supplementary information-lee et al - springer static …10.1007...articles for acta...

Articles for Acta Neuropathologica

Lee et al. 1

Supplementary Information

Remodeling of heterochromatin structure slows neuropathological progression and prolongs survival in an animal model of

Huntington’s disease

Junghee Lee, Yu Jin Hwang, Yunha Kim, Min Young Lee, Seung Jae Hyeon, Soojin Lee,

Dong Hyun Kim, Sung Jae Jang, Hyoenjoo Im, Sun-Joon Min, Hyunah Choo, Ae Nim Pae,

Dong Jin Kim, Kyung Sang Cho, Neil W. Kowall, and Hoon Ryu


Lee et al. 2

Supplementary Materials and Methods Primary neuron culture Mouse primary neurons were obtained from the neostriatum of B6C57BL/6 [embryonic day 15 (E15)] as described previously [Supplementary Reference 1-3]. All experiments were initiated 48 to 72 hr after plating. Under these conditions the primary neurons are not susceptible to camptothecin-induced cytotoxicity. For cytotoxicity studies, cells were rinsed with warm PBS and then placed in Minimum Essential Medium (MEM; Life Technologies, Gaithersburg, MD) with 5.5 g/l glucose, 10% FCS, 2 mM L-glutamine). Camptothecin (1µM) was treated to primary cultures for 12 hour with or without either 1hr pre-treatment of nogalamycin (1µM) or distamycin (1 µM). Neuronal cell viability was determined by phase contrast microscopy and 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) assay [Supplementary References 1-3]. Supplementary Reference 1. Ryu H, Lee J, Zaman K, Kubilis J, Ferrante RJ, Ross BD, Neve R, Ratan RR (2003a) Sp1

and Sp3 are oxidative stress-inducible, antideath transcription factors in cortical neurons. J Neurosci 23: 3597-3606.

2. Ryu H, Lee J, Olofsson BA, Mwidau A, Deodoglu A, Escudero M, Flemington E, Azizkhan-Clifford J, Ferrante RJ, Ratan RR (2003b) Histone deacetylase inhibitors prevent oxidative neuronal death independent of expanded polyglutamine repeats via an Sp1-dependent pathway. Proc Natl Acad Sci USA 100: 4281-4286.

3. Lee J, Kosaras B, Del Signore SJ, Cormier K, McKee A, Ratan RR, Kowall NW, Ryu H (2010) Modulation of lipid peroxidation and mitochondrial function improves neuropathology in Huntington's disease mice. Acta Neuropathol 121:487-498


Lee et al. 3

Supplementary Table 3. The list of qPCR primers for the detection of mRNA levels in mouse cells and brains.

Gene Oligo Sequence

Arc Forward: 5'- GGA GTT CAA GAA GGA GTT TC -3'

Reverse: 5'- CCA CAT ACT GAA TGA TCT CC -3'

Egr1 Forward: 5'- AAC TTC AGT CGT AGT GAC CA -3'

Reverse: 5'- CCA CAC TTT TGT CTG CTT TC -3'

Ezh1 Forward: 5'- GTG AAG GAA GAA GAT GAG AC -3'

Reverse: 5'- TCA TCA GAG TAC TGG TTG AG -3'

Fos Forward: 5'- GAG CTG ACA GAT ACA CTC CA -3'

Reverse: 5'- CAG ACC TCC AGT CAA ATC CA -3'

Gabarapl2 Forward: 5'- AGT GGA TGT TTA AGG AGG AC -3'

Reverse: 5'- GAT GAT CCA CAT GAA CTG AG -3'

Gapdh Forward: 5'- CCG TGT TCC TAC CCC CAA T -3'

Reverse: 5'- CTT CAC CAC CTT CTT GAT GTC ATC -3'

Setdb1 Forward: 5'- GGC TCT CAG AAT CAT GGA CA -3'

Reverse: 5'- CTA TCA ACA GCT GTG GCT GA -3'


Lee et al. 4

Supplementary Table 4. The list of qPCR primers for the detection of H3K9me3 occupancy in the 5’-UTR promoter of Setdb1/Eset gene.

Primer

name

Binding

region

Sequence Primer

length

Primer1-F -1179~-1158 AATGCCCTACTTCACACATGCA 22mer

Primer1-R -982~-963 GCCAAACCCAGGCAAACTGA 20mer

Primer2-F -334~-315 GGTTAGACTCGGTGTAGTGA 20mer

Primer2-R -159~-140 GAGCCTCATCTTCTCACACA 20mer

Primers were designed through BLAST/GRCm38 to target two 5’-UTR regions of Setdb1 promoter (-1179~-

963/-334~ (upstream) and -315~-140 (down stream) from the CDS region). Mouse Setdb1 is located in

Chromosome 3: 95,323,525-95,357,202 reverse strand. GRCm38: CM000996.2.


Lee et al. 5

Supplementary Table 5. The list of qPCR primers for the detection of human mutant HTT and mouse endogenous Htt mRNA levels.

Gene Oligo Sequence

HTT Forward: 5'-AGG TTC GCT TTT ACC TGC GG-3'

Reverse: 5'-CAT CAG CTT TTC CAG GGT CG-3'

Htt Forward: 5'-CCC CAT TCA TTG CCT TGC TG-3'

Reverse: 5'-CTT GAG CGA CTC GAA AGC CT-3'


Lee et al. 6

Supplementary Figure 1. Western blot analysis with anti-SETDB1 antibody shows the specificity for SETDB1 protein. a, Anti-SETDB1 rabbit antibody (Santa Cruz, sc-66884)

detected the expression of Myc-tagged SETDB1 protein. The major band of SETDB1 protein

was found at 180kDa (red arrow). Cells (HEK293) were transiently transfected with Myc-His

or Myc-SETDB1 plasmid DNAs for 48h and then harvested for the immunoblot analysis. b, The Myc antibody (MBL, M192-3) detected the expression of Myc-tagged SETDB1. c, The

immunoblotting with STDEB1 antibody confirmed that the endogenous level of SETDB1

protein is increased in HD striatal cells (STHdhQ111/111) compared to wild type cells

(STHdhQ7/7). This image (panel c) represents the full blot of SETDB1 protein in the main

Figure 2c.


Lee et al. 7

Supple Figure 2. Nogalamycin reduces the colocalization of heterochromatin binding

protein 1 alpha (HP1α) and H3K9me3 in HD transgenic (R6/2) mice. a, Nogalamycin

reduces the level of HP1α in the striatum of R6/2 mice. Scale bar: 10 µm. b, Nogalamycin

reduces the level of H3K9me3 in the striatum of R6/2 mice. WT (n=5); R6/2 (n=5);

R6/2+nogalamycin (R6/2+Nogala) (n=5). c, The alteration in HP1α level is correlated with

H3K9me3 level in the striatum. Nogalamycin administration shifted the correlation levels of

H3K9me3 and HP1α in the striatum of R6/2 mice. Significantly different from WT at **p <

0.001. Significantly different from R6/2 at ##p < 0.001.


Lee et al. 8

Supplementary Figure 3. Analysis of the dimethylated H3K9 (H3K9me2) level and its colocalization with nucleosomal structure using deconvolved and 3-D constructed confocal images. a, Deconvolved image shows punctate structures of H3K9me3 (red) in the

nuclei of striatal neurons in WT (n=5), R6/2 mice (n=5), and nogalamycin-treated R6/2 mice

(R6/2+Nogala) (n=5). Scale bar: 10µm. Significantly different from R6/2 mice at **p < 0.001.

b, Nogalamycin reduced the density of H3K9me2 in R6/2 mice. 3-D rendering (deconvolved

and isosurface) images showing that H3K9me2 (red) is landscaped spatially apposed to

pericentromere structure (blue) in the striatal neuron of R6/2 mice. Nogalamycin reduced the

volume expansion of pericentromeric structure. Scale bars (white): 5µm.


Lee et al. 9

Supplementary Figure 4. Nogalamycin modulates the ratio of H3K9me3 versus acetylated histone H3K9 (H3K9ac) in the striatum of HD transgenic (R6/2) mice. a,

Nogalamycin improves the H3K9ac immunoreactivity in the striatum of R6/2 mice. The

H3K9ac immunoreactivity was reduced in striatal neurons of R6/2 mice compared with WT

mice. Scale bar, 10 µm. b, Densitometry analysis shows that nogalamycin restores the level

of H3K9ac in the striatum of R6/2 mice. WT (n=5); R6/2 (n=5); R6/2 + nogalamycin

(R6/2+Nogala) (n=5). Significantly different from WT at **p < 0.001. Significantly different

from R6/2 at #p < 0.05. c, Nogalamycin balances the acetylation and the trimethylation of

H3K9. Examination of the proportion of H3K9me3 to H3K9ac reveals a shift towards greater

methylation in R6/2 mice relative to WT control mice. Nogalamycin shifts the H3K9me3 level

and balances the ratio of H3K9me3 versus H3K9ac towards the level in WT mice.


Lee et al. 10

Supplementary Figure 5. Scatter plot analysis of H3K9me-ChIP-on-ChIP array from the striatal tissue of WT, R6/2, and R6/2 + nogalamycin (Nogala) mice. a, The distributions of

H3K9me3-enriched DNA are well normalized between WT versus R6/2 mice. B, The

distributions of H3K9me3-enriched DNA are well normalized between R6/2 versus R6/2 +

Nogala mice.


Lee et al. 11

Figure 6. The effect of nogalamycin on motor behavior in WT mice. a, Scheme showing

experimental procedure of nogalamycin treatment and rotarod tests in WT mice. Mice were

treated with nogalamycin from 5 to 8 weeks of age. Rotarod tests were measured three times

at 6, 7 and 8 weeks of age. b, Nogalamycin (Nogala) administration did not influence the

rotarod performance in WT mice. WT (n=5); WT + Nogala (n=5).


Lee et al. 12

Supplementary Figure 7. Nogalamycin reduces immunoreactivity of mHtt in the striatum of HD transgenic (R6/2) mice. a, Light microscopy images show that nogalamycin

decreases mHtt immunoreactivity in the striatal neurons of R6//2 mice compared to the

vehicle-treated R6/2 mice. b, Densitometry analysis shows that nogalamycin decreases mHtt

immunoreactivity in the cytosol of striatal neurons compared to the vehicle-treated R6/2 mice.

WT (n=5); R6/2 (n=5); R6/2 + nogalamycin (R6/2+Nogala) (n=5). Significantly different at **,

p<0.001. Scale bar: 10 µm.


Lee et al. 13

Supplementary Figure 8. Effect of nogalamycin on endogenous Htt and mutant HTT (mHTT) transgene expression in HD transgenic (R6/2) mice. a, qPCR analysis of Htt

expression in the striatal tissue of WT (n=3), R6/2 mice (n=3), and nogalamycin-treated

(Nogala) R6/2 mice (n=3). Nogalamycin did not affect the expression level of endogenous

Htt. Htt expression was normalized to Gapdh expression. b The relative mRNA expression of

mHTT transgene in the striatal tissue of WT (n=3), R6/2 mice (n=3), and nogalamycin-treated

(Nogala) R6/2 mice (n=3). Nogalamycin did not affect the expression level of mHTT. c The

agarose gel analysis represents that nogalamycin does not affect mRNA levels of

endogenous Htt, mHTT transgene, and Gapdh in the striatum of R6/2 mice.


Lee et al. 14

Supplementary Figure 9. Nogalamycin prevents camptothecin-induced primary neuronal death. a Nogalamycin protects primary neurons from genotoxic neuronal damage.

Phase contrast images show the morphology change of primary neurons in response to

camptothecin. Primary neurons (48 hr in vitro culture) were pretreated with nogalamycin (1

µM) or distamycin (1µM) 1 hr before camptothecin (1µM) treatment. b Nogalamycin increases

the viability of primary neurons against camptothecin-induced cell death. The graph

represents triplicate experiments. **Significantly different from control at p<0.01; ##Significantly different from camptothecin only at p<0.01; ♮♮Significantly different from

control at p<0.01.


Lee et al. 15

Supplementary Figure 10. Nogalamycin reduces immunoreactivity of activated caspase-3 in the striatum of HD transgenic (R6/2) mice. Caspase-3 immunoreactivity is

increased in striatal neurons of R6/2 mice compared to wild-type littermate mice at 10 weeks

of age (left panel). Nogalamycin decreases caspase-3 immunoreactivity in striatal neurons of

R6/2 mice. WT (n=5); R6/2 (n=5); R6/2 + nogalamycin (R6/2+Nogala) (n=5). Significantly

different from WT mice at **p < 0.001. Significantly different from R6/2 mice at ##p < 0.001.

supplementary information-lee et al - springer static …10.1007...articles for acta...

Documents