The 5th Neuroscience Workshop in Kyushu

PROGRAM

November 30 – December 1, 2007 Lake-side Hotel Hisayama (Fukuoka)

Organized by

Integrated Brain Research Grant-in-Aid for Scientific Research

on Priority Areas from MEXT

-1-

November 30 (Fri) 12:30-13:00 13:00-13:10 13:10-13:40 13:40-14:40 (short break) 14:50-15:50 coffee break 16:10-17:10

PROGRAM Registration Opening remark: Akinori Nishi (Kurume Univ)

I. Molecular and Functional Neuroscience Chairperson: Naoki Sotogaku (Kurume Univ)

“The novel neurovascular events in the brain embolism” Han Feng Department of Pharmacology, Graduate Sch of Pharmaceutical Sci, Tohoku Univ Invited lecture 1

Chairperson: Shozo Jinno (Kyushu Univ) “Molecular mechanisms of Kv4.2 trafficking in CA1 pyramidal neurons and the role of neuronal calcium sensor-1 (NCS-1)” Andreas Jeromin Allen Institute for Brain Science, Seattle, WA, USA

Invited lecture 2 Chairperson: Shutaro Katsurabayashi (Fukuoka Univ)

“The role of vesicular glutamate transporter in regulating synaptic vesicle release” Christian Rosenmund Department of Human Genetics and Dept of Neuroscience, Baylor College of Medicine, TX, USA II. Expert Seminar

Chairperson: Hiroshi Nakanishi (Kyushu Univ) “Molecular mechanism of sleep-wake regulation” Yoshihiro Urade Department of Molecular Behavioral Biology, Osaka Bioscience Institute

-2-

November 30 (Fri) 17:10-17:30 17:30-17:45 17:45-18:05 18:05-18:35 19:00-21:00

Presentation-I

Chairperson: Jiro Kasahara (Tohoku Univ)

“The reduced expression of organic cation transporter3 shows the antidepressant-like effect in forced swimming test in mice” Kiyoyuki Kitaichi Department of Pharmacology, Faculty of Pharmaceutical Sciences, Nagasaki International University “Neuronal type specific regulation of DARPP-32 phosphorylation in the striatum of D1R/ D2R-DARPP-32 mice” Mahomi Kuroiwa Department of Pharmacology, Kurume University School of Medicine “Impaired cold synaptic transmission in the spinal dorsal horn of mice lacking cadeherin-8, a cell-cell adhesion molecule” Hidemasa Furue Department of Integrative Physiology, Graduate School of Medical Sciences, Kyushu University Activity report of “Brain Science Kenkyukai” （Program in Japanese, 日本語のプログラムです。） お茶の水女子大学：化学・生物総合管理の再教育講座 「分子がささえる脳の働きと機能脆弱性」 笛田 由紀子 産業医科大学産業保健学部 第１環境管理学講座 Getting Together Party (Room Uguisu /うぐいすの間)

-3-

December 1 (Sat) 9:00-9:30 9:30-10:00 10:00-11:00 coffee break 11:20-11:35 11:35-11:50 11:50-12:05 12:05-12:20 12:20-

III. The New Trends of Computational Neuroscience Chairperson: Kiyohisa Natsume (Kyushu Institute of Technology)

“Modeling and simulation of neural network with complex topology” Norihiro Katayama Laboratory of Biomodeling, 
Graduate School of Information Sciences, 
Tohoku University “A chemical sensor system with non-uniform alcohol sensors” Katsumi Tateno Department of Brain Science and Engineering, Kyushu Institute of Technology Invited lecture 3

Chairperson: Kiyohisa Natsume (Kyushu Institute of Technology) “Influence of synaptic plasticity, learning and sleep on hippocampal place cell plasticity” Mayank R. Mehta Department of Neuroscience, Brown University, RI, USA Presentation-II

Chairperson: Hidemasa Furue (Kyushu Univ) “Weekly developmental changes of high K+-induced epileptiform activity in rat hippocampal slices” Akira Masuda Department of Brain Science and Engineering, Kyushu Institute of Technology “Reduced synaptic activity mediated by extracellular nucleotides precedes the stripping response of microglia after axotomy” Jun Yamada Laboratory of Oral Aging, Faculty of Dental Sciences, Kyushu University Delayed treatment with minocycline improved neurological impairment via activated microglia-inhibiting mechanism Kazuhide Hayakawa Department of Neuropharmacology, Faculty of Pharmaceutical Sciences, Fukuoka University Calculation of channel conductance using recurrent neural network Masaaki Takahashi Department of Brain Science and Engineering, Kyushu Institute of Technology Closing Remarks Hiroshi Nakanishi (Kyushu Univ)

-4-

I. Molecular and Functional Neuroscience

The novel neurovascular events in the brain embolism

Feng Han1 and Kohji Fukunaga1,2 1Department of Pharmacology, Graduate School of Pharmaceutical Sciences, Tohoku University, Sendai, Japan. 2Tohoku University 21st Century COE Program “CRESCENDO,” Sendai, Japan.

Ischemic stroke, a significant neurovascular dysfunction, leads to cerebral hypoperfusion and endothelial cell degeneration. To define mechanisms underlying neurovascular injury following brain embolism, we investigated spatiotemporal changes in neurovascular events in rats microsphere embolism (ME) model. ME-induced up-regulation of eNOS in brain microvessels was observed 2-48 hours after ischemia. The eNOS induction preceded disruption of the blood-brain barrier (BBB) observed 6-72 hours after ischemia. ME-induced eNOS expression was predominant in the vascular endothelial cells and closely associated with protein tyrosine nitration. To determine whether eNOS expression and protein tyrosine nitration in vascular endothelial cells mediates BBB disruption in the ME brain, we tested effect of a novel calmodulin-dependent NOS inhibitor, DY-9760e. DY-9760e treatment inhibited protein tyrosine nitration and in turn BBB disruption. Thus, ME-induced eNOS expression in neurovascular endothelial cells likely mediates BBB disruption and in turn brain edema.

We further investigated relevance of ME-induced microvascular injury model as Alzheimer’s disease (AD) using aged male rats. Like severe ME model, mild ME upregulated eNOS and protein tyrosine nitration in brain microvessels. Interestingly, strong β-amyloid immunoreactivity was coincident with increased eNOS immunoreactivity in microvessels. Immunoblotting analyses with purified brain microvessels revealed that β-amyloid accumulation significantly increased 1 week after ME induction and remained elevated for 12 weeks. Importantly, β-amyloid deposition in brain parenchyma was also observed in areas surrounding injured microvessels at 12 weeks. AD-related hyperphosphorylated tau proteins also found in neurons surrounding regions of β-amyloid accumulation 12 weeks after ME induction, with concomitant increase in glycogen synthase kinase (GSK3β) (Tyr-216) phosphorylation. Taken together, ME-induced aberrant eNOS expression in microvessels following mild ME likely triggers β-amyloid accumulation both in microvessels and brain parenchyma, leading to hyperphosphorylation of neuronal tau proteins through GSK3β activation.

In conclusion, these findings suggest a causative relationship between eNOS-induced cerebrovascular injury and β-amyloid accumulation in the mild brain embolism.

-5-

Invited lecture 1

Molecular mechanisms of Kv4.2 trafficking in CA1 pyramidal neurons and the role of neuronal calcium sensor-1 (NCS-1) Andreas Jeromin, PhD Allen Institute for Brain Science, Seattle, WA, USA The transient A-type current (IA) in CA1 pyramidal neurons is an important regulator of excitability and plasticity, which is regulated by various kinases, including calcium-calmodulin-dependent kinases (CamKII). CaMKII increases the density of IA without affecting its surface expression. I will present evidence that Kv4.2 is a major constituent of the A-type current in CA1 pyramidal neurons. Co-expression of constitutively active CaMKII appears to induce a translocation of Kv4.2 to spines. Kv4.2 interacts with SAP-97 and PSD-95 and SAP-97 promotes the localization of Kv4.2 to spines in a CaMKII-dependent manner. These experiments support a molecular scheme according to which the trafficking of Kv4.2 to spines is regulated by SAP-97. In addition, we have recently identified a role for neuronal calcium sensor-1 (NCS-1) in promoting surface expression of Kv4-type channels. The physiological relevance of this interaction will be discussed.

-6-

Invited lecture 2 The role of vesicular glutamate transporter in regulating synaptic vesicle release Christian Rosenmund Baylor College of Medicine, Dept Human Genetics and Dept Neurosci, One Baylor Plaza, Houston, TX 77030, USA Vesicular glutamate transporters (VGLUT) facilitate the translocation of the excitatory amino acid neurotransmitter glutamate from the cytosol into synaptic vesicles. Three VGLUT paralogs have been identified in mammals, each of which has a unique pattern of expression in the brain. VGLUT1 predominates in the cortex and hippocampus, VGLUT2 in the midbrain and thalamus, and VGLUT3 is found in serotonergic and cholinergic cells that may also release glutamate. Although in vitro transport assays have failed to identify any functional differences between VGLUT1, 2 or 3, each paralog may impart specific characteristics on synapses at which it is expressed. To test this hypothesis we used a knockout/rescue approach. We made autaptic cultures of thalamic or hippocampal neurons that lacked VGLUT2 or VGLUT1, and which show a 90-95% reduction in glutamate release. Lentiviral infection was used to express VGLUT1, 2 or 3 to rescue the release deficit. In thalamic cells, viral expression of all three paralogs rescued glutamate release to wildtype levels. No differences in miniature EPSC release, short-term plasticity or vesicular release probability were found between wildtype cells or knockout cells rescued with VGLUT1, 2 or 3. In hippocampal cells, viral expression of all three paralogs also rescued both spontaneous and evoked glutamate release to wildtype levels. But while knockout cells expressing VGLUT1 displayed identical short-term plasticity and vesicular release probability to wildtype cells, both VGLUT2 and VGLUT3 rescue cells displayed higher release probability and stronger short-term depression. These results suggest that VGLUT paralogs play a role in the regulation of release probability and demonstrate that VGLUT3 is capable of supporting fast glutamatergic transmission in central synapses.

-7-

II. Expert Seminar Molecular mechanism of sleep-wake regulation 「睡眠覚醒調節の分子機構」 Yoshihiro URADE Osaka Bioscience Institute 裏出 良博 （大阪バイオサイエンス研究所・分子行動生物学部門・研究部長） Prostaglandin (PG) D2 is the major PG produced in the CNS of various mammals and the most potent endogenous somnogen, whose action mechanism is the best characterized at the molecular level among various sleep-inducing substances. We recently demonstrated that the i.p. injection of SeCl4, an inhibitor of PGD synthase, into WT mice decreased the PGD2 content in the brain, without affecting the amounts of PGE2 and PGF2α, and inhibited remarkably their sleep in a dose-dependent manner. The SeCl4-induced insomnia was not observed at all in KO mice of lipocalin-type PGD synthase or DP1 receptor. A DP1 antagonist ONO-4127Na reduced sleep of rats dose-dependently during infusion into the subarachnoid space under the rostral basal forebrain (Qu et al., PNAS 103, 17949, 2006), in which DP1 receptors are localized (Mizoguchi et al., PNAS 98, 11674, 2001). Caffeine, a non-selective antagonist of adenosine A1 and A2A receptors, inhibited sleep in wild-type mice in a dose-dependent manner and induced complete insomnia for several hours after the i.p. injection at 15 mg/kg. The caffeine-induced insomnia was also observed in A1 receptor KO mice but not at all in A2A receptor KO mice (Huang et al., Nat. Neurosci. 8, 858, 2005). These results indicate that DP1 and A2A receptors are critical in regulation of physiological sleep.

-8-

Presentation-I-1 The reduced expression of organic cation transporter3 shows the antidepressant-like effect in forced swimming test in mice

Kiyoyuki Kitaichi, Yoko Nawata, Tuneyuki Yamamoto Department of Pharmacology, Faculty of Pharmaceutical Sciences, Nagasaki International University, Sasebo, Nagasaki, 859-3298, Japan (E-mail: kitaichi@niu.ac.jp) There are major problems in modern society to increase the number of patients with psychiatric disorders such as depression, schizophrenia and drug abuse. Although several drugs are available, currently-used drugs have not fulfilled our clinical demands yet. Thus, it is deemed important to further evaluate the novel molecular target(s) for developing new drugs for psychiatric disorders. Organic cation transporter3 (OCT3), expressed in brain, is a transporter to transport monoamines as well as psychostimulants. In the present study, we performed antidepressant-sensitive Posolt’s forced swimming test (FST) in mice treated with antisense oligonucleotides against OCT3 since the regulation of extracellular levels of monomamines play a key role to regulate the antidepressant-sensitive immobility in FST.

Male male ddY mice (Nippon SLC, Hamamatsu, Japan) was used. For genetic modification, antisense oligodeoxynucleotides against OCT3 (OCT3-AS, 5’TGGTCGAACGTGGGCATGGTG3’) was continuously infusued into third ventricule by the osmotic minipump at a rate of 0.075-0.25 μg/0.25 μl/h in mice up to 2 weeks. OCT3-AS but in a scrambled order (OCT3-SCR, 5’TAGTCGGAGGTGAGCGGCGTT3’) and vehicle were used as controls. FST was done by the following schedule. In pre-test, mice without any drug treatment were placed individually in the glass cylinders (height 17 cm, diameter 15.5 cm), and left there for 5 min. A mouse was judged to be immobile when it remained floating in the water and made only the movements necessary to keep its head above the surface. The total duration of immobility during the test was evaluated. After the pre-test, animals were randomly divided into groups by adjusting the average time of immobility in pre-test to the same values. One day after the pre-test, osmotic minipumps (model 1002, Alza, Palo Alto, CA) containing vehicle, OCT3-AS or OCT3-SCR were implanted to infuse it into the third ventricle. Seven days after the start of the conteneous infusion, the post-test was performed. Similar to the pre-test, immobility time was measured. Imipramine (IMI, 4-16 mg/kg, i.p.), an antidepressant, was administered 30 min before post-test. Normetanephrine (NOR, 25 µg/0.25 µl/hr) was also infusued into third ventricule.

OCT3-AS (0.25 µg/0.25 µl/hr), which decreased the expression of OCT3 in brain, significantly reduced the immobility time in FST. Neither OCT3-AS (0.075 µg/0.25 µl/hr) nor IMI (4 mg/kg) solely reduce the immobility time. However, the immobility time was reduced by the concomitant administration of OCT3-AS (0.075 µg/0.25 µl/hr) with IMI (4 mg/kg). NOR (25 µg/0.25 µl/hr), one of relatively selective inhibitors of OCT3, also reduced the immobility time.

Present results suggest the reduction of OCT3 expression or the blockade of OCT3 transport by its substrates might represnt antidepressant-like effect. Thus, it would be expected that OCT3 would be a novel molecular target to treat psychiatric disorders related to the disfunction of monoaminergic neuronal transmission such as depression, schizophrenia, and drug abuse.

-9-

Presentation-I-2 Neuronal type-specific regulation of DARPP-32 phosphorylationin the striatum of D1R/ D2R-DARPP-32 mice.

Mahomi Kuroiwa1, Helen S. Bateup2, Paul Greengard2 and Akinori Nishi1 1 Dept of Pharmacol, Kurume Univ Sch of Med, Kurume 830-0011, Japan; 2 Lab of Mol and Cell Neurosci, The Rockefeller Univ, New York 10021, USA Dopamine plays a central role in the regulation of psychomotor function in the brain. Many of the actions of dopamine are mediated through signal transduction pathways that involve DARPP-32 (dopamine- and cAMP-regulated phosphoprotein of Mr 32 kDa). Activation of D1 receptors that couple to Gs/adenylyl cyclase stimulates PKA, leading to the phosphorylation of DARPP-32 at Thr34. When DARPP-32 is phosphorylated on Thr34, it is converted into a potent inhibitor of protein phosphatase-1 (PP-1), and thereby controls the phosphorylation state and activity of many downstream physiological effectors. DARPP-32 is selectively expressed in two types of medium spiny neurons in the striatum: D1 receptor-expressing striatonigral and D2 receptor-expressing striatopallidal neurons. Phosphorylation of DARPP-32 is thought to be differentially regulated in two types of striatal neurons, but DARPP-32 phosphorylation was not able to analyze separately in two types of neurons. The D1R/D2R-DARPP-32 mouse, in which Flag-tagged DARPP-32 and Myc-tagged DARPP-32 are driven by promoters of D1 and D2 receptors, respectively, is recently developed. Immunohistochemical analysis revealed that Flag- and Myc-tagged DARPP-32 were selectively expressed in striatonigral and striatopallidal neurons, respectively. DARPP-32 Thr34 phosphorylation in two types of striatal neurons was analyzed using immunoprecipitation technique in striatal slices from D1R/D2R-DARPP-32 mice. Activation of D1 receptors by SKF81297 increased Thr34 phosphorylation selectively in striatopallidal neurons, whereas activation of D2 receptors by quinpirole decreased Thr34 phosphorylation selectively in striatopallidal neurons. Thus, the D1/D2-DARPP-32 mouse is a useful tool for analyzing dopaminergic signaling in two types of striatal neurons.

-10-

Presentation-I-3 Impaired cold synaptic transmission in the spinal dorsal horn of mice lacking cadeherin-8, a cell-cell adhesion molecule Hidemasa Furue and Megumu Yoshimura Department of Integrative physiology, Graduate School of Medical Sciences, Kyushu University, Fukuoka 812-8582, Japan Multiple sensory receptors expressed in noxious primary afferents are specialized to respond only to particular sensory modalities and to act as sensory transducers. The mechanisms as to how these primary afferents are sorted and connected with their specific target spinal dorsal horn (DH) neurons are, however, largely unknown. We focused on cadherin-8 (Cad8), a cell adhesion molecule implicated in synaptic contact formation between dorsal root ganglion neurons and DH neurons, and analyzed synaptic responses in DH neurons of wild and cad8 knockout mice (1). The majority of Cad8-positive DRG neurons were small-diameter cells and co-expressed TRPM8 (cold temperature/menthol receptor). Dorsal root stimulation elicited monosynaptic EPSC in DH neurons. The amplitude of EPSCs evoked in substantia gelatinosa (SG, lamina II) neurons by the activation of slow-conducting fiber (considered as Aδ or C) was significantly smaller in cad8 -/- mice than that in cad8+/+ mice. On the other hand, the amplitude of Aβ fiber-evoked EPSCs in deep lamina (lamina III-IV) neurons did not differ between cad8+/+ and -/- mice. Menthol increased the frequency of mEPSCs in Cad8-positive SG neurons but not negative neurons in cad8+/- mice. The Cad8-positive cells exhibited fast and slow (rise-times: 0.24 ms and 0.73 ms) mEPSCs. The distribution histogram of the mEPSCs rise-time indicated that menthol selectively increased the frequency of the slow mEPSCs. The frequency of slow mEPSCs was significantly lower in cad8 -/- mice than that in cad8+/- mice. The cad8-/- mice also showed a reduced sensitivity to cold temperature in behavioral tests. These results suggest that menthol-sensitive (TRPM8-expressing) afferent fibers transmit cool sensation to SG neurons through Cad8-expressing synapses and Cad8 has an essential role in determination of the synaptic connectivity. 1. Furue H*, Suzuki SC*, Koga K, Jiang N, Nohmi, M, Shimazaki Y, Katoh-Fukui Y, Yokoyama M, Yoshimura M, Takeichi M

(*contributed equally): Cadherin-8 is Required for the First Relay Synapses to Receive Functional Inputs from Primary Sensory

Afferents for Cold Sensation. J. Neurosci. 24:3466-76, 2007

Modeling and Simulation of Neural Network with Complex Topology Norihiro Katayama

Laboratory of Biomodeling, Graduate School of Information Sciences, Tohoku University, Japan

E-mail: katayama@ecei.tohoku.ac.jp

In the hippocampus and cerebral cortex of the animal’s brain, sinusoidal wave-like electro- encephalographic (EEG) activity ranging between 20 and 80-Hz is observed associated with the animal’s behavior [1]. The rhythmic EEG, called gamma oscillation, is thought to be used as a clock signal to coordinate distributed neural information processing in the brain because the gamma oscillation is observed in a spatially coherent manner. Recently, it has been revealed that the inhibitory neural network having complex topology plays an essential role in generation and maintenance of the gamma oscillation [2]. In this study, we develop a simple algorithm to generate a network with complex topology to mimic the biological neural network. We explore the topology-dependency of spatio-temporal dynamics of the gamma oscillation in the interneuron network with complex topology by the computer simulations.

The interneuron network model was composed of biologically realistic Hodgkin-Huxley type neurons interacting with inhibitory synapses. Dynamical property of the neuron was described as a set of differential equations. Model parameters were given based on the physiological data of the hippocampal GABAergic fast-spiking neurons with type-1 firing characteristics [3, 4]. Each model neuron was injected with an independent white-noise current, thereby all the neurons fire independently if there was no interaction between them. The network of the interneurons was modeled as a directed graph with a small-world topology. To generate the network, we developed an algorithm based on the Watts and Strogatz’s algorithm [5, 6]. Briefly, all the networks were generated from a directed regular network of N neurons having symmetric synaptic connections only between neighboring Msyn neurons. Source or destination neuron of a synaptic connection was randomly rewired with probability p, which controls the randomness of the network. Numerical solutions of the neural network dynamics were obtained by the Runge-Kutta method. Degree of spatial coherence of gamma oscillation was evaluated by the coherence function [4] defined by the maximal coefficient value of the ensemble mean of cross-correlation functions of the time series of spike occurrence time of the neurons.

Computer simulations revealed that the spatio- temporal dynamics of the interneuron network alter dependent on the average number of synapses per neuron (Msyn) and the rewiring probability of synaptic connections (p). The dynamics can be classified as follows: (1) spatially and temporally random activity emerges if Msyn is small and p is

large (random network). (2) Spatio-temporally coherent gamma oscillation emerges when Msyn is in an adequate range and p is small (small-world network). These results are similar to that of the excitatory neural networks [7]. In addition, in the case of inhibitory neural network (3) some clusters of neurons showing locally coherent gamma oscillation (clustered gamma oscillation) are organized when Msyn is large and p is small (small-world network). The clusters are observed at an almost constant interval of space. Naturally, the random network model shows only patterns (1) and (2) because the spatial arrangement of neuron of the random network is meaningless. We have found a mathematical function that approximates the curves separating the Msyn-p parameter plane into the regions (1)-(3).

It was found that the small-world network requires fewer numbers of synapses to generate coherent gamma oscillation than the random network. Therefore, the small-world network would be more preferred than the random one to save the number of synapses without loss of coherent gamma oscillation. Interestingly, it was found that the inhibitory network model shows clustered gamma oscillation. At present, the clustered gamma oscillation has not been found in the real brain. Thus it should be verified by the physiological experiments in the future.

Acknowledgements This research was partially supported by the Ministry of Education, Science, Sports and Culture, Grant-in-Aid for Scientific Research (C), 1011B, 19500002-0001, 2007.

References [1] Gray CM et al., J. Comput. Neurosci. 1, 11-38, 1994. [2] Traub RD et al., Prog. Neurobiol. 55, 563-575, 1998. [3] Whittington MA et al., J. Physiol. 502, 591-607, 1997. [4] Wang XJ & Buzsaki G, J. Neurosci. 16, 6402-6413, 1996. [5] Watts DJ, Strogatz SH, Nature, 393, 440-442, 1998. [6] Katayama N et al., IEICE Tech Rep. NC2005-3, 13-18, 2005. [7] Lago-Fernandez LF et al., Phys. Rev. Lett. 84, 2758-2671, 2000.

Small-world (p = 0.1) Random (p = 0)

Fig. 1: Examples of raster plots of neuronal activities of the interneuron networks having small-world or random topology. Msyn=18. Horizontal bar, 200 ms.

Time Time

natumeテキストボックス-11-

-12-

III. The New Trends of Computational Neuroscience-2 A chemical sensor system with non-uniform alcohol sensors

Katsumi Tateno, Jun Igarashi, Kazuki Nakada, Tsutomu Miki, Yoshitaka Ohtubo, Kiyonori Yoshii

Department of Brain Science and Engineering, Kyushu Institute of Technology, Kitakyushu 808-0196, Japan

A taste bud is a taste-sensing organ on a tongue. Taste buds sense taste substances under non-ideal

conditions. Such properties of taste buds potentially contribute to improve a chemical sensor.

However, it is still far from understanding mechanisms of taste sensing. For developing a chemical

sensor inspired by mammalian taste buds, we daringly assumed functions of taste bud cells and

then applied our idea to a chemical sensor.

A taste bud includes ~50 cells. Those are classified into four different types of cells: Type I to

Type IV. Only Type III cells receive synaptic projections from the brain. It means that Type III

cells are output cells in a taste bud. Type II cells have receptors for taste substances: bitter, sweet

and Umami tastes. Further, Ohtubo and Yoshii have reported that there are possible interactions

between taste bud cells through gap junctions or secretions. Taste substances are potentially

detected as electrical activities of Type II or Type III cells. Those electrical activities are

propagated to taste nerves via Type III cells. The present chemical sensor array consists of 50 Type

II cells with receptive membranes and 2 Type III cells. Those structures followed mouse taste buds.

According the electrophysiological experiments, different Type II cell shows different response to

taste stimuli: adaptation, tonic action potentials and so on. We assumed that those irregular

responses work as a random pulse. Those random pulses are conducted to Type III cells and lead to

synchronization of spikes on Type III cells. A distribution of inter-pulse intervals of Type II cells

depend on concentration of a chemical substance. Changes of the distribution determine the degree

of synchronization of spikes on Type III cells.

The present algorithm was applied with 32 commercially available alcohol sensors. Those

alcohol sensors have the internal resistance of 10 kΩ - 90 kΩ in air. When the alcohol gas was

insufflated into a plastic bottle, the output voltage of the alcohol sensor circuit was elevated and

sampled by 32 channels of an A/D converter. The output voltage was different in every sensor

circuit. Low concentration of the alcohol gas induced infrequent bursts of the Type III cells, and

there were few chances of synchronization. An increase in concentration of the alcohol gas

facilitated synchronization of bursts between Type III cells. As a result, the degree of

synchronization of bursts was represented as a function of the concentration of the alcohol gas. * This project is supported by 21st COE program of Kyushu Institute of Technology.

Influence of synaptic plasticity, learning and sleep on hippocampal place cell plasticity

Mayank R. Mehta

Department of Neursocience, Brown University, Providence, RI 02912, USA

http://neurophysics.brown.edu

The hippocampus is thought to be critical for episodic learning and memory, especially spatial

memory. Consistently, hippocampal neurons fire in a spatially selective fashion. This spatial

selectivity of hippocampal place cells is thought to arise via mechanisms of synaptic plasticity

and the place cells are thought to enable the rodent to form long term memory or map of the

spatial environment. Further, it is thought that the recently learned spatial information in the

hippocampus during behavior is consolidated to the neocrotex during sleep for long term storage.

Thus, an intricate interaction between behavior, sleep and synaptic plasticity is thought to govern

the hippocampal activity to mediate learning and episodic memory formation. We have tested

these hypotheses using computational modeling, in vivo ensemble electrophysiology using

tetrodes, and whole cell recordings in freely behaving and anesthetized rats and transgenic mice.

To measure the effect on behavior on place cells, we measured the experience-dependent

changes in place cells called place cell plasticity. We found that the firing rate of place cells

doubled within a few traversals of an environment. Further, the place cells became more

anticipatory with experience. These experience-dependent changes in hippocampal activity are

called place cell plasticity. Place cell plasticity is environment specific and is abolished by

NMDA antagonists. Further, computational models show that these results could arise due to the

Hebbian or the spike-timing dependent plasticity (STDP) during behavior. Even though place

cell plasticity persists for at least half an hour, it is not erased by experiencing another

environment, and it occurs in both novel and familiar environments, a major part of place cell

plasticity is erased within a day.

We hypothesized that the place cell plasticity could be erased by the neural activity pattern

during sleep. To test this hypothesis we induced slow-wave sleep (SWS) oscillations using

urethane and measured the membrane potential of identified hippocampal pyramidal neurons and

interneurons, along with the local field potential of parietal cortical neurons. We found that

instead of the hippocampus driving the neocortex during SWS, as expected by theories of

consolidation, the neocortex seemed to be driving the hippocampus. Further, the neocortical

activity had a differential effect on the hippocampal activity. These results do not provide a

support for the hypothesis that the hippocampus drives neocortex during the slow wave sleep to

consolidate long term memories. Instead, the SWS oscillations may be erasing recent memory

trace from the hippocampus. These findings raise fresh questions about the role of synaptic

plasticity in governing hippocampal activity and behavioral learning.

Reference:

M. R. Mehta ‘Cortico-hippocampal interaction during up-down states and memory

consolidation’. Nature Neuroscience, 10, 13 - 15 (2007)

natumeテキストボックス-1３-

-14-

Presentation-II-1 Weekly developmental changes of high K+-induced epileptiform activity in rat hippocampal slices

Akira Masuda, Shuji Aou, Kiyohisa Natsume Department of Brain Science and Engineering, Kyushu Institute of Technology, Kitakyushu, Japan Epilepsy is one of the most common neurological disorders typically characterized by recurrent unprovoked epileptic seizures. Incidence of epilepsy is very high (~1-2/1000) in neonates and infancy and falls dramatically as one grows. This age-dependence was also found in experimental animals both in vivo and in vitro. However, the age-dependent characteristics of the epileptiform activity concerning excitatory (AMPA, NMDA) and inhibitory (GABA or adenosine) receptors are still not clear. The present study was conducted to determine which synaptic transmission is related to the epileptic discharges of infant (1 w), juvenile (4 w), and adult (10 w) rats. We recorded the extracellular field potential in hippocampal CA3 regions of the slices in high K+ induced epileptiform activities model. The amplitudes of epileptiform activity seemed smaller in 1 w (average: 0.26±0.070 mV, 8 slices), and the frequencies of the epileptiform activity in 10 w (0.41±0.057 Hz, 14 slices) were relatively low compared with the other two groups. Application of GABAA receptor antagonist, gabazine (10 µM), increased the amplitudes in 1 w (p

-15-

Presentation-II-2 Reduced synaptic activity mediated by extracellular nucleotides precedes the stripping response of microglia after axotomy Jun Yamada, 1 Yoshinori Hayashi, 1 Shozo Jinno, 2 and Hiroshi Nakanishi 1 1 Laboratory of Oral Aging, Faculty of Dental Sciences 2 Department of Anatomy and Neurobiology, Graduate School of Medical Sciences, Kyushu University, Fukuoka 812-8582, Japan Activated microglia which spread on the motoneurons following an axotomy, engage in the displacement of detached afferent synaptic boutons from the surface of a regenerating neuron. This phenomenon is known as “synaptic stripping”. The present study attempted to examine whether changes in synaptic inputs after axotomy are correlated with the apposition of microglia on the dorsal motoneurons of the vagas (DMV) using a combination of electrophysiological and morphological analyses. DMV neurons in Wistar rats could survive after axotomy. At 2 days after axotomy, there was a significant decrease in the mean frequency of both miniature EPSCs and IPSCs recorded from DMV neurons, without significant changes in their amplitudes. However, the stripping response of microglia was not evident at this stage. Our observations further indicates that extracellular nucleotides are involved in the reduction of synaptic inputs, because PPADS, a P2 receptor antagonist, and DPCPX, a specific antagonist of adenosine receptors, stimulated the recovery of the frequency of miniature EPSCs and IPSCs recorded from the injured DMV neurons to the control level, respectively. No significant change in synaptic inputs was observed in the mechanically dissociated DMV neurons following an axotomy, indicating the glial source of extracellular nucleotides. These observations strongly suggest that extracellular nucreotides-mediated presynaptic inhibition precedes the stripping response of microglia in DMV neurons following axotomy.

-16-

Presentation-II-3 Delayed treatment with minocycline improved neurological impairment via activated microglia-inhibiting mechanism Kazuhide Hayakawaa, Kenichi Mishima, PhDa, Mai Hazekawaa, Keiichi Irie, PhDa, Shutaro Katsurabayashi, PhDa, Takasaki, PhDa, Katsunori Iwasaki, PhDa,b, Michihiro Fujiwara, PhDa,b. aDepartment of Neuropharmacology, Faculty of Pharmaceutical Sciences bAdvanced Materials Institute, Fukuoka University, Fukuoka, 814-0180, Japan Minocycline, a semi-synthetic tetracycline antibiotic, has been reported to improve ischemic injury, and to inhibit microglial activation after focal cerebral ischemia. In the present study, we investigated the cerebroprotective effect of minocycline on post-ischemic injury induced by 4-h middle cerebral artery (MCA) occlusion in mice. One day after 4-h MCA occlusion, minocycline (1, 5, 10 mg/kg) was administrated intraperitoneally for 14 days. Neurological score and motor coordination with rota-rod test were measured at 1, 7, 14th day after MCA occlusion. Hematoxylin & eosin (H&E) staining and terminal deoxynucleotidyl transferase-mediated dUTP nick-end labeling (TUNEL) immunostaining were carried out at 1, 3, 7, 14th day after MCA occlusion. Activated microglia and reactive astrocyte were evaluated in immunofluorescent stain with Iba1 and GFAP, respectively, at 1, 3, 7, 14th day. The neurological function and the rota-rot test were impaired in MCA-occluded mice during the experimental periods. In the striatum, all examined tissues showed progressive cell vacuolization and an increase in dark staining of cytoplasm in H&E staining. The TUNEL positive cells and microglial activation were detected earlier than reactive astrocyte. The 14-day repeated treatment with minocycline (1, 5, 10 mg/kg) dose-dependently improved survival rate, neurological score and motor coordination. Minocycline significantly improved histological changes in H&E staining and decreased TUNEL positive cells at 14th day after cerebral ischemia. In the immunostaining, minocycline decreased expression of Iba1, while minocycline did not affect the expression level of GFAP. These results suggest that delayed treatment with minocycine prevented the brain damage by inhibiting microglial activation.

-17-

Presentation-II-4 Calculation of Channel Conductance using Recurrent Neural Network

Masaaki Takahashi and Kiyohisa Natsume Kyusyu Institute of Technology

The electrical activities of neurons are induced by many channels located in the neuron’s plasma membrane. In order to simulate neuronal activity, there are two methods. One is to inference the channel dynamics using the time course of the membrane potential [1]. The other one is to formulate it directly using that of channel conductance. The former is a top-down approach, and the latter is a bottom-up approach. We want to select several kinds of the channels to design a neuron freely and simulate it easily. Hence, we are taking the bottom-up approach. For the approach, it is necessary to estimate the differential equations to formulate the time course of the current-voltage relationship of the channel recorded by the voltage clamp experiment. Formulating such differential equations is the most difficult. To simulate the current without formulating them, we used the recurrent neural network (RNN) technology.

The RNN is a neural network technology, and can automatically learn and reproduce a time sequence [2]. The network has recurrent connections. Using the connections past outputs of units can associate with the current outputs, making it possible to memorize the time sequence. We attempted to learn the dynamics of the conductance of neuronal channels using RNN.

In this study, we simulated with RNNs the results of the Hodgkin-Huxley model [3] which is the most famous model representing neuronal activity. The model is calculated by Na+, K+, and leak current which are dependent on neuronal membrane potential. Na+ and K+ channel conductances are dependent on membrane potential. We prepared the two RNNs to learn conductances of them respectively. The time course of the conductances for learning data was given by calculating them on the HH model using the 4th Runge-Kutta method. It was calculated by clamping the voltage value from -100 to +50 mV by 10 mV.

The HH model with the RNNs could reproduce neuronal responses against stimuli, rebound response, and responses to the constant stimulation, which were qualitatively the same as those of the HH model calculated directly using the differential equations.

In the future we would like to implement not only voltage-dependent but also Ca2+ dependent channel using RNN. [1] K.Doya, A.I. Slverston, P.F.Rowat. (1994) A Hodgkin-Huxley type neuron model that learns slow non-spike oscillation.

Advances in Neural Information Processing Systems 6, 566-573 [2] Jordan M.(1986). A parallel distributed processing approach. ICS Report 8604. [3] Hodgkin A. and Huxley A.(1952). A quantitative description of membrane current and its application to conduction and

excitation in nerve. Journal of Physiology 117, 500-544.