t wang et al. nature 000 , 1-5 (2013) doi:10.1038/nature12045

T Wang et al. Nature 000, 1-5 (2013) doi:10.1038/nature12045 The coupling between EcfT and EcfA– EcfA′.

Upload: wilbur

Post on 24-Jan-2016

21 views

Category:

Documents

1 download

Report

Download

Tags:

t wang

Embed Size (px):

DESCRIPTION

The coupling between EcfT and EcfA– EcfA′. T Wang et al. Nature 000 , 1-5 (2013) doi:10.1038/nature12045. - PowerPoint PPT Presentation

TRANSCRIPT

T Wang et al. Nature 000, 1-5 (2013) doi:10.1038/nature12045

The coupling between EcfT and EcfA–EcfA′.

GI Motility online (May 2006) | doi:10.1038/gimo48

Published in Nature Materials (2016) doi:10.1038/nmat4569

Neuropsychopharmacology (2013) 38 , 1521-1534; doi:10.1038/npp.2013.51

XQ Wang et al. Nature 461 , 947 - 955 (2009) doi:10.1038/nature08 435

DOI: 10.1038/NMAT4299 Supplementary file for P … · SUPPLEMENTARY INFORMATION. DOI: 10.1038/NMAT4299. NATURE MATERIALS | . 1 1 Supplementary file for Photo-oxidation and quantum

DOI: 10.1038/NMAT4228 - imechanicaimechanica.org/files/nmat4228-s1_0.pdf · SUPPLEMENTARY INFORMATION. DOI: 10.1038/NMAT4228. NATURE MATERIALS | . 1. 1. In Situ Atomic-Scale Observation

Nature Biotechnology: doi:10.1038/nbtmanalis-lab.mit.edu/publications/stevens_SI.pdf · Nature Biotechnology: doi:10.1038/nbt.3697. Supplementary Figure 8 MAR or mass can be used

DOI: 10.1038/NPHYS3211 Supplementary Information for

Nature Neuroscience: doi:10.1038/nnNtrk2 TTTTTTTAGTTTTTTTTGTTAGTTAATAAA CACATCTCAATAATCAACCACATC BS Nature Neuroscience: doi:10.1038/nn.3976 Author Andrew Gordon Created Date 2/25/2015

Nature Biotechnology: doi:10.1038/nbt

Neuropsychopharmacology (2011) 36, 2406-2421; doi:10.1038/npp.2011.128

Nature Genetics doi:10.1038/ng · Aortic stenosis Aortic regurgitation Nature Genetics: doi:10.1038/ng.3618. Cardiomyopathy Hypertrophic card Pericardial Problem Pericarditis Pericardial

Guo et al ., Nature Materials, DOI:10.1038/ nmat3234 (2012)

GI Motility online (May 2006) | doi:10.1038/gimo12

Vol 453 1 May 2008 doi:10.1038/nature06733 LETTERS

DOI: 10.1038/NCHEM - Nature · NATURE CHEMISTRY | 3 DOI: 10.1038/NCHEM.1870 SUPPLEMENTARY INFORMATION S3 1. Syntheses (i) General methods and instrumentation

C Wang et al. Nature 000 , 1-6 (2013) doi:10.1038/nature12167

doi:10.1038/nature05202 LETTERS

Vol 437 15 September 2005 doi:10.1038/nature03943 LETTERS

Ecosystem turnover in palaeoecological records: …€¦ · Web viewNature Publishing Group: 53–59. DOI: 10.1038/nature08227. DOI: 10.1038/nature08227. Seddon AW, Macias-Fauria

DOI: 10.1038/NPHOTON.2015 - media.nature.com PHOTONICS | . 3. DOI: 10.1038/NPHOTON.2015. 181. SUPPEENTAR INORATION 1 polarized laser beams to …

Nature Genetics: doi:10.1038/ng - Seth Field's Lab at UCSDsethfield.ucsd.edu/Papers/Bielas..Gleeson NatureGenetics 2009 suppl... · Nature Genetics: doi:10.1038/ng.423. Supplemental

SCIENTIFIC REPORTS | 2 : 592 | DOI: 10.1038/srep00592

DOI: 10.1038/NMAT4143 - Nature Research...in – √ ((− ((((= √ (. (). (in (() (∼ × → in ≃), ∆ = (˜)/ (˜ +) ± × ˜/ = = ˜/ =. × ×−

Nature, 2008, Doi:10.1038/nature07103 Semrah Kati 09.02.2009

GI Motility online (May 2006) | doi:10.1038/gimo46

GI Motility online (May 2006) | doi:10.1038/gimo31

Neuropsychopharmacology (2014) 39 , 1603-1613; doi:10.1038/npp.2014.7

DOI: 10.1038/NMAT4204 Supplementary Information · SUPPLEMENTARY INFORMATION. DOI: 10.1038/NMAT4204. NATURE MATERIALS | . 1. 1 . Supplementary Information . High-precision realization

doi: 10.1038/nature09205 SupplementaryInformationfor ...projects.iq.harvard.edu/files/ped/files/nature09205-s1.pdf 2 doi: 10.1038/nature09205 SUPPLEMENTARY INFORMATION 10Asexualreproduction

doi:10.1038/nature12886 Neanderthal from the Altai

Nature Biotechnology: doi:10.1038/nbtmanalis-lab.mit.edu/publications/cermak_SI.pdf · Nature Biotechnology: doi:10.1038/nbt.3666. Supplementary Figure 13 Comparison of precision

Calcium modulates force sensing by the von ... - aj-lab.gitlab.io · ARTICLE nATuRE CommunICATIons | DoI: 10.1038/ncomms1385 nATuRE CommunICATIons | 2:385 | DoI: 10.1038/ncomms1385

17 September 2009 doi:10.1038/nature08355 LETTERS