..1

1.1.1. Incidence and statistics…………………………………………..1

1.1.2. Types………………………………………….…………………1

1.1.3. Screening and Diagnosis………………………………………...2

1.1.4. Current cures…………………………………………………….2

1.2. Breast cancer…………………………………………………………..3

1.2.1. Incidence and statistics…………………………………………..3

1.2.2. Types...............................................................................................3

1.2.3. Screening and Diagnosis………………………………………...4

1.3.4. Current cures………………….…………………………………4

1.3. Signaling pathways in cancer….………………………………………5

1.3.1. Bcl-2 family of apoptosis regulatory proteins…………………....5

1.3.2. Roles of p53 and p21 in apoptosis……………………………….6

1.3.3. TGF-alpha signaling pathway…………………………………...7

1.3.4. TGF-beta signaling pathway…………………………………….8

1.4. Motility, invasion, and metastasis of cancer cells……………………...9

1.5. Kefir…………………………………………………………………..10

1.5.1. Probiotics……………………………………………………….10

1.5.2. Characteristics and composition………………………………...11

1.5.3. Preparation of kefir……………………………………………...11

1.5.4. Origin of kefir…………………………………………………..12

1.5.5. Health benefits of kefir…………………………………………12

1.5.6. Anticancer effect……………………………………………….12

x

1.5.6.1. In vivo studies………………………………………...13

1.5.6.2. In vitro studies………………………………….……13

1.5.6.3. Effect on metastasis…………………………….…....14

1.6. Purpose of the study…………………………………………......14

2. MATERIALS & METHODS ……………………………………..….15-18

2.1. Cell line and Cell culture…………………………………………....15

2.2 Preparation of kefir cell-free fraction and milk……………………...15

2.3 Antibodies and reagents……………………………………………..16

2.4. Western blotting…………………………………………………….16

2.5. Reverse-transcription PCR………………………………………….16

2.6. Wound Healing……………………………………………………..17

2.7. Motility assay……………………………………………………….17

2.8. Invasion assay……………………………………............................18

2.8. Statistical analysis…………………………………………………..18

3. RESULTS …………………………………………………….....…. 19-25

4. DISCUSSION …………………………………………………...…. 26-29

5. CONCLUSION ………………………………………………….….… 30

6. BIBLIOGRAPHY ……………………………………………..…...31-39

xi

LIST OF FIGURES

Figure Page

1. Expression of TGF-α and TGF-β1 using reverse-transcription pcr in kefir and milk

treated HT-29 cells………………………………………………………………….……19

2. Fold increase in Bax:Bcl-2 expression in kefir and milk treated HT-29 cells………....20

3. The expression of P21 and P53 in kefir and milk treated HT-29 cells……………........21

4. The migration ability of control and kefir-treated Caco-2 and HT-29 cells in vitro using

wound healing analysis…………………………………………………………………..22

5. The migration ability of control and kefir-treated MCF-7 and MDA-MB-231 cells in

vitro using wound healing analysis………………………………………...................…..23

6. The migration ability of control and kefir-treated MCF-7 and MDA-MB-231 cells in

vitro using time-lapse movies……………………………………………………….……24

7. The invasive ability of control and kefir-treated HT-29 cells in vitro………………....25

xii

LIST OF ABBREVIATIONS

CRC: Colorectal cancer

5-FU: 5-Fluorouracil

VEGF: Vascular endothelial growth factors

EGFR: Epidermal growth factor receptor

DCIS: Ductal carcinoma in situ

LCIS: Lobular carcinoma in situ

DC: Ductal carcinoma

LC: Lobular carcinoma

Her-2: Human Epidermal Growth Factor Receptor 2

ER-positive: Estrogen receptor-positive

HR-positive: hormone-receptor-positive

TNBC: Triple negative breast cancer

CBE: Clinical breast examination

BSE: Breast self-examination

ACS: American Cancer Society

BRCA1: Breast cancer 1

BRCA2: Breast cancer type 2 susceptibility protein

MRI: Magnetic resonance imaging

Bcl-2: B-cell lymphoma 2

BH domain: Bcl-2 Homology domains

Bcl-xL: B-cell lymphoma-extra large

Bcl-w: Bcl-2-like protein 2

Bak: Bcl-2 antagonistic killer

Bax: Bcl-2–associated X protein

PUMA: Promoter upregulated modulator of apoptosis

Bid: Bcl-2 interacting domain death agonist

OMM: Outer mitochondrial membrane

SMAC: Second mitochondrial activator of caspases

dATP: Deoxyadenosine triphosphate

xiii

Apaf-1: Apoptosis protease-activating factor-1

P53: Protein 53

MDM-2: Mouse double minute 2 homolog

DNA: Deoxyribonucleic acid

pRB: Retinoblastoma protein

S phase: Synthesis phase

G1 Phase: Gap 1 phase

TGF-α: Transforming growth factor alpha

EGF: Epidermal growth factor

PI3K: Phosphoinositide 3-kinase

KRAS: Kirsten rat sarcoma viral oncogene homolog

BRAF: v-Raf murine sarcoma viral oncogene homolog B1

MEK: Mitogen-activated protein kinases

ERK: Extracellular signal-regulated kinases

STAT: Signal Transducer and Activator of Transcription

MMP: Matrix metalloproteinases

IL-8: Interleukin

TGF-β: Transforming growth factor beta

EMT: Epithelial to mesenchymal transition

MCF-7: Michigan Cancer Foundation-7

HTLV-1: Human T-lymphotropic virus 1

RT-PCR: Reverse Transcription Polymerase Chain Reaction

DMEM: Dulbecco's Modified Eagle Medium

FBS: Fetal Bovine Serum

ATCC: American Type Culture Collection

SDS-PAGE: Sodium Dodecyl Sulfate Polyacrylamide Gel Electrophoresis

PVDF: Polyvinylidene fluoride

BSA: Bovine serum albumin

PBS: Phosphate buffered saline

ECL: Enhanced Chemiluminescence

RNA: Ribonucleic acid

xiv

cDNA: Complementary deoxyribonucleic acid

HEPES: Hydroxyethyl piperazineethanesulfonic acid

SEM: Standard error of the mean

1

Chapter I

Literature Review

1.1. Colorectal cancer

1.1.1. Incidence and statistics

In 2013, the American Cancer Society (ACS) ranked colorectal cancer (CRC) as

the third leading cause of cancer-related mortalities in the United States in both men and

women. In 1975, 60 new cases of colorectal cancer per 100,000 people were diagnosed

every year in the United Stated, but this rate has declined by 2007 to approximately 45

new cases per 100,000 individuals. Moreover, the mortality rates decreased from 28 in

1975 to 17 by 2007 per 100,000 individuals (The National Cancer Institute, 2010). In

2013, it is estimated that 142,820 new cases of CRC will be diagnosed among which

50,830 death cases will arise (Siegel, Naishadhan, & Jemal, 2013).

1.1.2. Types

Among all CRC, 72% arise in the colon and the remaining 28% arise in the rectum

(National Cancer Institute, 2010). Adenocarcinoma, the cancer caused by the mucus-

secreting epithelial cells of the colon, account for more than 95% of CRC. Other less

common tumors that can originate in the colon or rectum might include carcinoid tumors

formed from neuroendocrine cells of the colon, lymphomas caused by immune system

cells that reside in the colon, as well as sarcomas caused by different connective tissues

including muscle and blood vessel cells. Therefore, when medical doctors refer to CRC

they are most probably referring to adenocarcinomas (American Cancer Society, 2013).

The sequence of events leading to the formation of CRC takes place over a period of 10-15

years and involves the accumulation of genetic mutations and chromosomal aberrations

induced by several environmental factors as well as inherited genetic mutations (Hoff,

Foerster, Vatn, Sauar, & Larsen, 1986; Hamilton, 1993; O’Brien, et al., 1993). The

extended period of time leading to CRC allows sufficient time for chances to screen,

properly interfere, and to potentially save the lives of more patients.

2

1.1.3. Screening and Diagnosis

By the time people are diagnosed with CRC, 25% of patients would have already

developed metastasis. Among these patients with metastatic colorectal cancer, 50% will

survive (Kufe, et al., 2003). This necessitates the need for tools and techniques to screen

for and diagnose early stage cancer as well as adenomatous polyps.

In 2008, the U.S. Preventive Services Task Force recommended that individuals

between the ages of 50 and 75 years screen for colorectal cancer using three different

screening methods to diminish the risk of death from CRC. The fecal occult blood testing

is recommended to be performed annually. Two other tests are accompanied by a small

risk of compilations, therefore sigmoidoscopy is advised every five years, and

colonoscopy is recommended every ten years (Pignone & Sox, 2008).

1.1.4. Current cures

Surgical treatment remains the best option for the treatment of colorectal cancer

but in a large number of cases solely it is not the ideal treatment since its outcome

depends on the extent of the disease (Cunningham, et al., 2010). On the other hand,

radiation therapy is not used as a standard treatment for CRC, yet it is used along with

chemotherapy preoperatively (Latkauska, et al., 2010).

Significant successes have been achieved by chemotherapeutic drugs in the

treatment of CRC to an extent that the survival of patients with CRC can now be extended

by nearly two years (Wolpin & Mayer R, 2008). 5-Fluorouracil (5-FU) was one of the

earliest and most commonly used drugs for the treatment of CRC (Sobrero, Guglielmi,

Grossi, Puglisi, & Aschele, 2000). Later on, Oxaliplatin and Leucovorin have shown to

enhance the survival of patients when added to 5-FU (Becouarn, et al., 1998). Irinotecan,

an inhibitor of topoisomerase I, is able to enhance the overall survival of patients with

metastatic CRC when administered with leucovorin and 5-FU (Fuchs, et al., 2007).

Recently, focus has been directed toward targeted therapy. For example,

Bevacizumab, a monoclonal antibody that binds the Vascular Endothelial Growth Factors

(VEGFs) which play a role in blood vessel formation, has shown to improve the survival

3

of patients when combined with chemotherapeutic drugs (Ferrara & Gerber, 2003). The

epidermal growth factor receptor (EGFR) is also an important target in the treatment of

colorectal cancer and the most effective antibodies used against it are cetuximab and

panitumumab (Messersmith & Hidalgo, 2007). Yet the limitation of these targeted

therapies lies in the fact that in rare cases tumors develop mutations in the intra-signaling

pathways of EGFR rendering the treatment ineffective (Berg & Soreide, 2012).

1.2. Breast cancer

1.2.1. Incidence and statistics

In 2012, the American Cancer Society ranked breast cancer as the second deadliest

cancer in women in the United States. Breast cancer rarely affects men; it is 100 times

more common in women (American Cancer Society, 2012). Between 2005 and 2009 on

average 124.3 cases of breast cancer were diagnosed per 100,000 women yearly (National

Cancer Institute, 2013).

1.2.2. Types

In situ carcinomas of the breast are of two types, ductal carcinoma in situ (DCIS)

or lobular carcinoma in situ (LCIS). These types of carcinomas can not invade surrounding

tissues and do not metastasize. LCIS do not develop into invasive LC but may be a marker

of an increased risk for invasive DC or LC development in any of the breasts (Simpson &

Wilkinson, 2004). Yet, DCIS was shown to be a precursor to invasive DC. Invasive

lesions have the ability to penetrate the basement membrane and spread into adjacent

stroma in the breast and therefore have the potential to metastasize. Among invasive breast

cancer 70 to 80% are invasive DC and almost 10% are invasive LC, the remaining are less

common histologic types such as apocrine, tubular, medullary, mucinous, and papillary

(Simpson & Wilkinson, 2004). A classification based on gene expression profiling done in

2000 by Perou et al. identified five subgroups of breast cancer they are basal epithelial-like

group, Her-2 (Human Epidermal Growth Factor Receptor-2) overexpressing, normal

breast like group, and ER positive luminal A and B. These subtypes have differential

survival rates, prognosis, and response to different treatments. Also, from a clinical

perspective, breast cancer is subdivided into three categories, the HR-positive (Hormone-

4

receptor positive) cells that express estrogen and progesterone receptors, Her-2

overexpressing cells, and the remaining are known as triple negative breast cancer

(TNBC) since they lack any of these three receptors (Perou, et al., 2000; Sorlie, et al.,

2001)

1.2.3. Screening and Diagnosis

In 2012, the American Cancer Society in 2012 recommended that women above

the age of 40 do annual mammograms, an X-ray for the breast, in order to detect early

breast cancer. It also recommends a clinical breast exam (CBE) to be performed every

three years for women between the ages of 20 and late 30s and annually for women above

the age of 40 by a health care professional. Breast self-examination (BSE) is also

recommended by the ACS for woman above the age of 20. For women who are at a high

risk (eg. having a BRCA1, Breast cancer 1, and BRCA2, Breast cancer type 2 susceptibility

protein) an MRI (Magnetic resonance imaging) along with mammogram is recommended

annually.

1.3.4. Current cures

Lumpectomy, the removal of the cancerous tissues, or mastectomy, the removal of

the entire breast, are ideal for the treatment of early breast cancer, yet micro-metastatic

cells may remain and cause recurrence (Hassan, Ansari, Spooner, & Hussain, 2010).

Therefore, chemotherapy is regularly used as an adjuvant six weeks after surgery. The

most commonly used combination used is fluorouracil, adriamycin, cyclophosphamide or

fluorouracil, epirubicin, and cyclophosphamide. Also, postoperative locoregional radiation

shows reduced risk of recurrence and mortality rates (Whelan, Julian, Wright, Jadad, &

Levine, 2000).

Targeted therapy is widely used in the treatment of breast cancer. An important

example is Trastuzumab (Herceptin), a monoclonal antibody that targets the Her-2

receptor, usually overexpressed in 20% of breast cancers, when added to chemotherapy

decreased the recurrence of the disease by 53% (Romond, at al., 2005). Tamoxifen, an

estrogen receptor antagonist in the breast, significantly decreases the death rate for ER-

5

positive (Estrogen receptor-positive) breast cancer, the most common type of breast cancer

(EBCTCG, 2005). Megestrol acetate, a derivative of progesterone, is also used for the

treatment of advanced breast cancer (Allegra, 1987). Ovarian ablation, oophorectomy, is

also used following hormone therapy mainly to treat metastatic breast cancer in pre-

menopausal women (Pater & Parulekar, 2003). TNBC cells which do not express the

estrogen, progesterone, or the Her2 receptors on their plasma membrane do not respond

well to targeted therapy is usually treated with chemotherapeutic drugs (Vaklavas &

Forero-Torres, 2011).

Despite the fact that significant improvements have been made in the treatment of

early breast cancer, a major challenge in breast cancer remains in the treatment of

metastatic cases (Hassan, Ansari, Spooner, & Hussain, 2010)

1.3. Signaling pathways in cancer

1.3.1. Bcl-2 family of apoptosis regulatory proteins

The Bcl-2 (B-cell lymphoma 2) protein family plays a crucial role in apoptosis

through its anti-apoptotic as well as pro-apoptotic proteins. The expression of proteins in

this family are dynamically balanced and alterations in their expression leads to either

enhancement or prevention of cell death (Ola, Nawaz, & Ahsan, H, 2011). Members of

this family possess Bcl-2 homology domains known as BH1, BH2, BH3, and BH4 which

are necessary for the formation of heterodimeric binding among members of the Bcl-2

family (Danial & Korsmeyer, 2004). Antiapoptotic proteins of this family include Bcl-2,

Bcl-xL, and Bcl-w. On the other hand, the pro-apoptotic include Bak and Bax or those that

only possess the BH3 domain such as Puma (Promoter upregulated modulator of

apoptosis) and Bid (Bcl-2 interacting domain death agonist) (Wang, Yin, Chao, Milliman,

& Korsmeyer, 1996; Brunelle & Letai, 2009). In normal physiological conditions, Bak, a

proapoptotic protein, is present in the outer mitochondrial membrane OMM in its inactive

form while Bax is inactive in the cytosol (Youle & Strasser, 2008). Following stimulation

by an apoptotic signal, Bax is translocated to the OMM and leads to the formation

Bax/Bak homodimers that leads to the formation of pores in the OMM and causes the

leakage of proteins from the intermembrane space into the cytosol such as Smac (Second

6

mitochondrial activator of caspases) and cytochrome c. Cytochrome c is then activated

through its interaction with dATP and Apaf-1(Apoptosis protease-activating factor-1)

leading to the formation of apoptosome that causes the activation of caspases that cleavage

various components required for the proper functioning of the cell (Yethon, et al. 2003;

Wei, et al 2001). In the absence of apoptotic signals, antiapoptotic members of the bcl-2

prevent any leakage from the mitochondria by preventing the oligomerization of the

proapoptotic members of the Bcl-2 family (Youle & Strasser, 2008). Therefore, the

regulation of activity and expression of BH3-only proteins is critical in the induction of

apoptosis. Generally, the proportion of pro-survival to pro-apoptotic proteins of the Bcl-2

family appears to regulate the sensitivity of the cell to the apoptotic signal (Ola, et al.,

2011).

1.3.2. Roles of p53 and p21 in apoptosis

P53 (Protein 53) is a widely known transcription factor that localizes mostly in the

nucleus and is able to induce the expression of several genes that lead to DNA damage

repair, cell cycle arrest, and apoptosis (Oren & Rotter, 1999; Vousden & Lu, 2002). In

normal physiology, the expression of p53 is maintained at a low level through its

proteasomal degradation induced by the ubiquitin protein ligase MDM-2 (Mouse double

minute 2 homolog) (Kubbutat, Jones, & Vousden, 1997). When DNA damage occurs, p53

becomes active by undergoing post-translational modifications which increase its stability

and allows its accumulation in the nucleus (Prives & Hall, 1999). When active, p53

induces the expression of a set of genes involved in DNA damage repair and cell cycle

arrest. After the DNA is repaired, the cell returns to its normal cell cycle. But when the

DNA damage is severe and beyond repair, p53 would then induce apoptosis in the cell (El-

Deiry, 2003). P53 exerts its effect through several target genes among them the cell cycle

inhibitor p21. P21 binds to the cyclin-dependent kinase-2 and prevents it from

phosphorylating the retinoblastoma protein pRB. The inactive pRB will bind transcription

factors of the E2F protein and constrain it in an inactive form which will prevent the cell

from proceeding to the S phase of the cell cycle and remain in the G1 phase. (Harper,

Adami, Wei, Keyomars, & Elledge, 1993). However, p21 can also be induced in a p53-

independent manner whether induced by DNA damage or not (Macleod, et al., 1995).

7

Another target of p53 is MDM-2 which is needed to negatively regulate the expression of

p53 levels (Barak, Juven, & Haffner, 1993). P53 also induces its apoptototic effect by

modulating the activity and expression of pro-apoptptic proteins of the Bcl-2 family such

as Bax, PUMA, as well as others (Selvakumaran, et al., 1994; Yu, Zhang, Hwang, Kinzler,

& Vogelstein, 2001).

1.3.3. TGF-alpha signaling pathway

Transforming growth factor alpha (TGF-α) is a member of the epidermal growth

factor family EGF (Salomon, Brandt, Ciardiello, & Normanno, 1995). It shares a 40%

homology in sequence with EGF and competitively compete for its receptor which is the

Epidermal Growth Factor Receptor EGFR. EGFR belongs to the ErbB protein family of

tyrosine kinases that play a significant role in cell survival, proliferation, motility,

angiogenesis, and adhesion (Arteaga, 2003). Receptor activation triggers a downstream

signaling pathways including the phosphoinositide 3-kinase (PI3K), the KRAS-BRAF-

MEK-ERK pathway, the phospholipase C gamma, and the STAT signaling pathway

(Yarden & Sliwkowski, 2001; Baselga & Albanell, 2002)

To maintain proper cell homeostasis, the expression of EGFR ligands is stringently

regulated. In atypical cases, dysplasia could occur due to an increase in the expression of

TGF-α or any other ligand belonging to the EGF family or due to a constitutively active

mutation in the EGFR (Ji, et al., 2006). It has been reported that an elevation of EGFR

expression is detected in 60 to 80% of cases of CRC (Goldstein & Armin, 2001). The

higher its expression in several types of cancer the more aggressive the tumor would be

and the poorer is its prognosis (Umekita, Ohi, Sagara, & Yoshida 2000). In human colon

cancer, the level of TGF-α expression was observed to be four times more than that of

normal mucosa (Liu, Woo, & Tsao, 1990). Similarly, an upregulation in the expression of

TGF-α has been reported in many types of cancer compared to normal cells (Mellon,

Cook, Chambers, & Neal, 1996).

Several in vitro studies have showed TGF-α significantly increase the invasive

ability of several types of cancer cell lines and this effect could be abolished almost

completely by the additions of antibodies targeting the EGF receptor (Hölting, Siperstein,

8

Clark, & Duh, 1995; Ueda, et al., 1998). In vivo studies showed that overexpression of

TGF-α by colon cancer cells favors their progression and metastasis through the

recruitment of cells that express VEGF, matrix metalloproteinases (MMPs), and

interleukin-8 (IL-8), as well as by increasing metastasis to the lymphatic system (Sasaki, et

al., 2008). These data provide sufficient evidence for the need to target the TGF-α/EGFR

signaling pathway for therapeutic intervention.

1.3.4. TGF-beta signaling pathway

Transforming growth factors beta (TGF-β) are ligands that belong to the TGFβ

superfamily. This superfamily includes cytokines such as activins, bone morphogenic

proteins (BMPs), inhibins, and the anti-Müllerian hormone (Schmierer & Hill, 2007).

TGF-β signaling plays a role in many cellular responses such as cell cycle arrest,

migration, invasion, Epithelial to mesenchymal (EMT) transition, as well as immune

suppression (Derynck, & Miyazono, 2008). Until recently, TGF-β signaling pathway was

a paradox since it could promote cell proliferation but can also inhibit its growth, it could

lead to stem cell differentiation but also enhances its pluripotency, and it suppresses pre-

malignant cells yet boosts metastatic ones. Current studies have shown that the response of

a cell to the stimulation of TGF-β is dependent on three contextual determinants which are

the epigenetic status of the cell, the proteins involved in the signaling transduction

pathway, and the transcription factors present. Therefore, its effect varies among cell types

and disease stage (Massagué, 2012).

In normal cells, TGF-β suppresses tumorigenesis by causing cell cycle arrest and

apoptosis, yet in advanced cancer, where it is usually overexpressed, the cells develop

mutation in the TGF-β receptor or internal proteins that allow them to avoid the cytostatic

and apoptotic effect and can even use the increase TGF-β expression to induce their own

proliferation (Massagué, 2008). Also this increased ligand production promotes invasion

of the cancer cells, through EMT transition and increased angiogenesis, and causes the

recruitments of cells involved in inflammation, all of which leads to disease progression

and metastasis (Thiery, Acloque, Huang, & Nieto, 2009; Heldin, Vanlandewijck, &

Moustakas, 2012). The effect of TGF-β is not only limited to the cancer cells but also has

9

potent effect on many immune system cells. It suppresses the proliferation of T cells and

induces apoptosis in B cells (Ramesh, Wildey, & Howe, 2009).

In colorectal cancer, TGF-β1 expression significantly increases with the

advancement of cancer stage, invasive ability, and metastasis (Xiong, et al., 2002). TGF-

β1 overexpression is not only observed in tissues of the CRC but also it is also

overexpressed in the patient’s serum (Tsushima, et al. 1996). In CRC, TGF-β also affects

the microenvironment by modulating, immune system cells, endothelial and stromal cells

as well as others which consequently would increase cell invasiveness (Elliott & Blobe,

2005).

Drugs that target the TGF-β signaling pathway have been designed and some are

currently in Phase III clinical trials for the treatment of cancer. These drugs include

monoclonal antibodies against the TGF-β receptor, ligand competitive peptides, inhibitors

of TGF-β kinase activity, inhibitors of gene expression, as well as anti-sense

oligonucleotides, the latter which have proceeded the furthest in clinical trials (Akhurst &

Hata, 2012). Some adverse side effects for these drugs have been seen in pre-clinical trials

but most were absent in clinical trials. The only adverse effects observed in clinical trials

were the development of non-malignant skin lesion which disappears upon the withdrawal

from the drug (Morris, J. C. et al, 2008)

1.4. Motility, invasion, and metastasis of cancer cells

The ability of cells to migrate is essential for the development and homeostasis of a

multicellular organism. Cell motility is required during embryonic development to allow

cells to reach their destined positions to properly form tissues and organs. Also in normal

physiology, cells migrate to injured tissues to repair wounds, vascular endothelial cells

move to create new capillaries, and white blood cells relocate to sites of inflammation to

fight foreign organisms. Yet, pathological forms of migration exist in cancer cells, where

these cells acquire the ability to migrate which is otherwise absent in their normal

counterparts (Lauffenburger & Horwitz, 1996; Sheetz, Felsenfeld, Galbraith, Choquet,

1999). Cell migration can be induced by either chemical or physical factors in the

environment and comprises a complex process that involves the formation of a protrusion

10

at the leading side of the cell, followed by the creation of adhesions at the front edge,

translocation of the cell, and then the retraction at the rear (Ridley, et al., 2003).

Many studies have confirmed the involvement of cell motility in metastasis and in

2010 alone more than a thousand published manuscripts have discussed this contribution.

Whether it initially exists during diagnosis, or occurs during treatment or relapse, the

dissemination of cancer cells from their primary site remains the primary cause of death in

cancer patients (Palmer, Ashby, Lewis, & Zijlstra, 2011). Metastasis is a complex process

not only limited to the ability of the cell to migrate but is dependent on the ability of the

cell to invade neighboring tissues, intravasate nearby vasculature, survive in the blood or

lymph, extravasate, and colonize at secondary sites (Fidler, 2003). A very important step

in metastasis is invasion which is not only dependent on capabilities of the cells

themselves but also on the surrounding microenvironment. Cancer cells reorganize their

microenvironment by secreting growth factors, cytokines, and matrix metalloproteinases.

These signals would alter the extra cellular matrix and affect neighboring stromal cells

such as macrophages, endothelial cells, and fibroblasts (Egeblad & Werb, 2002). In turn,

these cells would release growth factors and other cytokines to enhance the invasion and

proliferation of cancer cells (Alexander & Friedl, 2012). The early steps in the invasion

process involves the activation of signaling pathways that modulate the cytoskeleton of the

invasive cells and modifies cell-matrix and cell-cell junction which is then followed by the

active migration of the cancer cells into nearby microenvironments (Friedl & Wolf, 2003).

Targeting any step in the metastatic process such as motility or invasion can limit the

metastatic ability of cancer cells and retain them in their primary location.

1.5. Kefir

1.5.1. Probiotics

Recently because of the increasing need to find substitutes for conventional

therapies, research has been directed toward the beneficial effects of probiotics and their

potential role in the prevention and healing of various chronic diseases (Preidis et al. 2011;

McNaught & MacFie, 2001). Probiotics have shown to exert beneficial effects on health

and are now of great interest to the science community as well as to the food industry

(Lopitz-Otsoa, Rementeria, Elguezabal, & Garaizar, J. 2006; Preidis et al. 2011). A

11

probiotic is either a single strain or a combination of different microorganisms claimed to

positively affect the well-being of the host if ingested in adequate quantities (McNaught &

Macfie, 2001). An example of probiotics is kefir, which is similar to yogurt in that it is a

fermented milk beverage, but varies a lot in its constituents due to the fact that it produced

by kefir grains (Lopitz-Otsoa et al. 2006).

1.5.2. Characteristics and composition

Kefir is an acidic drink containing small amounts of alcohol and is slightly

carbonated (Lopitz-Otsoa et al. 2006). Kefir grains are a white, soft, gelatin-like mass

composed of bacteria and yeast in a matrix of proteins, fat, and polysaccharides, with

kefiran being the most important water-soluble polysaccharide (Lopitz-Otsoa et al. 2006).

The yeasts and bacteria co-exist in a symbiotic relationship in the kefir grains and trying to

culture different strains individually either inhibits their growth or decreases their

biological activity which makes it difficult to examine the microbial population in the kefir

grains (Lopitz-Otsoa et al. 2006). Kefir grains contain lactic acid bacteria (Lactobacillus

delbruecki, Lactobacillus helveticus, Lactobacillus casei, Lactobacillus acidophilus,

Lactobacillus brevis, etc.), yeasts (Saccharomyces sp., Candida, Torulopsis and

Kluyveromyces), streptococci (Streptococcus salivarius), lactococci (Leuconostoc

cremoris, Leuconostoc mesenteroides, Lactococcus lactis ssp. etc.) and infrequently acetic

acid bacteria (Simova et al. 2005).

1.5.3. Preparation of kefir

The conventional method of producing kefir is by adding kefir grains to raw milk

in a container and incubating them at room temperature for 24 hours. The fermented milk

is filtered to retrieve the grains which would increase in biological mass, the grains can be

used to inoculate a new batch of milk, and the process can be repeated continuously

(Lopitz-Otsoa et al. 2006). To produce a new batch of kefir, it is essential to use kefir

grains to inoculate the milk and not the previously produced kefir since the end product of

the fermentation has a different microbiological profile from the kefir grains (Simova et al.

2002).

12

1.5.4. Origin of kefir

Kefir was produced for centuries in the Caucasus Mountains. Fresh milk from

cows and goats were added to leather and goatskin sacs and allowed to ferment, then the

fermented milk was removed and the sacs were replenished by fresh milk. After the

continuous use of the same container, water-insoluble kefir grains started to form on the

internal wall of the sac (Farnworth, 2005).

1.5.5. Health benefits of kefir

It has long been thought that kefir holds many healing powers for example the

longevity of Bulgarian farmers has been assumed to be due their ingestion of kefir (Liu et

al. 2002). Since the eighteenth century, many health benefits have been attributed to kefir

including its ability to stimulate the immune system (Vinderola, Perdigón, Duarte,

Farnworth, & Matar, 2006a), improve lactose digestion and tolerance in individuals with

lactose intolerance (Hertzler & Clancy, 2003), decrease serum cholesterol levels (Liu et al.

2006), act as an antifungal and antibacterial agent against many pathogenic organisms

(Rodrigues, Caputo, Carvalho, Evangelista, & Schneedorf, 2005), provide resistance

against enteric and diarrheal diseases (Preidis et al. 2011), in addition to its anti-tumoral

activity (Chen, Chan, & Kubow, 2007).

1.5.6. Anticancer effect

1.5.6.1. In vivo studies

The first publication to show an antitumoral activity of a water-soluble

polysaccharide (KGF-C) separated from kefir grains was published in 1982 by Shiomi et

al. Whether this polysaccharide was administered orally or peritoneally it prevented the

growth of Ehrlich carcinoma or Sarcoma 180 in comparison to control mice although its

mode of action was elusive (Murofushi, Shiomi, & Aibara, 1983; Shiomi, Sasaki,

Murofushi, & Aibara, 1982). Later studies determined that KGF-C polysaccharide

enhances the immune system by affecting T-cell and not B-cell action (Murofushi,

Mizuguchi, Aibara, & Matuhasi, 1986). Additionally, studies have also shown that Lewis

lung carcinoma and Ehrlich ascites carcinoma were both inhibited upon the oral

administration of kefir (Furukawa, Matsuoka, & Yamanaka, 1990; Kubo, Odani,

13

Nakamura, Tokumaru, & Matsuda, 1992). Moreover, kefir produced from soy milk and

cow’s milk considerably repressed tumor growth in mice injected with Sarcioma 180 as

compared to unfermented milk and upon microscopic observations, it was suspected that

the tumor size was decreased due to apoptosis (Liu, Wang, Lin, & Lin, 2002).

1.5.6.2 In vitro studies

In 2007, in vitro studies were performed on cell lines to determine whether kefir

has any direct effect on cancer cells and its mode of action. Cell free kefir fractions

exhibited an anti-proliferative effect on human mammary cancer cells (MCF-7) but did not

affect normal human mammary epithelial cells (Chen et al. 2007). Similarly in vitro

experiments using cell free kefir fractions showed anti-proliferative and pro-apoptotic

effects on HTLV-1 (Human T-lymphotropic virus 1) positive and HTLV-1 negative T-

lymphocytes but did not exert any effect on lymphocytes removed from the peripheral

blood of healthy individuals (Rizk, Maalouf, & Baydoun, 2009; Maalouf, Baydoun, &

Rizk, 2011). To better understand its mechanism of action, the levels of expression of

transforming growth factors (TGFs) in the HTLV-1 negative cell lines CEM and Jurkat

were determined using RT-PCR. When the CEM and Jurkat cell lines were treated with

kefir, the levels of TGF-α which is a mitogen decreased whereas those of TGF-β which is

usually a tumor suppressor in normal cells increased which is consistent with the observed

anti-proliferative and pro-apoptotic effects of kefir. Moreover, in these cell lines the levels

of MMP-2 and MMP-9 were evaluated using RT-PCR to examine the metastatic ability of

the leukemic cell lines. No difference in the levels of MMP-2 was observed between

control and treated cells whereas MMP-9 was not detected in either the control or the

treated samples but this doesn’t rule out the effect of kefir on the metastatic ability of these

cells (Maalouf et al. 2011).

Recent work in our lab showed that kefir has anti-proliferative and pro-apoptotic

effects on Caco-2 and HT-29 colorectal cell lines (unpublished data). This finding is

important since earlier studies showed that the prevention of carcinogenesis by kefir and

other probiotics was either through inducing changes in the intestinal microbiota that

14

inhibit the growth of bacteria converting pro-carcinogens into carcinogens or by

modulating the immune response (LeBlac & Perdigo, 2010).

1.5.6.3. Effect on metastasis

Among the few studies that examine the anti-tumoral activity of kefir, only one

work discusses the anti-metastatic ability of kefir on cancer cells in vivo. A study in

2000 by Furukawa et al. showed that when the water-soluble polysaccharide fraction

from kefir grains is administered orally either before or after tumor transplantation it

inhibited the pulmonary metastasis of Lewis lung carcinoma. On the other hand, the

water insoluble fraction of kefir grains was able to prevent metastasis in mice injected

with the highly metastatic B16 melanoma cells compared to control mice (Furukawa,

Matsuoka, Takahashi, & Yamanaka, 2000).

1.6. Purpose of the study

Until present the mechanism of action of kefir remains elusive, therefore the aim of

this study is to determine a possible mechanism of action for the anti-proliferative and pro-

apoptotic effect seen upon the treatment of colorectal cancer cell lines with cell-free

fractions of kefir. Moreover, since its effect on the motility and metastasis of cancer cells

has not been thoroughly studied, the purpose of this study also involves determining the

effect of cell-free fractions of kefir on the motility and invasion of colorectal and breast

cancer cell in vitro.

15

Chapter II

Materials and Methods

2.1. Cell line and cell culture

Two human colorectal adenocarcinoma cell lines, Caco-2 and HT-29, were

cultured in DMEM medium supplemented with 10% FBS and 100U

penicillin/streptomycin at 37°C and 5% CO2 in a humidified chamber. Human breast

cancer cell lines (MCF-7 and MDA-MB231) obtained from ATCC (American Type

Culture Collection), were cultured in DMEM medium supplemented with 10% FBS

and 100U penicillin/streptomycin at 37°C and 5% CO2 in a humidified chamber.

2.2 Preparation of kefir cell-free fraction and milk

Sterilized, pasteurized skimmed milk (150 ml) was inoculated with kefir grains

(50 g). Inoculated milk samples were incubated at 20°C for 24 hours in a sealed glass

container. At the end of fermentation, the milk was strained to remove the kefir grains.

The yeast and bacteria in the filtrate were removed by centrifugation (35,000 rpm for

10 minutes at 4°C). The supernatant was stored at -20°C until needed for treatment of

cells. On the day of treatment, the kefir was thawed and then passed through a 0.22-μm

filter (Millipore, Billerica, MA). This cell free fraction of fermented milk, also termed

kefir, was applied directly to the cells in different volumes to establish the different

concentrations required.

Sterilized, pasteurized skimmed milk was centrifuged (35,000 rpm for 10

minutes at 4°C). The supernatant was stored at -20°C until needed for treatment of

cells. On the day of treatment, the milk was thawed and then passed through a 0.45-μm

filter and a 0.22-μm filter (Millipore, Billerica, MA) successively. The filtrate was

applied directly to the cells in different volumes to establish the different

concentrations required.

16

2.3 Antibodies and reagents

Mouse monoclonal IgG anti-β-Actin, anti-Bax, anti-Bcl2, and anti-p53

antibodies and rabbit polyclonal anti-p21 were obtained from Santa Cruz

Biotechnology. Anti-mouse and anti-rabbit IgG HRP-conjugated secondary antibodies

were obtained from Promega.

2.4. Western blotting

Cell lysates were prepared by scraping the cells in a sample buffer consisted of

4% SDS, 10% β-mercaptoethanol, 20% glycerol, 0.004% bromophenol blue, and

0.125 M Tris-HCl at a pH of 6.8. The resulting lysates were boiled for 5 minutes.

Protein samples were separated by SDS-PAGE on 10% (for Actin and P53) or 12%

(for Bax, Bcl-2, and P21) gels and transferred to PVDF membranes overnight at 30V.

The membranes were then blocked with 5% BSA (Bovine Serum Albumin) in PBS

containing 0.1% Tween-20 for 1 hour at room temperature and incubated with primary

antibody at a concentration of 1:1000 for 2 hours at room temperature. After the

incubation with the primary antibody, the membranes were washed and incubated with

secondary antibody at a concentration of 1:1000 for 1 hour at room temperature. The

membranes were then washed, and the bands visualized by treating the membranes

with western blotting enhanced chemiluminescent reagent ECL (GE Healthcare). The

results were obtained on an X-ray film (Agfa Healthcare). The levels of protein

expression were compared by densitometry using the ImageJ software.

2.5. Reverse-transcription PCR

Cells were grown in 6-well plate at density of 1x106

cells/ml. After 24hrs, cells

were treated with 0, 5, and 10% cell free fractions of kefir. 24hrs later, total RNA was

extracted using RNeasy extraction kit (Qiagen) according to manufacturer’s

instruction. Reverse transcriptase polymerase chain reaction (RT-PCR) was used to

amplify RNA of β-actin, TGF-α and TGF-β. 2µg of RNA was converted to cDNA

using the OneStep RT-PCR kit (Qiagen) as described by the manufacturer. All gene-

specific primers designed to detect cDNA were obtained from Sigma-Aldrich. Primers

for β-actin have the following sequences: Forward: 5’-

17

ATGAAGATCCTGACCGAGCGT-3’, Reverse: 5’-AACGCAGCTCAGTAACAGT-

CCG-3’. Primers for TGF-α have a forward sequence of: 5'-

ATGTTGTTCCCTGCAAGTCC -3' and a reverse sequence of: 5'-

ACTATGGAGAGGGGTCGCTT -3'. Primers for TGF-β Primers have a forward

sequence of: 5’-GAAGTCACCCGCGTGCTAATGG -3’ and a reverse sequence of:

3’- GGATGTAAACCTCGGACCTGTGTG -5’. All primers were used at a final

concentration of 0.6 µM. Primers were added to 5X Qiagen OneStep RT-PCR buffer

providing a final concentration of 2.5 mM MgCl2 in the reaction mix. A final

concentration of 400µM of each dNTP was added along with 2.0 µL/reaction of

enzyme mix. Final mastermix volume was adjusted to 50 µL using RNase-free water.

Thermal cycler conditions, for both reverse transcription and PCR, was programmed

as follows: reverse transcription at 50 oC for 30 min, initial PCR activation step at

95oC for 15 min, followed by 30 cycles of denaturation at 94

oC for 1 min, annealing

at: 52 oC for β-actin, 48 °C for TGF-α and 50

oC for TGF-β1for 1min, and extension at

72oC for 1min followed by a final extension step at 72

oC for 10min. From the PCR

product, 10µL were run on 0.8% agarose gel stained with ethidium bromide at 100V

for 30min. The resulting bands were visualized under UV light and photographed. β-

actin was used as a loading control.

2.6. Wound Healing

Cells were grown to confluence on culture plates and a wound was made in the

monolayer with a sterile pipette tip. After wounding, the cells were washed twice with

PBS to remove debris and new medium was added. Phase-contrast images of the

wounded area were taken at 0 and 24 hours after wounding. Wound widths were

measured at 11 different points for each wound, and the average rate of wound closure

was calculated in m/hr using ImageJ software.

2.7. Motility assay

For motility analysis, images of cells moving randomly in serum were

collected every 60 seconds for 2 hours using a 20X objective. During imaging, the

temperature was controlled using a Nikon heating stage which was set at 37 °C. The

18

medium was buffered using HEPES and overlayed with mineral oil. The speed of cell

movement was quantified using the ROI tracker plugin in the ImageJ software, which

was used to calculate the total distance travelled by individual cells. The speed was

then calculated by dividing this distance by the time (120 minutes) and reported in

m/min. The speed of at least 10 cells for each condition was calculated.

2.8. Invasion assay

Cells were grown in 6-well plate. After 24 hrs, cells were treated with 0, 5, and

10% cell free fractions of kefir for another 24 hrs. Invasion assay was performed

following treatment period using the collagen-based invasion assay (Millipore)

according to manufacturer’s instructions. Briefly, 24hrs prior to assay, cells were

starved with serum free medium. Cells were harvested, centrifuged and then

resuspended in quenching medium (without serum). Cells were then brought to a

concentration of 1x106

cells/ml. In the meantime, inserts were prewarmed with 300l

of serum free medium for 30min at room temperature. After rehydration, 250l of

media was removed from inserts and 250l of cell suspension was added. Inserts were

then placed in a 24-well plate, and 500l of complete media (with 10% serum) was

added to the lower wells. Plates were incubated for 24hrs at 37oC in a CO2 incubator.

Following incubation period, inserts were stained for 20min at room temperature with

400l of cell stain provided with the kit. Stain was then extracted with extraction

buffer (also provided). 100ul of extracted stain was then transferred to a 96-well plate

suitable for colorimetric measurement using a plate reader. Optical Density was then

measured at 560m.

2.8. Statistical analysis

All the results reported represent average values from three independent

experiments. All error estimates are given as ± SEM. The p-values were calculated by

t-tests or chi-square tests depending on the experiment using the VassarStats: Website

for Statistical Computation (http://vassarstats.net/).

19

Chapter III

RESULTS

3.1. Kefir reduces the expression of TGF-α and TGF-β in HT-29 cells:

In order to determine a possible mechanism for the anti-proliferative effect of

kefir observed in colorectal cancer cell lines, the expression of TGF-α and TGF-β1

was assessed at the mRNA level using RT-PCR in HT-29 cells. The results showed a

decrease in the expression of both cytokines in a dose dependent manner upon kefir

treating HT-29 cells for 24hrs (Figure 1A). Yet, the expression of both cytokines did

not change in milk treated cells (Figure 1B).

Figure 1. Expression of TGF-α and TGF-β1using reverse-transcription

pcr in kefir and milk treated HT-29 cells. Figure 1A The expression of

both cytokines in 0, 5, and 10% (v:v) kefir treated cells. Figure 1B The

expression of both cytokines in 0, 5, and 10% (v:v) kefir treated cells.

20

3.2. Bax:Bcl-2 is increased in HT-29 cells

To determine a possible mechanism of action for the pro-apoptotic effect of

kefir on colorectal cancer cells, the expression of Bax and Bcl-2 was assessed at the

protein level using western blot analysis. We observed an increase in the Bax:Bcl-2

ratio upon kefir treatment while a slight decrease in this ratio was observed upon

milk treatment.

Figure 2. Fold increase in Bax:Bcl-2 expression in kefir and milk

treated HT-29 cells. Figure 2A Western Blot analysis images for Bax

and Bcl-2 in kefir treated cells. Figure 2B Western Blot analysis

images for Bax and Bcl-2 in milk treated cells. Figure 2C Bar graph

representing the fold increase in Bax:Bcl-2 expression in kefir and

milk treated HT-29 cells relative to actin.

21

3.3. P21 but not P53 levels are increased in HT-29 cells upon kefir treatment

To further elucidate the mechanism of action for the pro-apoptotic effect and

anti-proliferative effect of kefir on colorectal cancer cells, the expression of P53 and

P21 was assessed at the protein level using western blot analysis. The results showed

no significant increase in the expression of P53 in kefir treated, yet p21 levels

dramatically increased upon treating with 10% kefir. For milk treated cells, the

expression of P53 and P21 does not vary between control and 10% treated cells.

Figure 3. The expression of P21 and P53 in kefir and milk treated HT-29. Figure

3A Western Blot analysis images for P21 and P53 in kefir treated cells. Figure 3B

Western Blot analysis images for P21 and P53 in milk treated cells. Figure 3C Bar

graph representing the fold increase in expression of P53 in kefir and milk treated

cells relative to actin. Figure 3D Bar graph representing the fold increase in

expression of P21 in kefir and milk treated cells relative to actin.

22

3.4. Kefir treatment does not affect the motility of HT-29 and Caco-2 cells

The effect of kefir on the metastatic ability of cancer cells was only assessed

once by Furukawa et al. in 2000 and the study was done in vivo. Therefore, we

wanted to determine whether there is any direct effect on the motility of cancer cells

in vitro upon kefir treatment and we started by looking at the motility of colorectal

cancer cell lines Caco-2 and HT-29 using wound healing analysis. We observed no

difference in the migration ability of control and kefir treated cells after 24 hrs of

treatment (Figure 4).

Figure 4. The migration ability of control and kefir-treated Caco-2 and HT-29

cells in vitro using wound healing analysis. Figure 4A Images from the wound

healing assay measuring the motility of HT-29 cells. Figure 4B Quantitation of the

migration rate of figure 4A. Figure 4C Images from the wound healing assay

measuring the motility of Caco-2 cells. Figure 4D Quantitation of the migration rate

of figure 4C. Data are the mean ± SEM from 3 experiments. The results were not

significant with p>0.05

23

3.5. Kefir treatment does not affect the motility of MCF-7 and MDA-MB-231 cells

After observing no difference in the motility of CRC cells upon kefir treatment, we

decided to explore whether kefir might induce an effect on the motility of other cancer

types in vitro. Therefore we chose to look at MCF-7, breast cancer cells lines. We chose

these cell lines in particular since the effect of cell-free fractions of kefir on MCF-7 has

been previously established in 2007 by Chen et al. and it was also observed that kefir

hindered the proliferative ability of these cells similar to our findings. And since we were

looking at breast cancer cell lines, we also chose to explore the effect of kefir on another

breast cancer cell line which is MDA-MB-231 cell line. In both of these cell lines, we

observed a slight decrease in the migration ability between control and treated cells but the

decrease was non-significant.

24

After observing no effect on the migration ability of MCF-7 and MDA-MB-231

using the wound healing assay, we decided to assess the effect of kefir on their migration

using a different assay known as time-lapse movie. Consistent with our previous results,

we observed a slight decrease in the migration ability of both cell lines upon kefir

treatment, yet the decrease was also non-significant.

Figure 6. The migration ability of control and kefir-treated MCF-7 and MDA-MB-231

cells in vitro using time-lapse movies. Figure 6A Migration path of the MCF-7 cells

randomly moving in serum complete media for 2 hrs. Figure 6B. Bar graphs measuring the

migration rate for the path traveled by MCF-7 cells in figure 6A. Figure 6C Migration path

of the MDA-MB-231cells randomly moving in serum complete media for 2 hrs. Figure

6D. Bar graphs measuring the migration rate for the path traveled by MDA-MB-231cells in

figure 6C. Data are the mean ± SEM from 3 experiments. The results were not significant

with p> 0.05

25

3.6. In vitro invasion of HT-29 cells is not affected by kefir treatment.

After looking at the motility of colorectal and breast cancer cell lines in two-

dimensions and observing no effect upon kefir treatment, we decided to look at whether

kefir has any effect on the invasive ability of the colorectal cancer cell line HT-29. Using

the collagen-based invasion assay, we noticed no difference in the invasive ability of HT-

29 cell lines between control and 10% kefir treated cells.

Figure 7. The invasive ability of control and kefir-treated HT-29 cells

in vitro. Figure 7A Bar graph showing the absorbance of the stain

retained by the invasive cells at 560nm which reflects the amount of

invading cells. Figure 7B Representative images showing the collagen

invading cells in purple which were seeded at a concentration of

1x106cells/ml and allowed to migrate toward 10% FBS containing media.

Data are the mean ± SEM from 3 experiments. The results were not

significant with p> 0.05

26

Chapter IV

DISCUSSION

It was always assumed among the Bulgarian farmers that kefir held special healing

powers, and they believed that their longevity was attributed to their ingestion of kefir (Liu

et al. 2002). Although kefir has been made in the Caucasus Mountains for hundreds of

years, it was kept in secrecy within tribes who held it as their legacy, and not until recently

has kefir grains been distributed to different regions of the world (Farnworth, 2005). Since

then many studies have been made to confirm whether kefir has any health benefits, and

these studies showed that kefir is able to enhance the immune system, inhibit the growth of

pathogenic bacteria and fungi, decrease serum cholesterol levels, and most importantly

have antitumoral activity among other beneficial effects (Vinderola, et al., 2006a.; Liu et

al. 2006; Rodrigues, et al. 2005; Chen, et al., 2007). Studies done in vivo showed that kefir

is able to prevent the growth of tumors such as Sarcoma 180, Ehrlich carcinoma, as well

Lewis lung carcinoma (Murofushi, et al., 1983; Shiomi, et al., 1982). Yet its mechanism

of action remained elusive and some data showed that this effect could be indirectly

induced by kefir through the modulation of the immune system (Murofushi, et al., 1986).

Since 2007, in vitro studies testing the effect of cell free fraction on breast and T-

lymphocyte cancer cell lines showed that kefir has anti-proliferative and pro-apoptotic

effects on these cell lines (Chen et al. 2007; ). And similarly in 2009, a study performed by

Rizk et al. showed the same effect on T-lymphocytes (Rizk, et al., 2009; Maalouf, et al.,

2011). Our lab have recently showed that kefir have the same effects on Caco-2 and HT-

29 colorectal cell lines. So we aimed at trying to determine its possible mechanism of

action.

The expression of TGF-α and TGF-β1 at the mRNA level was first assessed to

determine a possible explanation for the anti-proliferative effect of kefir. TGF-α is a

known mitogen usually seen upregulated in many types of tumors especially CRC where

its expression exceeds four times that of normal colorectal tissues. TGF-α expression was

downregulated in HT-29 cells upon kefir treatment in a dose dependent manner with 5 and

27

10% kefir (v:v) (Ji, et al., 2006; Liu, et al., 1990) (Figure 1A). These results are consistent

with previous results in our lab showing a decrease in the proliferation of HT-29 and

consistent with a previously published paper by Maalouf et al. in 2011. Moreover, such

observation is important knowing that TGF-α also plays a significant role in invasion and

metastasis in vivo through the recruitment of cells expressing VEGF, interleukins, as well

as MMPs, and when the TGF-α/EGFR receptor was targeted by antibodies, the invasive

ability of CRC cells was abolished, (Sasaki, et al., 2008; Ueda, et al., 1998; Hölting, et al.,

1995). This further shows the importance of targeting TGF-α not only to inhibit cancer

growth but also its invasion and metastasis.

A downregulation in the expression level of TGF-β1 was noticed in HT-29 cells

upon kefir treatment in a dose dependent manner (Figure 1A). These data were perplexing

at the beginning since they contradicted a previously published paper by Maalouf at el. in

2011 on HTLV-negative T-lymphocytes that showed an upregulation in TGF-β1 upon

kefir treatment. TGF-β1 has long been assumed to act as a tumor suppressor yet many

studies have shown data conflicting with its known role. Therefore recent studies found

explanations for its dual role and demonstrated that the response of a cell to TGF-β1is

context dependent and is affected by the epigenetic status of the cell, the proteins present

in the signaling pathways, and by transcription factors (Massagué, 2012). In normal cells it

is a tumor suppressor but in many cancers its overexpression is exploited by the cells and

used as a mitogen (Massagué, 2008). In CRC TGF-β1 expression significantly increases

with increased invasion and metastasis, therefore it could be an important target to limit its

growth (Xiong, et al., 2002). Not only does it affect growth but TGF-β1 suppresses

immune system cells in the microenvironment, recruits cells required for the invasion of

CRC cells, induces EMT transition, and stimulates angiogenesis (Thiery, et al., 2012;

Ramesh, et al., 2009). Therefore our data might be of great significance especially that

drugs targeting the TGF-β signaling pathway especially through inhibiting the expression

of TGF-β have now reached phase III clinical trials and the only observed side effect in

clinical trials is the formation of non-malignant skin lesions that disappear after the

withdrawal from the treatment (Akhurst & Hata, 2012; Morris, J. C. et al, 2008). The

decrease of both cytokines was only observed in kefir and not milk treated cells which

28

confirms that it is either a single or a combination of end products from the fermentation

which are inducing the effect and not components originally found in milk (Figure 1)

To determine a possible explanation for the pro-apoptotic effect of kefir on CRC

cell lines, we looked at the expression of Bax:Bcl-2 at the protein level using western blot

analysis. Both of these proteins belong to the Bcl-2 family of protein where Bax acts as a

pro-apoptotic protein whereas Bcl-2 acts as an anti-apoptotic protein (Wang, et al., 2009).

It is generally considered that an increase in proportion of pro- to anti-apoptotic proteins

signals a cell to undergo apoptosis (Ola, et al., 2011). In our findings, we noticed an

upregulation in Bax:Bcl-2 expression in HT-29 cells consistent with the observed increase

in apoptosis previously confirmed by our lab through the Cell-death ELISA based kit. For

the milk treated cells, a decrease in Bax:Bcl-2 ratio was observed which is also in

accordance with the previously proven data in our lab showing a decrease in apoptosis

and increase in proliferation in milk treated HT-29 cells (Figure 2).

To further elucidate the mechanism of action of kefir, the expression levels of

P53 and P21 proteins were assessed. P53 is known to induce cell cycle arrest and DNA

repair and might also cause apoptosis in extremely damaged cells whereas P21, a target

of P53, is a known cell cycle inhibitor that locks cells in the G1 phase (Oren & Rotter,

1999; Harper, et al., 1993). For milk treated cells a slight decrease in P21 levels was

observed. Treating cells with 5 and 10% kefir (v:v) led to a very slight increase in P53

levels but a dramatic increase in P21 levels when treated with 10% kefir (v:v) (Figure 3).

This increase in P21 levels might explain the cell cycle arrest observed at the G1 phase

previously in our lab through cell cycle analysis by flow cytometry. Also our data

suggest that P21 induction is P53-independent (Macleod, et al., 1995). Unpublished data

in our lab also showed that kefir induce apoptosis in leukemic T-lymphocyte cell lines in

a p-53 independent manner.

Since metastasis is the main cause of death in cancer patients, and since the effect

of kefir on metastasis has only been studied once before by Furukawa et al. in 2000, we

wanted to assess the effect of cell-free fractions of kefir on the motility of CRC cancer cell

29

lines in vitro (Palmer, et al., 2011). Using wound-healing analysis, no difference in

motility between the control and 10% kefir treated HT-29 and Caco-2 CRC cells was

observed (Figure 4), yet these data contradict the previously published study in 2000

which showed that kefir inhibited metastasis of Lewis lung carcinoma and B16 melanoma.

The effect of cell free fractions of kefir were then assessed on weakly metastatic MCF-7

and highly metastatic MDA-MB-231 breast cancer cell lines. Using both time-lapse

movies and wound-healing assays to look at the motility of these two cells lines, we

noticed a slight decrease in the motility of MCF-7 and MDA-MB-231 yet the decrease

was non-significant (Figure 5 & 6). Yet metastasis does not depends only on the motility

of the cells but also involves invasion of the microenvironment, intravasation into blood or

lymphatic vessels, survival in the blood or lymph, extravasion, and colonization at

secondary sites (Fidler, 2003). Therefore, to determine whether kefir might be modulating

the invasive ability of the cells as a mechanism for inhibiting metastasis, a collagen-based

in vitro assay was performed. A decrease in the invasive ability of HT-29 cells was

expected since a downregulation in the expression of TGF-α and TGF-β1 was observed

upon kefir treatment, and knowing that they both play an important role in enhancing the

invasive ability of cancer cells (Hölting, et al., 1995; Xiong, et al., 2002). Yet after

performing the collagen-based invasion assay in vitro and no difference in the invasive

ability between control and 10% treated cells was noticed (Figure 7). Thus an explanation

for the contradiction observed between the motility and invasion data in vitro and that of

the published article in 2000 could be explained by several hypotheses. One explanation

could be that kefir is acting indirectly to inhibit metastasis in vivo by modulating the

immune system. Another hypothesis could be that kefir might be intervening in other

processes involved in metastasis beside motility and invasion. A third possibility is that

components found in kefir might be modified in our body by enzymes leading to the

formation of active compounds which are able to inhibit metastasis in vivo.

30

Chapter V

CONCLUSION

In this study we were the first to elucidate a potential mechanism of action for

kefir’s effect on colorectal cancer in vitro as well as its effect on the motility and invasion.

The downregulation in the expression of TGF-α and TGF-β1 explain the decrease in the

proliferation of HT-29 cells in vitro. Also the observed overexpression of p21 which was

seen to be p53-independent could be the reason behind the cell cycle arrest at the G1 phase

previously seen upon kefir treatment. Moreover, we have seen that the expression of Bax

to Bcl-2 at the protein level increases upon kefir treatment consistent with the increase in

apoptosis induced by kefir. On the other hand, the effect of kefir on the motility and

invasion of colorectal and breast cancer cell lines was insignificant, but this does not rule

out the fact that kefir does have an effect on the metastatic ability of cancer cells. Kefir’s

effect on metastasis could be by modulating other steps in the metastatic process or that its

effect is only observed in vivo. Future plans are to confirm the effect of kefir on the growth

of colorectal cancer in vivo and also to assess its effect on the metastasis of this cancer

through the intrasplenic injection of HT-29 that causes liver metastasis.

31

BIBLIOGRAPHY

Alexander, S., & Friedl, P. (2012). Cancer invasion and resistance: Interconnected

processes of disease progression and therapy failure. Trends Mol Med, 18(1), 13-

26.

Allegra, J. C. (1987). Megestrol acetate: A new role in the treatment of metastatic breast

cancer. Semin Hematol, 24(2 Supp1), 45.

Altekruse, S. F., Kosary, C. L., Krapcho, M., Neyman, N., Aminou, R., Waldron, W., ...

Edwards, B. K. (2010). SEER cancer statistics review, 1975-2007, National

Cancer Institute. Retrieved from the National Cancer Institute website:

http://seer.cancer.gov/csr/1975_2007/

American Cancer Society. (2013). Breast cancer. Retrieved from the American Cancer

Society website: http://www.cancer.org/cancer/breastcancer/detailedguide/breast-

cancer-key-statistics

American Cancer Society. (2013). Colorectal cancer. Retrieved from the American

Cancer Society website:

http://www.cancer.org/cancer/colonandrectumcancer/detailedguide/colorectal-

cancer-key-statistics

Arteaga, C. (2003). Targeting HER1/EGFR: A molecular approach to cancer therapy. Sem

Oncol, 30(3 Supp7), 3–14.

Baselga, J., & Albanell, J. (2002). Epithelial growth factor receptor interacting agents.

Hematol Oncol Clin North Am, 16(5), 1041-1063.

Barak, Y., Juven, T., Haffner, R., & Oren, M. (1993). Mdm2 expression is induced by

wild type p53 activity. EMBO J, 12(2), 461.

Becouarn, Y., Ychou, M., Ducreux, M., Borel, C., Bertheault-Cvitkovic, F., Seitz, J. F., ...

Rougier, P. (1998). Phase II trial of oxaliplatin as first-line chemotherapy in

metastatic colorectal cancer patients. Digestive Group of French Federation of

Cancer Centers. J Clin Oncol, 16(8), 2739-2744.

Berg, M. & Soreide, K. (2012). EGFR and downstream genetic alterations in

KRAS/BRAF and PI3K/AKT pathways in colorectal cancer: Implications for

targeted therapy. Discov Med, 14(76), 207-214.

Brunelle, J. K., & Letai, A. (2009). Control of mitochondrial apoptosis by the Bcl-2

family. J Cell Sci, 122(4), 437-441.

32

Chen, C., Chan, H. M., & Kubow, S. (2007). Kefir extracts suppress in vitro proliferation

of estrogen-dependent human breast cancer cells but not normal mammary

epithelial cells. J Med Food, 10(3), 416-422.

Cunningham, D., Atkin, W., Lenz, H. J., Lynch, H. T., Minsky, B., Nordlinger, B. &

Starling, N. (2010). Colorectal cancer. Lancet, 375(9719), 1030-1047.

Danial, N. N., & Korsmeyer, S. J. (2004). Cell death: Critical control points. Cell, 116(2),

205-219.

Derynck, R. & Miyazono, K. (2008). The TGF-β Family. Cold Spring Harbor, NY: Cold

Spring Harbor Laboratory Press.

Early Breast Cancer Trialists' Collaborative Group (EBCTCG). (2005). Effects of

chemotherapy and hormonal therapy for early breast cancer on recurrence and 15-

year survival: An overview of the randomised trials. Lancet, 365(9472), 1687-

1717.

Egeblad, M., & Werb, Z. (2002). New functions for the matrix metalloproteinases in

cancer progression. Nat Rev Cancer, 2(3), 161–174.

El-Deiry, W. S. (2003). The role of p53 in chemosensitivity and radiosensitivity.

Oncogene, 22(47), 7486-7495.

Elliott, R. L., & Blobe, G. C. (2005). Role of transforming growth factor Beta in human

cancer. J Clin Oncol, 23(9), 2078-2093.

Ferrara, N., Gerber, H. P., & LeCouter, J. (2003). The biology of VEGF and its receptors.

Nat Med, 9, 669–676.

Farnworth, E. (2005). Kefir–A complex probiotic. Food Sci Technol Bull, 2, 1-17.

Fidler, I. J. (2003). The pathogenesis of cancer metastasis: The seed and soil hypothesis

revisited. Nat Rev Cancer, 3(6), 453-458.

Friedl, P., & Wolf, K. (2003). Tumour-cell invasion and migration: Diversity and escape

mechanisms. Nat Rev Cancer, 3(5), 362–374.

Fuchs, C. S., Marshall, J., Mitchell, E., Wierzbicki, R., Ganju, V., Jeffery, M., ...

Barrueco, J. (2007). Randomized, controlled trial of irinotecan plus infusional,

bolus, or oral fluoropyrimidines in first-line treatment of metastatic colorectal

cancer: Results from the BICC-C Study. J of Clin Oncol, 25(30), 4779-4786.

Furukawa, N., Matsuoka, A., Takahashi, T. & Yamanaka, Y. (2000). Anti-metastatic

33

effect of kefir grain components on Lewis lung carcinoma and highly metastatic

B16 melanoma in mice. J Agr Sci Tokyo Nogyo Daigaku, 45, 62-70.

Furukawa, N., Matsuoka, A. & Yamanaka, Y. (1990). Effects of orally administered

yoghurt and kefir on tumor growth in mice. J Jpn Soc Food Sci Technol, 43, 450-

453.

Goldstein, N. S., & Armin, M. (2001). Epidermal growth factor receptor

immunohistochemical reactivity in patients with American Joint Committee on

cancer stage IV colon adenocarcinoma. Cancer, 92(5), 1331-1346.

Hassan, M. S., Ansari, J., Spooner, D., & Hussain, S. A. (2010). Chemotherapy for breast

cancer. Oncol Rep, 24(5), 1121-1131.

Harper, J. W., Adami, G. R., Wei, N., Keyomarsi, K., & Elledge, S. J. (1993). The p21

Cdk-interacting protein Cip1 is a potent inhibitor of G1 cyclin-dependent kinases.

Cell, 75(4), 805-816.

Heldin, C.H., Vanlandewijck, M., & Moustakas, A. (2012). Regulation of EMT by TGFβ

in cancer. FEBS Lett, 586(14), 1959-1970.

Hölting, T., Siperstein, A. E., Clark, O. H., & Duh, Q. Y. (1995). Epidermal growth factor

(EGF)-and transforming growth factor alpha-stimulated invasion and growth of

follicular thyroid cancer cells can be blocked by antagonism to the EGF receptor

and tyrosine kinase in vitro. Eur J Endocrinol, 132(2), 229-235.

Howlader, N., Noone, A. M., Krapcho, M., Garshell, J., Neyman, N., Altekruse, S. F., ...

Cronin, K. A. (2013). SEER Cancer Statistics Review, 1975-2010, National

Cancer Institute. Retrieved from the National Cancer Institute website:

http://seer.cancer.gov/statfacts/html/breast.html

Ji, H., Zhao, X., Yuza, Y., Shimamura, T., Li, D., Protopopov, A., ... Wong, K. K. (2006).

Epidermal growth factor receptor variant III mutations in lung tumorigenesis and

sensitivity to tyrosine kinase inhibitors. Proc Natl Acad Sci U S A, 103(20), 7817-

7822.

Kubbutat, M. H., Jones, S. N., & Vousden, K. H. (1997). Regulation of p53 stability by

MDM2. Nature, 387(6630), 299-303.

Kubo, M., Odani, T., Nakamura S., Tokumaru, S. & Matsuda, H. (1992).

Pharmacological study on kefir-a fermented milk product in Caucasus. I. On

antitumor activity (1). Yakugaku Zasshi, 112(7), 489-495.

Kufe, D. W., Pollock, R. E., Weichselbaum, R. R., Bast, R., Gansler, T., & Frei, E.

34

(2003). Cancer and medicine. (6th

ed.). Retrieved from

http://www.ncbi.nlm.nih.gov/books/NBK13267/

Latkauskas, T., Paskauskas, S., Dambrauskas, Z., Gudaityte, J., Saladzinskas, S., Tamelis,

A., & Pavalkis, D. (2010). Preoperative chemoradiation vs radiation alone for stage

II and III resectable rectal cancer: A meta‐analysis. Colorectal Dis, 12(11), 1075-

1083.

Lauffenburger, D. A., & Horwitz, A. F. (1996). Cell migration: A physically integrated

molecular process. Cell, 84(3), 359–369.

LeBlanc, A., & Perdigo, G. (2010). Session 8: Probiotics in the defense and metabolic

balance of the organism. The application of probiotic fermented milks in cancer

and intestinal inflammation. Proc Nutr Soc, 69, 421–428.

Liu, C., Woo, A., & Tsao, M. S. (1990). Expression of transforming growth factor-alpha in

primary human colon and lung carcinomas. Br J Cancer, 62(3), 425–429.

Liu, J. R., Wang, S. Y., Lin, Y. Y., & Lin, C. W. (2002). Antitumor activity of milk kefir

and soy milk kefir in tumor-bearing mice. Nutr Cancer, 44, 182-187.

Liu, J., Wang, S., Chen, M., Chen, H., Yueh, P. & Lin, C. (2006). Hypocholesterolaemic

effects of milk-kefir and soya milk-kefir in cholesterol-fed hamsters. Br J Nutr, 95,

939–946.

Lopitz-Otsoa, F., Rementeria, A., Elguezabal, N., & Garaizar, J. (2006). Kefir: A

symbiotic yeasts-bacteria community with alleged healthy capabilities. Rev

Iberoam Micol, 23(2), 67-74.

Maalouf, K., Baydoun, E., & Rizk, S. (2011). Kefir induces cell-cycle arrest and apoptosis

in HTLV-1-negative malignant T-lymphocytes. Cancer Manag Res, 3, 39-47.

Macleod, K. F., Sherry, N., Hannon, G., Beach, D., Tokino, T., Kinzler, K., ... Jacks, T.

(1995). P53-dependent and independent expression of p21 during cell growth,

differentiation, and DNA damage. Genes Dev, 9(8), 935-944.

Massagué, J. (2008). TGFβ in cancer. Cell, 134(2), 215-230.

Massagué, J. (2012). TGFβ signalling in context. Nat Rev Mol Cell Biol, 13(10), 616-630.

McNaught, C. E., & MacFie, J. (2001). Probiotics in clinical practice: A critical review of

the evidence. Nutr Res, 21, 343–353.

Mellon, J. K., Cook, S., Chambers, P., & Neal, D. E. (1996). Transforming growth factor

35

alpha and epidermal growth factor levels in bladder cancer and their relationship

to epidermal growth factor receptor. Br J Cancer, 73(5), 654.

Messersmith, W. A., & Hidalgo, M. (2007). Panitumumab, a monoclonal anti–epidermal

growth factor receptor antibody in colorectal cancer: Another One or the One? Clin

Cancer Res, 13(16), 4664-4666.

Morris, J. C., Shapiro, G. I., Tan, A. R., Lawrence, D. P., Olencki, T. E., Dezube, B. J., ...

Berzofsky, J. A. (2008). Phase I/II Study of GC1008: A human anti-transforming

growth factor-beta (TGF-β) monoclonal antibody (MAb) in patients with advanced

malignant melanoma (MM) or renal cell carcinoma (RCC). J Clin Oncol, 26, 9028.

Murofushi, M., Mizuguchi, J., Aibara, K., & Matuhasi, T. (1986). Immunopotentiative

effect of a polysaccharide from kefir grain, KGF-C, administered orally in mice.

Immunopharmacology, 12(1), 29-35.

Murofushi, M., Shiomi, M., & Aibara, K. (1983). Effect of orally administered

polysaccharide from kefir grain on delayed-type hypersensitivity and tumor growth

in mice. Jpn J Med Sci Biol, 36(1), 49-53.

Ola, M. S., Nawaz, M., & Ahsan, H. (2011). Role of Bcl-2 family proteins and caspases in

the regulation of apoptosis. Mol Cell Biochem, 351(1-2), 41-58.

Oren, M., & Rotter, V. (1999). Introduction: P53–the first twenty years. Cell and Mol Life

Sci, 55(1), 9-11.

Palmer, T. D., Ashby, W. J., Lewis, J. D., & Zijlstra, A. (2011). Targeting tumor cell

motility to prevent metastasis. Adv Drug Deliv Rev, 63(8), 568-581.

Pater, J. L., & Parulekar, W. R. (2003). Ovarian ablation as adjuvant therapy for

premenopausal women with breast cancer—another step forward. J Natl Cancer

Inst, 95(24), 1811-1812.

Perou, C. M., Sørlie, T., Eisen, M. B., Van de Rijn, M., Jeffrey, S. S., Rees, C. A., ...

Botstein, D. (2000). Molecular portraits of human breast tumours. Nature,

406(6797), 747–752.

Pignone, M., & Sox, H. C. (2008). Screening for colorectal cancer: US preventive services

task force recommendation statement. Ann Intern Med, 149(9), 680-682.

Preidis, G. A., Hill, C., Guerrant, R. L., Ramakrishna, B. S., Tannock, G. W., &

Versalovic, J. (2011). Probiotics, enteric and diarrheal diseases, and global health.

Gastroenterology, 140(1), 8-14.

Prives, C., & Hall, P. A. (1999). The p53 pathway. J Pathol, 187(1), 112-126.

36

Ramesh, S., Wildey, G. M. & Howe, P. H. (2009). Transforming growth factor β (TGFβ)-

induced apoptosis: The rise and fall of Bim. Cell Cycle, 8, 11–17.

Ridley, A. J., Schwartz, M. A., Burridge, K., Firtel, R. A., Ginsberg, M. H., Borisy, G., ...

Horwitz, A. R. (2003). Cell migration: Integrating signals from front to back.

Science, 302(5651), 1704-1709

Rizk, S., Maalouf, K., & Baydoun, E. (2009). The antiproliferative effect of kefir cell-free

fraction on HuT-102 malignant T lymphocytes. Clin Lymphoma Myeloma,

9(Supp3), S198-203.

Rodrigues, K. L., Caputo, L. R., Carvalho, J. C., Evangelista, J., & Schneedorf, J. M.

(2005). Antimicrobial and healing activity of kefir and kefiran extract. Int J

Antimicrob Agents, 25(5), 404-408.

Romond, E. H., Perez, E. A., Bryant, J., Suman, V. J., Geyer Jr, C. E., Davidson, N. E., ...

Wolmark, N. (2005). Trastuzumab plus adjuvant chemotherapy for operable

HER2-positive breast cancer. N Engl J Med, 353(16), 1673-1684.

Saikumar, P., Dong Z., Mikhailov, V., Denton, M., Weinberg, J. M., & Venkatachalam,

M. A. (1999). Apoptosis: Definition, mechanisms, and relevance to disease. Am J

Med, 107(5) 489–506.

Salomon, D. S., Brandt, R., Ciardiello, F., & Normanno, N. (1995). Epidermal growth

factor-related peptides and their receptors in human malignancies. Crit Rev in

Oncol Hematol, 19(3), 183-232.

Sasaki, T., Nakamura, T., Rebhun, R. B., Cheng, H., Hale, K. S., Tsan, R. Z., ... Langley,

R. R. (2008). Modification of the primary tumor microenvironment by

transforming growth factor alpha-epidermal growth factor receptor signaling

promotes metastasis in an orthotopic colon cancer model. Am J Pathol, 173(1),

205-216.

Schmierer, B., & Hill, C. S. (2007). TGFβ–SMAD signal transduction: Molecular

specificity and functional flexibility. Nat Rev Mol Cell Biol, 8(12), 970-982.

Selvakumaran, M., Lin, H. K., Miyashita, T., Wang, H. G., Krajewski, S., Reed, J. C., ...

Liebermann, D. (1994). Immediate early up-regulation of bax expression by p53

but not TGF beta 1: A paradigm for distinct apoptotic pathways. Oncogene, 9(6),

1791.

Sheetz, M. P., Felsenfeld, D., Galbraith, C. G., & Choquet, D. (1999). Cell migration as a

fivestep cycle. Biochem Soc Symp, 65, 233–243.

37

Shiomi, M., Sasaki, K., Murofushi, M., & Aibara, K. (1982). Antitumor activity in mice

of orally administered polysaccharide from Kefir grain. Jpn J Med Sci Biol, 35(2),

75-80.

Siegel, R., Naishadham, D., & Jemal, A. (2013). Cancer statistics, 2013. Cancer J Clin,

63, 11-30.

Simova, E., Beshkova, D., Angelov, A., Hristozova, T.S., Frengova, G., & Spasov, Z.

(2002). Lactic acid bacteria and yeasts in kefir grains and kefir made from them. J

Ind Microbiol Biotechnol, 28(1), 1-6.

Simova, E., Simov, Z., Beshkova, D., Frengova, G., Dimitrov, Z., & Spasov, Z. (2005).

Amino acid profiles of lactic acid bacteria, isolated from kefir grains and kefir

starter made from them. Int J Food Microbiol, 107(2), 112-23.

Simpson, J. F. & Wilkinson, E. J. (2004). The breast: Comprehensive management of

benign and malignant disorders. London: St. Louis Saunders.

Sobrero, A., Guglielmi, A., Grossi, F., Puglisi, F., & Aschele, C. (2000). Mechanism of

action of fluoropyrimidines: Relevance to the new developments in colorectal

cancer chemotherapy. Semin Oncol, 27, 72–77.

Sørlie, T., Perou, C. M., Tibshirani, R., Aas, T., Geisler, S., Johnsen, H., ... Børresen-Dale,

A. L. (2001). Gene expression patterns of breast carcinomas distinguish tumor

subclasses with clinical implications. Proc Natl Acad Sci U S A, 98(19), 10869–

10874.

Strasser, A., Harris, A. W., Huang, D. C., Krammer, P. H., & Cory, S. (1995). Bcl-2 and

Fas/APO-1 regulate distinct pathways to lymphocyte apoptosis. EMBO J, 14(24),

6136-6147.

Strasser, A., O'Connor, L., & Dixit, V. M. (2000). Apoptosis signaling. Annu Rev

Biochem, 69(1), 217-245.

Thiery, J. P., Acloque, H., Huang, R. Y., & Nieto, M. A. (2009). Epithelial-mesenchymal

transitions in development and disease. Cell, 139(5), 871-890.

Tsushima, H., Kawata, S., Tamura, S., Ito, N., Shirai, Y., Kiso, S., ... Matsuzawa, Y.

(1996). High levels of transforming growth factor beta 1 in patients with colorectal

cancer: Association with disease progression. Gastroenterology, 110(2), 375-382.

Ueda, M., Fujii, H., Yoshizawa, K., Terai, Y., Kumagai, K., Ueki, K., & Ueki, M. (1998).

Effects of EGF and TGF-alpha on invasion and proteinase expression of uterine

cervical adenocarcinoma OMC-4 cells. Invasion Metastasis, 18(4), 176-183.

Umekita, Y., Ohi, Y., Sagara, Y., & Yoshida, H. (2000). Co‐expression of epidermal

38

growth factor receptor and transforming growth factor‐α predicts worse prognosis

in breast‐cancer patients. Int J Cancer, 89(6), 484-487.

Vaklavas, C., & Forero-Torres, A. (2011). How do I treat "triple-negative" disease. Curr

Treat Options Oncol, 12(4), 369-388.

Vinderola, G., Perdigón, G., Duarte, J., Farnworth, E., & Matar, C. (2006a). Effects of the

oral administration of the exopolysaccharide produced by Lactobacillus

kefiranofaciens on the gut mucosal immunity. Cytokine, 36(5-6), 254-260.

Vinderola, G., Perdigon, G., Duarte, J., Thangavel, D., Farnworth, E., & Matar, C.

(2006b). Effects of kefir fractions on innate immunity. Immunobiology, 211(3),

149-156.

Vousden, K. H., & Lu, X. (2002). Live or let die: The cell's response to p53. Nat Rev

Cancer, 2(8), 594-604.

Wang, K., Yin, X. M., Chao, D. T., Milliman, C. L., & Korsmeyer, S. J. (1996). BID: A

novel BH3 domain-only death agonist. Genes Dev, 10(22), 2859-2869.

Wei, M. C., Zong, W. X., Cheng, E. H., Lindsten, T., Panoutsakopoulou, V., Ross, A. J.,

... Korsmeyer, S. J. (2001). Proapoptotic BAX and BAK: A requisite gateway to

mitochondrial dysfunction and death. Science, 292(5517), 727–730.

Whelan, T. J., Julian, J., Wright, J., Jadad, A. R., & Levine, M. L. (2000). Does

locoregional radiation therapy improve survival in breast cancer? A meta-analysis.

J Clin Oncol., 18(6), 1220-1229.

Whitlock, E. P., Lin, J., Liles, E., Beil, T., Fu, R., O'Connor, E., ... Cardenas, T. (2008).

Screening for colorectal cancer: An updated systematic review. Evidence

Syntheses, 65(1). Retrieved from http://www.ncbi.nlm.nih.gov/books/NBK35179/

Wolpin, B. M., & Mayer, R. J. (2008). Systemic treatment of colorectal cancer.

Gastroenterology, 134(5), 1296-1310.

Xiong, B., Yuan, H. Y., Hu, M. B., Zhang, F., Wei, Z. Z., Gong, L. L., & Yang, G. L.

(2002). Transforming growth factor-beta1 in invasion and metastasis in colorectal

cancer. World J Gastroenterol, 8(4), 674-678.

Yarden, Y., & Sliwkowski, M. X. (2001). Untangling the ErbB signalling network. Nat Rev

Mol Cell Biol, 2(2), 127-137.

Youle, R. J., & Strasser, A. (2008). The BCL-2 protein family: Opposing activities that

mediate cell death. Nat Rev Mol Cell Biol, 9(1), 47-59.

Yu, J., Zhang, L., Hwang, P. M., Kinzler, K. W., & Vogelstein, B. (2001). PUMA induces

39

the rapid apoptosis of colorectal cancer cells. Mol Cell, 7(3), 673-682.