the influence of opioids on gastric function: experimental and
TRANSCRIPT
The influence of opioids on gastric function:
experimental and clinical studies
Örebro Studies in Medicine 14
Jakob Walldén
The influence of opioids on gastric function:
experimental and clinical studies
© Jakob Walldén, 2008
Title: The influence of opioids on gastric function:experimental and clinical studies
Publisher: Örebro University 2008www.oru.se
Editor: Maria Alsbjer [email protected]
Printer: Intellecta DocuSys, V Frölunda 02/2008
issn 1652-4063 isbn 978-91-7668-583-9
14. 66 .
�
�
15
Introduction
Why, as an anesthesiologist, am I writing a thesis about the gastrointestinal tract?
Shouldn’t I be more interested in the brain and the nerves? As a matter of fact,
the stomach and the intestines play a major role during the perioperative period.
The aim of preoperative fasting is an empty stomach at the start of anesthesia in
order to reduce the risk of pulmonary aspiration. Postoperative nausea and
vomiting (PONV), often termed “the big little problem”, is a major concern.
Postoperative ileus (POI) due to impairments in gastrointestinal motility is
common, and it delays the start of oral feeding and the passage of stool. Patients
sometimes rate gastrointestinal symptoms as more severe than postoperative pain,
and impairment of gastrointestinal function often delays discharge from the
hospital. To answer the initial question, the gastrointestinal tract is of central
importance for both perioperative care and the anesthesiologist. Many factors
contribute to the impairment of perioperative gastrointestinal function (1-4), and
the opioid analgesics are one of the major contributors (5, 6).
The overall objective of this work was to acquire more knowledge about the
mechanism and physiology behind opioid effects on the gastrointestinal system.
The current understanding in the field is limited and much more research is
needed (7). In this thesis I have explored the effects of two opioid drugs, fentanyl
and remifentanil, on gastric motility.
Normal gastric motility
The physiological functions of the stomach are to receive ingested food, mix it
with secretions, mechanically break down the contents and finally pass the
contents to the duodenum (2). The proximal stomach, the fundus, functions as a
reservoir and with volume loads, muscles are adapted for maintaining a
continuous contractile tone (8). The distal antral region exhibits phasic and
peristaltic contractile activity and functions both as a pump and a grinding mill
(9). The tone of the pyloric sphincter regulates the outflow to the duodenum (10).
Two patterns of gastric motility can be distinguished – fasting and postprandial
motility. Fasting motility has a housekeeping function and consists of recurrent
contractile activity, sweeping contents distally in the bowel (11). This pattern is
described by the expression “migrating motor complex” (MMC), which is
characterized by three different phases. MMC phase I starts approximately 2-3
hours after a meal, lasts for 1 hour, and during this phase there are only a few
16
contractions every 5 minutes. In MMC phase II, the frequency of contractions
increases, but they are irregular. Phase III starts after a further 30 minutes, lasts
for about 10 minutes, and the coordinated contraction is maximal with clear
propagation of intraluminal contents. The interdigestive pattern terminates
abruptly after ingestion of food. After a meal, the motility pattern is dependent
on the physical state and nutrient content. The stomach exhibits submaximal and
phasic contractile activity, similar to MMC phase II. The contents are mixed,
digested and portioned out to the duodenum through the pylorus.
Myoelectric activity Gastric smooth muscles display a rhythmic electrical activity, slow waves, with a
frequency of approximately 3 cycles per minute. These slow waves originate from
a gastric pacemaker region in the corpus region of the stomach and propagate
towards the pylorus. With influence of the enteric nervous system and other
regulatory mechanisms, the slow waves trigger the onset of spike potentials,
which in turn initiate coordinated contractions of the gastric smooth muscles
(12). Gastric motility and emptying depend on these slow waves.
Neuronal control Neural networks for control of gastric motility are present both on the enteric
and the central levels. The enteric nervous system (ENS) is a separate division of
the autonomic nervous system and has local circuits for integrative functions
independent of extrinsic nervous control. Many of the reflexes, “programs” and
information processing for motility are located within the ENS. However, the
functional physiology of the stomach is dependent on higher levels of control.
(13)
The parasympathetic vagus nerve is a mixed sensory and motor nerve with 90%
afferent fibers, transmitting sensory information to the brainstem, and 10%
efferent fibers with motor functions (14). In the brainstem, the sensory neurons
are located in the nucleus tractus solitarius (NTS) and the motor neurons are
located in the dorsal motor nucleus of vagus (DMV). The two nucleuses are in
proximity to one another and there are dense networks of interneurons between
them, providing sensory information for the motor output, and completing the
vago-vagal reflex loop. The whole complex is also under the influence of higher
centers and circulating hormones (15, 16). There are two subgroups of the
efferent motor nerves, and the neurons are organized separately within the DMV
17
(16). Cholinergic fibers mediate excitations and non-adrenergic non-cholinergic
(NANC) inhibition to the stomach.
The sympathetic innervations to the stomach originate from the thoracic spinal
cord (T6 to T9). They consist of efferent adrenergic fibers and act mainly through
inhibition of the cholinergic transmission in the stomach (17). Together with
sympathetic afferent sensory fibers, the inhibiting gastro-gastric reflex is formed
(18).
The composition of the contents in the intestines also affects motility. Lipids,
carbohydrates, amino acids, low pH and hyperosmolarity in the duodenum
inhibit gastric motility. The “ileal break”, activated by caloric content in the
ileum, inhibits gastric motility and the glucagon-like peptide-1 (GLP-1) is the
proposed mediator (19). Colonic distension decreases gastric tone (20).
Several endogenous substances are involved in the integrative functions.
Cholecystokinin, released in the ileum in the presence of fatty contents, inhibits
gastric emptying mainly through activation of afferent vagal fibers (21). Ghrelin,
a relatively newly discovered gastric peptide, stimulates appetite, food intake and
gastric motility (22). Somatostatin, released from D-cells found throughout the
gastrointestinal tract, has complex actions on motility (21). Motilin, produced in
the duodenum, stimulates stomach motility through direct activation of motilin
receptors on enteric neurons, leading to activation of cholinergic neurons in the
antral region of the stomach (23).
Gastric tone The proximal part of the stomach acts as a reservoir and exhibits a constant
dynamic tone. It adapts for volume loads, and volume waves portion contents to
the distal part of the stomach. The tone is mainly controlled by the autonomous
nervous system. (8, 18)
Tone is not equivalent to pressure. Gastric tone can be expressed as the length of
the muscle fibers in the proximal stomach. As there is an adaptive relaxant reflex,
a volume load might maintain the same intragastric pressure. Therefore, an
almost empty stomach and a full stomach are able to have the same intragastric
pressure, but different tone.
18
Gastric emptying Gastric emptying (GE), the functional outcome of gastric emptying, is dependent
on the character of the stomach contents. The emptying of liquids starts
immediately and follows an exponential profile, meaning that a certain
proportion of the liquids is emptied during each time interval. Usually the time
for emptying half of the liquid contents is about 15-20 minutes. In contrast, any
caloric content or solids in the food causes a change from the liquid pattern of
emptying. For solid food, there is first a delay in emptying, a so-called lag-phase,
where no contents are passed to the duodenum. Contents are then mixed, grinded
and digested. This lag-phase lasts up to 1 hour and is followed by an emptying
that is characterized as linear, as a certain amount of contents is emptied during
each time interval (24). Posture influences gastric emptying, particularly with long
emptying when patients are in a left lateral position (25-27) .
Methods for measuring gastric motility
Gastric emptying rates can be estimated with various methods. The “gold
standard” is scintigraphic methods with radionucelotide labeled test meals (28).
With ultrasound techniques, transpyloric flow and gastric volumes can be
estimated (29-31). Absorption tests, i.e. the paracetamol method, (32-34), and
hydrogen breath tests (35) measure gastric emptying indirectly. Gastric pressures
are studied with manometry catheters and gastric myoelectric activity with
cutaneous electrogastrography (36). The gastric barostat measures proximal
gastric tone (37).
Opioid drugs
Morphine-like alkaloids have been used for centuries for analgesia and sedation.
Morphine was isolated from the opium flower in the beginning of the 19th
century, and some half century later, with introduction of the needle and syringe
in clinical practice, morphine could be administered in a controlled manner.
Opioid drugs are still fundamental in the treatment of severe pain, and morphine
is the reference substance to which other opioids are compared. Numerous
analogues with various pharmacological profiles have been developed. (38)
Opioids mediate their effect via opioid receptors on cell membranes. Currently,
five classes of receptors are identified, but research in humans has focused on the
role of μ-, κ-, and δ-opioid receptors (39). All three receptor classes are expressed
throughout the nervous systems, including the GI tract, and they partly overlap in
distribution and function. The receptors bind to both exogenous opioids, i.e.
morphine, and endogenous opioid peptides. (40, 41). The receptors differ in their
19
pharmacological profiles and have selectivity for the three classes of endogenous
opioid peptides. Analgesia, as well as many of the side effects, are mainly
mediated via activation of the μ-opioid receptor (MOR) (42, 43).
Morphine-analogue drugs exhibit their actions mainly through the MORs (44).
MORs are widely distributed on cell membranes in the body and are present in
the central nervous system (45-47) including at the spinal level (48), on peripheral
nerves (49), and in the gastrointestinal tract (41, 50-52).
On the cellular level, the MOR is coupled to transmembrane G-proteins. The
cellular effects involve hyperpolarizations of the cell membrane via K+ and Ca++
channels and changes in the second messenger systems (i.e. cAMP, IP3). The
physiological result of receptor activation depends on the site of action, but
synaptic transmission is usually inhibited, i.e. via inhibition of presynaptic
excitatory transmitter release or postsynaptic hyperpolarization (38).
Fentanyl Fentanyl is the most common opioid used in daily anesthetic practice. It is a
MOR agonist with analgesic potency 100 times that of morphine. It is highly
lipophilic and has a high volume of distribution. It is usually given as repetitive
bolus injections during anesthesia. Clearance from the body can be long,
especially after repetitive doses. (53)
Remifentanil Remifentanil is a MOR agonist with analgesic potency similar to that of fentanyl.
It has a rapid onset and recovery and is usually administered as a continuous
infusion. Remifentanil is metabolized by unspecific esterases in the body, has a
relatively small volume of distribution, and has a systemic half life of about 10
minutes. The context sensitive halftime (time to reduce the effect site concentra-
tion to 50%) is around 4 minutes and is independent of infusion time. This gives
remifentanil the unique property that after termination of a several hour long
infusion, such as during anesthesia, remifentanil is rapidly cleared and patients
recover within minutes. Remifentanil is used routinely today in anesthetic
management. (54)
Effect of opioids on gastrointestinal motility
In 1917, Trendelenburg was the first to demonstrate the inhibitory effects of
opioids on motility in an experimental setting using isolated animal intestines (55,
56). Since then, effects of opioids on gastrointestinal motility have been studied
20
extensively, but the mechanism is complex and still uncertain (7). Opioid
receptors are widely spread in the gastrointestinal tract and are located on
neurons in the ENS, on secretomotor neurons and on smooth muscles (57-60).
Opioid receptors mediate the action of both exogenous opioids and endogenous
opioid peptides, and generally speaking opioids suppress neural excitability
through the opening of potassium conductance channels, leading to hyperpolari-
zations of cell membranes. Opioids affect a variety of functions including motility
(41, 51, 52, 61-65) and secretion (57), and both μ- and κ-receptors are involved
(40).
Opioid effects on motility can be both excitatory and inhibitory. The stomach
and the intestines are under tonic inhibitory influence from neuronal networks
controlling the coordinated contraction and propulsions. When opioids inhibit
these inhibitory neurons, control from the neuronal network is released and an
uncoordinated non-propulsive contraction occurs (57). This is seen, for example,
when opioids induce a phase III-like activity in the antroduodenal region and
disturb gastric motility (66). The negative effect is seen even with low doses of an
opioid (67).
There is clear evidence that there is both a peripheral and a central mechanism in
the inhibition of gastrointestinal motility (57, 66, 68). Higher centers involved in
the regulation of gastrointestinal motility also express MORs (46, 69, 70). Opioid
receptors are also present on afferent vagal nerve endings projecting to the NTS
(47, 71, 72).
Role of endogenous opioid peptides
Endogenous opioid peptides (enkephalins, β-endorphins and dynorphines) are
located within the GI tract. The function of these peptides is poorly understood,
but they might play a role in the normal control of motility. The distribution of
enkephalinergic neurons is closely matched to neurons expressing MOR (73).
There is evidence that endogenous opioids are released during stress and trauma
and inhibit the normal patterns of motility. After binding to ligands, the MOR
receptor complex is usually internalized into the cell through endocytosis (41).
Using immunhistochemical methods to demonstrate internalized opioid receptors,
the release of endogenous peptides can be studied. In an animal model,
abdominal surgery with and without manipulation of the intestines was
associated with endogenous peptide release, while anesthesia alone was not. (74)
21
Inhibition of endogenous peptides, i.e. through blockage of opioid receptors,
might therefore act prokinetically under conditions of disrupted motility (75).
Anesthetic drugs and gastric motility
Effects of volatile agents on gastrointestinal motility There are only a few published studies on volatile agents and gastrointestinal
motility and no studies regarding sevoflurane. Marshall et al showed (76) that
halothane depressed motility of the stomach, jejunum and colon in dogs and that
activity returned promptly after the agent was withdrawn. In rodents, halothane
and enflurane had profound but different effects on motility (77). Both agents
reduced the frequencies of the slow waves. Halothane reduced phase III activity in
duodenum, intestinal motor activity was slowed after anesthesia, and contractile
activity was affected. Enflurane increased the frequency of MMC during
anesthesia, the frequency slowed to a normal rate after anesthesia, and there were
no major effects on contractile activity. In humans, enflurane and halothane
depress antral motilty and reduce phase II activity (78). To summarize, volatile
anesthetics affect gastric motility, but the effect may cease quickly after
termination of the agents.
Effect of propofol on gastrointestinal motility Propofol in low doses does not influence gastric motility (79), but there is
evidence that propofol may inhibit motility in higher doses. In a laboratory
setting, propofol inhibited spontaneous contractions in human gastric tissue (80).
Prokinetic drugs
Prokinetic drugs can be used to improve and restore gastrointestinal motility.
Available major drug classes with prokinetic properties include antidopaminergic
agents, serotonergic agents and motilin-receptor agonists. However, the drugs
show signs of moderate prokinetic effects with adverse effects, and research on
novel substances is currently intense. (81, 82)
Metoclopramide is a dopamine receptor antagonist that has been used for
decades. As dopamine inhibits gastric motility (83, 84), blockade of the
dopamine-2 receptor (D2) promotes motility. It is also suggested that metoclo-
pramide has effects on serotonergic receptors. Metoclopramide is widely used in
clinical practice, but the prokinetic effects last for only a short time. Also, the side
effects are considerable, as all D2 receptor antagonists might induce extrapyrami-
dal symptoms. Domperidone has properties that are similar to those of
22
metoclopramide, although the most common side effect is hyperprolactemia. The
substance is available in many European countries, but currently not in Sweden.
Tegaserode is a novel serotonergic agent undergoing clinical evaluation. It is a
partial 5-HT4 receptor agonist and 5-HT2b receptor antagonist (85) and
accelerates orocecal transit in volunteers. It has not been associated with serious
side effects. Cisapride is a 5-HT4 receptor agonist with prokinetic actions in
major parts of the gastrointestinal tract, including the stomach. It stimulates
antral and duodenal contraction and improves gastric emptying. However, the
substance was associated with severe cardiac arrhythmias and was withdrawn
from the market in 2001.
The macrolide antibiotic erythromycin is a motilin receptor agonist and it
initiates MMC phase III, and stimulates motility and gastric emptying through
direct effects in the stomach. Compared to other prokinetic drugs, erythromycin
is considered effective. Novel motilin receptor agonists with higher potency and
without antibacterial activity are under development (86, 87).
μ-Opioid receptor antagonists The classical μ-opioidreceptor antagonist naloxone improves opioid induced
bowel dysfunction (88), but as the reversal also antagonizes the analgesic effect of
opioids, the use of naloxone is limited (89).
Research in recent decades has focused on the development of peripheral μ-
receptor antagonists that do not penetrate the blood-brain barrier. Hence,
analgesic effects of opioids are maintained while gastrointestinal effects are
antagonized. Alvimopan is a selective opioid antagonist with extremely limited
oral absorption, and when given orally it does not cross the blood-brain barrier
(39, 90, 91). Clinical phase III trials have showed that Alvimopan accelerates
gastrointestinal recovery after abdominal surgery without compromising opioid
based analgesia (92-96). Metylnaltrexone (MNTX), a derivate of naltrexone, is a
peripheral opioid receptor antagonist that does not cross the blood brain-barrier
and can be administered by both the oral and the intravenous route (97-99).
MNTX is still under investigation in late clinical trials focusing on opioid induced
obstipation (100). In patients treated with opioids, MNTX reduces orocecal
transit time, induces laxation and is well tolerated (100, 101).
23
Gastrointestinal motility during the perioperative period and intensive care
Preoperative fasting One of the most important preparations for patients before anesthesia and
surgery is an empty stomach. Protective reflexes are abundant during anesthesia,
and if regurgitation or vomiting occurs, contents from the stomach might be
aspirated into the lungs, causing fatal aspiration pneumonitis (102). Previously,
NPO (nil per os) after midnight was a rule, but research during the past 20 years
has changed this dogma (103). Current guidelines state a two-hour fast for fluids
and a six-hour fast for solids in healthy patients undergoing elective procedures
(104-107). However, a spectrum of conditions like trauma, pain, emergency
procedures, diabetes and opioid medication are associated with impaired gastric
motility. If the stomach is not considered empty, special procedures are used
routinely for rapidly protecting the airway during the induction of anesthesia
(108).
Early oral intake Today an early start of oral intake after anesthesia and surgery, sometimes within
hours, is common. However, while there is currently no evidence that early intake
diminishes the duration of postoperative ileus, the routine is not associated with
adverse effects, except an increased risk of nausea (109-112). As opioids given
perioperatively might have residual effects during recovery, this might delay the
start of oral intake. Optimizing opioid administration might therefore be
beneficial.
Postoperative ileus Postoperative ileus (POI) is a transient bowel dysmotility that occurs following
abdominal surgery (1, 113). It encompasses delayed gastric and colonic emptying
and failure in the propulsion of the intestinal contents due to atonic bowel (2),
and generally lasts for several days. Inhibitory neural reflexes, neurotransmitters,
inflammatory mediator release and endogenous and exogenous opioids contribute
to the pathogenesis (5). Activation of nociceptive afferent nerves and sympathetic
inhibitory efferent nerves through the spinal reflex is believed to play a major role
(18, 114). Blockade of these nerves with an intra- and postoperative epidural with
local anesthetic reduces gastrointestinal paralysis and enhances recovery by up to
36 hours compared to analgesia with systemic opioids (115). Recent studies have
shown that the prolonged phase of POI is caused by an enteric molecular
inflammatory response in the segments of the intestines manipulated during
surgery (1). Opioid receptors are also up-regulated with the inflammatory
response (49) and might contribute to the impairment.
24
Postoperative nausea and vomiting (PONV) PONV occurs commonly after anesthesia and is described as the “big little
problem”. Patients often recall PONV as their worst experience after undergoing
a surgical procedure. The etiology is multifactorial, and non-smokers, female
gender, history of PONV or motion sickness and the use of opioids are associated
with increased risks (116). The emetic center in the brainstem is in the proximity
of the NTS and DMV. Nausea and vomiting induce changes in gastric motility
through central mechanisms, but there is currently no evidence that motility
changes in the stomach per se induce PONV. However, factors that induce
motility changes also induce PONV. Therefore, it might be difficult to perform
studies in humans where the aim is to study if an intervention with isolated
gastric effects affects nausea and vomiting.
Intensive Care In critical illness, impaired gastric motility is common and is associated with
serious consequences. The underlying mechanisms are tissue ischemia, distur-
bances in fluid-electrolyte balance, abdominal surgery, infections and medications
(i.e. opioids, catecholamines, anticholinergica) (117). The clinical picture includes
enteral feeding intolerance, gastric retention, and paralytic ileus, and about 50%
of intensive care unit (ICU) patients have delayed gastric emptying. As early
enteral administration of nutrition is considered the best practice, with improved
outcome in morbidity and mortality, efforts have been made to promote gastric
motility in the critically ill (118). Erythromycin and metoclopramide are the most
commonly used prokinetics in the ICU (119). With advantage to erythromycin,
(120) both drugs improve gastric emptying (121, 122). Gastric emptying is even
more improved if the two drugs are combined (123). However, rapid tachyphy-
laxia occurs frequently and limits the use of these two drugs (118). The use of
enteral naloxone has been popular in many ICUs, but at this time there is only
weak evidence in the literature. Meissner found that naloxone reduced gastric
residual volumes and the frequency of pneumonia (124), and Mixides showed
that enteral feeding was better tolerated with naloxone (125). Novel prokinetics
are under evaluation for the ICU setting (126).
Genetic variability
In recent years research regarding individual variability in opioid-mediated
analgesia and in side-effects has suggested an association with genetic disposition.
Genetic variations might alter drug effects through changes in metabolizing
enzymes, transport proteins and expression of cellular receptors. Recently, several
25
studies have focused on single nucleotide polymorphism (SNP) in the gene coding
for the μ-opioid receptor (127-131).
Polymorphisms and mutations are variations of the normal ”wildtype” genetic
expression. If the variant is common in the population (>1%), it is termed
polymorphism, and if it is rare (<1%) it is termed mutation. A single nucleotide
polymorphism (SNP) occurs when a position in the DNA strand has two
alternative nucleotides. As all chromosomes exist in pairs, a subject is heterozy-
gote for a SNP if one of the genes carries the variant, and homocygote if both
genes are variants.
One of the most common SNPs in the MOR gene is a change in the nucleotide
base of A>G at position 118 (A118G). This results in an amino acid exchange
from aspargine > aspartate at position 40 (Asn40Asp) in the receptor (127, 131).
The expected frequencies in populations of heterozygous A118G and homozy-
gous subjects are 20 and 2 %, respectively, and there are substantial variations
between ethnic groups (132, 133).
The A118G alteration results in a loss of a putative glycosylation site of the
receptor (134). Investigators report up to 3 times higher affinity to beta-
endorphins for the variant (132), altered signal transduction pathways, and lower
thresholds for morphine in neurone models (135). In contrast, others have
reported no differences in ligand-binding or dose in the cellular response with the
variant (136). The differences might be explained by the use of different cell lines.
Subjects carrying the A118G variant have a diminished pupillary response to the
morphine metabolite morphine-6-glukoronide (M6G) (137). Observations in
patients with renal failure (causes accumulation of M6G) indicate that the variant
decreases side effects and the potency of M6G. There have been speculations
about an M6G toxicity protection by the A118G variant (137). Others report
that analgesic response to M6G is diminished in variants, while respiratory
response (depression) is unchanged (138).
In experimental settings, A118G carriers have a higher threshold for pain (139).
Clinical studies reveal decreased postoperative sensitivity to morphine after knee
arthroplasty (140), carriers of A118G required more morphine for alleviation of
pain caused by malignant disease (141), while there were no differences in opioid
consumption after abdominal hysterectomy (142). After abdominal surgery there
26
was a tendency toward higher morphine consumption with the variant (143).
Interestingly, there is speculation about an association with opioid induced
nausea and vomiting, as carriers of the variant had less symptoms after after
exposure to M6G (144). Compared to a control group, patients switching to
alternative opioids from morphine due to intolerance did not differ in the MOR
gene (145).
The SNP A118G has also been explored in the context of substance addictions.
Regarding alcohol intake, carriers of the variant had a higher sensitivity to
alcohol, became more stimulated and sedated than normal “wildtypes” (146),
and also had a stronger urge to drink more (147). Naltrexone, an opioid receptor
antagonist, blunted the alcohol effect more in subjects with the variant (148).
Some investigators report an association between alcohol dependence and the
variant (146, 149, 150). However, a recent meta analysis concluded that there
was no evidence for such an association (151).
Opioid systems are also believed to inhibit the hypothalamic-pituitary-adrenal
axis (HPA-axis). A blockade of this opioidergic effect releases cortisol. In
response to the MOR antagonist naloxone, the cortisol response was higher
among carriers of the variant (152).
27
Aims of the thesis
- To study effects of the opioid remifentanil on gastric emptying and
evaluate if extreme postures affect gastric emptying.
- To compare postoperative gastric emptying between a remifentanil-
propofol based total intravenous anesthesia and an opioid free se-
voflurane inhalational anesthesia.
- To study effects of remifentanil on proximal gastric tone using a
gastric barostat.
- To study effects of fentanyl on gastric myoelectric activity using a
cutaneous multichannel electrogastrograph (EGG).
- To test the hypothesis that single nucleotide polymorphisms (SNP)
in the μ-opioid receptor gene are associated with the variable effects
on gastric motility caused by opioids.
29
Materials
All studies were approved by the Ethics Committee of Örebro County Council
(prior to 2004) and the Uppsala Regional Ethical Review Board (after 2004).
Study II was also approved by the Swedish Medical Product Agency. All studies
were performed at Örebro University Hospital, Örebro, Sweden, during the
period 2000-2005.
Study I Ten healthy male volunteers (ASA-class I-II) with a mean age of 23.9 years
(range, 21-31) underwent four gastric emptying studies on four separate days.
Study II Fifty patients (ASA-class I-II) undergoing day-case laparoscopic cholecystectomy
were randomly allocated to receive either total intravenous anesthesia with
propofol-remifentanil (TIVA, n=25) or opioid-free inhalational anesthesia with
sevoflurane (GAS, n=25). Five patients (TIVA, n=4, GAS, n=1) were excluded for
perioperative surgical reasons. Postoperative data were analyzed for 21 subjects
in the TIVA group (mean age 45 years, (range 29-64)), females, n= 20) and 24
patients in the GAS group (mean age 46 years, (range 19-69)), females, n= 20).
The gastric emptying study was successful in 18 patients in the TIVA group and
20 patients in the GAS group.
Study III Ten healthy male volunteers (ASA-class I-II) with a mean age 24 years (range, 19-
31) underwent two gastric tone studies on two separate days. Later, analyses of
SNP in the MOR gene were performed. Two subjects did not complete the first
barostat study (glucagon) and 1 subject did not complete the second barostat
study (remifentanil). Genetic analyses were performed in all subjects (n=9) with
successful gastric tone measurements.
Study IV Gastric myoelectric activity was studied with an electrogastrograph in 20 patients
scheduled for elective surgery (ASA-class I-II, mean age 45 years (range, 28-67),
females, n=16) and the effect of a bolus dose of fentanyl 1μg/kg was evaluated.
Later, genetic analyses of SNP in the MOR gene were performed in 18 of the
patients.
31
Methods
Gastric emptying (I-II)
Gastric emptying was studied with the paracetamol method. (Acetaminophen is
the name for paracetamol in North America and in the literature the method is
also called the acetaminophen method). Paracetamol is not absorbed from the
stomach, but is rapidly absorbed from the small intestine. Consequently, the rate
of gastric emptying determines the rate of absorption of paracetamol adminis-
tered into the stomach (32).
Paracetamol 1.5 g dissolved in 200 mL of water (at room temperature) was given
orally (Study I) or through a nasogastric tube (Study II). Blood samples were
taken from an intravenous catheter prior to the administration of paracetamol, at
5, 10, and 15 minutes after administration, and then at 15-minute intervals
during a total period of 120 min. Serum paracetamol was determined by an
immunologic method including fluorescence polarization (TDx acetaminophen®;
Abbott Laboratories, Chicago, IL, USA). Paracetamol concentration curves were
produced and the maximal paracetamol concentration (Cmax), the time taken to
reach the maximal concentration (Tmax), and the area under the serum paraceta-
mol concentration time curves from 0 to 60 minutes (AUC60) and from 0 to 120
minutes (AUC120) were calculated. Tmax was assumed to be 120 minutes if no
paracetamol was detected in any sample. The paracetamol method is a well-
accepted method for studying the liquid phase of gastric emptying, and AUC60
correlates well with measures of gastric emptying performed using isotope
techniques (32, 153)
Gastric tone (III)
Gastric tone was measured by an electronic barostat (SVS®; Synetics AB,
Stockholm, Sweden). The gastric barostat is an instrument with an electronic
control system that maintains a constant preset pressure within an air-filled
flaccid intragastric bag by momentary changing of the volume of air in the bag
(37, 154). When the stomach contracts, the barostat aspirates air to maintain the
constant pressure within the bag, and when the stomach relaxes, air is injected.
The pressure in the bag was set at 2 mmHg above the basal intragastric pressure.
The pressure change at which respiration is perceived on the pressure tracing,
without an increase or decrease in the average volume, is the basal intragastric
pressure.
32
The bag, made of ultrathin polyethylene, has a capacity of 900 ml and is
connected to the barostat by a double-lumen 16 Ch gastric tube. The barostat
measurements followed the recommendations presented in a review article by an
international working team and the barostat instrument fulfilled the criteria
determined by this group (37).
Before the gastric intubation, propofol 0.3 mg/kg was given for sedation. Previous
studies in volunteers have shown that this dose of propofol does not influence
gastric tone (155), and it was given at least 30 min before the study started. The
intragastric bag was folded carefully around the gastric tube and positioned in the
gastric fundus via oral intubation. Thereafter, the gastric bag was unfolded by
being slowly inflated with 300 ml of air under controlled pressure (<20mmHg),
and the correct position of the bag was verified by traction of the gastric tube.
During the measurements, the mean gastric volume during each five-minute
interval was calculated.
Electrogastrography (IV)
Electrogastrography (EGG) is the cutaneous recording of gastric myoelectrical
activity, and the activity is closely associated with gastric motility (156). Gastric
smooth muscles display a rhythmic electrical activity, slow waves, with a
frequency of approximately 3 cycles per minute. These slow waves originate from
a gastric pacemaker region in the corpus and propagate towards the pylorus.
With influence of the enteric nervous system and other regulatory mechanisms,
the slow waves trigger the onset of spike potentials, which in turn initiate
coordinated contractions of the gastric smooth muscles (12). Gastric motility and
emptying depend on these slow waves.
Figure 1. Electrode placements in electrogastrographic study: Electrode 3 was placed halfway between the xyphoid process and the umbilicus. Electrode 4 was placed 4 cm to the right of electrode 3. Electrodes 2 and 1 were placed 45 degrees to the upper left of electrode 3, with an interval of 4 to 6 cm. The ground electrode was placed on the left costal margin horizontal to electrode 4. The reference electrode (electrode 0) was placed at the cross point of the horizontal line containing electrode 1 and the vertical line containing electrode 3. (Walldén et al, Acta Anest Scand 2008. In Press.)
33
Six EGG electrodes were placed on the abdomen after skin preparation. The
electrodes consisted of four active electrodes, one reference electrode and one
ground electrode, as illustrated in Figure 1. A motion sensor was also attached to
the abdomen. We used the Medtronic Polygram NET EGG system (Medtronic
A/S, Denmark) for the simultaneous recording of four EGG signals. Our EGG
system was configured to accept an electrode impedance of less than 11 kΩ after
skin preparation. The EGG signal was sampled at ~105 Hz, and this was
downsampled to 1 Hz as part of the acquisition process (157).
All EGG tracings were first examined manually by two of the investigators (JW,
GL). Prior to the analysis, motion artifacts in the EGG signal, indicated by the
motion sensor, were identified and removed manually. For each patient, the EGG
channel with the most typical slow-wave pattern during baseline recording
(before fentanyl) was selected for further analysis.
An overall spectrum analysis was performed on each of the two main 30-minute
segments (before and after fentanyl, respectively) of the selected channel using the
entire time-domain EGG signal (157). Sequential sets of measurement data for
256s with an overlap of 196s were analyzed using fast Fourier transforms and a
Hamming window for the calculation of running power spectra. When the entire
signal was processed, the power spectra for each segment were combined to
arrive at the overall dominant frequency (DF) and power of the dominant
frequency (DP).
The EGG segments and the spectral analysis after fentanyl were further classified
either as 1) Unaffected EGG (no change in DF after fentanyl), 2) Bradygastric
EGG (decrease in DF >=0.3 after fentanyl) or 3) Flatline-EGG (total visual
disappearance of a previously clear sinusoidal 3 cpm EGG-curve after fentanyl)
(see example in figure 3) without any quantifiable DF. When DF was not
quantifiable, DF was set to 0.
Data from the baseline EGG were compared to data from a previous multicenter
study in normal subjects (157) to test if the group in study IV was similar to a
normal population.
Genetic Analysis (III-IV)
Due to the large interindividual variations in the gastric tone response after
remifentanil, we investigated if this variation could be explained by genetic
34
variability, polymorphisms, in the μ-opioid receptor gene. After reviewing the
literature, we decided to analyze polymorphisms with relative high frequencies
and with reports of altered responses. Therefore, we focused on the μ-opioid
receptor gene polymorphisms A118G and G691C (128).
DNA collection and purification. Venous blood (10 ml) was collected from the subjects in EDTA tubes and the
samples were stored frozen at –70°C. Genomic DNA was purified from
peripheral leukocytes in 1 ml of EDTA blood on a MagNA Pure LC DNA
extractor, using the MagNA Pure LC Total Nucleic Acid Isolation Kit – Large
Volume (Roche Diagnostics Corporation, Indianapolis, IN, USA).
Genotyping. Genotyping was performed at CyberGene AB, Huddinge, Sweden. The A118G
SNP in Exon 1 and the IVS2 G691C SNP in Intron 2 were genotyped using
polymerase chain reaction amplification and sequencing. Oligonucleotide primers
(forward: 5'-GCGCTTGGAACCCGAAAAGTC; reverse: 5'-CATTGAG
CCTTGGGAGTT) and (forward: 5'-CTAGCTCATGTTGAGAGGTTC; reverse:
5'-CCAGTACCAGGTTGGATGAG) were used for amplifying gene fragments
containing Exon 1 and Intron 2, respectively. PCR conditions comprised an initial
denaturing step at 95°C for 1 min followed by 30 cycles at 94°C for 1 min,
annealing at 47.2-53.4°C (depending on primer) for 1 min and extension at 68°C
for 3 min, and a final extension at 68°C for 3 min. The amplified fragments were
sequenced using the same primers with the addition of Rev 1-2 5'-
TTAAGCCGCTGAACCCTCCG and the BigDye Terminator v1.1Cycle Sequence
Kit (Applied Biosystems, Foster City, CA, USA). PCR amplification and sequence
reactions were done on ABI GeneAmp 2400 and 9700 (Applied Biosystems).
Sequence analysis was first done on MegaBACE 1000 (Amersham Biosciences,
CA, USA) and then confirmed with ABI 377XL (Applied Biosystems).
Procedure
Study I In a randomized order, gastric emptying was studied on four occasions in each
subject, with at least 1 day between occasions. The subjects were given a
continuous infusion of remifentanil on two occasions while lying either on the
right lateral side with the bed in a 20º head-up position (RHU) or on the left
lateral side with the bed in a 20º head-down position (LHD). On the other two
occasions, no remifentanil infusion was given, and the subjects were studied lying
in the two positions.
35
All subjects fasted for at least 6 h before each study. For the two occasions with
remifentanil, remifentanil was given as a continuous intravenous infusion in a
dose of 0.2 μg· kg-1·min-1 and was started 10 minutes before the ingestion of
paracetamol. The infusion was terminated directly after the last blood sample
(120 min) was drawn.
Study II All patients fasted according to clinical guidelines (107) and were premedicated
with midazolam 1-2 mg I.V. Before induction, all patients received ketorolac 30
mg I.V. In the TIVA group, anesthesia was induced with an infusion of
remifentanil 0.2 μg·kg-1·min –1, followed after 2 minutes by a target-controlled
infusion (TCI) of propofol at 4 μg·mL –1 (induction time 60 seconds). In the GAS
group anesthesia was induced with 8 % sevoflurane via a facial mask. After
attaining an adequate level of anesthesia, muscular relaxation was obtained in
both groups with rocuronium 0.6 mg·kg-1 IV and the trachea was intubated after
90 seconds. In the TIVA group anesthesia was maintained with remifentanil 0.2
μg·kg-1·min –1 and TCI propofol adjusted (2-4 μg·mL –1 ) to maintain a BIS-index
below 50. In the GAS group anesthesia was maintained with sevoflurane,
adjusted to maintain a BIS-below 50. No prophylactic antiemetics were given. A
nasogastric tube was placed in all patients during anesthesia. At the end of
surgery, 20 mL of 0.25% levobupivacaine was infiltrated at the insertion sites of
the laparoscopic instruments, muscular relaxation was reversed with neostigmine
2.5 mg/glycopyrrolate 0.5 mg, and anesthetic agent(s) were terminated. The
patients were extubated in the operating room after return of consciousness and
spontaneous breathing and transferred to the adjacent day-care unit for recovery.
Except for the continuous infusion of remifentanil in the TIVA group, no opioids
were given during anesthesia. The gastric emptying study measurement was
initiated immediately after arrival in the day-care unit.
Patients stayed in the day-care unit for at least 4 hours and PONV and pain
parameters were evaluated every hour. After discharge, patients received a
questionnaire regarding the postoperative 4-24 hour-period, and they rated their
maximal pain and maximal nausea and were questioned about vomiting. In
addition, a telephone interview was performed on the first postoperative day.
Combining the results, we received postoperative data on PONV, maximal VAS-
score for pain, and time to first postoperative opioid analgesic for the time
periods 0-2 hours and 2-24 hours postoperatively.
36
Study III All subjects fasted for at least 6 h before each study. Each subject underwent two
study protocols on two separate days. Before the gastric intubation the subjects
received a bolus dose of propofol (0.3 mg/kg IV). In the first study, the effect of
glucagon on gastric tone was measured. In the second study, gastric tone was
measured during and after a remifentanil infusion and, after a washout-time of 30
minutes, during readministration of remifentanil in combination with glucagon.
The study protocol is illustrated in Figure 2.
During study situations, vital parameters, blood-glucose, nausea and any other
symptoms were recorded.
Later, subjects (n=9) were asked to participate in the genetic analysis of the MOR
gene and we obtained blood samples.
Figure 2 Schematic illustration of the study protocol in study III.
0 min 15 min
Glucagon 1 mg
Propofol0.3 mg ·kg-1
-10 min-40- -80 min
Measurement of Gastric Tone
0 min 75 min15 min 45 min30 min 85 min 95 min
Start Remifentanil Stop Remifentanil Glucagon 1 mg Stop Remifentanil
Start RemifentanilPropofol0.3 mg ·kg-1
-10 min-40- -80 min
Measurement of Gastric Tone
Glucagon Study
Remifentanil Study
0.1�g·kg-1·min-1 0.2 �g·kg-1·min-1 0.3 �g·kg-1·min-10.3 �g·kg-1·min-1Remifentanil
Glucagon
Glucagon
37
Study IV The study was performed in a pre-anesthesia area before the induction of
anesthesia. Patients fasted for at least 6 hours from solid foods and 2 hours from
clear fluids. No premedication was given. While the patient was lying in a
comfortable bed rest position, an intravenous line was inserted and the EGG
recordings were initiated. After achieving a stable EGG signal, a 30-minute
baseline EGG recording was collected. Without discontinuation of the EGG
recording, 1 μgram•kg-1 of fentanyl was given as an intravenous bolus through
the intravenous line and the EGG recording continued for another 30 minutes.
Charts and notes from the recovery unit were reviewed and we collected data
regarding analgesic and antiemetic requirements.
Later, patients were asked to participate in the genetic analysis of the MOR gene
and we obtained blood samples.
Statistics
The significance level was set at 5% in all tests. Data are presented as means (SD)
or medians (ranges).
In study I, repeated-measures analysis of variance was used for overall differences
between the study situations. If the analysis of variance showed differences, a
paired Student’s t-test with Bonferroni Correction was performed between the
study situations.
In study II, the unpaired Student’s t-test was used for comparisons between the
groups of primary outcome variables. For the secondary outcome variables, the
unpaired Student’s t-test, the Mann Whitney U test or Fisher’s exact test were
used.
In study III, repeated-measures analysis of variance was used for overall changes
in gastric tone over time. For comparisons between time periods, Fisher’s PLSD
was used.
In study IV, Wilcoxon’s signed rank test and the 95% confidence interval for the
difference between the medians were used for analysis of the primary EGG
outcome variables. The unpaired t-test was used for the comparison of baseline
EGG data with the historical controls. Fisher’s exact test was used to test
associations between PONV parameters and EGG outcome.
39
Results
Gastric emptying during an infusion of remifentanil and the
influence of posture (I).
Infusion of remifentanil delayed gastric emptying. During the control situations
there were differences in gastric emptying variables between the two extreme
positions, but there were no differences during the infusion of remifentanil (Table
1 and Figure 3). In three subjects, the dose of remifentanil had to be reduced due
to side effects.
Immediate postoperative gastric emptying after total intravenous remifen-
tanil-propofol based anesthesia (II).
There were no differences in postoperative gastric emptying between the TIVA
group and the GAS group. Both groups differed significantly from a pooled
historical control group. However, there was great variability within both study
groups (Table 1 and Figure 4).
Table 1. Gastric emptying variables in study I and study II. AUC60 Cmax Tmax
min μmol mL-1 μmol mL-1 min
Study I (n=10)
Control RHU 5092 (1125) 138 (45) 25 (14)
Control LHD 3793 (1307) 94 (30) 47 (22)
Remifentanil RHU 962 (902) 34 (24) 94 (33)
Remifentanil LHD 197 (128) 16 (14) 109 (10)
Study II
TIVA (n=18) 2458 (2775) 71 (61) 53 (55)
GAS (n=20) 2059 (2633) 81 (37) 83 (41)
Historical controls (n=36) 5988 (1713) 155 (46) 29 (15)
AUC 60 Cmax Tmax Paired T-test with Bonferroni Correction RHU-Remi vs RHU-Control p<0.0001 p< 0.0001 p<0.0001 RHU-Remi vs LHD-Remi NS NS NS RHU-Remi vs LHD-Control p<0.0001 p < 0.0001 p<0.0001 RHU-Control vs LHD-Remi p<0.0001 p < 0.0001 p<0.0001 RHU-Control vs LHD-Control p<0.0083 p <0.0083 NS LHD-Remi vs LHD-Control p < 0.0001 p<0.0001 p<0.0001 Unpaired t-test TIVA vs GAS NS NS NS TIVA vs Historical Controls p<0.001 p<0.001 p<0.001 GAS vs Historical Controls p<0.001 p<0.001 p<0.001
40
Figure 3 Gastric emptying in study I. Mean (SD) concentrations of paracetamol over time.
0
20
40
60
80
100
120
140
160
180
200
0 30 60 90 120
Time (minutes)
Mea
n S-
Para
ceta
mol
con
cent
ratio
n (�
mol
/L) (
SD)
Control- Right lateral side head upControl- Left lateral side head downRemifentanil 0.2�g/kg/min- Right lateral head upRemifentanil 0.2�g/kg/min- Left lateral head down
Figure 4 Gastric emptying in study II. Mean (SD) concentrations of paracetamol over time.
0
50
100
150
200
0 30 60 90 120Minutes
Mea
n (S
D) S
-Par
acet
amol
con
cent
ratio
n (�
mol
/L)
Group TIVA (n=18)
Group GAS (n=20)
Historical Controls (n=36)
41
Gastric tone after injection of glucagon (III)
Glucagon decreased gastric tone in all subjects during the glucagon study. During
the remifentanil study and the ongoing remifentanil infusion, only one subject
had a decrease in gastric tone after the injection of glucagon, while the others
were almost unaffected. (Figure 5).
Gastric tone during an infusion of remifentanil (III)
There were distinct responses in gastric tone during the remifentanil infusion.
However, the responses were variable. Four subjects responded to remifentanil
with a marked increase in gastric tone (decreased volume in bag) that returned to
baseline levels during washout. Four subjects responded to remifentanil with a
marked decrease in gastric tone (increased volume) and maintained a low gastric
tone during the washout period. In one subject (no. 5) gastric tone was almost
unaffected. The mean gastric tone was significantly lower during the washout
period than before starting the infusion. During the readministration of
remifentanil, there were increases in gastric tone among subjects who increased in
tone during the previous remifentanil infusion. The subject with unaffected
gastric tone during the previous infusion increased in gastric tone. The subjects
who maintained a low gastric tone during washout continued to maintain a low
gastric tone. (Figure 5)
Figure 5. Individual gastric volumes in the barostat study (III).
0
200
400
600
800
1000
Bas
elin
e 0
- 5 m
in
5 -
10 m
in
Glu
cago
n
0 -
5 m
in
5 - 1
0 m
in
10 -
15 m
in
Bas
elin
e 0
- 5 m
in
5 - 1
0 m
in
Rem
i 0.1
0
- 5
min
5 - 1
0 m
in
10 -
15 m
in
Rem
i 0.2
0
- 5
min
5 - 1
0 m
in
10 -
15 m
in
Rem
i 0.3
0
- 5
min
5 - 1
0 m
in
10 -
15 m
in
Was
hout
0
- 5
min
5 - 1
0 m
in
10 -
15 m
in
15 -
20 m
in
20 -
25 m
in
25 -
30 m
in
Rem
i 0.3
0
- 5
min
5 - 1
0 m
in
Glu
cago
n
0 -
5 m
in
5 - 1
0 m
in
Was
hout
0
- 5
min
5 - 1
0 m
in
Time
Intr
agas
tric
Bag
Vol
ume
(ml)
Subj 1
Subj 2
Subj 3
Subj 4
Subj 5
Subj 6
Subj 7
Subj 8
Subj 10
Glucagon Studyn=8
Remifentanil Studyn=9
42
Electrogastrography (IV)
Compared to historical controls (157), there were no differences in the baseline
EGG variables.
After the administration of intravenous fentanyl, there was a significant reduction
in both the dominant frequency (DF) and the dominant power (DP) of the EGG
spectra (Figure 7).
Among patients with a flatline-EGG (n=6), the median (range) time from the
administration of intravenous fentanyl to the observed disappearance of the slow
waves was 5 (1-9) minutes. In 5 of these patients, there was reappearance of the 3
cpm slow-wave EGG pattern 30 (29-35) minutes after the administration of
fentanyl.
There was large variation between patients in the response to intravenous
fentanyl. EGG recordings were unaffected in 8 patients, 5 patients developed a
slower DF (bradygastria) and in 6 patients the slow-wave tracings disappeared
totally (flatline-EGG). For an illustration of the effect, see Figure 6.
Figure 6. An individual electrogastrographic response to Fentanyl.
-80
-60
-40
-20
0
20
40
60
80
0:00:00 0:10:00 0:20:00 0:30:00 0:40:00 0:50:00 1:00:00
Time (min)
�V
Fentanyl 1�g/kg I.V.
-80
-60
-40
-20
0
20
40
60
80
00:0400:5300:0300:52Time (min)
�V
Fentanyl 1�g/kg I.V.
Slow-waves 3cpm Disappearance of Slow-waves
-80
-60
-40
-20
0
20
40
60
80
00:0400:5300:0300:52Time (min)
�V
Fentanyl 1�g/kg I.V.
Slow-wavevv s 3cpm Disappearance of Slow-wavevv s
43
Figure 7. Changes in the dominant frequency (DF) and the dominant power (DP) of the electrogastro-graphic spectra after Fentanyl. (Walldén et al. Acta Anest Scand, 2008. In Press)
25
30
35
40
45
50
55
Baseline After Fentanyl 1�g/kg
Dom
inan
t Pow
er (d
B)
*
0
0,5
1
1,5
2
2,5
3
3,5
Baseline After Fentanyl 1�g/kg
Dom
inan
t Fre
quen
cy (c
pm)
*
A B
Genetic study (III-IV)
We found no association between the variable outcome in studies III and IV and
the presence of SNP A118G or G691C in the MOR (Table 2).
Table 2. Results from the determinations of SNPs in the MOR gene with correlations to outcome groups in studies III and IV. 118 A>G genotype IVS2 + 691 G>C genotype Wild Type Hetero- Variant Wild Type Hetero- Variant
zygous zygous (AA) (AG) (GG) (GG) (GC) (CC)
Study III n=7 n=2 n=0 n=5 n=2 n=1
Increased tone (n=4) 4 3 1 Unchanged tone (n=1) 1 1 Decreased tone (n=4) 3 1 1 2 1 Study IV n=15 n=2 n=1 n=0 n=14 n=4
Unaffected EGG (n=6) 5 1 6 Bradygastria (n=5) 4 1 2 3 Flatline (n=6) 5 1 5 1 Excluded from the 1 1 EGG-analysis (n=1)
No associations found between presence of polymorphism and gastric outcome (Chi-Square tests).
PONV (I-IV), other side effects (I-IV) and postoperative pain (II).
In study I, six subjects experienced nausea, three subjects vomited and six subjects
had pruritus during infusion of remifentanil. Seven subjects experienced
44
dysphagia during remifentanil and five subjects complained of headache during
and/or after the infusion of remifentanil.
In study II, the postoperative incidence of nausea and vomiting was high. During
the 0-24 h postoperative period, 16 patients (76%) in the TIVA group and 20
(83%) patients in the GAS group experienced PONV symptoms. However, there
were no significant differences between the groups. There were shorter times to
rescue analgesics in the TIVA group (median 17 minutes) compared to the GAS
group (median 44 minutes).
In study III, 62% (n=5) of the subjects experienced nausea during the glucagon
experiment. During remifentanil, 33% (n=3) experienced nausea and 66% (n=6)
had nausea with the combination of remifentanil and glucagon. Further, during
remifentanil, 77% (n=7) had pruritus, 33% (n=3) had headache and 22% (n=2)
reported dysphagia.
In study IV, the incidence of PONV in the recovery unit was 53% (n=10) and
there was a need for rescue antiemetics in 47% (n=9) of the patients. We found
an association between flatline/bradygastric EGG and the requirement for rescue
analgesics (P=0.02).
45
Discussion
In this thesis I have studied the physiologic effects of opioid drugs on gastric
motility using both standard and novel methods. With the genetic analyses of the
μ-opioid receptor gene, I have introduced new aspects in the field of opioid
induced gastrointestinal motility disturbances.
As expected, opioids had a pronounced effect on gastric motility. Gastric
emptying was delayed, gastric tone altered and there were changes in the EGG
recordings. However, there was great interindividual variability and the
variability could not be explained by genetic variations in the μ-opioid receptor.
Further, we found no difference in postoperative gastric emptying between an
opioid based and opioid free anesthesia, and we suggest that other factors than
opioids contribute to affecting gastric motility.
The Paracetamol method
In studies I-II we used the paracetamol method to study the liquid phase of gastric
emptying. Paracetamol is absorbed in the proximal part of the small intestine,
and as gastric emptying is considered the rate limiting step in the absorption
profile, variables calculated from the paracetamol plasma concentration curve can
be used to describe the emptying rate from the stomach (33). Nimmo et al
showed in 1975 that the area under the concentration curve during the first 60
minutes (AUC60) correlated well with “gold standard” scintigraphic methods
(32). A recent systematic review concluded that the paracetamol method is well
correlated to scintigraphic assessments of gastric emptying (153), and in our
studies we used the validated variables AUC60, AUC120, Tmax and Cmax to
describe gastric emptying. However, it has been suggested that other variables
might be even more accurate, i.e. the ratio between concentrations at two time
points, C(2t)/C(t) or the ratio between two AUC at two time points. Then only
absorption and elimination constants influence the results, and differences
between individuals in volume of distribution, dose and first-passage metabolism
are eliminated (153, 158). It might be valuable to add these variables in future
studies. Also, the use of a salivary instead of a venous sample for the measure-
ment of paracetamol has been proposed, but the method still needs validation
(159). There are also suggestions that studies with the paracetamol method
should be done with crossover designs to reduce the influence of variability
between individuals in pharmacokinetic parameters (158). This might be taken
46
into account in experimental studies, but it would be difficult in clinical
postoperative studies as the surgical procedure cannot be repeated.
The paracetamol method is a simple and cheap bedside method for the evaluation
of gastric emptying, but it is important to remember that it is an indirect
quantification of gastric emptying with limitations regarding interpretation.
Gastric barostat
In study III we used the gastric barostat for the measurement of proximal gastric
tone. It could be difficult to understand the concept of gastric tone, and it is
therefore important to distinguish it from gastric pressure. The smooth muscles in
the proximal stomach have the ability to generate a constant contraction (also
called a tonic contraction) and with that contraction the gastric wall applies a
certain pressure to the intraluminal contents. As the stomach adapts for volume
loads, the smooth muscles are elongated through diminished contraction and the
intraluminal pressure is maintained. This regulation with sustained muscular
activity is referred to as gastric tone (8), and to simplify, changes in gastric tone
are changes in the length of the smooth muscles.
The gastric barostat is the standard method for the evaluation of gastric tone, and
there are currently no other good methods available. The technique is invasive
and involves the introduction of a bag into the stomach (160), and this might
interfere with the response. However, the bag resembles a load of food and we
can consider it as partly physiological. The gastric barostat method is most
commonly used in research regarding the accommodation response, i.e. in the
field of dyspepsia, and usually subjective discomfort and compliance are
evaluated while the bag in the proximal stomach is distended (37, 160). It is
important to point out that we did not perform any distension tests and that we
did not study the accommodation response. We maintained a fixed, relatively low
pressure in the bag and studied effects of an opioid on gastric tone at a specific
pressure level. It might be interesting to perform distension tests with opioids, but
we consider this difficult with remifentanil and other potent opioids as their
analgesic effects blunt the perceptions and might harm the stomach if pressure is
elevated too high.
We found great variability in gastric tone during the remifentanil infusion. We do
not believe this was due to a methodological problem with the gastric barostat.
During the glucagon part of the study all subjects responded with a clear decrease
47
in tone (increased volume). This validates that the gastric barostat was working
properly, since an expected relaxant stimulus, glucagon, decreased the tone in all
subjects. Also, the same barostat equipment and setup were used in previous
studies by our group (84, 155) and we did not observe this kind of variation.
Electrogastrography (EGG)
In study IV we used cutaneous electrogastrography to study gastric myoelectric
activity. This activity is characterized as a constant ongoing fluctuation of the
membrane potential in the syncytium of the gastric smooth muscle cells.
Specialized smooth muscle cells without contractile properties, interstitial cells of
Cajal (ICC), are responsible for the distribution and propagation of the electric
activity. The pace of the fluctuations is normally determined by ICCs in the
corpus region, and the electric potential is propagated distally. These electrical
fluctuations are called gastric slow waves and they usually have a frequency of
about 3 cycles per minute. (156, 157, 161-163) The fluctuations per se do not
initiate muscular contraction, as the electrical potential is below the contraction
threshold. Excitatory stimuli from the controlling enteric network must be
present to initiate spike potentials and contractions (12). With the slow waves,
the pulse and propagation of the propulsive contractions are controlled.
Cutaneous EGG is the summation of electrical potentials from the gastric muscle
in a specific axis. This must be distinguished from electromyographic tracings
with electrodes inserted into the gastric wall; in that case the electrical potential at
a fixed point is measured. After our intervention, we found a lower frequency in
the slow waves and also a disappearance of the waves. The physiological
explanation for the bradygastria might either be a reduction in the frequency of
the pacesetter cells in the corpus or that normal pacesetter ICCs are “knocked-
out” and the slow waves are controlled by more distal ICCs with slower intrinsic
frequency (156). Further, the disappearance of the slow waves might reflect a
disappearance of the oscillations in membrane potential or a total disorganization
of the spontaneous activity. The latter might be more likely, as antral tachygas-
tria, leading to a functional uncoupling of the slow waves, has been observed
after opioid administration (66), and gastric arrhythmias are generally caused by
disruptions of the slow waves(164). Our study is one of the first to use the EGG
in the perioperative setting. We suggest that the method should be used more
frequently, as it measures changes in gastric myoelectric activity, and this might
help us to understand the pathology behind the opioid induced impairments of
gastric myoelectric activity.
48
Genetic testing
Genetic evaluation of the μ-opioid receptor gene was done in studies III and IV.
The findings included major interindividual variability in motility variables in
subjects receiving opioids. Recent reports have suggested that SNPs in the MOR
gene can alter the effects of opioids (129, 165), and to our knowledge there is no
previous work where the issue is explored in the context of gastrointestinal
motility. Therefore, we collected blood samples from subjects who participated in
the studies. Genetic analysis was done by a contracted laboratory using routine
molecular biological techniques. Hence, we are the first to evaluate a possible
association between opioid effects on gastrointestinal motility and genetic
variations in the MOR.
Gastric emptying during a remifentanil infusion and influence of posture (I)
In Study I we evaluated the effect of posture on gastric emptying and the
objectives were in part to evaluate pyloric function. If gastric contents are
passively directed towards the pylorus, gastric emptying would be facilitated in
states of normal motility or when the pyloric sphincter is abnormally relaxed. We
used two extreme body positions in our study protocol – the RHU-position where
contents theoretically are directed towards the pylorus, and the LHD-position
where contents are directed from the pylorus. During the control situations,
gastric emptying was better in the RHU-position. This is in agreement with other
studies where body positions that direct stomach contents towards the pylorus
facilitate gastric emptying (25-27, 166). During the remifentanil infusion, gastric
emptying was delayed in both positions compared to the control situations. This
confirms that remifentanil has the same ability as other MOR agonists to affect
gastric motility and delay gastric emptying (32, 67, 68, 88, 167). However, we
found no significant differences between the positions. This indicates that
remifentanil increases pyloric tone and thereby impairs the flow out to the
duodenum.
Gastric emptying after opioid based vs opioid free anesthesia (II)
In study II we compared gastric emptying in two anesthetic protocols, one with
the opioid remifentanil and the other without opioids. We hypothesized that if
perioperative opioids play a major role in the postoperative inhibition of gastric
motility, there would be differences between the groups. ´The results showed that
gastric emptying was delayed in both groups compared to pooled data from
historical controls. However, we could not find any significant differences
between the groups. This indicates that the use of remifentanil during anesthesia
49
impairs postoperative gastric emptying in the same way as a solely inhalational
anesthesia.
Interestingly, if the figures are compared to the gastric emptying rates during the
remifentanil infusion in Study I, gastric emptying was better in Study II. A
reasonable assumption is that gastric motility during anesthesia with remifentanil
would be affected at least in the same way as during the remifentanil experiments.
As the measure of gastric emptying in study II was done after the cessation of
anesthesia, the results indicate that the inhibitory effect of remifentanil on gastric
emptying was reduced quickly. At the time when we measured gastric emptying
in Study II, the opioid effect might no longer have been present and other factors
might have contributed to the delay. The surgical trauma per se delays gastric
motility (1, 2, 4, 168), and if this factor plays the major role, then there would be
no differences between the groups.
There is limited knowledge about the effect on gastric motility of the other
anesthetics used in our protocols. Propofol in higher doses might inhibit motility
(80), and volatile agents inhibit motility with an effect that ceases quickly after
termination of the agents (76-78). Remifentanil and volatile agents might
therefore be considered similar regarding the time course of the gastric inhibition,
and that might also explain the finding of no difference. Future studies must
compare remifentanil with other potent opioids and evaluate if postoperative
gastric emptying is enhanced with remifentanil. As an early oral intake is
preferred today, the choice of a perioperative opioid with minimal impact on
postoperative gastric motility could be of importance.
Furthermore, there was great variability in the gastric emptying rates within the
groups, and both groups had patients with normal gastric emptying and patients
with no gastric emptying at all. As patients received IV opioids for severe pain
during recovery, we tested whether there was any association between opioid
analgesia during recovery and gastric emptying rates, but we found no associa-
tion. The variability must be related to other factors.
Effects of remifentanil on gastric tone (III)
In study III we evaluated changes in gastric tone during an IV infusion of
remifentanil. We found that remifentanil had a marked effect on gastric tone, but
there were two distinctly different patterns of reactions, with about half of the
subjects increasing in gastric tone (decreased volume) and about half of the
50
subjects decreasing in gastric tone (increased volume). Due to this variability, we
were not able to statistically prove the response during remifentanil. However,
the gastric tone was statistically lower (higher volume) after the infusion of
remifentanil compared to the baseline period. We believe these are important
findings, as they show that opioid effects on human gastric motility are variable
and complex.
Proximal gastric tone is an important part of gastric motility and it is mainly
controlled by the autonomous nerve system. Vagal cholinergic nerves mediate
excitation (contraction) while vagal non-cholinergic non-adrenergic (NANC)
nerves mediate inhibition (relaxation) (169). Recent studies have identified
nitrous oxide as one of the main transmitters in the NANC pathway. In humans,
the NANC pathway is believed to be silent during fasting conditions and
activated on volume load by the adaptive reflex (170). In addition, there are
sympathetic adrenerigic spinal nerves that inhibit motility mainly through
cholinergic inhibition (17).
Several animal studies have tried to identify targets for the opioid induced
inhibition of gastric motility. It is widely believed that μ-opioid receptor (MOR)
agonists inhibit the release of Ach in the stomach (61), and there is also evidence
that MOR agonists reduce the relaxation induced by the NANC pathway (171).
Opioids might also have direct excitatory effects on gastric smooth muscles (51).
Opioids also act in the central nervous system (CNS). There is evidence that
MORs are present on and inhibit excitatory neurons projecting to gastrointestinal
motor neurons in the dorsal motor complex (DMV) of the medulla (69). In this
way activation of central MORs inhibits the excitatory vagal output, leading to
inhibition of intestinal transit and induction of gastric relaxation in animal
models. In humans, there is evidence that opioids inhibit gastric motility through
a central mechanism (66).
Hence, depending on the current state of autonomous and enteric nerve systems
and the main effect site, opioids have the potential to both increase and decrease
gastric tone.
There are diverging results in the literature regarding the effects of opioids on
gastric tone in humans. Penagini found that morphine increased gastric tone
(172), while Hammas reported a decrease in gastric tone (155). Both studies used
the same dose of intravenous morphine (0.1 mg/kg) and both used a gastric
51
barostat. However, there were important differences between the studies. In the
first study, baseline gastric tone was set to resemble a gastric load of a meal, and
in the second study baseline was set to fasting conditions. The stomach wall was
probably more distended (higher volumes in the intragastric bag) before
morphine in Penagani’s study compared to Hammas’ study, resulting in an
activated adaptive reflex. This leads to completely different baseline conditions.
In Penagini’s subjects there were probably low cholinergic and high NANC vagal
inputs to the stomach, and the reverse baseline conditions were probably present
in Hammas’ subjects. This might explain why a MOR antagonist contracted the
stomach (through NANC inhibition) in one study and relaxed the stomach
(through cholinergic inhibition) in the other study.
An interesting finding in Hammas’ study was that the concurrent administration
of propofol altered the effect of morphine on gastric tone. Propofol per se had no
effect on gastric tone, but after the subsequent administration of morphine,
gastric tone increased (volume decreased), contrary to the response to morphine
alone. We cannot explain the mechanism behind this modulation, but there is
evidence for central interactions and modulations between GABAergic and opioid
pathways (47). Other types of modulations of gastric tone have also been
described; in animals with an intact vagus nerve, noradrenaline relaxed the
proximal stomach while vagotomy reversed this response (169).
Can we explain the variable responses seen in our study within this context?
Remifentanil is a potent MOR agonist and the effect sites are probably both at
the stomach level and in the CNS. We speculate that the “normal” opioid
response during fasting conditions, as seen in Hammas’ study, is a decreased
cholinergic activity resulting in a decrease in gastric tone. However, due to the
high potency of remifentanil, direct smooth muscle effects might predominate in
some subjects, resulting in an increase in tone. Like propofol, remifentanil might
also have properties that modulate the opioid response. The focus of these
speculations is that opioid effects on gastric tone are variable and depend on
factors like the state of the subject and the current status of the neural pathways
and smooth muscles that are involved. This might be an explanation for the
variable results in study III.
Effects of fentanyl on gastric myoelectrical activity (IV)
In study IV we evaluated how fentanyl affected gastric myoelectrical activity.
Before the intervention, all subjects had a 3 cpm slow wave activity, which did
52
not differ from a recent multicenter electrogastrography study in normal subjects
(157). After fentanyl, gastric myoelectrical activity was inhibited, with a decrease
in both the dominant frequency and the dominant power of the electrogastro-
graphic spectra. The electrical activity was disrupted after the administration of
fentanyl, and we observed both bradygastria and disappearance of the slow wave
activity. However, the EGG was unaffected in about half of the subjects.
There are only a few reports in the literature regarding the effects of opioids on
gastric electrical activity. Invasive recordings of gastric myoelectrical activity have
shown that morphine transiently distorts the slow-wave activity and initiates
migrating myoelectric complexes (65, 173). Cutaneous recordings with EGG have
shown that morphine induces tachygastria (66). The shift in the basal EGG
frequency towards bradygastria that we observed in some of the subjects indicates
that opioids inhibit the ICC-network. Bradygastria is believed to be a decrease in
the frequency of the normal pacemaker cells, while other dysrhythmias like
tachygastria have ectopic origins in the stomach (174).
We tried to explain the variability seen in responders and non-responders. One
hypothesis may be a difference between the individuals in the plasma concentra-
tion of fentanyl. Unfortunately, blood samples were not collected during the EGG
study. By using a pharmacokinetic model (53, 175), we calculated the predicted
plasma concentrations of fentanyl for each subject. We were not able to find any
differences in the predicted concentrations between the outcome groups.
However, there is a notable wide variability in the model that may conceal
relevant differences. Further, as body composition affects the pharmacokinetic
profiles of a drug, we tested for differences in body weight and body mass index
between the groups, but found no differences. Also, it cannot be ruled out that
differences between the subjects in pharmacokinetic factors, i.e. distribution
volume, metabolism and clearance, alter the effect-site concentration of fentanyl
and thus the effect on gastric motility.
With the knowledge we have today, we cannot determine the exact mechanism of
the inhibition of myoelectrical activity. Possible locations of opioid receptors are
the interstitial cells of Cajal, interneurons in the enteric nervous system, and nerve
terminals from ascending pathways. There might also be a direct effect on gastric
smooth muscles, but such an effect would probably not affect the slow waves.
53
Our findings confirm that opioids inhibit the electrical activity, but we cannot
explain the variable outcome.
Associations to genetic factors (III, IV).
We hypothesized that genetic variability in the MOR gene was responsible for the
variations seen in the barostat and EGG studies (III and IV), but we did not find
such an association.
There are data indicating that genetic differences are able to alter the gastrointes-
tinal response to opioids. The variable analgesic effect of codeine is related to
genetic variations, leading to different expressions of the enzyme (CYP2D6) that
metabolizes codeine to morphine. Among extensive metabolizers, orocecal transit
time is prolonged compared to poor metabolizers and correlates to higher
morphine concentrations in plasma (176). To our knowledge, there are no studies
regarding the relation of SNP in the μ-opioid receptor to the effect of opioids on
gastrointestinal motility. After reviewing the literature, we decided to analyze two
common SNPs in the μ-opioid receptor gene - A118G and IVS2 G691C (128).
The frequencies of SNP A118G in our material were similar to the frequencies
reported in the literature, and the distributions were in Hardy-Weinberg
equilibrium. There were discrepancies in the distributions of SNP G691C between
studies III and IV. In study III, the distribution was in equilibrium. In study IV, all
investigated subjects were either heterozygote or homozygote to G691C and there
were no normal “wild types” of G691C, and the distribution was not consistent
with the expected distributions in Hardy-Weinberg equilibrium. Our study group
may not represent a normal population, as the majority of subjects were woman
and almost all of them had gallbladder disease. This may introduce a selection
bias. However, with the small sample size it is difficult to draw any conclusions
regarding the distribution.
Our results indicate that pharmacogenetic differences in the opioid receptor gene
may not be a major factor regarding the variable gastric outcome caused by an
opioid. However, due to the small sample size we want to emphasis that our
results are preliminary observations and they must be interpreted with caution.
Genetic variations can still be one co-factor, but not the factor that determined
the outcome in our studies.
54
Side effects of opioids
Nausea and vomiting are known side effects of opioid treatment (177) and we
had a high incidence in our studies. In the studies with volunteers (I and III), one
third to one half of the subjects experienced nausea during the remifentanil
infusion. The incidences of PONV in study II were 48% and 62% (TIVA and
GAS), respectively, and in study II the incidence was around 50%.
Those in Study I who experienced nausea did so during both occasions with
remifentanil. This indicates that there are individual factors that do not change
over time that determine if opioids induce nausea. In study IV we found an
association between opioid induced EGG changes and PONV. We speculate that
in subjects who are sensitive to opioids, both gastric motility changes and nausea
are easily induced. The emetic center and the motor nuclei are located close to
each other in the medulla and neurons influenced by opioids might affect both
systems.
In studies I and III, subjects experienced difficulties swallowing during the
remifentanil infusion. There are reports in the literature showing that potent
opioids can cause dysphagia (178). This side effect provides evidence that potent
opioids inhibit motility patterns through central mechanisms, as swallowing is a
process controlled by neuronal networks in the medulla (179).
Future perspectives
As we still have only small islands of knowledge about the actions of opioids in
the gastrointestinal system and the underlying mechanisms (7), more research is
needed to find out how we can diminish the side effects of the opioids. Novel,
peripheral-acting opioid antagonists are promising and need more evaluation.
However, as opioids also act through central mechanisms in the brain (66), it
might be impossible to antagonize all side effects in the gastrointestinal tract.
Using the results from out studies as a base, we might be able to further explore
the efficiency of the new antagonists. Can we improve gastric emptying during
opioid treatment? How is the dual response we achieved in gastric tone altered,
and can we reveal peripheral and central actions of opioids?
The finding that EGG changes predicted PONV might be useful in helping us
identify subjects at high risk for PONV. Properly designed studies must be
conducted with this issue as the primary hypothesis.
55
Conclusions
- Remifentanil delayed gastric emptying.
- Posture did not influence gastric emptying rates during a remifentanil
infusion.
- There were no differences in postoperative gastric emptying rates between
a remifentanil-propofol based total intravenous anesthesia and an opioid
free sevoflurane inhalational anesthesia.
- Remifentanil both increased and decreased proximal gastric tone and the
responses were individual.
- Fentanyl inhibited gastric myoelectrical activity, although half of the
subjects were “non-responders.”
- “Responders” to fentanyl (EGG changes) had higher incidences of PONV.
- No associations were found between common SNPs in the μ-
opioidreceptor gene and the variable outcomes in the gastric barostat stud-
ies and the EGG studies.
56
Acknowledgments
I wish to express my warm and sincere gratitude to:
All the volunteers and patients who contributed to this thesis.
My friend and tutor Magnus Wattwil, for initiating and guiding me in the field of research, for patiently believing in me despite my remote location and the other projects in my life, and for his incredible knowledge about how-to-get-to-and-survive-a-congress.
My friend and co-tutor Sven-Egron Thörn, for head-hunting me into anesthesia, for invaluable collaboration in my studies, for being a computer-mate, for enthusiasm about everything, and for sharing important things in life.
Greger Lindberg, for collaboration with the electrogastrograph, for the genetic hypothesis, and for constructive and valuable criticism.
Lisbeth Wattwil and Åsa Löfqvist, for all the blood samples and for your unfailing practical support in my projects.
Mathias Sandin, for assistance in the electrogastrography study.
All my fellow colleagues and members of the staff at the Department of Anesthesia, Sundsvall Hospital, for supporting me and being great colleagues and friends.
My boss, Thomas Bohlin, for giving me time for my research.
My former colleagues and members of the staff at ANIVA-kliniken, Örebro, for creating an inspiring research environment.
Hans Malker and FoU-centrum, Landstinget Västernorrland, for believing in my projects and for providing the possibility for me to carry them out.
Margaretha Jurstrand, for deep-freezing my blood samples for the genetic analysis.
The Medical Library at Sundsvall Hospital, for excellent bibliographic service.
Jane Wigertz, for linguistic revision of the text.
My friends and family, hopefully all of you now understand a little of what I have been doing.
Those I have forgotten to mention… many thanks!
Maria, my beloved wife and best friend, for your love and support. If we hadn’t had so much fun together, this thesis would have been defended ages ago…
Andreas, our best gift ever.
The work in this thesis was supported by fundings from Research and Development Center (FoU-Centrum), Västernorrland County Council and Research Committee of Örebro County Council.
57
References
1. Bauer AJ, Boeckxstaens GE. Mechanisms of postoperative ileus. Neurogastroenterol Motil 2004:16 Suppl 2:54-60.
2. Resnick J, Greenwald DA, Brandt LJ. Delayed gastric emptying and postoperative ileus after nongastric abdominal surgery: part I. Am J Gastroenterol 1997:92(5):751-62.
3. Luckey A, Livingston E, Tache Y. Mechanisms and treatment of postoperative ileus. Arch Surg 2003:138(2):206-14.
4. Baig MK, Wexner SD. Postoperative ileus: a review. Dis Colon Rectum 2004:47(4):516-26.
5. Delaney CP. Clinical perspective on postoperative ileus and the effect of opiates. Neurogastroenterol Motil 2004:16 Suppl 2:61-6.
6. Kurz A, Sessler DI. Opioid-induced bowel dysfunction: pathophysiology and potential new therapies. Drugs 2003:63(7):649-71.
7. Hicks GA, DeHaven-Hudkins DL, Camilleri M. Opiates in the control of gastrointestinal tract function: current knowledge and new avenues for research. Neurogastroenterol Motil 2004:16 Suppl 2:67-70.
8. Azpiroz F. Control of gastric emptying by gastric tone. Dig Dis Sci 1994:39(12 Suppl):18S-19S.
9. Read NW, Houghton LA. Physiology of gastric emptying and pathophysiology of gastroparesis. Gastroenterol Clin North Am 1989:18(2):359-73.
10. Ramkumar D, Schulze KS. The pylorus. Neurogastroenterol Motil 2005:17 Suppl 1:22-30.
11. Burks TF, Galligan JJ, Porreca F, Barber WD. Regulation of gastric emptying. Fed Proc 1985:44(14):2897-901.
12. Chang FY. Electrogastrography: Basic knowledge, recording, processing and its clinical applications. J Gastroenterol Hepatol 2005:20(4):502-16.
13. Wood JD, Alpers DH, Andrews PL. Fundamentals of neurogastroenterology. Gut 1999:45 Suppl 2:II6-II16.
14. Chang HY, Mashimo H, Goyal RK. Musings on the wanderer: what's new in our understanding of vago-vagal reflex? IV. Current concepts of vagal efferent projections to the gut. Am J Physiol Gastrointest Liver Physiol 2003:284(3):G357-66.
15. Brookes SJH, Costa M. Functional Histoanatomy of the Enteric Nervous System. In: Johnsson LR, editor. Physiology of the Gastrointestinal Tract. 4th ed: Elsevier Academic Press; 2006. p. 577-602.
16. Travagli RA, Hermann GE, Browning KN, Rogers RC. Brainstem circuits regulating gastric function. Annu Rev Physiol 2006:68:279-305.
17. Abrahamsson H, Glise H. Sympathetic nervous control of gastric motility and interaction with vagal activity. Scand J Gastroenterol Suppl 1984:89:83-7.
18. Glise H, Abrahamsson H. Reflex inhibition of gastric motility pathophysiological aspects. Scand J Gastroenterol Suppl 1984:89:77-82.
19. Naslund E, Bogefors J, Skogar S, Gryback P, Jacobsson H, Holst JJ, Hellstrom PM. GLP-1 slows solid gastric emptying and inhibits insulin, glucagon, and PYY release in humans. Am J Physiol 1999:277(3 Pt 2):R910-6.
20. Bojo L, Cassuto J. Gastric reflex relaxation by colonic distension. J Auton Nerv Syst 1992:38(1):57-64.
58
21. Dockray JD. Gastrointestinal Hormones: Gastrin, Cholecystokinin, Somatostatin, and Ghrelin. In: Johnsson LR, editor. Physiology of the Gastrointestinal Tract. 4th ed: Elsevier Academic Press; 2006. p. 91-120.
22. Masuda Y, Tanaka T, Inomata N, Ohnuma N, Tanaka S, Itoh Z, Hosoda H, Kojima M, Kangawa K. Ghrelin stimulates gastric acid secretion and motility in rats. Biochem Biophys Res Commun 2000:276(3):905-8.
23. Englander EW, Greeley GH. Postpyloric Gastrointetsinal Peptides. In: Johnsson LR, editor. Physiology of the Gastrointestinal Tract. 4th ed: Elsevier Academic Press; 2006. p. 121-159.
24. Hellstrom PM, Gryback P, Jacobsson H. The physiology of gastric emptying. Best Pract Res Clin Anaesthesiol 2006:20(3):397-407.
25. Spiegel TA, Fried H, Hubert CD, Peikin SR, Siegel JA, Zeiger LS. Effects of posture on gastric emptying and satiety ratings after a nutritive liquid and solid meal. Am J Physiol Regul Integr Comp Physiol 2000:279(2):R684-94.
26. Horowitz M, Jones K, Edelbroek MA, Smout AJ, Read NW. The effect of posture on gastric emptying and intragastric distribution of oil and aqueous meal components and appetite. Gastroenterology 1993:105(2):382-90.
27. Burn-Murdoch R, Fisher MA, Hunt JN. Does lying on the right side increase the rate of gastric emptying? J Physiol 1980:302:395-8.
28. Maurer AH, Parkman HP. Update on gastrointestinal scintigraphy. Semin Nucl Med 2006:36(2):110-8.
29. Gentilcore D, Hausken T, Horowitz M, Jones KL. Measurements of gastric emptying of low- and high-nutrient liquids using 3D ultrasonography and scintigraphy in healthy sub-jects. Neurogastroenterol Motil 2006:18(12):1062-8.
30. Hausken T, Mundt M, Samsom M. Low antroduodenal pressure gradients are responsible for gastric emptying of a low-caloric liquid meal in humans. Neurogastroenterol Motil 2002:14(1):97-105.
31. Soreide E, Hausken T, Soreide JA, Steen PA. Gastric emptying of a light hospital breakfast. A study using real time ultrasonography. Acta Anaesthesiol Scand 1996:40(5):549-53.
32. Nimmo WS, Heading RC, Wilson J, Tothill P, Prescott LF. Inhibition of gastric emptying and drug absorption by narcotic analgesics. Br J Clin Pharmacol 1975:2(6):509-13.
33. Clements JA, Heading RC, Nimmo WS, Prescott LF. Kinetics of acetaminophen absorption and gastric emptying in man. Clin Pharmacol Ther 1978:24(4):420-31.
34. Tarling MM, Toner CC, Withington PS, Baxter MK, Whelpton R, Goldhill DR. A model of gastric emptying using paracetamol absorption in intensive care patients [see comments]. Intensive Care Med 1997:23(3):256-60.
35. Jackson SJ, Bluck LJ. Measurement of gastric emptying by octanoate metabolism. Curr Opin Clin Nutr Metab Care 2005:8(5):538-44.
36. Camilleri M, Hasler WL, Parkman HP, Quigley EM, Soffer E. Measurement of gastrointestinal motility in the GI laboratory. Gastroenterology 1998:115(3):747-62.
37. Whitehead WE, Delvaux M. Standardization of barostat procedures for testing smooth muscle tone and sensory thresholds in the gastrointestinal tract. The Working Team of Glaxo-Wellcome Research, UK. Dig Dis Sci 1997:42(2):223-41.
38. Bailey PL, Egan TD, Stanley TH. Intravenous Opioid Anesthestics. In: Miller RD, editor. Anesthesia. 5th ed: Churchill Livingstone; 2000. p. 273-376.
39. Camilleri M. Alvimopan, a selective peripherally acting mu-opioid antagonist. Neurogas-troenterol Motil 2005:17(2):157-65.
40. Greenwood-Van Meerveld B, Gardner CJ, Little PJ, Hicks GA, Dehaven-Hudkins DL. Preclinical studies of opioids and opioid antagonists on gastrointestinal function. Neurogas-troenterol Motil 2004:16 Suppl 2:46-53.
59
41. Sternini C, Patierno S, Selmer IS, Kirchgessner A. The opioid system in the gastrointestinal tract. Neurogastroenterol Motil 2004:16 Suppl 2:3-16.
42. Ferrante FM. Principles of opioid pharmacotherapy: practical implications of basic mechanisms. J Pain Symptom Manage 1996:11(5):265-73.
43. Ganesh A, Maxwell LG. Pathophysiology and Management of Opioid-Induced Pruritus. Drugs 2007:67(16):2323-2333.
44. Sora I, Takahashi N, Funada M, Ujike H, Revay RS, Donovan DM, Miner LL, Uhl GR. Opiate receptor knockout mice define mu receptor roles in endogenous nociceptive re-sponses and morphine-induced analgesia. Proc Natl Acad Sci U S A 1997:94(4):1544-9.
45. Aicher SA, Goldberg A, Sharma S, Pickel VM. mu-opioid receptors are present in vagal afferents and their dendritic targets in the medial nucleus tractus solitarius. J Comp Neurol 2000:422(2):181-90.
46. Tsuchida D, Fukuda H, Koda K, Miyazaki M, Pappas TN, Takahashi T. Central effect of mu-opioid agonists on antral motility in conscious rats. Brain Res 2004:1024(1-2):244-50.
47. Browning KN, Zheng Z, Gettys TW, Travagli RA. Vagal afferent control of opioidergic effects in rat brainstem circuits. J Physiol 2006:575(Pt 3):761-76.
48. Tejwani GA, Rattan AK, McDonald JS. Role of spinal opioid receptors in the antinocicep-tive interactions between intrathecal morphine and bupivacaine. Anesth Analg 1992:74(5):726-34.
49. Pol O, Puig MM. Expression of opioid receptors during peripheral inflammation. Curr Top Med Chem 2004:4(1):51-61.
50. Shahbazian A, Heinemann A, Schmidhammer H, Beubler E, Holzer-Petsche U, Holzer P. Involvement of mu- and kappa-, but not delta-, opioid receptors in the peristaltic motor depression caused by endogenous and exogenous opioids in the guinea-pig intestine. Br J Pharmacol 2002:135(3):741-50.
51. Grider JR, Makhlouf GM. Identification of opioid receptors on gastric muscle cells by selective receptor protection. Am J Physiol 1991:260(1 Pt 1):G103-7.
52. Allescher HD, Ahmad S, Daniel EE, Dent J, Kostolanska F, Fox JE. Inhibitory opioid receptors in canine pylorus. Am J Physiol 1988:255(3 Pt 1):G352-60.
53. Shafer SL, Varvel JR, Aziz N, Scott JC. Pharmacokinetics of fentanyl administered by computer-controlled infusion pump. Anesthesiology 1990:73(6):1091-102.
54. Burkle H, Dunbar S, Van Aken H. Remifentanil: a novel, short-acting, mu-opioid. Anesth Analg 1996:83(3):646-51.
55. Trendelenburg P. Physiological and pharmacological investigations of small intestinal peristalsis. Translation of the article "Physiologische und pharmakologische Versuche uber die Dunndarmperistaltik", Arch. Exp. Pathol. Pharmakol. 81, 55-129, 1917. Naunyn Schmiedebergs Arch Pharmacol 2006:373(2):101-33.
56. Trendelenburg P. Physiologische und pharmakologische Versuche uber die Dunndarmperi-staltik´. Arch Exp Pathol Pharmakol 1917(81):55-129.
57. Wood JD, Galligan JJ. Function of opioids in the enteric nervous system. Neurogastroen-terol Motil 2004:16 Suppl 2:17-28.
58. Kromer W. Endogenous and exogenous opioids in the control of gastrointestinal motility and secretion. Pharmacol Rev 1988:40(2):121-62.
59. Burks TF, Hruby VJ, Galligan JJ, Porreca F. Opioids and CNS control of the gut. Nippon Heikatsukin Gakkai Zasshi 1985:21 Suppl:101-2.
60. Bagnol D, Mansour A, Akil H, Watson SJ. Cellular localization and distribution of the cloned mu and kappa opioid receptors in rat gastrointestinal tract. Neuroscience 1997:81(2):579-91.
60
61. Yokotani K, Osumi Y. Involvement of mu-receptor in endogenous opioid peptide-mediated inhibition of acetylcholine release from the rat stomach. Jpn J Pharmacol 1998:78(1):93-5.
62. Soldani G, Del Tacca M, Bernardini MC, Bardon T, Ruckebusch Y. Peripheral opioid receptors mediate gastrointestinal secretory and motor effects of dermorphin N-terminal tetrapeptide (NTT) in the dog. Neuropeptides 1987:10(1):67-76.
63. Zhang L, Gu ZF, Pradhan T, Jensen RT, Maton PN. Characterization of opioid receptors on smooth muscle cells from guinea pig stomach. Am J Physiol 1992:262(3 Pt 1):G461-9.
64. Bitar KN, Makhlouf GM. Specific opiate receptors on isolated mammalian gastric smooth muscle cells. Nature 1982:297(5861):72-4.
65. Telford GL, Hoshmonai M, Moses AJ, Szurszewski JH. Morphine initiates migrating myoelectric complexes by acting on peripheral opioid receptors. Am J Physiol 1985:249(5 Pt 1):G557-62.
66. Thorn SE, Wattwil M, Lindberg G, Sawe J. Systemic and central effects of morphine on gastroduodenal motility. Acta Anaesthesiol Scand 1996:40(2):177-86.
67. Yuan CS, Foss JF, O'Connor M, Roizen MF, Moss J. Effects of low-dose morphine on gastric emptying in healthy volunteers. J Clin Pharmacol 1998:38(11):1017-20.
68. Murphy DB, Sutton JA, Prescott LF, Murphy MB. Opioid-induced delay in gastric emptying: a peripheral mechanism in humans. Anesthesiology 1997:87(4):765-70.
69. Browning KN, Kalyuzhny AE, Travagli RA. Opioid peptides inhibit excitatory but not inhibitory synaptic transmission in the rat dorsal motor nucleus of the vagus. J Neurosci 2002:22(8):2998-3004.
70. Aicher SA, Mitchell JL, Mendelowitz D. Distribution of mu-opioid receptors in rat visceral premotor neurons. Neuroscience 2002:115(3):851-60.
71. Silverman MB, Hermes SM, Zadina JE, Aicher SA. Mu-opioid receptor is present in dendritic targets of Endomorphin-2 axon terminals in the nuclei of the solitary tract. Neu-roscience 2005:135(3):887-96.
72. Grundy D, Booth CE, Winchester W, Hicks GA. Peripheral opiate action on afferent fibres supplying the rat intestine. Neurogastroenterol Motil 2004:16 Suppl 2:29-37.
73. Patierno S, Zellalem W, Ho A, Parsons CG, Lloyd KC, Tonini M, Sternini C. N-methyl-D-aspartate receptors mediate endogenous opioid release in enteric neurons after abdominal surgery. Gastroenterology 2005:128(7):2009-19.
74. Patierno S, Raybould HE, Sternini C. Abdominal surgery induces mu opioid receptor endocytosis in enteric neurons of the guinea-pig ileum. Neuroscience 2004:123(1):101-9.
75. Sanger GJ, Tuladhar BR. The role of endogenous opioids in the control of gastrointestinal motility: predictions from in vitro modelling. Neurogastroenterol Motil 2004:16 Suppl 2:38-45.
76. Marshall FN, Pittinger CB, Long JP. Effects of halothane on gastrointestinal motility. Anesthesiology 1961:22:363-6.
77. Wright JW, Healy TE, Balfour TW, Hardcastle JD. Effects of inhalation anaesthetic agents on the electrical and mechanical activity of the rat duodenum. Br J Anaesth 1982:54(11):1223-30.
78. Schurizek BA. The effects of general anaesthesia on antroduodenal motility, gastric pH and gastric emptying in man. Dan Med Bull 1991:38(4):347-65.
79. Hammas B, Hvarfner A, Thorn SE, Wattwil M. Propofol sedation and gastric emptying in volunteers. Acta Anaesthesiol Scand 1998:42(1):102-5.
80. Lee TL, Ang SB, Dambisya YM, Adaikan GP, Lau LC. The effect of propofol on human gastric and colonic muscle contractions. Anesth Analg 1999:89(5):1246-9.
81. Karamanolis G, Tack J. Promotility medications--now and in the future. Dig Dis 2006:24(3-4):297-307.
61
82. Galligan JJ, Vanner S. Basic and clinical pharmacology of new motility promoting agents. Neurogastroenterol Motil 2005:17(5):643-53.
83. Levein NG, Thorn SE, Wattwil M. Dopamine delays gastric emptying and prolongs orocaecal transit time in volunteers. Eur J Anaesthesiol 1999:16(4):246-50.
84. Levein NG, Thorn SE, Lindberg G, Wattwill M. Dopamine reduces gastric tone in a dose-related manner. Acta Anaesthesiol Scand 1999:43(7):722-5.
85. Beattie DT, Smith JA, Marquess D, Vickery RG, Armstrong SR, Pulido-Rios T, McCullough JL, Sandlund C, Richardson C, Mai N, Humphrey PP. The 5-HT4 receptor agonist, tegaserod, is a potent 5-HT2B receptor antagonist in vitro and in vivo. Br J Phar-macol 2004:143(5):549-60.
86. Park MI, Ferber I, Camilleri M, Allenby K, Trillo R, Burton D, Zinsmeister AR. Effect of atilmotin on gastrointestinal transit in healthy subjects: a randomized, placebo-controlled study. Neurogastroenterol Motil 2006:18(1):28-36.
87. Cowles VE, Nellans HN, Seifert TR, Besecke LM, Segreti JA, Mohning KM, Faghih R, Verlinden MH, Wegner CD. Effect of novel motilide ABT-229 versus erythromycin and cisapride on gastric emptying in dogs. J Pharmacol Exp Ther 2000:293(3):1106-11.
88. Lewis TD. Morphine and gastroduodenal motility. Dig Dis Sci 1999:44(11):2178-86.
89. Foss JF. A review of the potential role of methylnaltrexone in opioid bowel dysfunction. Am J Surg 2001:182(5A Suppl):19S-26S.
90. Taguchi A, Sharma N, Saleem RM, Sessler DI, Carpenter RL, Seyedsadr M, Kurz A. Selective postoperative inhibition of gastrointestinal opioid receptors. N Engl J Med 2001:345(13):935-40.
91. Liu SS, Hodgson PS, Carpenter RL, Fricke JR, Jr. ADL 8-2698, a trans-3,4-dimethyl-4-(3-hydroxyphenyl) piperidine, prevents gastrointestinal effects of intravenous morphine with-out affecting analgesia. Clin Pharmacol Ther 2001:69(1):66-71.
92. Wolff BG, Weese JL, Ludwig KA, Delaney CP, Stamos MJ, Michelassi F, Du W, Techner L. Postoperative ileus-related morbidity profile in patients treated with alvimopan after bowel resection. J Am Coll Surg 2007:204(4):609-16.
93. Herzog TJ, Coleman RL, Guerrieri JP, Jr., Gabriel K, Du W, Techner L, Fort JG, Wallin B. A double-blind, randomized, placebo-controlled phase III study of the safety of alvimopan in patients who undergo simple total abdominal hysterectomy. Am J Obstet Gynecol 2006:195(2):445-53.
94. Tan EK, Cornish J, Darzi AW, Tekkis PP. Meta-analysis: Alvimopan vs. placebo in the treatment of post-operative ileus. Aliment Pharmacol Ther 2007:25(1):47-57.
95. Wolff BG, Michelassi F, Gerkin TM, Techner L, Gabriel K, Du W, Wallin BA. Alvimopan, a novel, peripherally acting mu opioid antagonist: results of a multicenter, randomized, double-blind, placebo-controlled, phase III trial of major abdominal surgery and postopera-tive ileus. Ann Surg 2004:240(4):728-34; discussion 734-5.
96. Senagore AJ, Bauer JJ, Du W, Techner L. Alvimopan accelerates gastrointestinal recovery after bowel resection regardless of age, gender, race, or concomitant medication use. Sur-gery 2007:142(4):478-86.
97. Yuan CS, Foss JF, Moss J. Effects of methylnaltrexone on morphine-induced inhibition of contraction in isolated guinea-pig ileum and human intestine. Eur J Pharmacol 1995:276(1-2):107-11.
98. Foss JF, O'Connor MF, Yuan CS, Murphy M, Moss J, Roizen MF. Safety and tolerance of methylnaltrexone in healthy humans: a randomized, placebo-controlled, intravenous, ascending-dose, pharmacokinetic study. J Clin Pharmacol 1997:37(1):25-30.
99. Yuan CS, Foss JF. Gastric effects of methylnaltrexone on mu, kappa, and delta opioid agonists induced brainstem unitary responses. Neuropharmacology 1999:38(3):425-32.
62
100. Yuan CS. Methylnaltrexone mechanisms of action and effects on opioid bowel dysfunction and other opioid adverse effects. Ann Pharmacother 2007:41(6):984-93.
101. Shaiova L, Rim F, Friedman D, Jahdi M. A review of methylnaltrexone, a peripheral opioid receptor antagonist, and its role in opioid-induced constipation. Palliat Support Care 2007:5(2):161-6.
102. Janda M, Scheeren TW, Noldge-Schomburg GF. Management of pulmonary aspiration. Best Pract Res Clin Anaesthesiol 2006:20(3):409-27.
103. Maltby JR. Fasting from midnight--the history behind the dogma. Best Pract Res Clin Anaesthesiol 2006:20(3):363-78.
104. Ljungqvist O, Soreide E. Preoperative fasting. Br J Surg 2003:90(4):400-6.
105. Stuart PC. The evidence base behind modern fasting guidelines. Best Pract Res Clin Anaesthesiol 2006:20(3):457-69.
106. Soreide E, Eriksson LI, Hirlekar G, Eriksson H, Henneberg SW, Sandin R, Raeder J. Pre-operative fasting guidelines: an update. Acta Anaesthesiol Scand 2005:49(8):1041-7.
107. Soreide E, Ljungqvist O. Modern preoperative fasting guidelines: a summary of the present recommendations and remaining questions. Best Pract Res Clin Anaesthesiol 2006:20(3):483-91.
108. Morris J, Cook TM. Rapid sequence induction: a national survey of practice. Anaesthesia 2001:56(11):1090-7.
109. Andersen HK, Lewis SJ, Thomas S. Early enteral nutrition within 24h of colorectal surgery versus later commencement of feeding for postoperative complications. Cochrane Database Syst Rev 2006(4):CD004080.
110. Han-Geurts IJ, Hop WC, Kok NF, Lim A, Brouwer KJ, Jeekel J. Randomized clinical trial of the impact of early enteral feeding on postoperative ileus and recovery. Br J Surg 2007:94(5):555-61.
111. Charoenkwan K, Phillipson G, Vutyavanich T. Early versus delayed (traditional) oral fluids and food for reducing complications after major abdominal gynaecologic surgery. Cochrane Database Syst Rev 2007(4):CD004508.
112. Mangesi L, Hofmeyr GJ. Early compared with delayed oral fluids and food after caesarean section. Cochrane Database Syst Rev 2002(3):CD003516.
113. Fukuda H, Tsuchida D, Koda K, Miyazaki M, Pappas TN, Takahashi T. Impaired gastric motor activity after abdominal surgery in rats. Neurogastroenterol Motil 2005:17(2):245-50.
114. Liu SS, Carpenter RL, Mackey DC, Thirlby RC, Rupp SM, Shine TS, Feinglass NG, Metzger PP, Fulmer JT, Smith SL. Effects of perioperative analgesic technique on rate of recovery after colon surgery. Anesthesiology 1995:83(4):757-65.
115. Jorgensen H, Wetterslev J, Moiniche S, Dahl JB. Epidural local anaesthetics versus opioid-based analgesic regimens on postoperative gastrointestinal paralysis, PONV and pain after abdominal surgery. Cochrane Database Syst Rev 2001(1):CD001893.
116. Apfel CC, Laara E, Koivuranta M, Greim CA, Roewer N. A simplified risk score for predicting postoperative nausea and vomiting: conclusions from cross-validations between two centers. Anesthesiology 1999:91(3):693-700.
117. Martin B. Prevention of gastrointestinal complications in the critically ill patient. AACN Adv Crit Care 2007:18(2):158-66.
118. Chapman MJ, Nguyen NQ, Fraser RJ. Gastrointestinal motility and prokinetics in the critically ill. Curr Opin Crit Care 2007:13(2):187-94.
119. Rohm KD, Schollhorn T, Boldt J, Wolf M, Papsdorf M, Piper SN. Nutrition support and treatment of motility disorders in critically ill patients - Results of a survey on German intensive care units. Eur J Anaesthesiol 2007:1-9.
63
120. Nguyen NQ, Chapman MJ, Fraser RJ, Bryant LK, Holloway RH. Erythromycin is more effective than metoclopramide in the treatment of feed intolerance in critical illness. Crit Care Med 2007:35(2):483-9.
121. Berne JD, Norwood SH, McAuley CE, Vallina VL, Villareal D, Weston J, McClarty J. Erythromycin reduces delayed gastric emptying in critically ill trauma patients: a random-ized, controlled trial. J Trauma 2002:53(3):422-5.
122. Jooste CA, Mustoe J, Collee G. Metoclopramide improves gastric motility in critically ill patients. Intensive Care Med 1999:25(5):464-8.
123. Nguyen NQ, Chapman M, Fraser RJ, Bryant LK, Burgstad C, Holloway RH. Prokinetic therapy for feed intolerance in critical illness: One drug or two? Crit Care Med 2007.
124. Meissner W, Dohrn B, Reinhart K. Enteral naloxone reduces gastric tube reflux and frequency of pneumonia in critical care patients during opioid analgesia. Crit Care Med 2003:31(3):776-80.
125. Mixides G, Liebl MG, Bloom K. Enteral administration of naloxone for treatment of opioid-associated intragastric feeding intolerance. Pharmacotherapy 2004:24(2):291-4.
126. Roberts DJ, Banh HL, Hall RI. Use of novel prokinetic agents to facilitate return of gastrointestinal motility in adult critically ill patients. Curr Opin Crit Care 2006:12(4):295-302.
127. Mayer P, Hollt V. Pharmacogenetics of opioid receptors and addiction. Pharmacogenet Genomics 2006:16(1):1-7.
128. Ikeda K, Ide S, Han W, Hayashida M, Uhl GR, Sora I. How individual sensitivity to opiates can be predicted by gene analyses. Trends Pharmacol Sci 2005:26(6):311-7.
129. Klepstad P, Dale O, Skorpen F, Borchgrevink PC, Kaasa S. Genetic variability and clinical efficacy of morphine. Acta Anaesthesiol Scand 2005:49(7):902-8.
130. Lotsch J, Geisslinger G. Are mu-opioid receptor polymorphisms important for clinical opioid therapy? Trends Mol Med 2005:11(2):82-9.
131. Palmer SN, Giesecke NM, Body SC, Shernan SK, Fox AA, Collard CD. Pharmacogenetics of anesthetic and analgesic agents. Anesthesiology 2005:102(3):663-71.
132. Bond C, LaForge KS, Tian M, Melia D, Zhang S, Borg L, Gong J, Schluger J, Strong JA, Leal SM, Tischfield JA, Kreek MJ, Yu L. Single-nucleotide polymorphism in the human mu opioid receptor gene alters beta-endorphin binding and activity: possible implications for opiate addiction. Proc Natl Acad Sci U S A 1998:95(16):9608-13.
133. Landau R, Cahana A, Smiley RM, Antonarakis SE, Blouin JL. Genetic variability of mu-opioid receptor in an obstetric population. Anesthesiology 2004:100(4):1030-3.
134. Hollt V. A polymorphism (A118G) in the mu-opioid receptor gene affects the response to morphine-6-glucuronide in humans. Pharmacogenetics 2002:12(1):1-2.
135. Margas W, Zubkoff I, Schuler HG, Janicki PK, Ruiz-Velasco V. Modulation of Ca2+ channels by heterologously expressed wild-type and mutant human micro-opioid receptors (hMORs) containing the A118G single-nucleotide polymorphism. J Neurophysiol 2007:97(2):1058-67.
136. Beyer A, Koch T, Schroder H, Schulz S, Hollt V. Effect of the A118G polymorphism on binding affinity, potency and agonist-mediated endocytosis, desensitization, and resensitiza-tion of the human mu-opioid receptor. J Neurochem 2004:89(3):553-60.
137. Lotsch J, Skarke C, Grosch S, Darimont J, Schmidt H, Geisslinger G. The polymorphism A118G of the human mu-opioid receptor gene decreases the pupil constrictory effect of morphine-6-glucuronide but not that of morphine. Pharmacogenetics 2002:12(1):3-9.
138. Romberg R, Olofsen E, Bijl H. Polymorphism of μ-Opiodreceptor Gene (OPRM1:c.118>G) Does Not Protect Against Opioidinduced Respiratory Depression despite Reduced Analgetic Response? Anesthesiology 2005:102(3):522-30.
64
139. Fillingim RB, Kaplan L, Staud R, Ness TJ, Glover TL, Campbell CM, Mogil JS, Wallace MR. The A118G single nucleotide polymorphism of the mu-opioid receptor gene (OPRM1) is associated with pressure pain sensitivity in humans. J Pain 2005:6(3):159-67.
140. Chou WY, Yang LC, Lu HF, Ko JY, Wang CH, Lin SH, Lee TH, Concejero A, Hsu CJ. Association of mu-opioid receptor gene polymorphism (A118G) with variations in mor-phine consumption for analgesia after total knee arthroplasty. Acta Anaesthesiol Scand 2006:50(7):787-92.
141. Klepstad P, Rakvag TT, Kaasa S, Holthe M, Dale O, Borchgrevink PC, Baar C, Vikan T, Krokan HE, Skorpen F. The 118 A > G polymorphism in the human micro-opioid receptor gene may increase morphine requirements in patients with pain caused by malignant dis-ease. Acta Anaesthesiol Scand 2004:48(10):1232-9.
142. Chou WY, Wang CH, Liu PH, Liu CC, Tseng CC, Jawan B. Human opioid receptor A118G polymorphism affects intravenous patient-controlled analgesia morphine consump-tion after total abdominal hysterectomy. Anesthesiology 2006:105(2):334-7.
143. Coulbault L, Beaussier M, Verstuyft C, Weickmans H, Dubert L, Tregouet D, Descot C, Parc Y, Lienhart A, Jaillon P, Becquemont L. Environmental and genetic factors associated with morphine response in the postoperative period. Clin Pharmacol Ther 2006:79(4):316-324.
144. Skarke C, Darimont J, Schmidt H, Geisslinger G, Lotsch J. Analgesic effects of morphine and morphine-6-glucuronide in a transcutaneous electrical pain model in healthy volun-teers. Clin Pharmacol Ther 2003:73(1):107-21.
145. Ross JR, Rutter D, Welsh K, Joel SP, Goller K, Wells AU, Du Bois R, Riley J. Clinical response to morphine in cancer patients and genetic variation in candidate genes. Pharma-cogenomics J 2005:5(5):324-36.
146. Ray LA, Hutchison KE. A polymorphism of the mu-opioid receptor gene (OPRM1) and sensitivity to the effects of alcohol in humans. Alcohol Clin Exp Res 2004:28(12):1789-95.
147. van den Wildenberg E, Wiers RW, Dessers J, Janssen RG, Lambrichs EH, Smeets HJ, van Breukelen GJ. A functional polymorphism of the mu-opioid receptor gene (OPRM1) influ-ences cue-induced craving for alcohol in male heavy drinkers. Alcohol Clin Exp Res 2007:31(1):1-10.
148. Ray LA, Hutchison KE. Effects of naltrexone on alcohol sensitivity and genetic moderators of medication response: a double-blind placebo-controlled study. Arch Gen Psychiatry 2007:64(9):1069-77.
149. Nishizawa D, Han W, Hasegawa J, Ishida T, Numata Y, Sato T, Kawai A, Ikeda K. Association of micro-opioid receptor gene polymorphism A118G with alcohol dependence in a Japanese population. Neuropsychobiology 2006:53(3):137-41.
150. Bart G, Kreek MJ, Ott J, LaForge KS, Proudnikov D, Pollak L, Heilig M. Increased attributable risk related to a functional mu-opioid receptor gene polymorphism in associa-tion with alcohol dependence in central Sweden. Neuropsychopharmacology 2005:30(2):417-22.
151. Arias A, Feinn R, Kranzler HR. Association of an Asn40Asp (A118G) polymorphism in the mu-opioid receptor gene with substance dependence: a meta-analysis. Drug Alcohol De-pend 2006:83(3):262-8.
152. Chong RY, Oswald L, Yang X, Uhart M, Lin PI, Wand GS. The Mu-Opioid Receptor Polymorphism A118G Predicts Cortisol Responses to Naloxone and Stress. Neuropsycho-pharmacology 2006:31(1):204-11.
153. Willems M, Quartero AO, Numans ME. How useful is paracetamol absorption as a marker of gastric emptying? A systematic literature study. Dig Dis Sci 2001:46(10):2256-62.
154. Azpiroz F, Malagelada JR. Gastric tone measured by an electronic barostat in health and postsurgical gastroparesis. Gastroenterology 1987:92(4):934-43.
65
155. Hammas B, Thorn SE, Wattwil M. Propofol and gastric effects of morphine. Acta Anaesthesiol Scand 2001:45(8):1023-7.
156. Sanders KM, Ördög T, Koh SD, Ward SM. Properties of Electrical Rhytmicity in the Stomach. In: Koch KL, Stern RM, editors. Handbook of Electrogastrography. New York: Oxford University Press; 2004. p. 13-36.
157. Simonian HP, Panganamamula K, Parkman HP, Xu X, Chen JZ, Lindberg G, Xu H, Shao C, Ke MY, Lykke M, Hansen P, Barner B, Buhl H. Multichannel electrogastrography (EGG) in normal subjects: a multicenter study. Dig Dis Sci 2004:49(4):594-601.
158. Sanaka M, Kuyama Y, Yamanaka M. Guide for judicious use of the paracetamol absorption technique in a study of gastric emptying rate of liquids. J Gastroenterol 1998:33(6):785-91.
159. Sanaka M, Kuyama Y, Nishinakagawa S, Mineshita S. Use of salivary acetaminophen concentration to assess gastric emptying rate of liquids. J Gastroenterol 2000:35(6):429-33.
160. Schwizer W, Steingotter A, Fox M, Zur T, Thumshirn M, Bosiger P, Fried M. Non-invasive measurement of gastric accommodation in humans. Gut 2002:51 Suppl 1:i59-62.
161. Parkman HP, Hasler WL, Barnett JL, Eaker EY. Electrogastrography: a document prepared by the gastric section of the American Motility Society Clinical GI Motility Testing Task Force. Neurogastroenterol Motil 2003:15(2):89-102.
162. Simonian HP, Panganamamula K, Chen JZ, Fisher RS, Parkman HP. Multichannel electrogastrography (EGG) in symptomatic patients: a single center study. Am J Gastroen-terol 2004:99(3):478-85.
163. Sanders KM, Koh SD, Ward SM. Interstitial cells of cajal as pacemakers in the gastrointes-tinal tract. Annu Rev Physiol 2006:68:307-43.
164. Wang ZS, Elsenbruch S, Orr WC, Chen JD. Detection of gastric slow wave uncoupling from multi-channel electrogastrogram: validations and applications. Neurogastroenterol Motil 2003:15(5):457-65.
165. Lotsch J, Geisslinger G. Current evidence for a genetic modulation of the response to analgesics. Pain 2006:121(1-2):1-5.
166. Anvari M, Horowitz M, Fraser R, Maddox A, Myers J, Dent J, Jamieson GG. Effects of posture on gastric emptying of nonnutrient liquids and antropyloroduodenal motility. Am J Physiol 1995:268(5 Pt 1):G868-71.
167. Bueno L, Fioramonti J. Action of opiates on gastrointestinal function. Baillieres Clin Gastroenterol 1988:2(1):123-39.
168. Behm B, Stollman N. Postoperative ileus: etiologies and interventions. Clin Gastroenterol Hepatol 2003:1(2):71-80.
169. Jahnberg T. Gastric adaptive relaxation. Effects of vagal activation and vagotomy. An experimental study in dogs and in man. Scand J Gastroenterol Suppl 1977:46:1-32.
170. Tack J, Demedts I, Meulemans A, Schuurkes J, Janssens J. Role of nitric oxide in the gastric accommodation reflex and in meal induced satiety in humans. Gut 2002:51(2):219-24.
171. Storr M, Gaffal E, Schusdziarra V, Allescher HD. Endomorphins 1 and 2 reduce relaxant non-adrenergic, non-cholinergic neurotransmission in rat gastric fundus. Life Sci 2002:71(4):383-9.
172. Penagini R, Allocca M, Cantu P, Mangano M, Savojardo D, Carmagnola S, Bianchi PA. Relationship between motor function of the proximal stomach and transient lower oeso-phageal sphincter relaxation after morphine. Gut 2004:53(9):1227-31.
173. Thorn SE, Wickbom G, Philipson L, Leissner P, Wattwil M. Myoelectric activity in the stomach and duodenum after epidural administration of morphine or bupivacaine. Acta Anaesthesiol Scand 1996:40(7):773-8.
66
174. Qian LW, Pasricha PJ, Chen JD. Origins and patterns of spontaneous and drug-induced canine gastric myoelectrical dysrhythmia. Dig Dis Sci 2003:48(3):508-15.
175. Shibutani K, Inchiosa MA, Jr., Sawada K, Bairamian M. Accuracy of pharmacokinetic models for predicting plasma fentanyl concentrations in lean and obese surgical patients: derivation of dosing weight ("pharmacokinetic mass"). Anesthesiology 2004:101(3):603-13.
176. Mikus G, Trausch B, Rodewald C, Hofmann U, Richter K, Gramatte T, Eichelbaum M. Effect of codeine on gastrointestinal motility in relation to CYP2D6 phenotype. Clin Phar-macol Ther 1997:61(4):459-66.
177. Watcha MF, White PF. Postoperative nausea and vomiting. Its etiology, treatment, and prevention. Anesthesiology 1992:77(1):162-84.
178. Currier DS, Levin KR, Campbell C. Dysphagia with intrathecal fentanyl. Anesthesiology 1997:87(6):1570-1.
179. Martino R, Terrault N, Ezerzer F, Mikulis D, Diamant NE. Dysphagia in a patient with lateral medullary syndrome: insight into the central control of swallowing. Gastroenterol-ogy 2001:121(2):420-6.
115
STUDY I
Klunserna Study 05-10-25, 10.10115
STU
DY
IThe Delay of Gastric Emptying Induced by Remifentanil IsNot Influenced by PostureJakob Wallden, MD*†, Sven-Egron Thorn, MD, PhD*, and Magnus Wattwil, MD, PhD*†
*Department of Anesthesia and Intensive Care, Orebro University Hospital, Orebro, Sweden; and †Department ofMedicine and Care, Faculty of Health Sciences, Linkoping, Sweden
Posture has an effect on gastric emptying. In this study,we investigated whether posture influences the delay ingastric emptying induced by opioid analgesics. Tenhealthymale subjectsunderwent4gastric emptyingstud-ieswith theacetaminophenmethod.Ontwooccasions thesubjectswere given a continuous infusion of remifentanil(0.2 �g · kg�1 · min�1) while lying either on the right lat-eral side ina20°head-uppositionoron the left lateral sidein a 20° head-down position. On two other occasions noinfusionwasgiven, and the subjectswere studied lying inthe two positions. When remifentanil was given, therewere no significant differences between the two posturesin maximal acetaminophen concentration (right side, 34�mol � L�1; versus left side, 16 �mol � L�1), time taken toreach the maximal concentration (94 versus 109 min), or
area under the serum acetaminophen concentration timecurve from 0 to 60 min (962 versus 197 min � �mol � L�1).In the control situation, there were differences betweenthe postures in maximal acetaminophen concentration(138 versus 94 �mol � L�1; P � 0.0001) and area under theserum acetaminophen concentration time curves from 0to 60min (5092 versus 3793min � �mol � L�1; P � 0.0001),but there was no significant difference in time taken toreach themaximalconcentration (25versus47min).Com-pared with the control situation, remifentanil delayedgastric emptying in both postures. We conclude thatremifentanildelaysgastric emptyingand that thisdelay isnot influenced by posture.
(AnesthAnalg 2004;99:429–34)
T he use of IV, epidural, and intrathecal opioids forpostoperative pain relief causes a delay in gastricemptying (1–3). This may delay intake of fluids
and food and influence the absorption of drugs ad-ministered orally. Both systemic and spinal opioidsdelay gastric emptying (2). This delay may be causedby decreased gastric motility and gastric tone or in-creased pyloric tone. The pylorus has a rich enkepha-linergic innervation, and opioids may therefore in-crease pyloric tone (4). Posture influences gastricemptying, particularly with prolonged emptyingwhen patients are in a left lateral position (5–7). Theuse of opioids also increases the risk for postoperativenausea and vomiting (8).
The effects of posture on gastric emptying duringopioid administration have not been studied. If posture
has an effect, then an optimal position may be found thatfacilitates gastric emptying and thereby reduces the neg-ative effects. However, if opioids increase pyloric tone,gastric emptying may not be influenced by posture.
Because postoperative opioids are used in most pa-tients undergoing major surgery, the purpose of thisstudy was to evaluate whether posture can influence thedelayed gastric emptying induced by an opioid. Wecompared the effects on gastric emptying of 2 extremepostures in 10 healthy volunteers with and without theadministration of remifentanil. The objective for usingvolunteers was to eliminate other factors (e.g., surgicalstress and pain) that influence gastric emptying andstudy the pure effect of an opioid. As an opioid, aninfusion of the ultra-short-acting opioid remifentanilwas chosen because of its pharmacological profilewith which a predictable and constant effect could beachieved. The acetaminophen method was used tostudy gastric emptying.
MethodsAfter approval of the study protocol by the ethicscommittee of the Orebro County Council, 10 healthymale volunteers with a mean age of 23.9 yr (range,21–31 yr), a mean weight of 80 kg (range, 71–98 kg),
The study was supported by grants from the Orebro CountyCouncil Research Committee.
Accepted for publication January 20, 2004.Address correspondence to Jakob Wallden, MD, Department of
Anesthesia and Intensive Care, Orebro University Hospital, 701 85Orebro, Sweden. Address e-mail to [email protected]. Ad-dress reprint requests to Magnus Wattwil, MD, PhD, Department ofAnesthesia and Intensive Care, Orebro University Hospital, 701 85Orebro, Sweden. Address e-mail to [email protected].
DOI: 10.1213/01.ANE.0000121345.58835.93
©2004 by the International Anesthesia Research Society0003-2999/04 Anesth Analg 2004;99:429–34 429
and a mean height of 180 cm (range, 173–188 cm) wererecruited to the study. The subjects gave their in-formed consent to participate after receiving verbaland written information. Only men were recruited,because the menstrual cycle may alter gastric empty-ing (9). None of them was taking any medications, andnone had a history of gastrointestinal disturbances. Ina randomized order, each subject was studied on fouroccasions, with at least 1 day between occasions. Theywere given a continuous infusion of remifentanil ontwo occasions while lying either on the right lateralside with the bed in a 20° head-up position (RHU) oron the left lateral side with the bed in a 20° head-downposition (LHD). On the other two occasions, noremifentanil infusion was given, and the subjects werestudied lying in the two positions (RHU and LHD).
The subjects fasted (both liquids and solids) for atleast 6 h before each study. An indwelling IV catheterwas placed in one arm for the drawing of blood sam-ples. On the occasions when remifentanil was given,an IV line was established in the opposite arm.Remifentanil was administered as a continuous infu-sion in a dose of 0.2 �g · kg�1 · min�1 and was started10 min before the ingestion of acetaminophen. Theinfusion was terminated directly after the last bloodsample (120 min) was drawn.
During the study, the usual monitors were used.Heart rate, arterial blood pressure, oxygen saturation,end-tidal carbon dioxide (CO2), respiratory rate, andsedation level were recorded every fifth minute. Atthe same intervals, the subjects were asked if theywere experiencing nausea or any other symptoms. Thesedation level was recorded as follows: no sedation �1, light sedation � 2, moderate sedation � 3, and deepsedation � 4. The visual analog scale (VAS) 0–10 wasused for nausea, where VAS 0 was no subjectivesymptoms and VAS 10 was the worst nausea thesubjects could imagine.
If the subject showed signs of excessive sedation, re-spiratory depression, severe nausea, or vomiting orshowed signs of other severe symptoms related to theinfusion of remifentanil, the dose was reduced. Duringthe two control situations, heart rate, arterial blood pres-sure, and sedation level were recorded every 15min, andthe subjects were questioned about nausea. Their level ofsedation was checked at the same intervals.
The acetaminophen absorption test was used formeasurement of gastric emptying. Acetaminophen1.5 g dissolved in 200 mL of water was ingested orally,and venous blood samples were taken at 5, 10, and15 min and then at 15-min intervals for 120 min. Whenremifentanil was given, acetaminophen was takenorally 10 min after the start of the infusion. Acetamin-ophen is not absorbed from the stomach but is rapidlyabsorbed from the small intestine. Consequently, therate of gastric emptying determines the rate of absorp-tion of acetaminophen administered into the stomach.
Serum acetaminophen was determined by an immu-nologic method including fluorescence polarization(TDx® acetaminophen; Abbott Laboratories; NorthChicago, IL). Acetaminophen concentration curveswere produced, and the maximal acetaminophen con-centration (Cmax), the time taken to reach the maximalconcentration (Tmax), and the area under the serumacetaminophen concentration time curves from 0 to60 min (AUC60) were calculated. Tmax was assumed tobe 120 min if no acetaminophen was detected in anysample. The acetaminophen method is a well acceptedmethod for studying the liquid phase of gastric emp-tying, and AUC60 correlates very well with measuresof gastric emptying performed with isotope tech-niques (10,11).
A prior power calculation was performed and de-signed to detect differences in AUC60 between the 2postures when remifentanil was given. On the basis ofdata from previous studies, the estimated sample sizewas 10 volunteers with a power of 80% at the 5%significance level.
The results are presented as means with standarddeviations. Repeated-measures analysis of variancewas used for overall differences between the studysituations. If the analysis of variance showed differ-ences, a paired Student’s t-test with Bonferroni’s cor-rection was used for comparisons between the situa-tions. The significance level was set at 5% in all tests.
ResultsThe acetaminophen concentration curves are pre-sented in Figure 1. There were significant differencesin AUC60 (P � 0.001), Cmax (P � 0.001), and Tmax (P �0.001) among the 4 study situations. During theremifentanil infusion, AUC60 was lower, Cmax wassmaller, and Tmax was longer in both postures com-pared with the control situations. During the controlsituations, there were statistically significant differ-ences, with a higher AUC60 and a larger Cmax in theRHU position. There were no statistically significantdifferences in AUC60, Cmax, or Tmax between the 2postures when remifentanil was given (Table 1).
In 3 subjects (30%), the dose of remifentanil had tobe reduced during the study because of side effects(Table 2). Six subjects (60%) experienced nausea, threesubjects (30%) vomited, and six subjects (60%) hadpruritus during at least one of the remifentanil situa-tions. There was no nausea, vomiting, or pruritusduring the control situations (Table 3).
Systolic blood pressure and heart rate were stable inall situations during the study. Arterial blood pressuredecreased slightly compared with the initial pressurein all situations, but no further changes were detected.Heart rate decreased in the LHD position when noinfusion was given (Table 4).
430 ANESTHETIC PHARMACOLOGY WALLDEN ET AL. ANESTH ANALGREMIFENTANIL AND GASTRIC EMPTYING 2004;99:429–34
STU
DY
I
Respiratory rate decreased in the RHU position, andend-tidal CO2 increased in both positions during theremifentanil infusion (Table 4). There was no changein oxygen saturation. In 7 subjects (70%), the respira-tory rate decreased during the remifentanil infusion to�5 breaths/min. After verbally reminding the volun-teers to breathe and, for one subject, reducing theinfusion of remifentanil, the respiratory rate immedi-ately returned to an acceptable level.
Seven subjects experienced difficulty swallowingduring the remifentanil infusion, but the symptomceased within minutes after the infusion was termi-nated. Five subjects complained of headache duringand after the infusion of remifentanil, and in somesubjects the headache persisted for several hours.
DiscussionThis study has demonstrated that body position influ-ences gastric emptying of fluids, that remifentanil insmall doses delays gastric emptying of fluids, and thata change in body position does not influence the delayin gastric emptying induced by remifentanil. Duringthe control situation, the RHU position resulted infaster gastric emptying than the LHD position.
Gastric emptying is influenced by at least threemechanisms—gastric tone, gastric motility, and pylo-ric tone. The proximal fundus of the stomach func-tions as a reservoir, and the muscles are adapted formaintaining a continuous contractile tone. The distalantrum/pyloric area of the stomach exhibits phasicand peristaltic contractile activity and functions bothas a pump and a grinding mill (12). The tone of thepyloric sphincter regulates the outflow to the duode-num. Consequently, changes in any of these factorswill affect the rate of gastric emptying.
There are limited reports on the effects of posture ongastric emptying. Anvari et al. (13) found that gastricemptying of nonnutrient liquids was faster in the sit-ting position compared with the left lateral position
and that even after a delay in gastric emptying in-duced by atropine there were differences between thepositions. The faster emptying in the sitting positionbefore atropine was associated with increased antralperistaltic activity and increased pyloric pressure, butafter atropine, no differences in antropyloroduodenalmotility could be observed. The mechanism for thechange in motility was thought to be due to effects ofgravity rather than primarily to changes in motility.Other authors also report that the left lateral positionis associated with a delay in gastric emptying (5–7),and our findings are in accordance with these results.
The effect of gravity on gastric emptying is depen-dent on pyloric tone. Even if posture moves the gastriccontents toward the pylorus and there is a high pylorictone, gastric emptying will be difficult. In the controlsituation in this study, emptying time was fast in bothpostures. This indicates that passage through the py-loric region was easy. Opioids decrease gastric tone(14), but even if gastric tone was decreased, gastricemptying would have been facilitated by the RHUposition. Because our study showed no significantdifferences in gastric emptying between the RHU andLHD positions during remifentanil infusion, these re-sults indicate that remifentanil increases pyloric toneand thereby impairs the flow into the duodenum. Ithas been clearly shown that the pylorus has a richenkephalinergic innervation (4), which may explainthe effect of opioids on pyloric obstruction. No con-clusions about gastric motility can be drawn on thebasis of the results of our study.
Several studies have demonstrated that both systemicand spinal opioids delay gastric emptying (1,15,16), andthese effects are both peripherally and centrally medi-ated (2). Opioid receptors are present in the gastric tract,and recently developed opioid antagonists such asmeth-ylnaltrexone and alvimopan, which do not pass theblood-brain barrier, reverse the opioid-induced inhibi-tion of gastrointestinal motility (17,18).
Opioids pass the blood-brain barrier and have thepotential to regulate motility through a central mecha-nism. The dorsal vagal complex, located in the medullarbrainstem, receives sensory information from the gastro-intestinal tract through afferent vagal fibers and is alsothe origin of efferent vagal fibers projecting to the gas-trointestinal tract. �-Opioid receptors have been identi-fied in the synaptic connections within this region, andopioid agonists given locally inhibit gastric motility anddecrease gastric tone (19). The role of opioids in thebrainstem’s normal physiological control of gastrointes-tinal motility is controversial, because local injection ofthe opioid antagonist naloxone has not been found toinfluence motility per se (20). However, intrathecal mor-phine has been shown to inhibit motility and delay gas-tric emptying (2), so clinical studies consequently sup-port the findings that opioids can inhibit motilitythrough a central mechanism.
Figure 1. Mean (sd) serum acetaminophen concentrations duringthe four study situations.
ANESTH ANALG ANESTHETIC PHARMACOLOGY WALLDEN ET AL. 4312004;99:429–34 REMIFENTANIL AND GASTRIC EMPTYING
The respiratory rate decreased and end-tidal CO2increased during the infusion of remifentanil. CO2induces relaxation of smooth muscle in vascular beds,but we are not aware of any reports concerning theeffects of CO2 on gastrointestinal motility. However,hypercapnia also induces sympathetic stimulation,and the increased sympathetic activity may influencegastric function, with delayed gastric emptying. Soonafter the infusion of remifentanil was terminated, therespiratory rate and end-tidal CO2 were normalized.
Half of the volunteers experienced nausea duringthe remifentanil infusion. Five subjects vomited, butthis was late in the study and therefore had no majoreffect on the acetaminophen study. Opioids are
known to cause nausea and vomiting, but the mecha-nisms are complex. The action is believed to be medi-ated through activation of the chemoreceptor triggerzone (located in the area postrema) (8).
Sixty percent of the subjects experienced pruritus.Pruritus is often seen after the administration of opi-oids, particularly after spinal administration, in whichthere are reports of incidences up to 50% (21).
Remifentanil induced difficulties in swallowing inmost volunteers. Swallowing is a complex motor be-havior controlled by neuronal networks in the brain-stem, and after the administration of intrathecal fent-anyl, there are reports of dysphagia (22). This suggeststhat the mechanism is mediated by a central action.
Table 1. Mean (sd) of AUC60, Tmax, and Cmax in Two Different Body Postures With and Without Infusion ofRemifentanil 0.2 �g � kg�1 � min�1
Variable
Right lateral side head-up position Left lateral side head-down position
Remifentanil Control Remifentanil Control
AUC60 (min � �mol � L�1) 962 (902) 5092 (1125) 197 (128) 3793 (1307)Cmax (�mol � L�1) 34 (24) 138 (45) 16 (14) 94 (30)Tmax (min) 94 (33) 25 (14) 109 (10) 47 (22)
AUC60 Cmax Tmax
RHU-Remi vs RHU-Control P � 0.0001 P � 0.0001 P � 0.0001
RHU-Remi vs LHD-Remi NS NS NS
RHU-Remi vs LHD-Control P � 0.0001 P � 0.0001 P � 0.0001
RHU-Control vs LHD-Remi P � 0.0001 P � 0.0001 P � 0.0001
RHU-Control vs LHD-Control P � 0.0083 P � 0.0083 NS
LHD-Remi vs LHD-Control P � 0.0001 P � 0.0001 P � 0.0001
Paired Student’s t-tests with Bonferroni’s correction after the analysis of variance detected differences. The significance level was set at 5%, with P � 0.0083considered significant.
AUC60 � area under the serum acetaminophen concentration curve from 0 to 60 min during the study; Cmax � maximum acetaminophen concentration;Tmax � time taken to reach the maximum acetaminophen concentration.
Table 2. Adjustments of the Initial Dose of Remifentanil 0.2 �g � kg�1 � min�1 in Three Subjects Because of SideEffects
SubjectNo. Position
Time after startof remifentanila
(min) Side effect
Adjusted dose ofremifentanil
(�g � kg�1 � min�1)
4 RHU 86 Nausea (VAS � 9) 0.196 Nausea (VAS � 7) 0.05
105 Vomited 0LHD 120 Vomited 0
5 RHU 120 Vomited 0LHD 83 Nausea (VAS � 6) 0.1
103 Nausea (VAS � 6) 0.05113 Headache 0.025
9 RHU 31 Respiratory rate 3 breaths/min 0.15LHD 0 Dose reduced from start because of
respiratory depression duringRHU position
0.15
36 Respiratory rate 3 breaths/min 0.1
RHU � right lateral head-up position; LHD � left lateral head-down position; VAS � visual analog scale (scale 0–10; no subjective symptom � 0, worstsubjective symptom � 10).
a Infusion of remifentanil was started 10 min before the ingestion of acetaminophen. The infusion was normally terminated after 130 min, when the last bloodsample was taken.
432 ANESTHETIC PHARMACOLOGY WALLDEN ET AL. ANESTH ANALGREMIFENTANIL AND GASTRIC EMPTYING 2004;99:429–34
STU
DY
I
Even though remifentanil is an ultra-short-actingdrug, the subjects complained of headache and latenausea after the infusion was stopped. This is proba-bly not a direct effect of remifentanil and may insteadbe an effect of the increased CO2 level, with a possiblecerebral influence.
Because of the extensive side effects found in vol-unteers, we do not consider remifentanil a suitabledrug for postoperative analgesia. A multicenter eval-uation of the use of remifentanil for early postopera-tive analgesia found an occurrence of adverse respira-tory events in 29% of patients (23) and concluded thatthe technique is probably not practical for routineclinical use.
However, with adequate monitoring, remifentanil isa valuable drug for studying the effects of opioids inexperimental setups with volunteers. With this drug,
it is possible to study the dose-response effects ofopioids.
In conclusion, remifentanil delays gastric emptying,and this delay is not influenced by changes in bodyposture. During the control situation, the RHU posi-tion facilitated gastric emptying.
References1. Murphy DB, Sutton JA, Prescott LF, Murphy MB. Opioid-
induced delay in gastric emptying: a peripheral mechanism inhumans. Anesthesiology 1997;87:765–70.
2. Thorn SE, Wattwil M, Lindberg G, Sawe J. Systemic and centraleffects of morphine on gastroduodenal motility. Acta Anaesthe-siol Scand 1996;40:177–86.
3. Thoren T, Wattwil M. Effects on gastric emptying of thoracicepidural analgesia with morphine or bupivacaine. AnesthAnalg 1988;67:687–94.
Table 3. Incidence of Nausea, Vomiting, and Pruritus for Each Posture With and Without Infusion of Remifentanil 0.2�g � kg�1 � min�1 (n � 10)
Variable
Right lateral side head-up position Left lateral side head-down position
Remifentanil Control Remifentanil Control
Nausea 5/10 0/10 6/10 0/10Vomiting 3/10 0/10 2/10 0/10Pruritus 4/10 0/10 4/10 0/10
Five subjects had nausea in both remifentanil situations. The maximal nausea VAS score for those subjects who experienced nausea was in the right lateralhead-up position (median, 6; range, 3–10) and in the left lateral head-down position (median, 4.5; range, 2–9).
Two subjects vomited in both remifentanil situations. There was prior nausea in all subjects who vomited.Two subjects had pruritus in both remifentanil situations.VAS � visual analog scale (Scale 0–10; no subjective symptom � 0, worst subjective symptom � 10).
Table 4. Vital Variables During the Study
VariableBeforestart �10 to 0 min 0–30 min 31–60 min 61–90 min 91–120 min P value
Mean systolic blood pressure (mm Hg)RHU with remifentanil infusion 120 (10.8) 105 (9.2) 109 (10.9) 106 (10.2) 105 (7.3) 105 (8.8) �0.0001a
RHU with no infusion (control) 126 (15.8) — 111 (12.7) 106 (9.6) 104 (8.3) 107 (10.6) �0.0001a
LHD with remifentanil infusion 129 (12.2) 111 (10.5) 109 (14.7) 106 (10.8) 105 (9.5) 106 (11.1) �0.0001a
LHD with no infusion (control) 121 (12.8) — 104 (11.4) 99 (6.9) 100 (8) 106 (7.7) �0.0001a
Mean heart rate (bpm)RHU with remifentanil infusion 66 (12) 66 (15) 68 (18) 70 (14) 70 (13) 70 (14) NSRHU with no infusion (control) 68 (11) — 65 (12) 63 (10) 63 (7) 63 (7) NSLHD with remifentanil infusion 68 (10) 64 (10) 63 (10) 66 (10) 66 (10) 67 (12) NSLHD with no infusion (control) 66 (12) — 60 (9) 59 (6) 59 (5) 58 (6) 0.0055a
Mean respiratory rate (breaths/min)RHU with remifentanil infusion 13.4 (3.3) 9.6 (3.4) 8.8 (3) 8.5 (4) 8.7 (3.6) 9 (3.6) �0.0001a
LHD with remifentanil infusion 10.9 (4.4) 8.5 (2.2) 9.2 (2.4) 9.6 (2.7) 9.2 (3.4) 9.9 (2.1) NSMean end-tidal CO2 (%)
RHU with remifentanil infusion 5.3 (0.4) 6.0 (0.7) 6.8 (0.9) 6.9 (1.1) 6.8 (1.1) 6.8 (0.9) �0.0001b
LHD with remifentanil infusion 5.5 (0.5) 6.0 (0.6) 7.0 (0.6) 6.9 (0.8) 6.9 (1) 6.5 (1.2) �0.0001b
Mean oxygen saturation (%)RHU with remifentanil infusion 98 (1) 98 (1) 98 (1) 98 (1) 98 (1) 98 (1) NSLHD with remifentanil infusion 98 (1) 99 (2) 98 (1) 98 (1) 98 (1) 98 (1) NS
Values are mean (sd).RHU � right lateral side head-up position; LHD � left lateral side head-down position; NS � not significant.Repeated-measurement analysis of variance was used to evaluate differences over time in the monitored variables.a Significant changes in values between before start and during the infusion, but no detectable changes during the infusion of remifentanil.b Significant increase in end-tidal CO2 during the infusion of remifentanil.
ANESTH ANALG ANESTHETIC PHARMACOLOGY WALLDEN ET AL. 4332004;99:429–34 REMIFENTANIL AND GASTRIC EMPTYING
4. Edin R, Lundberg J, Terenius L, et al. Evidence for vagal en-kephalinergic neural control of the feline pylorus and stomach.Gastroenterology 1980;78:492–7.
5. Horowitz M, Jones K, Edelbroek MA, et al. The effect of postureon gastric emptying and intragastric distribution of oil andaqueous meal components and appetite. Gastroenterology 1993;105:382–90.
6. Burn-Murdoch R, Fisher MA, Hunt JN. Does lying on the rightside increase the rate of gastric emptying? J Physiol 1980;302:395–8.
7. Spiegel TA, Fried H, Hubert CD, et al. Effects of posture ongastric emptying and satiety ratings after a nutritive liquid andsolid meal. Am J Physiol Regul Integr Comp Physiol 2000;279:R684–94.
8. Apfel CC, Roewer N. Risk assessment of postoperative nauseaand vomiting. Int Anesthesiol Clin 2003;41:13–32.
9. Notivol R, Carrio I, Cano L, et al. Gastric emptying of solid andliquid meals in healthy young subjects. Scand J Gastroenterol1984;19:1107–13.
10. Nimmo WS, Heading RC, Wilson J, et al. Inhibition of gastricemptying and drug absorption by narcotic analgesics. Br J ClinPharmacol 1975;2:509–13.
11. Medhus AW, Lofthus CM, Bredesen J, Husebye E. Gastricemptying: the validity of the paracetamol absorption test ad-justed for individual pharmacokinetics. NeurogastroenterolMotil 2001;13:179–85.
12. Read NW, Houghton LA. Physiology of gastric emptying andpathophysiology of gastroparesis. Gastroenterol Clin North Am1989;18:359–73.
13. Anvari M, Horowitz M, Fraser R, et al. Effects of posture ongastric emptying of nonnutrient liquids and antropyloroduode-nal motility. Am J Physiol 1995;268:G868–71.
14. Hammas B, Thorn SE, Wattwil M. Propofol and gastric effects ofmorphine. Acta Anaesthesiol Scand 2001;45:1023–7.
15. Yuan CS, Foss JF, O’Connor M, et al. Effects of low-dose mor-phine on gastric emptying in healthy volunteers. J Clin Phar-macol 1998;38:1017–20.
16. Lydon AM, Cooke T, Duggan F, Shorten GD. Delayed postop-erative gastric emptying following intrathecal morphine andintrathecal bupivacaine. Can J Anaesth 1999;46:544–9.
17. Yuan CS, Foss JF. Gastric effects of methylnaltrexone on mu,kappa, and delta opioid agonists induced brainstem unitaryresponses. Neuropharmacology 1999;38:425–32.
18. Taguchi A, Sharma N, Saleem RM, et al. Selective postoperativeinhibition of gastrointestinal opioid receptors. N Engl J Med2001;345:935–40.
19. Browning KN, Kalyuzhny AE, Travagli RA. Opioid peptidesinhibit excitatory but not inhibitory synaptic transmission in therat dorsal motor nucleus of the vagus. J Neurosci 2002;22:2998–3004.
20. Gue M, Junien JL, Bueno L. Central and peripheral opioidmodulation of gastric relaxation induced by feeding in dogs.J Pharmacol Exp Ther 1989;250:1006–10.
21. Rathmell JP, Pino CA, Taylor R, et al. Intrathecal morphine forpostoperative analgesia: a randomized, controlled, dose-ranging study after hip and knee arthroplasty. Anesth Analg2003;97:1452–7.
22. Currier DS, Levin KR, Campbell C. Dysphagia with intrathecalfentanyl. Anesthesiology 1997;87:1570–1.
23. Bowdle TA, Camporesi EM, Maysick L, et al. A multicenterevaluation of remifentanil for early postoperative analgesia.Anesth Analg 1996;83:1292–7.
434 ANESTHETIC PHARMACOLOGY WALLDEN ET AL. ANESTH ANALGREMIFENTANIL AND GASTRIC EMPTYING 2004;99:429–34
STUDY II
Klunserna Study 05-10-25, 10.12123
STU
DY
II
J Anesth (2006) 20:261–267DOI 10.1007/s00540-006-0436-3
Original articles
The effect of anesthetic technique on early postoperative gastricemptying: comparison of propofol-remifentanil and opioid-freesevoflurane anesthesia
Jakob Walldén1, Sven-Egron Thörn2, Åsa Lövqvist2, Lisbeth Wattwil2, and Magnus Wattwil2
1 Department of Anesthesia, Sundsvall Hospital, 851 86 Sundsvall, Sweden2 Departments of Anesthesia and Intensive Care, Örebro University Hospital, Örebro, Sweden
Introduction
Gastric emptying is an essential part of gastrointestinalmotility, and a postoperative delay may postpone theearly start of oral feeding and alter the bioavailability oforally given drugs [1]. Today a majority of our patientsundergo surgery on an ambulatory basis and an impor-tant part of the care is to have them tolerate oral nutri-tion and per-oral analgesics as soon as possible. A delayin gastric emptying may therefore postpone a patient’sdischarge.
Activation of inhibitory neural pathways by the surgi-cal trauma, a local inflammatory response in the gas-trointestinal tract, and the drugs used perioperativelycontribute to the impairment of gastric motility [2], and,of the drugs used, opioids are thought to constitute themost important factor.
The extent to which anesthetic technique contributesto the early postoperative inhibition of gastric motilityis uncertain. With an inhalation technique withoutopioids, the effect of inhalation agents on gastric motil-ity may cease quickly after discontinuation of the agent[3]. An intravenous technique with an ultra-short-acting opioid, to minimize the negative opioid effect onmotility, combined with propofol, which has antiemeticproperties, and to some degree, antagonizes the opioideffect on gastric motility [4], may favor motility.Both methods are, theoretically, optimal for gastricmotility. However, when these anesthetic techniquesare used in major surgery there may be a needfor opioid analgesics in the early postoperative period,as the residual analgesic properties of the anestheticscease quickly. If one of the techniques proves to havea faster gastric emptying rate, this may have animpact on the choice of anesthesia to optimize gastricmotility.
The aim of this study was to compare the effect onearly gastric emptying between two anesthetic methods,an inhalation opioid-free sevoflurane-based anesthesia
AbstractPurpose. A postoperative decrease in the gastric emptying(GE) rate may delay the early start of oral feeding and alterthe bioavailability of orally administered drugs. The aim ofthis study was to compare the effect on early gastric emptyingbetween two anesthetic techniques.Methods. Fifty patients (age, 19–69 years) undergoingday-case laparascopic cholecystectomy were randomlyassigned to received either total intravenous anesthesia withpropofol/remifentanil/rocuronium (TIVA; n = 25) or inhala-tional opioid-free anesthesia with sevoflurane/rocuronium(mask induction; GAS; n = 25). Postoperative gastric empty-ing was evaluated by the acetaminophen method. Afterarrival in the recovery unit, acetaminophen (paracetamol)1.5g was given through a nasogastric tube, and blood sampleswere drawn during a 2-h period. The area under the serum-acetaminophen concentration curve from 0–60min (AUC60),the maximal concentration (Cmax), and the time to reach C-max (Tmax) were calculated.Results. Twelve patients were excluded due to surgical com-plications (e.g., conversion to open surgery) and difficulty indrawing blood samples (TIVA, n = 7; GAS, n = 5). Gastricemptying parameters were (mean ± SD): TIVA, AUC60,2458 ± 2775 min·μmol·l−1; Cmax, 71 ± 61 μmol·l−1; and Tmax,81 ± 37min; and GAS, AUC60, 2059 ± 2633min·μmol·l−1;Cmax, 53 ± 53 μmol·l−1; and Tmax, 83 ± 41 min. There were nosignificant differences between groups.Conclusion. There was no major difference in early postop-erative gastric emptying between inhalation anesthesia withsevoflurane versus total intravenous anesthesia with propofol-remifentanil. Both groups showed a pattern of delayed gastricemptying, and the variability in gastric emptying was high.Perioperative factors other than anesthetic technique mayhave more influence on gastric emptying.
Key words Gastrointestinal motility · Gastric emptying ·Anesthesia, inhalation · Anesthesia, intravenous · Analgesics,opioid · Cholecystectomy, laparoscopic
Address correspondence to: J. WalldénReceived: March 20, 2006 / Accepted: July 28, 2006
262 J. Walldén et al.: Anesthetic technique and gastric emptying
and an intravenous propofol-remifentanil basedanesthesia.
Patients, materials, and methods
Fifty patients (American Society of Anesthesiologists[ASA] physical status I and II) undergoing day-caselaparoscopic cholecystectomy at Örebro UniversityHospital, Sweden, were included in this study. Thestudy protocol was approved by the Ethics Committeeof the Örebro County Council and by the SwedishMedical Product Agency. The patients entered thestudy after giving verbal and written consent. Patientswere randomly allocated (by the use of sealed envel-opes) to receive either total intravenous anesthesia(TIVA group; n = 25) or total inhalation anesthesia(GAS group; n = 25). An independent nurse preparedall the sealed envelopes from of a computer-generatedtable before the study started. Investigators (J.W.,M.W., S.E.T.) enrolled patients to the study. The envel-opes were opened by the investigators just before theinduction of anesthesia. There was no blinding in thestudy.
Patients were excluded from the study if the proce-dure was converted to open cholecystectomy, or if theduration of surgery exceeded 150 min.
The gastric emptying study was started immediatelyafter the patient’s arrival at the recovery unit. Duringthe first 24 h after surgery, the incidence of postopera-tive nausea and vomiting (PONV) and pain, and theneed for opioid analgesics were evaluated by means ofobservations in the recovery unit, a telephone inter-view, and a questionnaire.
The primary endpoints in the study were the gastricemptying parameters, and we tested the hypothesis thatthere would be a difference in gastric emptying betweenthe study groups.
For the secondary outcome variables (PONV, pain,opioid need) we were aware that the number of patientsmight be too small to detect differences.
The patients fasted for 6 h but were allowed to drinkclear fluids up to 2 h before premedication. All patientsreceived premedication with midazolam 1–2 mg IV atthe day-care unit, 20–30min before the induction ofanesthesia. In the operating room, patients underwentroutine monitoring, including continuous processedelectroencephalography (Bispectral index [BIS]-monitor; Aspect Medical Systems, Newton, MA, USA).Before induction, all patients received ketorolac 30mgIV. In the TIVA group, anesthesia was induced with aninfusion of remifentanil 0.2μg·kg−1·min−1, followed, after2 min, by a target-controlled infusion (TCI) of propofolat 4μg·ml−1 (induction time, 60 s). In the GAS group,anesthesia was induced with 8% sevoflurane via a facial
mask. After an adequate level of anesthesia was at-tained, muscular relaxation was obtained in both groupswith rocuronium 0.6 mg·kg−1 IV, and the trachea wasintubated after 90 s. In the TIVA group, anesthesia wasmaintained with remifentanil 0.2 μg·kg−1·min−1 and TCIpropofol, adjusted (2–4 μg·ml−1) to maintain a BISindex below 50. In the GAS group, anesthesia wasmaintained with sevoflurane, with concentrations ad-justed to maintain a BIS index below 50. No prophylac-tic antiemetics were given. A nasogastric tube wasplaced in all patients during anesthesia. At the end ofsurgery, 20 ml of 0.25% levobupivacaine was infiltratedat the insertion sites of the laparoscopic instruments,muscular relaxation was reversed with neostigmine2.5 mg/glycopyrrolate 0.5mg, and anesthetic agent(s)were terminated. The patients were extubated in theoperating room after return of consciousness and spon-taneous breathing and transferred to the adjacentday-care unit for recovery. Except for the continuousinfusion of remifentanil in the TIVA group, no opioidswere given during anesthesia.
Acetaminophen absorption was used as an indirectmeasure of gastric emptying [5]. Acetaminophen is notabsorbed from the stomach, but is rapidly absorbedfrom the small intestine. Consequently, the rate of gas-tric emptying determines the rate of absorption ofacetaminophen administered into the stomach.Immediately after patients’ arrival at the day-care unit,acetaminophen 1.5 g, dissolved in 200ml of water (atroom temperature), was given through the nasogastrictube. Prior to administration, correct placement of thetube was verified by auscultation over the stomach areaduring the injection of 20ml of air into the tube. Thetube was removed after acetaminophen was given.Blood samples were taken from an intravenous catheterprior to the administration of acetaminophen and then5, 10, and 15min after the administration, and then at15-min intervals during a period of 120min. Serumacetaminophen was determined by an immunologicmethod, including fluorescence polarization (TDx ac-etaminophen; Abbott Laboratories, Chicago, IL, USA).Acetaminophen concentration curves were produced,and the maximal acetaminophen concentration (Cmax),the time taken to reach the maximal concentration(Tmax), and the area under the serum-acetaminophenconcentration time curves from 0 to 60min (AUC60) and0 to 120 min (AUC120) were calculated. Tmax was as-sumed to be 120min if no acetaminophen was detectedin any sample. The acetaminophen method is a well-accepted method for studying the liquid phase of gastricemptying, and the AUC60 correlates well with measuresof gastric emptying performed using isotope techniques[5].
The patients stayed in the day-care unit for at least4 h. During this period, nausea, vomiting, and pain were
STU
DY
II
J. Walldén et al.: Anesthetic technique and gastric emptying 263
evaluated every hour. Nausea and pain were evaluatedwith a visual analogue scale (VAS), and occurrences ofvomiting were recorded. Droperidol 0.5–1mg IV wasgiven on request as the first rescue antiemetic accordingto the routines of the department. If not sufficient,ondansetron 2–4mg IV was given as the second drug.If patients scored more than 3 on the VAS for pain,ketobemidone 1–2mg IV was given. Ketobemidoneis an opioid analgesic with properties similar to thoseof morphine and is widely used in the Scandinaviancountries.
After discharge from the day-care unit, the patientsthemselves completed a questionnaire about PONVand pain during the time period 4–24h postoperatively.The patients scored the maximal pain and maximal nau-sea on a VAS and were questioned as to whether theyhad vomited or not. A nurse or doctor also performed atelephone interview on the first postoperative day,during which patients were questioned about events ofpain, nausea, or vomiting after discharge. Combiningthe observations from the recovery unit, the question-naire, and the telephone interview, we acquired vari-ables regarding the incidence of PONV during 0–2hand 2–24h, the need for antiemetics in the day-care unit,the maximal VAS score for pain during the periods 0–2h and 2–24h, the time to first dose of opioid analgesics,and the total dose of opioids given. These variableswere regarded as secondary outcome variables in thestudy.
Sample size was calculated based on the AUC60 as theprimary outcome variable. A difference of at leastone-third of AUC60 under normal conditions wasconsidered clinically significant. Based on previousstudies [6], we estimated the minimal difference to be2000min·μmol·l−1 and the within-group SD for theAUC60 to be 2000 min·μmol·l−1. For a power of 0.8
and α = 0.05, a sample size of 17 patients in each groupwas calculated to be appropriate. From previous studieswith the acetaminophen method, we had the experiencethat, in some patients, it might be difficult to drawvenous blood samples due to a constricted venous sys-tem. For this reason, we increased the study populationto 25 patients in each group.
To be able to compare our gastric-emptying resultswith a normal gastric-emptying profile (in our contextwithout any influence from anesthesia, surgery, pain,drugs, etc) we used a pooled dataset of controlgastric-emptying measurements from three previousstudies by our group. In the first study [6] the controlswere taken 4–5 weeks after an open cholecystectomy (n= 17; ASA, I–II; mean (±SD) age, 49 ± 15 years; male, n= 4; female, n = 13); in the second study (unpublisheddata), 4 weeks after abdominal surgery (n = 9; ASA,I–II; mean age, 69 ± 10 years; male, n = 7; female, n = 2);and in the third study, the controls were young healthymale volunteers in an experimental setting [7] (n = 10;ASA, I; mean age, 24 ± 3.4 years). In all control mea-surements, 1.5g acetaminophen dissolved in 200ml ofwater was given orally after a period of fasting andblood samples were taken every 15min during 2 h. Thehandling and laboratory analysis of the samples werethe same as in the current study, as described above.The mean serum-acetaminophen concentration curveof the pooled data is presented in Fig. 1, and thegastric emptying parameters were (mean ± SD): AUC60,5988 ± 1713 min·μmol·l−1; Cmax, 145 ± μmol·l−1; and Tmax,29 ± 15min.
The primary outcome variables AUC60, AUC120, Cmax,and Tmax, are presented as means with SDs. The second-ary outcome variables are presented as events, num-bers, or medians with ranges. Unpaired Student’s t-test,Mann-Whitney U-test, or Fisher’s exact test was used
Fig. 1. Mean (+SD) serum (S)-acetaminophen concentrations during thegastric emptying study after propofol-remifentanil total intravenous anesthesia(TIVA) or opioid-free sevoflurane (GAS)anesthesia. As a reference for normal gas-tric emptying, a group of historical con-trols, pooled from control groups in threeprevious studies (see the Methods sectionfor description), is included in the graph
264 J. Walldén et al.: Anesthetic technique and gastric emptying
for statistical analysis, and P < 0.05 was considered sta-tistically significant.
Results
Fifty patients were included in the study from April2002 to January 2003. Five patients (TIVA, n = 4; GAS,n = 1) were excluded due to conversion to open chole-cystectomy or prolonged duration of surgery (>150 min)due to choledochal stones. In 7 patients (TIVA, n = 3;GAS, n = 4) there were difficulties in drawing bloodsamples for the acetaminophen concentration analysis.Hence, a total of 12 patients (TIVA, n = 7; GAS, n = 5)were excluded from the analysis of the primary outcomevariable.
Patient characteristics are presented in Table 1. Sur-gery and anesthesia were uneventful in all patients.There were no differences between the groups in dura-tion of surgery or duration from end of surgery to startof the gastric emptying studies.
Acetaminophen concentration curves are presentedin Fig. 1. There were no differences between the groupsin the primary outcome variables, AUC60, AUC120, Cmax,or Tmax (Table 2). Both groups differed significantly (P <0.01) from the pooled historical control group. Of the 38patients eligible for the primary outcome analysis, only1 patient had no detectable acetaminophen in any of theblood samples (i.e., no gastric emptying at all); seeTable 3.
Table 1. Patient characteristics and time variables before the start of the gastricemptying study
TIVA group GAS group(n = 24) (n = 21) P valuea
Age (years) 45 (29–64) 46 (19–69) NSHeight (cm) 168 (152–189) 169 (158–187) NSWeight (kg) 80 (56–112) 75 (56–100) NSFemales 20 16 NSMales 4 5 NSSmokers 4 4 NSASA Class I 19 17 NSASA Class II 5 4Duration of surgery (min) 74 (25–148) 70 (65–108) NSDuration from end of surgery 8 (2–17) 9 (2–22) NS
to tracheal extubation (min)Duration from end of surgery 19 (10–30) 22 (8–45) NS
to arrival at recovery unit (min)Duration from end of surgery 24 (13–35) 26 (17–45) NS
to start of GE study (min)
Values are given as means with ranges or numbersTIVA, total intravenous anesthesia with remifentanil and propofol; GAS, total inhalationanesthesia with sevoflurane; GE, gastric emptyinga Unpaired Student’s t-test or Fisher’s exact test
Table 2. Mean and SD of AUC60, AUC120, Cmax, and Tmax in the two study groups
TIVA group GAS group 95% CI for the differenceVariable (n = 18) (n = 20) between the means P valuea
AUC60 (min·μmol−1·l−1) 2458 ± 2775 2059 ± 2633 −1390 to 2188 NS (P = 0.65)AUC120 (min·μmol−1·l−1) 5889 ± 5750 4288 ± 4820 −1877 to 5079 NS (P = 0.36)Cmax(μmol·l−1) 71 ± 61 53 ± 55 −20 to 56 NS (P = 0.35)Tmax(min) 81 ± 37 83 ± 41 −28 to 24 NS (P = 0.85)
TIVA, total intravenous anesthesia with remifentanil and propofol; GAS, total inhalation anesthesia with sevoflurane; AUC60, AUC120, areaunder the serum-acetaminophen concentration curve at 0–60min and 0–120 min; Cmax, maximum acetaminophen concentration; Tmax, time takento reach the maximum acetaminophen concentration; CI, confidence interval; NS, not significanta Unpaired Student’s t-test
Table 3. Number of patients without detectable serum aceta-minophen (no gastric emptying at all) at different time periods
TIVA group GAS group(n = 18) (n = 20) P valuea
0–60 Min 3 1 NS0–120 Min 1 0 NS
TIVA, total intravenous anesthesia with remifentanil and propofol;GAS, total inhalation anesthesia with sevoflurane; NS, not significanta Fisher’s exact test
STU
DY
II
J. Walldén et al.: Anesthetic technique and gastric emptying 265
Secondary outcome variables were obtained in 45patients (TIVA, n = 21; GAS, n = 24). The questionnairewas completed by 20 patients (95%) in the TIVA groupand 23 patients (96%) in the GAS group. The telephoneinterview was performed in 20 patients (95%) in theTIVA group and 22 patients (92%) in the GAS group.For the period 2–24h postoperatively, secondary out-come variables could be obtained in all patients.
There were no statistically significant differencesbetween the groups in the incidence of nausea,vomiting, or PONV (Table 4). Twelve (57%) patients inthe TIVA group and 10 (42%) patients in the GASgroup were given rescue antiemetics in the recoveryunit.
There were no differences between the groupsin maximal VAS scores for pain, the need for opioid
analgesics, or the dose of opioid analgesics. The time tothe first administration of opioids in the recovery unitwas significantly longer in the GAS group (Table 5).
Discussion
This study demonstrates that patients anesthetized withan inhalational, opioid-free regimen with sevofluranehad a gastric emptying pattern in the early postopera-tive period (0–2h) similar to that in patients anes-thetized with an intravenous propofol-remifentanilregimen. When our results were compared with the gas-tric emptying pattern seen in a normal state (no anes-thesia and no surgery), gastric emptying could beconsidered to be delayed in both groups.
Table 5. Pain variables
Variable TIVA group GAS group P valuea
n = 21 n = 24Median (range) for the highest VAS score for pain 0–2h 5 (0–9) 4 (0–9) NSMedian (range) for the highest VAS score for pain 2–24h 4 (0–10) 4 (0–7) NSNumber of patients with need for opioid analgesics in recovery unit 17 (81%) 20 (83%) NS
n = 17 n = 20Median (range) total dose of ketobemidone IV (mg) in patients 5.9 (1.5–11) 5.0 (2.0–11) NS
who received opioid analgesicsMedian (range) time from arrival at recovery unit to first dose of 17 (0–45) 44 (0–155) <0.01
ketobemidone (min) in patients who received opioid analgesics
TIVA, total intravenous anesthesia with remifentanil and propofol; GAS, total inhalation anesthesia with sevoflurane; NS, not significant; VAS,100-mm visual analogue scalea Mann-Whitney U-test or Fisher’s exact test
Table 4. Numbers (%) of patients with events of postoperative nausea and/or vomiting(PONV) during the study
TIVA group GAS groupVariable (n = 21) (n = 24) P valuea
Postoperative 0–2hNausea 10 (48%) 15 (62%) NSVomiting 2 (10%) 4 (17%) NSNausea or vomiting 10 (48%) 16 (67%) NS
Postoperative 2–24hNausea 11 (52%) 16 (67%) NSVomiting 5 (24%) 8 (33%) NSNausea or vomiting 12 (57%) 16 (67%) NS
Postoperative 0–24hNausea 15 (71%) 20 (83%) NSVomiting 6 (29%) 8 (33%) NSNausea or vomiting 16 (76%) 20 (83%) NS
TIVA, total intravenous anesthesia with remifentanil and propofol; GAS, total inhalationanesthesia with sevoflurane; NS, not significantEvent of nausea 0–2h, VAS for nausea >10mm at day-care unit; event of nausea 2–24 h, VAS fornausea >10mm at day-care unit or VAS for nausea >10mm on questionnarie, or nausea reportedat telephone interview; VAS, 100-mm visual analogue scalea Fisher’s exact test
266 J. Walldén et al.: Anesthetic technique and gastric emptying
Our study was powered to detect major differences ingastric emptying rate, and the results indicate that theremight be a small difference, with faster gastric emptyingin the total intravenous anesthesia group. However,gastric emptying was greatly delayed in both groups,and we do not consider a potential difference of thissmall magnitude as clinically relevant.
There was great variability in the gastric emptyingrate within the groups. We tested the hypothesis of acorrelation between opioid administration in the earlypostoperative period and gastric emptying rate, but wefound no relation (data not shown). There was both fastand slow emptying among patients who received opioidanalgesics during the gastric emptying study, as well asamong those who did not receive any opioid analgesicsor those who received opioid analgesics after the gastricemptying study was completed. The use of opioid anal-gesics and antiemetics in the recovery period is part ofthe overall perioperative care of the patients and ispartly a consequence of the anesthetic technique. Thesefactors cannot be eliminated and should be consideredas part of the anesthetic technique.
It is always doubtful to include historical data as acontrol. However, we thought it would be valuable torelate the gastric emptying profile seen in the groups inthe present study to a normal gastric emptying profile,which, in our context, means under no influence of anes-thesia, surgery, drugs, pain etc. To create a reference,we pooled data from control situations in three previousstudies performed under different conditions. The gas-tric emptying profiles for these data, both the individualcontrol groups and the pooled group, are similar tothose in other control situations published in the litera-ture [8–10]. We consider our control dataset as an ac-ceptable estimate of a normal gastric emptying profile.It would have been ideal to have control values for eachpatient included in the study, but, unfortunately, thatwas not the study design.
We were aware that the number of patients might betoo small to detect any differences in postoperative nau-sea and vomiting (PONV) [11], and we could not detectany statistically significant differences in PONV be-tween the groups. PONV was not a primary endpoint inthis study, but we considered it valuable to have thePONV recordings. There was a tendency in our studytoward a higher incidence of PONV in the GAS group,and it has been reported that volatile agents may bea main cause of vomiting in the early postoperativeperiod [12]. To draw any conclusions about differencesin PONV between the anesthetic techniques, a largernumber of patients must be studied.
The incidence of PONV was high in both groups. Themajority of patients were non-smoking women, andopioids were given as analgesics in the recovery unit. IfApfel’s simplified risk score [13] were to be applied, the
predicted incidence of PONV would be high in patientswith these characteristics. As there are no data on howantiemetics affect gastric emptying, no prophylacticantiemetics were given.
There is probably no direct relation between gastricemptying and PONV. We have previously shown thatthe perioperative gastric emptying rate is not a predic-tor for PONV [14], and gastric decompression duringanesthesia does not reduce the incidence of PONV [15].
There was a shorter time to the first dose of post-operative opioid analgesics in the group receiving theintravenous anesthesia. This may be explained either bya residual effect of the inhalation agent [16] or by hype-ralgesia caused by remifentanil [17].
Previous studies comparing the effects on gastrointes-tinal motility exerted by different general anesthetictechniques in the clinical situation are limited, and thesehave not shown any differences between different tech-niques [9,18,19]. The results from our study are in accor-dance with these study results, as we found no majordifferences between the groups. Nothing can beconcluded as to what extent the anesthetics used areinvolved in the postoperative impairment of gas-trointestinal motility. Other factors, such as the surgicaltrauma or individual sensitivity to the drugs used maybe more important.
There are several experimental studies addressing theeffects of anesthetic drugs on gastrointestinal motility.The inhibitory effect of opioids on gastrointestinalmotility has been studied extensively. This effect ismainly mediated via opioid receptors, but the mecha-nism and understanding are complex and still uncertain[20]. Opioids inhibit motility even at low doses [21], andthe mechanism is both peripherially and centrally medi-ated [22]. Propofol at low doses does not influence gas-tric motility [23], but there is evidence that propofolmay inhibit motility at higher doses. In a laboratorysetting, propofol inhibited spontaneous contractions inhuman gastric tissue [24]. There are only a few studieson volatile agents and gastrointestinal motility. Volatileanesthetics have inhibitory effects on gastric motility,but the effect may cease quickly after termination of theagents [3, 25].
The anesthetic techniques used in this study, oneopioid-free and one with an ultra-short-acting opioid,would, theoretically, be ideal for optimizing gastricemptying. However, the majority of patients haddelayed gastric emptying with both of these methods.This indicates that it may be difficult to further improveearly gastric emptying by further altering the methodsof general anesthesia. We cannot exclude the possibilitythat all general anesthetic methods have inhibitory ef-fects on early postoperative gastric emptying. Otherperioperative factors may also have main impacts onearly gastric emptying, and it is difficult to distinguish
STU
DY
II
J. Walldén et al.: Anesthetic technique and gastric emptying 267
between all the factors involved. However, intra-operative and postoperative intravenous fluid restric-tion promotes the return of gastrointestinal motility andreduces complications after abdominal surgery [26].Minimizing the surgical trauma during the laparoscopicprocedure reduces pain and nausea [27].
The weakness in our study is that the variability ofgastric emptying was higher than expected, whichresulted in loss of power. However, we believe that ourstudy indicates that, even after optimizing the anes-thetic regimen, gastric emptying is delayed for themajority of patients. In both groups there were severalpatients with fast gastric emptying and there may alsohave been a small difference between the groups thatwas not detected in our study. The high variability mayhave been due to factors other than the anestheticsused, and must be addressed in future studies.
In summary, there were no major differences in earlypostoperative gastric emptying between opioid-freesevoflurane anesthesia and intravenous propofol-remifentanil anesthesia. The variability was high in bothgroups, and perioperative factors other than the anes-thetics used may have greater influence on early postop-erative gastric emptying.
Acknowledgments. This study was supported by grants fromÖrebro County Council, Örebro, and Emil Andersson’s Fundfor Medical Research, Sundsvall.
References
1. Watcha MF, White PF (1992) Postoperative nausea and vomiting.Its etiology, treatment, and prevention. Anesthesiology 77:162–184
2. Bauer AJ, Boeckxstaens GE (2004) Mechanisms of postoperativeileus. Neurogastroenterol Motil 16 (Suppl 2):54–60
3. Schurizek BA (1991) The effects of general anaesthesia onantroduodenal motility, gastric pH and gastric emptying in man.Dan Med Bull 38:347–365
4. Hammas B, Thorn SE, Wattwil M (2001) Propofol and gastriceffects of morphine. Acta Anaesthesiol Scand 45:1023–1027
5. Nimmo WS, Heading RC, Wilson J, Tothill P, Prescott LF (1975)Inhibition of gastric emptying and drug absorption by narcoticanalgesics. Br J Clin Pharmacol 2:509–513
6. Thorn SE, Wattwil M, Naslund I (1992) Postoperative epiduralmorphine, but not epidural bupivacaine, delays gastric emptyingon the first day after cholecystectomy. Reg Anesth 17:91–94
7. Wallden J, Thorn SE, Wattwil M (2004) The delay of gastricemptying induced by remifentanil is not influenced by posture.Anesth Analg 99:429–434
8. Nimmo WS, Littlewood DG, Scott DB, Prescott LF (1978) Gas-tric emptying following hysterectomy with extradural analgesia.Br J Anaesth 50:559–561
9. Mushambi MC, Rowbotham DJ, Bailey SM (1992) Gastric emp-tying after minor gynaecological surgery. The effect of anaesthetictechnique. Anaesthesia 47:297–299
10. Kennedy JM, van Rij AM (2006) Drug absorption from the smallintestine in immediate postoperative patients. Br J Anaesth97:171–180
11. Apfel CC, Roewer N, Korttila K (2002) How to study post-operative nausea and vomiting. Acta Anaesthesiol Scand 46:921–928
12. Apfel CC, Kranke P, Katz MH, Goepfert C, Papenfuss T, RauchS, Heineck R, Greim CA, Roewer N (2002) Volatile anaestheticsmay be the main cause of early but not delayed postoperativevomiting: a randomized controlled trial of factorial design. Br JAnaesth 88:659–668
13. Apfel CC, Laara E, Koivuranta M, Greim CA, Roewer N (1999)A simplified risk score for predicting postoperative nausea andvomiting: conclusions from cross-validations between two cen-ters. Anesthesiology 91:693–700
14. Wattwil M, Thorn SE, Lovqvist A, Wattwil L, Klockhoff H,Larsson LG, Naslund I (2002) Perioperative gastric emptying isnot a predictor of early postoperative nausea and vomiting inpatients undergoing laparoscopic cholecystectomy. Anesth Analg95:476–479
15. Burlacu CL, Healy D, Buggy DJ, Twomey C, Veerasingam D,Tierney A, Moriarty DC (2005) Continuous gastric decompres-sion for postoperative nausea and vomiting after coronaryrevascularization surgery. Anesth Analg 100:321–326
16. Matute E, Rivera-Arconada I, Lopez-Garcia JA (2004) Effects ofpropofol and sevoflurane on the excitability of rat spinalmotoneurones and nociceptive reflexes in vitro. Br J Anaesth93:422–427
17. Hood DD, Curry R, Eisenach JC (2003) Intravenous remifentanilproduces withdrawal hyperalgesia in volunteers with capsaicin-induced hyperalgesia. Anesth Analg 97:810–815
18. Freye E, Sundermann S, Wilder-Smith OH (1998) No inhibitionof gastro-intestinal propulsion after propofol- or propofol/ketamine-N2O/O2 anaesthesia. A comparison of gastro-caecaltransit after isoflurane anaesthesia. Acta Anaesthesiol Scand 42:664–669
19. Jensen AG, Kalman SH, Nystrom PO, Eintrei C (1992) Anaes-thetic technique does not influence postoperative bowel function:a comparison of propofol, nitrous oxide and isoflurane. Can JAnaesth 39:938–943
20. Hicks GA, DeHaven-Hudkins DL, Camilleri M (2004) Opiates inthe control of gastrointestinal tract function: current knowledgeand new avenues for research. Neurogastroenterol Motil 16(Suppl 2):67–70
21. Yuan CS, Foss JF, O’Connor M, Roizen MF, Moss J (1998)Effects of low-dose morphine on gastric emptying in healthy vol-unteers. J Clin Pharmacol 38:1017–1020
22. Thorn SE, Wattwil M, Lindberg G, Sawe J (1996) Systemic andcentral effects of morphine on gastroduodenal motility. ActaAnaesthesiol Scand 40:177–186
23. Hammas B, Hvarfner A, Thorn SE, Wattwil M (1998) Propofolsedation and gastric emptying in volunteers. Acta AnaesthesiolScand 42:102–105
24. Lee TL, Ang SB, Dambisya YM, Adaikan GP, Lau LC (1999)The effect of propofol on human gastric and colonic muscle con-tractions. Anesth Analg 89:1246–1249
25. Marshall FN, Pittinger CB, Long JP (1961) Effects of halothaneon gastrointestinal motility. Anesthesiology 22 363–366
26. Brandstrup B, Tonnesen H, Beier-Holgersen R, Hjortso E,Ording H, Lindorff-Larsen K, Rasmussen MS, Lanng C, Wallin L,Iversen LH, Gramkow CS, Okholm M, Blemmer T, Svendsen PE,Rottensten HH, Thage B, Riis J, Jeppesen IS, Teilum D,Christensen AM, Graungaard B, Pott F (2003) Effects of intrave-nous fluid restriction on postoperative complications: comparisonof two perioperative fluid regimens: a randomized assessor-blinded multicenter trial. Ann Surg 238:641–648
27. Cengiz Y, Janes A, Grehn A, Israelsson LA (2005) Randomizedtrial of traditional dissection with electrocautery versus ultrasonicfundus-first dissection in patients undergoing laparoscopic chole-cystectomy. Br J Surg 92:810–813
STUDY III
Klunserna Study 05-10-25, 10.13135
STU
DY
III
Effects of Remifentanil on Gastric Tone Jakob Walldén, MD * †; Sven-Egron Thörn, MD,PhD §†; Greger Lindberg, MD,
PhD ‡; Magnus Wattwil, MD, PhD §†
* Department of Anesthesia, Sundsvall Hospital, Sundsvall; † School of Health and Medical Sciences, Örebro University, Örebro ‡ Karolinska Institutet, Department of
Medicine, Karolinska University Hospital Huddinge; Huddinge § Department of Anes-thesia and Intensive Care, Örebro University Hospital, Örebro;
SWEDEN
Objectives: Opioids are well known for impairing gastric motility. The mechanism is far from clear and there is wide interindividual variability. The purpose of this study was to evaluate the effect of remifentanil on proximal gastric tone. Materials and Methods: Healthy volunteers were studied on two occasions and proximal gastric tone was measured by a gastric barostat. On the first occasion (n=8) glucagon 1 mg IV was given as a reference for a maximal relaxation of the stomach. On the second occasion (n=9) remifentanil was given in incremental doses (0.1, 0.2 and 0.3 μg•kg-
1•min-1) for 15 min each, followed by a washout period of 30 minutes. Thereafter re-mifentanil was readministered, and 10 minutes later glucagon 1 mg was given. Mean in-tragastric bag volumes were calculated for each 5-minute interval. Analyses of single nu-cleotide polymorphisms (SNP) A118G and G691C in the μ-opioid receptor (MOR) gene were done in all subjects. Results: Glucagon decreased gastric tone in all subjects. Remifentanil had a marked effect on gastric tone; we found two distinct patterns of reactions with both increases and de-creases in gastric tone, and during the remifentanil infusion glucagon did not affect gas-tric tone. We found no association between SNPs A118G and G691C and the two pat-terns of gastric tone reactions to remifentanil. Conclusions: Remifentanil induced changes in gastric tone with both increases and de-creases in tone. As a preliminary observation, the variation between individuals could not be explained by SNPs in the MOR gene. Keywords: Gastrointestinal motility; Gastric tone; Analgesics, Opioid; Polymorphism, Single Nucleotide; Receptors, Opioid, mu/*genetics; Genotype This study was supported by grants from FoU-centrum, Sundsvall, Emil Andersson’s Fund for Medical Research, Sundsvall and Örebro County Council Research Committee. The manuscript is submitted.
2 Jakob Wallden
Introduction Preoperative fasting, bioavailability of drugs given orally (i.e. premedication), gastric re-tention with the associated risk of aspiration, and the postoperative start of oral intake are examples of issues that are highly dependent on gastric motility. Gastric motility is often impaired during and after surgery/anesthesia as a result of many contributing fac-tors. Opioids, given as part of the anesthesia and the postoperative analgesic regimes, play a major role in this impairment. Gastric emptying, the functional goal of gastric motility, is determined by an integrative motor activity in the stomach. The proximal part of the stomach acts as a reservoir and exhibits a constant dynamic tone that adapts to the volume load. The distal part of the stomach exhibits a distinct peristaltic activity and acts both as a pump towards the duo-denum and a grinding mill. Gastric tone can be expressed as the length of the muscle fibers in the proximal stomach. The tone is not equivalent to pressure. As there is an adaptive relaxant reflex, a volume load can maintain the intragastric pressure. Therefore, an almost empty stomach and a full stomach are able to have the same intragastric pressure, but different tone. The gas-tric barostat, which maintain a constant pressure in an air-filled intragastric bag, meas-ures gastric tone as isobaric volume variations (1). Opioids are well known for impairing gastric motility and emptying (2-4). However, knowledge about the effects of opioids on proximal gastric tone is limited and results from published research are divergent (5, 6). There is also little knowledge about how the highly potent μ-opioid receptor agonist remifentanil affects gastric motility. The primary aim of this study was to evaluate the effect of the μ-opioid receptor agonist remifentanil on proximal gastric tone during fasting conditions. The study was per-formed in healthy volunteers and the gastric barostat was used to measure gastric tone. There are substantial inter-individual differences in the general response to opioids (7), and recent studies have suggested that polymorphism of the μ-opioid receptor (MOR) gene, with an altering of the receptor-function, may be a cause of the variation (8-10). Since we found large variations in gastric tone in response to remifentanil in this study, we also investigated if the variation was correlated to the presence of two different poly-morphisms in the μ-opioid receptor gene.
Methods Following approval of the study protocol by the Ethics Committee of the Örebro County Council, 10 healthy male volunteers with a mean age of 24 years (range, 19-31 years), a mean weight of 75 kg (range, 60-84 kg) and a mean height of 182 cm (range, 171-185 cm) were recruited to the study. The subjects gave their informed consent to participate after receiving verbal and written information. Only men were recruited, since the men-strual cycle may alter gastric motility (11). None of them were taking any medications and there was no history of gastrointestinal disturbances. Each subject underwent two study protocols on two separate days. In the first study, the effect of glucagon on gastric tone was measured. Glucagon is a potent inhibitor of gas-trointestinal motility and induces a powerful relaxation of the stomach, resulting in an increase in gastric volume (12). The objectives were to study the effect of glucagon in or-der to obtain an estimate of maximal stomach relaxation and to test the performance of the gastric barostat system.
STU
DY
IIIRemifentanil and Gastric Tone 3
In the second study, gastric tone was measured during and after a remifentanil infusion and, after a washout time of 30 minutes, also during readministration of remifentanil in combination with glucagon. Remifentanil is an ultra-short-acting opioid (μ-opioid recep-tor agonist) with a predictable and constant effect. Measurement of gastric tone Gastric tone was measured by an electronic barostat (SVS®; Synetics AB, Stockholm, Sweden). The gastric barostat is an instrument with an electronic control system that maintains a constant preset pressure within an air-filled flaccid intragastric bag by mo-mentary changes in the volume of air in the bag. When the stomach contracts, the baro-stat aspirates air to maintain the constant pressure within the bag, and when the stomach relaxes, air is injected. The pressure in the bag was set at 2 mmHg above the basal intra-gastric pressure. The pressure change at which respiration is perceived on the pressure tracing- without an increase or decrease in the average volume- is the basal intragastric pressure. The bag, made of ultrathin polyethylene, has a capacity of 900 ml and is con-nected to the barostat by a double-lumen 16 Ch gastric tube. The barostat measurements were performed following the recommendations presented in a review article by an inter-national working team, and the barostat instrument fulfilled the criteria determined by this group (13). Procedure The subjects fasted for at least six hours before each study. An IV line was established in one arm and an IV-infusion of 5% buffered glucose 100ml/hour was given. Before the gastric intubation the subjects received a bolus dose of propofol (0.3 mg/kg IV). Previous studies in volunteers have shown that this dose of propofol, which was given at least 30 min before the study started, does not influence gastric tone (6). The intragastric bag was folded carefully around the gastric tube and positioned in the gastric fundus via oral in-tubation. Thereafter, the gastric bag was unfolded by being slowly inflated with 300 ml of air under controlled pressure (<20mmHg), and the correct position of the bag was verified by traction of the gastric tube. The gastric bag was completely deflated and thereafter inflated with air to a pressure 2 mmHg above the intragastric pressure. During the study the participants were lying down, positioned on their right side, and were asked to relax comfortably. Volume and pressure in the gastric bag were continuously recorded by the electronic barostat and sampled in the computer. The mean gastric bag volume during each 5-min interval was calculated. Glucagon study After 10 min of stable basal gastric tone recording the subjects were given an intravenous bolus dose of 1 mg glucagon. Mean gastric volumes before the injection, and during the time intervals 0 – 5 min, 5 –10 min, and 10-15 min after the injection, were calculated. For a schematic illustration of the study protocol, see Figure 1. Remifentanil Study After 10 minutes of stable basal gastric tone recordings, a continuous intravenous infu-sion of remifentanil was started. The initial dose was 0.1 μg•kg-1•min-1, after 15 minutes the dose was increased to 0.2 μg•kg-1•min-1, and after a further 15 minutes the dose was increased to 0.3 μg•kg-1•min-1. The infusion was discontinued after 45 minutes, follow-ing which there was a washout period of 30 minutes. Thereafter, remifentanil was read-ministered in a dose of 0.3 μg·kg-1·min-1, and 10 minutes later glucagon 1 mg was given intravenously and the remifentanil infusion was continued for a further 10 minutes. For a schematic illustration of the study protocol, see Figure 1.
4 Jakob Wallden
Figure 1 (opposite page) Schematic illustration of the study design
Monitoring and safety During both studies, the usual monitors were used. Heart rate, blood pressure, oxygen saturation, end-tidal carbon-dioxide (CO2), respiratory rate and sedation level were re-corded every fifth minute. At the same intervals, the subjects were asked if they were ex-periencing nausea or any other symptoms. The sedation level was recorded as follows: No sedation = 1, Light sedation =2, Moderate sedation = 3 and Deep sedation = 4. A vis-ual analog scale (VAS) ranging from 0-10 was used for nausea, where VAS 0 was no sub-jective symptoms and VAS 10 was the worst nausea the subjects could imagine. Blood glucose was followed during both studies. In the glucagon study, blood glucose was measured just before and 15 min after the administration of glucagon. In the remifentanil study, blood glucose was measured during the baseline period and just before and 15 minutes after the administration of glucagon. If the subject showed signs of excessive sedation, respiratory depression, severe nausea or vomiting, or showed signs of other severe symptoms related to the infusion of remifen-tanil, the dose was reduced or discontinued. Genetic analyses Due to the large inter-individual variations in the gastric tone response after remifentanil, we investigated if this variation could be explained by genetic variability, polymor-phisms, in the μ-opioid receptor gene. After reviewing the literature, we decided to ana-lyze polymorphisms with relative high frequencies and with reports of altered responses. Therefore, we focused on the μ-opioid receptor gene polymorphisms A118G and G691C (14). As ethnicity has impact on genetic expressions, we reviewed patient data and found that all of the subjects were Caucasians. DNA collection and purification. Venous blood (10 ml) was collected from the subjects in EDTA tubes and the samples were stored frozen at –70°C. Genomic DNA was puri-fied from peripheral leukocytes in 1 ml of EDTA blood on a MagNA Pure LC DNA ex-tractor, using the MagNA Pure LC Total Nucleic Acid Isolation Kit – Large Volume (Roche Diagnostics Corporation, Indianapolis, IN, USA). Genotyping. Genotyping was performed at CyberGene AB, Huddinge, Sweden. The A118G SNP in Exon 1 and the IVS2 G691C SNP in Intron 2 were genotyped using po-lymerase chain reaction amplification and sequencing. Oligonucleotide primers (forward: 5'-GCGCTTGGAACCCGAAAAGTC; reverse: 5'-CATTGAGCCTTGGGAGTT) and (forward: 5'-CTAGCTCATGTTGAGAGGTTC; reverse: 5'-CCAGTACCAGGTTGGATGAG) were used for amplifying gene fragments contain-ing Exon 1 and Intron 2, respectively. PCR conditions comprised an initial denaturing step at 95°C for 1 min followed by 30 cycles at 94°C for 1 min, annealing at 47.2-53.4°C (depending on primer) for 1 min and extension at 68°C for 3 min, and a final extension at 68°C for 3 min. The amplified fragments were sequenced using the same primers with the addition of Rev 1-2 5'-TTAAGCCGCTGAACCCTCCG and the BigDye Terminator v1.1Cycle Sequence Kit (Applied Biosystems, Foster City, CA, USA). PCR amplification and sequence reactions were done on ABI GeneAmp 2400 and 9700 (Applied Biosys-tems). Sequence analysis was first done on MegaBACE 1000 (Amersham Biosciences) and then confirmed with ABI 377XL (Applied Biosystems).
0 min
15 min
Glucagon 1 m
gP
ropofol0.3 m
g ·kg-1
-10 min
-40--80 min
Measurem
entof Gastric
Tone
0 min
75 min
15 min
45 min
30 min
85 min
95 min
Start R
emifentanil
Stop R
emifentanil
Glucagon 1 m
gS
top Rem
ifentanil
Start R
emifentanil
Propofol
0.3 mg ·kg-1
-10 min
-40--80 min
Measurem
entof Gastric
Tone
Glucagon Study
Rem
ifentanil Study
0.1μg·kg-1·m
in-1
0.2 μg·kg-1·m
in-1
0.3 μg·kg-1·m
in-1
0.3 μg·kg-1·m
in-1
Rem
ifentanil
Glucagon
Glucagon
STU
DY
III
6 Jakob Wallden
Statistics The results are presented as means with standard deviations and medians with ranges. Repeated measures ANOVA was used for evaluating overall differences between the study situations. If the statistical analysis showed differences, Fisher’s PLSD was used for comparisons between the situations. For the analysis, the remifentanil study was split into two parts. The Chi-square test was used for analysis of the genetic variations. The significance level was set at 5% in all tests.
Results Eight subjects completed the glucagon study and nine subjects completed the remifentanil study. One subject (no. 8) did not tolerate the gastric tube during the glucagon study and terminated participation in both study protocols. One subject refused to participate in the glucagon study after completing the remifentanil study. Glucagon study Glucagon induced a significant decrease in gastric tone (increase in volume) in all sub-jects (n=8) (Table 1 and Fig. 2). There was a temporary increase in heart rate after the injection of glucagon (Before: 70 (6.1) min-1; 0-5 min: 87 (8.7) min-1; p<0.001), other vital variables were normal and sta-ble. Blood glucose increased after glucagon (Before: 5.4 (1.4) mmol L-1; After: 11.1 (2.2) mmol L-1; p<0.001). 5 subjects experienced nausea (VAS 4 (2-8)) after receiving gluca-gon. Table 1 Gastric tone in healthy volunteers (n=8) studied with a barostat. Intragastric bag volumes (ml) after intravenous glucagon 1 mg. Mean (SD) ml ANOVA Median (range) ml Before Glucagon -10 to -5 minutes 138 (16) 168 (65-224) -5 to 0 minutes 156 (20) 158 (68-192) After Glucagon 1mg P <0.0001 0 to 5 minutes 362 (40)* 329 (230-454) 5 to 10 minutes 456 (47)* 410 (299-701) 10 to 15 minutes 448 (50)* 387 (330-714)
Change over time evaluated with repeated measures ANOVA. Pairwise comparison between the periods with Fisher’s PLSD. * = Significant difference (p<0.05) compared to “Before Glucagon -5 to 0 min” Figure 2 (opposite page) Gastric tone measured with a gastric barostat. The curves represent individual intragastric bag volumes during the studies. In the first part, glucagon 1 mg was given as an intravenous bolus in-jection. In the second part, remifentanil was given at the doses of 0.1, 0.2 and 0.3 μg•kg-1•min-1
STU
DY
III
Figure 2
0
200
400
600
800
1000
Baseline 0 - 5 min
5 - 10 min
Glucagon 0 - 5 min
5 - 10 min
10 - 15 min
Baseline 0 - 5 min
5 - 10 min
Remi 0.1 0 - 5 min
5 - 10 min
10 - 15 min
Remi 0.2 0 - 5 min
5 - 10 min
10 - 15 min
Remi 0.3 0 - 5 min
5 - 10 min
10 - 15 min
Washout 0 - 5 min
5 - 10 min
10 - 15 min
15 - 20 min
20 - 25 min
25 - 30 min
Remi 0.3 0 - 5 min
5 - 10 min
Glucagon 0 - 5 min
5 - 10 min
Washout 0 - 5 min
5 - 10 min
Time
Intragastric Bag Volume (ml)S
ubj 1
Subj 2
Subj 3
Subj 4
Subj 5
Subj 6
Subj 7
Subj 8
Subj 10
Glucagon S
tudyn=8
Rem
ifentanil Study
n=9
8 Jakob Wallden
Remifentanil study There were variable responses in gastric tone during the initial 45-minute infusion of re-mifentanil and the subsequent washout period of 30 minutes (Table 2 and Fig. 2). Four subjects (no. 1, 2, 3, 7) responded to remifentanil with a marked increase in gastric tone (decreased volume) that decreased during washout. Four subjects (no. 4, 6, 8, 10) re-sponded to remifentanil with a marked decrease in gastric tone (increased volume) and maintained a low gastric tone during the washout period. In one subject (no. 5) gastric tone was almost unaffected. The mean gastric tone was significantly lower during the washout period than before starting the infusion. Table 2 Gastric tone in healthy volunteers (n=9) studied with a gastric barostat. Intragastric bag volumes (ml) during infusion of remifentanil and in combination with intravenous glucagon 1 mg. Intragastric bag volumes (ml) Mean (SD) ml Median (range) Interval Period for volume Repeated Measure
during the study measurement ANOVA
Before Remifentanil 117 (44) 107 (62-192) -10 to 0 min -5 to 0 min During Remifentanil 0 to 45 min 0.1 μg•kg-1•min-1 156 (170) 114(1 - 473) 0 to 15 min 10 to 15 min 0.2 μg•kg-1•min-1 219 (240) 70 (1-542) 15 to 30 min 25 to 30 min P=0.0012 0.3 μg•kg-1•min-1 250 (291) 59 (0-722) 30 to 45 min 40 to 45 min Washout period 1 320 (276)* 304 (25–785) 45 to 75 min 55 to 60 min 394 (237)* 379 (90 – 820) 70 to 75 min Readmin Remifentanil 0.3 μg•kg-1•min-1 342 (314) 367 (0-856) 75 to 95 min 80 to 85min P=0.6 + Glucagon 1 mg 308 (316) 339 (0-879) at 85 min 90 to 95 min Washout period 2 347 (310) 242 (1-839) 95 to 105 min 100 to 105 min Change over time evaluated with repeated measures ANOVA. Pairwise comparison between the periods with Fisher’s PLSD. * = Significant difference (p<0.05) compared to “Before Remifentanil”.
During the initial remifentanil infusion there were significant decreases in heart rate (Be-fore: 67 (4.9 min-1; Minimum during Remi 0.1: 61 (4.6) min-1; p<0.001) and respiratory rate (Before: 12 (1.8) min-1; Minimum during Remi 0.2: 8 (2.3) min-1; p<0.001) and sig-nificant increases in end-tidal CO2 (Before: 5.4 (0.3) %; Maximum during Remi 0.3: 7.4 (1.3) %; p<0.001) and sedation level (Before: 1 (0); Maximum during Remi 0.3: 2 (0.7); p<0.05). The administration of glucagon at the end of the study induced a significant in-crease in systolic blood pressure (Before: 122 (9) mmHg; After: 137 (22) mmHg; p<0.001), heart rate (Before: 61 (4.1) min-1; After: 85 (22) min-1; p<0.001) and blood glucose (Before: 6.2 (1.1) mmol L-1; After: 10.3 (1.1) mmol L-1; p<0.001). One subject (no. 3) became too sedated during the highest dose of remifentanil and thin-fusion was discontinued. During readministration this subject received remifentanil 0.2 μg kg-1min-1.
STU
DY
IIIRemifentanil and Gastric Tone 9
Subjects experienced pruritus (n=7), nausea (n=3, VAS 1 (1-3)), headache (n=3) and diffi-culties swallowing (n=2) during the remifentanil infusion. After glucagon, the incidence of nausea increased (n=6; VAS 4.5 (2-7)). During the readministration of remifentanil there were increases in gastric tone among subjects with increased tone during the previous remifentanil infusion. The subject with unaffected tone during the previous infusion had an increase in gastric tone. The subjects who maintained a low gastric tone during washout continued to maintain a low gastric tone. Only one subject (no. 5) responded with a decrease in gastric tone after the injection of glucagon during the readministration of remifentanil. Genotype study Blood samples for genetic analysis were obtained from all 9 subjects in the study. We found no correlation between the gastric response to remifentanil and the polymorphisms A118G and G691C (Table 3). Table 3 Gastric tone response to remifentanil and correlation to genotype groups (n=9). 118 A>G genotype IVS2 + 691 G>C genotype Wild Type Hetero Variant Wild Type Hetero- Variant zygous zygous (AA) (AG) (GG) (GG) (GC) (CC) n=7 n=2 n=0 n=5 n=2 n=1 78% 22% 0 % 56% 22% 11% Increased tone (n=4) 4 3 1 Unchanged tone (n=1) 1 1 Decreased tone (n=4) 3 1 1 2 1 No association found between gastric tone response to remifentanil and presence of polymorphism A118G [Wild Type vs (Heterozygous OR Variant)] ; Chi-square test, P=0.097 No association found between gastric tone response to remifentanil and presence of polymorphism in G691C [Wild Type vs (Heterozygous OR Variant)]; Chi-square test , P =0.23
Discussion The major finding in this study is the marked effect of remifentanil on gastric tone. We found two distinctly different patterns of reactions, with about half of the subjects in-creasing in gastric tone (decreased volume) and about half of the subjects decreasing in gastric tone (increased volume). Due to this variability, we were not able to statistically prove a response during remifentanil. However, the gastric tone was significantly lower (higher volume) after the infusion of remifentanil compared to the baseline period. We believe these are important findings, as they show that opioid effects on human gastric motility are variable and complex. As expected, we found that glucagon decreased gastric tone in all subjects. In addition, we evaluated if the variable response in gastric tone to remifentanil could be explained by the single nucleotide polymorphisms A118G and G691C in the μ-opioid receptor gene, but we found no association.
10 Jakob Wallden
We have tried to explain the variability in gastric tone during the remifentanil infusion. We do not believe this is due to a methodological problem with the gastric barostat. Dur-ing the glucagon part of the study all subjects responded with a clear decrease in tone (increased volume). This validates that the gastric barostat was working properly, as an expected relaxant stimulus, glucagon, decreased tone in all subjects. Also, the same baro-stat equipment and setup have been used in previous studies by our group (6, 15) and we have not observed this kind of variation. There are several limitations in our study. There was no control group, and we cannot completely rule out that there was a time effect involved for the change in gastric tone. However, there was a stable baseline level in gastric tone before remifentanil and the dis-tinct changes in gastric tone after start of the infusion, as well as the changes after dis-continuation, are in agreement with the timing of the pharmacodynamic properties of remifentanil (16). This provides us with evidence that the effects are mediated by re-mifentanil. The number of subjects in this study was small. We expected a similar response to re-mifentanil in all subjects, but instead there were two kinds of divergent responses. As this is the first study to describe this dual effect, we consider our observations as important despite the lack of statistical power. Future studies may evaluate the quantitative relation between the responses, and the mechanisms behind them, in a larger group of subjects. Basic knowledge about the regulation of gastric tone is needed to explain the effects of opioids. Proximal gastric tone is an important part of gastric motility and is mainly con-trolled by the autonomous nerve system. Vagal cholinergic nerves mediate excitation (contraction) while vagal non-cholinergic non-adrenergic (NANC) nerves mediate inhibi-tion (relaxation) (17). Recent studies have identified nitrous oxide as one of the main transmitters in the NANC pathway. In humans, the NANC pathway is believed to be silent during fasting conditions and to be activated by the adaptive reflex (18). In addi-tion, there are sympathetic adrenerigic spinal nerves that inhibit motility mainly through cholinergic inhibition (19). Several animal studies have tried to identify targets for the opioid induced inhibition of gastric motility. It is widely believed that μ-opioid receptor (MOR) agonists inhibit the release of Ach in the stomach (20), and there is also evidence that MOR agonists reduce the relaxation induced by the NANC pathway (21). Opioids might also have a direct ex-citatory effect on gastric smooth muscles (22). Hence, depending on the current state of autonomous and enteric nerve systems and the main effect site, opioids have the potential to both relax and contract the stomach. Opioids also act in the central nervous system (CNS). There is evidence that MORs are present on and inhibit excitatory neurons projecting to gastrointestinal motor neurons in the dorsal motor complex (DMV) of the medulla (23). In this way activation of central MORs inhibits the excitatory vagal output, leading to inhibition of intestinal transit and induction of gastric relaxation in animal models. In humans, there is evidence that opioids inhibit gastric motility through a central mechanism (24). There are diverging results in the literature regarding the effects of opioids on gastric tone in humans. Penagini found that morphine increased gastric tone (5) while Hammas reported a decrease in gastric tone (6). Both studies used the same dose of intravenous morphine (0.1 mg/kg) and both used a gastric barostat. However, there were important differences between the studies. In the first study, baseline gastric tone was set to resem-ble a gastric load of a meal and in the second study, baseline was set to fasting condi-tions. The stomach wall was probably more distended (higher volumes in intragastric
STU
DY
IIIRemifentanil and Gastric Tone 11
bag) before morphine in Penagani’s study compared to Hammas’ study, resulting in an activated adaptive reflex. This leads to completely different baseline conditions. In Penagini’s subjects there were probably low cholinergic and high NANC vagal inputs to the stomach and the reverse baseline conditions were probably present in Hammas’ sub-jects. This might explain why a MOR antagonist contracted the stomach (through NANC inhibition) in one study and relaxed the stomach (through cholinergic inhibition) in the other study. An interesting finding in Hammas’ study was that the concurrent administration of pro-pofol altered the effect of morphine on gastric tone. Propofol per se had no effect on gas-tric tone, but after the subsequent administration of morphine, gastric tone increased (volume decreased), contrary to the response of morphine alone. We cannot explain the mechanism behind this modulation, but there is evidence for central interactions and modulations between GABAergic and opioid pathways (25). Other types of modulations of gastric tone have also been described; in animals with an intact vagus nerve, noradrenaline relaxed the proximal stomach while vagotomy reversed this response (17). Can we explain the variable responses seen in our study within this context? Remifen-tanil is a potent MOR agonist and the effect sites are probably both at the stomach level and in the CNS. We speculate that the “normal” opioid response during fasting condi-tions, as seen in Hammas’ study, is a decreased cholinergic activity resulting in a decrease in gastric tone. However, due to the high potency of remifentanil, direct smooth muscle effects might predominate in some subjects, resulting in an increase in tone. Like propo-fol, remifentanil might also have properties that modulate the opioid response. The fo-cus of these speculations is that opioid effects on gastric tone are variable and depend on factors like the state of the subject and the current status of the neural pathways and smooth muscles involved. This might be an explanation for the variable results in our study. As expected, glucagon decreased gastric tone in all subjects. The effect of glucagon is be-lieved to be an indirect inhibition of cholinergic activity (26). Among those subjects who already had low gastric tone a further decrease was not expected. With the exception of one subject, the administration of glucagon during the remifentanil infusion did not re-sult in a change in gastric tone. As the opioids might act on the smooth muscle level, glucagon might not have the ability to modulate the opioidergic effects on gastric motil-ity. We tested the hypothesis that pharmacogenetic differences in the μ-opioid receptor gene were responsible for the variable outcome. Investigators recently reported that the occur-rence of single nucleotide polymorphisms (SNP) in the μ-opioid receptor gene is associ-ated with altered responses to an opioid (8-10). We found no association between the presence of SNPs and the response in gastric tone after remifentanil. The results are in agreement with a recent published study by our group where we evaluated a variable ef-fect of fentanyl on electrogastrography (EGG) recordings (27). However, the results from the genetic analysis must be interpretated with care. The study was designed and pow-ered for the barostat variables and to investigate associations to genetic factors, a larger sample size is needed (28). The result of no association must be regarded as preliminary observations and has to be confirmed in properly designed studies. The observation might be an indication that the SNP A118G and G691C are not major factors for the observed variability, but we can neither confirm nor rule out that the presence of SNPs in the MOR alter opioid effects on motility. Do our results have any implications for the clinical situation? The main message is that gastric effects of opioids are variable, and it is not possible today to predict the response
12 Jakob Wallden
in the individual patient. An example of the variability is seen in the clinic, where opioids induce nausea and vomiting in some patients while other patients are totally unaffected. In future studies we need to evaluate whether the different kinds of gastric responses are of clinical significance. In summary, remifentanil induced distinct changes in gastric tone with both increases and decreases in tone. The effect of remifentanil on gastric tone is probably dependent on the current state of the systems involved. As a preliminary observation, the variations be-tween individuals could not be explained by SNPs in the MOR gene.
References 1. Azpiroz F. Control of gastric emptying by gastric tone. Dig Dis Sci 1994:39(12 Suppl):18S-19S. 2. Nimmo WS, Heading RC, Wilson J, Tothill P, Prescott LF. Inhibition of gastric emptying and drug
absorption by narcotic analgesics. Br J Clin Pharmacol 1975:2(6):509-13. 3. Lewis TD. Morphine and gastroduodenal motility. Dig Dis Sci 1999:44(11):2178-86. 4. Wallden J, Thorn SE, Wattwil M. The delay of gastric emptying induced by remifentanil is not influ-
enced by posture. Anesth Analg 2004:99(2):429-34. 5. Penagini R, Allocca M, Cantu P, Mangano M, Savojardo D, Carmagnola S, Bianchi PA. Relationship
between motor function of the proximal stomach and transient lower oesophageal sphincter relaxa-tion after morphine. Gut 2004:53(9):1227-31.
6. Hammas B, Thorn SE, Wattwil M. Propofol and gastric effects of morphine. Acta Anaesthesiol Scand 2001:45(8):1023-7.
7. Coulbault L, Beaussier M, Verstuyft C, Weickmans H, Dubert L, Tregouet D, Descot C, Parc Y, Lien-hart A, Jaillon P, Becquemont L. Environmental and genetic factors associated with morphine re-sponse in the postoperative period. Clin Pharmacol Ther 2006:79(4):316-324.
8. Klepstad P, Rakvag TT, Kaasa S, Holthe M, Dale O, Borchgrevink PC, Baar C, Vikan T, Krokan HE, Skorpen F. The 118 A > G polymorphism in the human micro-opioid receptor gene may increase morphine requirements in patients with pain caused by malignant disease. Acta Anaesthesiol Scand 2004:48(10):1232-9.
9. Chou WY, Yang LC, Lu HF, Ko JY, Wang CH, Lin SH, Lee TH, Concejero A, Hsu CJ. Association of mu-opioid receptor gene polymorphism (A118G) with variations in morphine consumption for anal-gesia after total knee arthroplasty. Acta Anaesthesiol Scand 2006:50(7):787-92.
10. Klepstad P, Dale O, Skorpen F, Borchgrevink PC, Kaasa S. Genetic variability and clinical efficacy of morphine. Acta Anaesthesiol Scand 2005:49(7):902-8.
11. Notivol R, Carrio I, Cano L, Estorch M, Vilardell F. Gastric emptying of solid and liquid meals in healthy young subjects. Scand J Gastroenterol 1984:19(8):1107-13.
12. Notivol R, Coffin B, Azpiroz F, Mearin F, Serra J, Malagelada JR. Gastric tone determines the sensi-tivity of the stomach to distention. Gastroenterology 1995:108(2):330-6.
13. Whitehead WE, Delvaux M. Standardization of barostat procedures for testing smooth muscle tone and sensory thresholds in the gastrointestinal tract. The Working Team of Glaxo-Wellcome Research, UK. Dig Dis Sci 1997:42(2):223-41.
14. Ikeda K, Ide S, Han W, Hayashida M, Uhl GR, Sora I. How individual sensitivity to opiates can be predicted by gene analyses. Trends Pharmacol Sci 2005:26(6):311-7.
15. Levein NG, Thorn SE, Lindberg G, Wattwill M. Dopamine reduces gastric tone in a dose-related manner. Acta Anaesthesiol Scand 1999:43(7):722-5.
16. Burkle H, Dunbar S, Van Aken H. Remifentanil: a novel, short-acting, mu-opioid. Anesth Analg 1996:83(3):646-51.
17. Jahnberg T. Gastric adaptive relaxation. Effects of vagal activation and vagotomy. An experimental study in dogs and in man. Scand J Gastroenterol Suppl 1977:46:1-32.
18. Tack J, Demedts I, Meulemans A, Schuurkes J, Janssens J. Role of nitric oxide in the gastric accom-modation reflex and in meal induced satiety in humans. Gut 2002:51(2):219-24.
19. Abrahamsson H, Glise H. Sympathetic nervous control of gastric motility and interaction with vagal activity. Scand J Gastroenterol Suppl 1984:89:83-7.
20. Yokotani K, Osumi Y. Involvement of mu-receptor in endogenous opioid peptide-mediated inhibition of acetylcholine release from the rat stomach. Jpn J Pharmacol 1998:78(1):93-5.
STU
DY
IIIRemifentanil and Gastric Tone 13
21. Storr M, Gaffal E, Schusdziarra V, Allescher HD. Endomorphins 1 and 2 reduce relaxant non-adrenergic, non-cholinergic neurotransmission in rat gastric fundus. Life Sci 2002:71(4):383-9.
22. Grider JR, Makhlouf GM. Identification of opioid receptors on gastric muscle cells by selective recep-tor protection. Am J Physiol 1991:260(1 Pt 1):G103-7.
23. Browning KN, Kalyuzhny AE, Travagli RA. Opioid peptides inhibit excitatory but not inhibitory syn-aptic transmission in the rat dorsal motor nucleus of the vagus. J Neurosci 2002:22(8):2998-3004.
24. Thorn SE, Wattwil M, Lindberg G, Sawe J. Systemic and central effects of morphine on gastroduode-nal motility. Acta Anaesthesiol Scand 1996:40(2):177-86.
25. Browning KN, Zheng Z, Gettys TW, Travagli RA. Vagal afferent control of opioidergic effects in rat brainstem circuits. J Physiol 2006:575(Pt 3):761-76.
26. Shimatani T. Involvement of cholinergic motor neurons in pharmacological regulation of gastrointes-tinal motility by glucagon in conscious dogs. J Smooth Muscle Res 1997:33(4-5):145-62.
27. Wallden J, Lindberg G, Sandin M, Thorn S-E, Wattwil M. Effects of fentanyl on gastric myoelectrical activity - a possible association to polymorphisms of the μ-opioid receptor gene? Acta Anaesthesiol Scand 2008:In Press.
28. Belfer I, Wu T, Kingman A, Krishnaraju RK, Goldman D, Max MB. Candidate gene studies of human pain mechanisms: methods for optimizing choice of polymorphisms and sample size. Anesthesiology 2004:100(6):1562-72.
STUDY IV
Klunserna Study 05-10-25, 10.15161
STU
DY
IV
Effects of fentanyl on gastric myoelectrical activity – a possible association to polymorphisms of the
μ-opioid receptor gene? Jakob Walldén, MD * †; Greger Lindberg, MD, PhD ‡ ;Mathias Sandin, MD §;
Sven-Egron Thörn, MD,PhD §†;Magnus Wattwil, MD, PhD §†
* Department of Anesthesia, Sundsvall Hospital, Sundsvall; † Department of Clinical Medicine, Örebro University, Örebro; ‡ Karolinska Institutet, Department of Medicine, Karolinska University Hospital Huddinge; Stockholm; § Department of Anesthesia and
Intensive Care, Örebro University Hospital, Örebro; SWEDEN Background: Opioids have inhibitory effects on gastric motility, but the mechanism is far from clear. Electrical slow waves in the stomach determine the frequency and the peri-staltic nature of gastric contractions. The primary aim of this study was to investigate the effects of the opioid fentanyl on gastric myoelectric activity. As there were large varia-tions between the subjects we investigated if the variation was correlated to single nu-cleotide polymorphisms (SNP) of the μ-opioidreceptor gene. Methods: We used cutaneous multichannel electrogastrography (EGG) to study myoelec-trical activity in 20 patients scheduled for elective surgery. Fasting EGG was recorded for 30 minutes, followed by intravenous administration of fentanyl 1μg•kg-1 and subsequent EGG recording for 30 minutes. Spectral analysis of the two recording periods was per-formed and variables assessed were dominant frequency (DF) of the EGG and its power (DP). Genetic analysis of the SNP A118G and G691C of the μ-opioidreceptor gene were performed with PCR-technique. Results: There was a significant reduction in DF and DP after intravenous fentanyl. However, there was a large variation between the patients. In eight subjects EGG was unaffected, five subjects had a slower DF (bradygastria) and in six subjects the slow waves disappeared. We found no correlation between the EGG outcome and presence of A118G or G691C in the μ-opioidreceptor gene. Conclusions: Fentanyl inhibited gastric myoelectrical activity in about half of the sub-jects. The variation could not be explained by SNP in the μ-opioid receptor gene. Due to small sample size, results must be regarded as preliminary observations. Keywords: Gastrointestinal motility; Gastric myoelectrical activity; Electrogastrography; Analgesics, Opioid; Polymorphism, Single Nucleotide; Receptors, Opioid, mu/*genetics; Genotype This study was supported by grants from FoU-centrum, Sundsvall and Emil Andersson’s Fund for Medical Research, Sundsvall. Accepted for publication in Acta Anaesthesiologica Scandinavica on January 2, 2008.
2 Jakob Wallden
Introduction Electrogastrography (EGG) is the cutaneous recording of gastric myoelectrical activity and the activity is closely associated to gastric motility (1). Gastric smooth muscles dis-play a rythmic electrical activity, slow-waves, with a frequency of approximately 3 cycles per minute. These slow-waves originate from a gastric pacemaker region in the corpus and propagate towards the pylorus. With influence of the enteric nervous system and other regulatory mechanisms, the slow-waves trigger the onset of spike potentials, which in turn initiate coordinated contractions of the gastric smooth muscles (2). Gastric motil-ity and emptying depend on these slow waves. Opiate drugs are well known to impair gastric motility. The mechanistic understanding how this impairment is mediated is far from clear (3) although opioid receptors are dis-tributed all over the gastrointestinal tract. To our knowledge there is only one study in the literature where cutaneous EGG was used for studying gastric effects of opiates (4) and in that study morphine induced tachygastria. The primary aim of our study was to investigate how the short acting opiate fentanyl affects gastric myoelectrical activity as recorded with cutaneous EGG. There are substantial inter-individual differences in the general response to opioids (5) and recent studies have suggested that polymorphism of the μ-opioid receptor (MOR) gene with an altering of the receptor-function may be a cause of the variation (6). Since we found large variations in the EGG response to an opioid, we also investigated if this variation was correlated to the presence of two different polymorphisms in the μ-opioid receptor gene. Methods After approval of the study protocol by the ethics committee of the Örebro County Council, 20 patients undergoing surgery on an ambulatory basis were recruited to the study. The subjects gave their informed consent to participate after receiving verbal and written information. Patient characteristics are presented in Table 1. The study was done before the induction of anesthesia in a pre-anesthetic area. Patients had fasted for at least 6 hours from solid foods and 2 hours from clear fluids. No pre-medication was given. While the patient was lying in a comfortable bed rest position, an intravenous line was inserted and the EGG recordings were initiated. After achieving a stable EGG signal, a 30-minute baseline EGG recording was collected. Without discon-tinuation of the EGG recording, 1 μgram•kg-1 of fentanyl was given as an intravenous bolus through the intravenous line and the EGG recording continued for another 30 minutes. Multichannel Electrogastrography Six EGG electrodes were placed on the abdomen after skin preparation. The electrodes consisted of four active electrodes, one reference electrode and one ground electrode as illustrated in Figure 1. A motion sensor was also attached to the abdomen. We used Medtronic Polygram NET EGG system (Medtronic A/S, Denmark) for the simultaneous recording of four EGG signals. Our EGG system was configured to accept an electrode impedance of less than 11 kΩ after skin preparation. The EGG signal was sampled at ~105 Hz, and this was downsampled to 1 Hz as part of the acquisition process (7). EGG analysis All EGG tracings were first examined manually by two of the authors (JW, GL). Prior the analysis motion artifact in the EGG signal, indicated by the motion sensor, were iden-
STU
DY
IVEffects of Fentanyl on EGG 3
tified and removed manually. For each patient, the EGG channel with the most typical slow-wave pattern during baseline recording (before fentanyl) was selected for further analysis. An overall spectrum analysis was performed on each of the two main 30 minute seg-ments (before and after fentanyl respectively) of the selected channel using the entire time-domain EGG signal (7). Sequential sets of measurement data for 256s with an over-lap of 196s were analyzed using fast Fourier transforms and a Hamming window for the calculation of running power spectra. When the entire signal was processed, the power spectra for each segment were combined to arrive at the overall dominant frequency (DF) and power of the dominant frequency (DP).
Table 1 Patient characteristics Age (yr) 45 (28-67) Height (cm) 169 (155-180) Weight (kg) 77 (54-124) Body Mass Index 27 (18-39) Females 16 Males 4 Smokers 3 ASA I 16 ASA II 4 Values are given as means with ranges or numbers. Figure 1 Electrogastrography electrode placement: -Electrode 3 was placed halfway between the xy-phoid process and the umbilicus. -Electrode 4 was placed 4 cm to the right of elec-trode 3. -Electrode 2 and 1 were placed 45 degree to the upper left of electrode 3, with an interval of 4 to 6 cm. -The ground electrode was placed on the left costal margin horizontal to electrode 4. -The reference electrode (electrode 0) was placed at the cross point of the horizontal line containing electrode 1 and the vertical line containing elec-trode 3.
4 Jakob Wallden
The EGG segments and the spectral analysis after fentanyl were further classified either as 1) Unaffected EGG (no change in DF after fentanyl), 2) Bradygastric EGG (decrease in DF >=0.3 after fentanyl) or 3) Flatline-EGG (total visual disappearance of a previously clear sinusoidal 3 cpm EGG-curve after fentanyl) (see example in figure 3) without any quantifiable DF. When DF was not quantifiable, DF was set to 0. Data from the baseline EGG were compared to data from a previous multicenter study in normal subjects (7) to test if our study group was similar to a normal population. Predicted fentanyl concentrations in blood was calculated using Shibutani’s modification of Shafer’s formula (8, 9). Genetic analyses Due to the large interindividual variation in the EGG pattern after fentanyl, we decided to investigate if this variation could be explained by genetic variability, polymorphisms, in the μ-opioid receptor gene. We decided to analyze polymorphisms with a relative high frequency and after reviewing the literature, we focused on the μ-opioid receptor gene polymorphisms A118G and G691C (10). As ethnicity has impact on genetic expressions, we reviewed patient data and found that all of the subjects were Caucasians. DNA collection and purification. Venous blood (10 ml) was collected from the subjects in EDTA tubes and the samples were stored frozen at –70°C. Genomic DNA was puri-fied from peripheral leukocytes in 1 ml of EDTA blood on a MagNA Pure LC DNA ex-tractor, using the MagNA Pure LC Total Nucleic Acid Isolation Kit – Large Volume (Roche Diagnostics Corporation, Indianapolis, USA). Genotyping. Genotyping was performed at CyberGene AB, Huddinge, Sweden. The A118G SNP in Exon 1 and the IVS2 G691C SNP in Intron 2 were genotyped using po-lymerase chain reaction amplification and sequencing. Oligonucleotide primers (forward: 5'-GCGCTTGGAACCCGAAAAGTC; reverse: 5'-CATTGAGCCTTGGGAGTT) and (forward: 5'-CTAGCTCATGTTGAGAGGTTC; reverse: 5'-CCAGTACCAGGTTGGATGAG) were used for amplifying gene fragments contain-ing Exon 1 and Intron 2, respectively. PCR conditions comprised an initial denaturing step at 95°C for 1 min followed by 30 cycles at 94°C for 1 min, annealing at 47.2-53.4°C (depending on primer) for 1 min and extension 68°C for 3 min, and a final extension at 68°C for 3 min. The amplified fragments were sequenced using the same primers with the addition of Rev 1-2 5'-TTAAGCCGCTGAACCCTCCG and the BigDye Terminator v1.1 Cycle Sequence Kit (Applied Biosystems, Foster City, CA, USA). PCR amplification and sequence reactions were done on ABI GeneAmp 2400 and 9700 (Applied Biosys-tems). Sequence analysis was first done on MegaBACE 1000 (Amersham Biosciences, CA, USA) and then confirmed with ABI 377XL (Applied Biosystems). Postoperative data Charts and notes from the recovery unit were reviewed and we collected data regarding analgesic and antiemetic requirements. The decision to include these data was done after the initial study was terminated. Statistics In order to detect a mean intraindividual difference of 1 cpm in the dominant frequency (DF) with 1 cpm as the expected standard deviation of the difference, a sample size of 12 was calculated (alpha=0.05, beta = 0.2). To further increase power and compensate for possible exclusions sample size was set to 20. The results are presented as medians with interquartile ranges. Wilcoxon's signed rank test and the 95% confidence interval of the difference between the medians were used for analysis of the primary EGG outcome
STU
DY
IVEffects of Fentanyl on EGG 5
variables. The unpaired t-test was used for the comparisons of baseline EGG data to the historical controls and for the comparisons of predicted fentanyl concentrations and body composition between the outcome groups. Analysis of change over time for the vi-tal variables (blood pressure, heart rate, oxygen saturation) was performed using a gen-eral linear model of variance for repeated measures. The Chi-squared test was used for the analysis of associations between the EGG outcome and the genetic variations. The significance level was set to 5% in all statistical tests.
Results All patients (n=20) tolerated the administration of fentanyl well and there were no ad-verse events. One patient was excluded from the EGG analysis due to major artifacts in the EGG recording (both before and after fentanyl). We interpreted the artifacts as elec-tromagnetical interference in the ambience. Blood pressure, heart rate and oxygen saturation were normal during the whole study period with small statistically significant decreases in systolic and diastolic blood pressure after administration of fentanyl (data not shown). Compared to historical controls (7), there were no differences in the baseline EGG vari-ables, see Table 2. After the administration of intravenous fentanyl, there was a significant reduction in both dominant frequency (DF) and dominant power (DP) of the EGG spectra, see Table 3. Individual changes in DF and DP are presented in Figure 2. There was large variation between patients in the response to intravenous fentanyl. EGG recordings were unaffected in 8 patients, 5 patients developed a slower DF (bradygastria) and in 6 patients the slow-wave tracings disappeared totally (flatline-EGG). For an illus-tration of the effect, see Figure 3. Among patients with a flatline-EGG (n=6), the median (range) time from the administra-tion of intravenous fentanyl to the observed disappearance of the slow waves was 5 (1-9) minutes. In 5 of these patients, there was a reapperance of the 3 cpm slow-wave EGG pattern 30 (29-35) minutes after the administration of fentanyl. We found no difference between the outcome groups in predicted fentanyl concentrations derived from a pharmacokinetic model (unaffected vs affected group (ng·mL-1): 10 min: 0.45 (0.061) vs 0.43 (0.065) (p=0.6); 20 min: 0.34 (0.046) vs 0.32 (0.049) (p=0.6); 30 min: 0.26 (0.035) vs 0.25 (0.037) (p=0.6)). Further, there were no difference between the groups in body weight (unaffected vs affected group (kg): 73.8 (13.5) vs 79 (19.3) (p=0.29)) or BMI (unaffected vs affected group (kg·m-2): 25.3 (4.8) vs 27.9 (5.1) (p=0.50)). Blood samples for genetic analysis were obtained from 18 subjects in the study. We found no correlation between the gastric response to fentanyl and the polymorphisms A118G or G691C (Table 4). We found an association between requirement for postoperative antiemetic and the gas-tric response to fentanyl (Table 5).
6 Jakob Wallden
25
30
35
40
45
50
55
Baseline After Fentanyl 1μg/kg
Dom
inan
t Pow
er (d
B)
*
0
0,5
1
1,5
2
2,5
3
3,5
Baseline After Fentanyl 1μg/kg
Dom
inan
t Fre
quen
cy (c
pm)
*
Table 2 EGG parameters from the baseline recordings compared to a multicenter study in nor-mal subjects (7).
Baseline recording
(n=19)
Historical control (n=60).
Difference between means with 95% C.I. P-value
Dominant Frequency (cpm) 2.92 ± 0.17 2.89 ± 0.26 0.03 (-0.1 to 0.16) p=0.64
Dominant Power (dB) 42.1 ± 3.8 42.4 ± 6.3 -0.30 (-3.5 to 2.7) p=0.85
Values are means (SD). Paired students t-test.
Table 3 Changes in EGG variables before (-30 to 0 min) and after (0 to 30 min) the administra-tion of 1μg•kg-1 intravenous fentanyl.
Baseline
recording After fentanyl 1μg•kg-1 I.V.
Difference between the medians with 95% C.I. P-value
Dominant Frequency (cpm) 2.9 ( 2.8 - 3.0 ) 2.5 ( 0 – 2.9 ) 0.4 (0-2.9) p=0.002
Dominant Power (dB) 41 ( 39 – 45 ) 38 ( 35 – 40 ) 3 (0.6-3.5) p=0.002
Values are medians with interquartile ranges. Wilcoxons signed rank test. C.I. = Confidence Inter-val. Figure 2 A: Individual values for the dominant frequency (DF) in the electrogastrographic (EGG) spectra before and after intravenous fentanyl 1μg•kg-1. If there was no dominant fre-quency, DF was set to zero. B: Individual values for the dominant power (DP) in the EGG spectra before and after intravenous fentanyl 1μg·kg-1. (* = Wilcoxons signed rank test, p<0.05) A B
STU
DY
IVEffects of Fentanyl on EGG 7
Figure 3 Electrogastrographic (EGG) tracing in a patient where the gastric slow waves disap-peared after intravenous fentanyl 1μg•kg-1 with a close-up of the period were fentanyl was administered.
-80
-60
-40
-20
0
20
40
60
80
25:00 30:00 35:00 40:00Time (min)
μV
Fentanyl 1μg/kg I.V.
Slow-waves 3 cpm Disappearance of Slow-waves
Table 4 EGG classification and genotype groups (n=18). 118 A>G genotype IVS2 + 691 G>C genotype
Wild Type (AA) n=15 83%
Hetero-zygous (AG) n=2 11%
Variant (GG) n=1 6%
Wild Type(GG) (n=0) 0%
Hetero-zygous (GC)
(n=14) 78%
Variant (CC) (n=4) 22%
Unaffected EGG (n=6)
5 1 6
Bradygastria (n=5) 4 1 2 3
Flatline (n=6) 5 1 5 1
Excluded from the EGG-analysis (n=1)
1 1
No association found between EGG-classification and prescence of polymorphism A118G [Wild Type vs (Heterozygous OR Variant)] ; Chi-square test, P=0.99. No association found between EGG-classification and prescence of polymorphism in G691C [Wild Type vs (Heterozygous OR Variant)]; Chi-square test was not possible to perform as there were no cases in “Wild type”. Two subjects, both classified as “Unaffected EGG”, did not participate in the genotype analysis.
8 Jakob Wallden
Table 5 PONV, Postopertive antiemetic and the correlation to the EGG outcome after fentanyl.
EGG after fentanyl
Unaffected (n=8)
Bradygastric or flatline (n=11)
PONV at the recovery unit No (n=9) 6 3 Yes (n=10) 2 8
Antiemetic administration at recovery unit No (n=10) 7 3 Yes (n=9) 1 8
Fishers exact test (2-sided): PONV vs EGG-classification; P=0.070; Antiemetics vs EGG-classification; P=0.020* PONV= Postopertive Nausea and Vomiting; EGG = Electrogastrography.
Discussion In this study, we found that intravenous administration of the opioid fentanyl 1μg·kg-1
inhibited gastric myoelectric activity with a decrease in both the dominant frequency and the dominant power of the electrogastrographic spectra. The responses were highly indi-vidual with responders and non-responders. We tested if this variability could be ex-plained by the single nucleotide polymorphisms A118G and G691C of the μ-opioid re-ceptor gene, but we found no association. We found that the EGG response to fentanyl predicted the need for postoperative antiemetic treatment. The results from the genetic analysis must be interpretated with care. The study was de-signed and powered for the EGG variables and to investigate associations to genetic fac-tors, a larger sample size is needed (11). The result of no association must be regarded as preliminary observations and has to be confirmed in properly designed studies. The ob-servation might be an indication that the SNP A118G and G691C are not major factors for the observed variability, but we can neither confirm nor rule out that the presence of SNPs in the MOR alter opioid effects on motility. In this study, we hypothesized that opioids would impair gastric electrical activity. Coor-dinated peristaltic contractions of gastric smooth muscles, initiated by electrical depolari-zation, are the bases for gastric emptying of solids. The stomach displays a rhythmic de-polarization that is characterized by slow waves with a frequency of about 3 cycles per minute (cpm). The electrical activity originates in the corpus region of the stomach and propagates towards the pylorus. Specialized pacemaker cells, the interstitial cells of Cajal (ICC), are localized as a network around the myenteric plexus of the stomach and are responsible for the generation and conduction of the slow waves (1). We used cutaneous electrogastrography, which revealed 3 cpm slow wave activity 30 minutes before the in-tervention with fentanyl in all subjects. Data from the baseline period did not differ from a recent multicenter electrogastrography study in normal subjects (7) and we consider the baseline period in our subjects as normal electrical activity. The electrical activity was disrupted after the administration of fentanyl and we observed both bradygastria and disappearance of the slow wave activity. However, in about half of the subjects, EGG was unaffected.
STU
DY
IVEffects of Fentanyl on EGG 9
Opioids are known inhibitors of gastrointestinal motility and there are numerous studies in the literature regarding the effect of opioids on gastroduodenal function. Gastric emp-tying is delayed (12-14), antroduodenal motility increased (15), pyloric spasm induced (16) and there are reports of both relaxation (17) and contraction (18) of the gastric fun-dus. The understanding how these effects are mediated is far from clear (3) and the opioids might act on opioid receptors at different levels, both within the stomach (19, 20) and in the central nervous system (4, 21, 22). There are only a few reports in the literature about the effects of opioids on gastric elec-trical activity. Invasive recordings of gastric myoelectric activity have shown that mor-phine transiently distort the slow-wave activity and initiate migrating myoelectric com-plexes (23, 24). Cutaneous recordings with EGG showed that morphine induced tachy-gastria (4). The shift in the basal EGG frequency towards bradygastria that we observed in some of the subjects indicates that opioids inhibit the ICC-network. Bradygastria is believed to be a decrease in the frequency of the normal pacemaker cells while other dys-rhythmias like tachygastria have ectopic origins in the stomach (25). There was no randomization or blinding in this study. We compared the EGG before and after an intervention and the subjects acted as their own control. We were aware that there are risks for bias and other errors with this study design. Other factors like time-effects, emotions or other stimuli may have contributed to the outcome. However, the onset-time of the effect among the responders was consistent with the pharmacological properties of fentanyl and we suggest that fentanyl is responsible for the EGG-changes. To further investigate and verify our results, a double-blinded randomized control trial is needed. We tried to explain the variability seen with responders and non-responders. One hy-pothesis may be a difference between the individuals in the plasma concentration of fen-tanyl. Unfortunately we did not collect blood samples during the EGG study. By using a pharmacokinetic model (8, 9), we calculated the predicted plasma concentrations of fen-tanyl for each subject. We were not able to find any differences in the predicted concen-trations between the outcome groups. However, there is a notable wide variability in the model that may conceal relevant differences. Further, as body composition affects the pharmacokinetic profiles of a drug, we tested for differences in body weight and body mass index between the groups, but found no differences. Also, we cannot rule out that differences between the subjects in pharmacokinetic factors, i.e. distribution volume, me-tabolism or clearance, alter the effect-site concentration of fentanyl and thus the effect on gastric motility. We tested the hypothesis if pharmacogenetic differences in the μ-opioid receptor were responsible for the variable outcome. Recently investigators have reported that occur-rence of single nucleotide polymorphisms (SNP) in the μ-opioid receptor gene are associ-ated with an altered responses to an opioid (26, 27). There are data supporting that ge-netic differences are able to alter gastrointestinal response to opioids. The variable anal-gesic effect of codein is related to genetic variations, leading to different expression of the enzyme (CYP2D6) that metabolizes codein to morphine. Among extensive metabolizers, oro-cecal transit time is prolonged compared to poor metabolizers and correlates to higher morphine concentrations in plasma (28). To our knowledge there are no studies on the relation of SNP in the μ-opioid receptor to the outcome of opioids on gastrointes-tinal motility. After reviewing the literature, we decided to analyze two SNPs in the μ-opioid receptor gene with a high reported frequency (10). The SNP A118G is also the polymorphism that is believed to have clinical significance.
10 Jakob Wallden
We found no association between the presence of SNPs and EGG changes after the inter-vention with fentanyl. Two subjects, both classified as “unaffected EGG”, refused to par-ticipate in the genotyping study. By using simulated genotype data with all hypothetical outcomes for the two subjects, we found that there were no changes in the results if they have been participating. The frequencies of A118G in our material were similar to the reported frequencies in the literature. All investigated subjects were either heterozygote or homozygote to G691C and there were no normal “wild types” of G691C. This SNP is reported in a high frequency, but the distribution in our study is not consistent with the expected distributions from the Hardy-Weinberg equilibrium. Our study group may not represent a normal population, as the majority of the subjects are woman and almost all of them had a gallbladder disease and this may introduce a selection bias. However, with the small sample size it is difficult to draw any conclusions regarding the distribution. Our results indicate that pharmacogenetic differences in the opioid receptor gene may not be a major factor for the variable gastric outcome by an opioid. However, due to the small sample size, we want to emphasis that our results are preliminary observations and the interpretation of the results have to be cautious. Retrospectively we reviewed the anesthetic and postoperative records regarding intraop-erative and postoperative opioid requirements, pain assessments, postoperative nausea or vomiting (PONV) and antiemetic treatments. We correlated the data to the EGG and pharmacogenetic results. We found a higher requirement of antiemetic treatments among the subjects classified as responders to fentanyl. There was also a tendency towards a higher incidence of PONV in this group. As we investigated many factors, these results may have resulted by chance, so other explanations are possible. Those subjects who re-sponded with gastric effects of fentanyl may somehow have a higher sensitivity to opioids, which may also results in higher emetic response to opioids. There is also a pos-sibility that the changes in gastric motility per se induce emesis. As there are great limita-tions in the retrospective review, we want to emphasis that our results are only an indica-tion for a possible association between PONV and opioid induced changes in gastric mo-tility. The pattern of responders and non-responders on the EGG after fentanyl raises the ques-tion if opioid-side effects follow a present or non-present pattern. In daily clinical rou-tine, we also observe that some patients experience PONV on opioid treatment, while others are totally unaffected. If there is such “switch”, the “trigger” must be identified. The issue is probably complex and might i.e. include pharmacokinetic, pharmacody-namic and pharmacogenetic factors. In summary, the opioid fentanyl induced changes in the gastric slow waves with brady-gastria and disappearance of the slow waves. Pharmacogenetic differences in the μ-opioid receptor gene could not explain the variability with responders and non-responders, but as our sample size was small the findings must be regarded as preliminary observations. Further studies are needed to survey the mechanism of gastric effects of opioids and the source of the great variability.
References 1. Sanders KM, Ördög T, Koh SD, Ward SM. Properties of Electrical Rhytmicity in the Stomach. In: Koch
KL, Stern RM, editors. Handbook of Electrogastrography. New York: Oxford University Press; 2004. p. 13-36.
2. Chang FY. Electrogastrography: Basic knowledge, recording, processing and its clinical applications. J Gastroenterol Hepatol 2005:20(4):502-16.
STU
DY
IVEffects of Fentanyl on EGG 11
3. Hicks GA, DeHaven-Hudkins DL, Camilleri M. Opiates in the control of gastrointestinal tract function: current knowledge and new avenues for research. Neurogastroenterol Motil 2004:16 Suppl 2:67-70.
4. Thorn SE, Wattwil M, Lindberg G, Sawe J. Systemic and central effects of morphine on gastroduodenal motility. Acta Anaesthesiol Scand 1996:40(2):177-86.
5. Coulbault L, Beaussier M, Verstuyft C, Weickmans H, Dubert L, Tregouet D, Descot C, Parc Y, Lien-hart A, Jaillon P, Becquemont L. Environmental and genetic factors associated with morphine response in the postoperative period. Clin Pharmacol Ther 2006:79(4):316-324.
6. Klepstad P, Rakvag TT, Kaasa S, Holthe M, Dale O, Borchgrevink PC, Baar C, Vikan T, Krokan HE, Skorpen F. The 118 A > G polymorphism in the human micro-opioid receptor gene may increase mor-phine requirements in patients with pain caused by malignant disease. Acta Anaesthesiol Scand 2004:48(10):1232-9.
7. Simonian HP, Panganamamula K, Parkman HP, Xu X, Chen JZ, Lindberg G, Xu H, Shao C, Ke MY, Lykke M, Hansen P, Barner B, Buhl H. Multichannel electrogastrography (EGG) in normal subjects: a multicenter study. Dig Dis Sci 2004:49(4):594-601.
8. Shibutani K, Inchiosa MA, Jr., Sawada K, Bairamian M. Accuracy of pharmacokinetic models for pre-dicting plasma fentanyl concentrations in lean and obese surgical patients: derivation of dosing weight ("pharmacokinetic mass"). Anesthesiology 2004:101(3):603-13.
9. Shafer SL, Varvel JR, Aziz N, Scott JC. Pharmacokinetics of fentanyl administered by computer-controlled infusion pump. Anesthesiology 1990:73(6):1091-102.
10. Ikeda K, Ide S, Han W, Hayashida M, Uhl GR, Sora I. How individual sensitivity to opiates can be pre-dicted by gene analyses. Trends Pharmacol Sci 2005:26(6):311-7.
11. Belfer I, Wu T, Kingman A, Krishnaraju RK, Goldman D, Max MB. Candidate gene studies of human pain mechanisms: methods for optimizing choice of polymorphisms and sample size. Anesthesiology 2004:100(6):1562-72.
12. Wallden J, Thorn SE, Wattwil M. The delay of gastric emptying induced by remifentanil is not influ-enced by posture. Anesth Analg 2004:99(2):429-34.
13. Nimmo WS, Heading RC, Wilson J, Tothill P, Prescott LF. Inhibition of gastric emptying and drug ab-sorption by narcotic analgesics. Br J Clin Pharmacol 1975:2(6):509-13.
14. Yuan CS, Foss JF, O'Connor M, Roizen MF, Moss J. Effects of low-dose morphine on gastric emptying in healthy volunteers. J Clin Pharmacol 1998:38(11):1017-20.
15. Lewis TD. Morphine and gastroduodenal motility. Dig Dis Sci 1999:44(11):2178-86. 16. Edin R, Lundberg J, Terenius L, Dahlstrom A, Hokfelt T, Kewenter J, Ahlman H. Evidence for vagal
enkephalinergic neural control of the feline pylorus and stomach. Gastroenterology 1980:78(3):492-7. 17. Hammas B, Thorn SE, Wattwil M. Propofol and gastric effects of morphine. Acta Anaesthesiol Scand
2001:45(8):1023-7. 18. Penagini R, Allocca M, Cantu P, Mangano M, Savojardo D, Carmagnola S, Bianchi PA. Relationship
between motor function of the proximal stomach and transient lower oesophageal sphincter relaxation after morphine. Gut 2004:53(9):1227-31.
19. Bitar KN, Makhlouf GM. Specific opiate receptors on isolated mammalian gastric smooth muscle cells. Nature 1982:297(5861):72-4.
20. De Schepper HU, Cremonini F, Park MI, Camilleri M. Opioids and the gut: pharmacology and current clinical experience. Neurogastroenterol Motil 2004:16(4):383-94.
21. Aicher SA, Mitchell JL, Mendelowitz D. Distribution of mu-opioid receptors in rat visceral premotor neurons. Neuroscience 2002:115(3):851-60.
22. Browning KN, Kalyuzhny AE, Travagli RA. Opioid peptides inhibit excitatory but not inhibitory synap-tic transmission in the rat dorsal motor nucleus of the vagus. J Neurosci 2002:22(8):2998-3004.
23. Telford GL, Hoshmonai M, Moses AJ, Szurszewski JH. Morphine initiates migrating myoelectric com-plexes by acting on peripheral opioid receptors. Am J Physiol 1985:249(5 Pt 1):G557-62.
24. Thorn SE, Wickbom G, Philipson L, Leissner P, Wattwil M. Myoelectric activity in the stomach and duodenum after epidural administration of morphine or bupivacaine. Acta Anaesthesiol Scand 1996:40(7):773-8.
25. Qian LW, Pasricha PJ, Chen JD. Origins and patterns of spontaneous and drug-induced canine gastric myoelectrical dysrhythmia. Dig Dis Sci 2003:48(3):508-15.
26. Klepstad P, Dale O, Skorpen F, Borchgrevink PC, Kaasa S. Genetic variability and clinical efficacy of morphine. Acta Anaesthesiol Scand 2005:49(7):902-8.
27. Chou WY, Yang LC, Lu HF, Ko JY, Wang CH, Lin SH, Lee TH, Concejero A, Hsu CJ. Association of mu-opioid receptor gene polymorphism (A118G) with variations in morphine consumption for analgesia after total knee arthroplasty. Acta Anaesthesiol Scand 2006:50(7):787-92.
28. Mikus G, Trausch B, Rodewald C, Hofmann U, Richter K, Gramatte T, Eichelbaum M. Effect of co-deine on gastrointestinal motility in relation to CYP2D6 phenotype. Clin Pharmacol Ther 1997:61(4):459-66.
Publikationer i serien Örebro Studies in Medicine
1. Bergemalm, Per-Olof (2004). Audiologic and cognitive long-term sequelae from closed head injury.
2. Jansson, Kjell (2004). Intraperitoneal Microdialysis. Technique and Results.
3. Windahl, Torgny (2004). Clinical aspects of laser treatment of lichen sclerosus and squamous cell carcinoma of the penis.
4. Carlsson, Per-Inge (2004). Hearing impairment and deafness. Genetic and environmental factors – interactions – consequences. A clinical audiological approach.
5. Wågsäter, Dick (2005). CXCL16 and CD137 in Atherosclerosis.
6. Jatta, Ken (2006). Inflammation in Atherosclerosis.
7. Dreifaldt, Ann Charlotte (2006). Epidemiological Aspects on Malig-nant Diseases in Childhood.
8. Jurstrand, Margaretha (2006). Detection of Chlamydia trachomatis and Mycoplasma genitalium by genetic and serological methods.
9. Norén, Torbjörn (2006). Clostridium difficile, epidemiology and antibiotic resistance.
10. Anderzén Carlsson, Agneta (2007). Children with Cancer – Focusing on their Fear and on how their Fear is Handled.
11. Ocaya, Pauline (2007). Retinoid metabolism and signalling in vas-cular smooth muscle cells.
12. Nilsson, Andreas (2008). Physical activity assessed by accelerometry in children.
13. Eliasson, Henrik (2008). Tularemia – epidemiological, clinical and diagnostic aspects.
14. Walldén, Jakob (2008). The influence of opioids on gastric function:
experimental and clinical studies.