supplemental figure s1. comparisson of our microarray data...
TRANSCRIPT
Supplemental Figure S1. Comparisson of our microarray data with previous studies using venn diagrams.
log2FC values in red denotes oposite trend in expression.
A. Overlap between genes regulated by solar UV A+B in Ler with UV-B regulated genes
in wild-type plants (Brown et al., 2005 and Favory et al., 2009)
Ler UV AB Genes regulated by solar UV A+B in Ler after 12 h
Col UVB 6h↓ Genes with decreased expression in Col, UV-B 1.5 µmol m-2 s-1 for 6 h (Favory et al., 2009)
Col UVB 6h↑ Genes with increased expression in Col, UV-B 1.5 µmol m-2 s-1 for 6 h (Favory et al., 2009)
Ler UVB Genes induced in Ler, UV-B 3 µmol m-2 s-1 for 4 h (Brown et al., 2005)
A1. Ler UV AB vs Col UVB 6h↑ Symbol log2FC in our study
1 At5g07990 TT7 3,388
2 At4g04840 MSRB6 2,091
3 At1g65560 F5I14.9 1,551
4 At1g54570 T22H22.2 1,623
5 At5g48880 PKT2 1,733
6 At2g37040 PAL1 1,678
7 At1g06690 F12K11.2 1,080
8 At3g19170 PREP1 0,873
9 At1g36160 ACC1 1,233
10 At3g53260 PAL2 1,412
11 At1g48850 EMB1144 0,792
12 At5g51040 K3K7.22 0,770
13 At1g10522 … 0,831
14 At1g48570 T1N15.19 0,740
15 At1g73990 SPPA 1,101
16 At4g32770 VTE1 0,663
17 At1g12050 F12F1.8 0,710
18 At3g49320 F2K15.180 0,685
19 At3g57180 F15A17.240 0,636
20 At5g48470 MJE7.11 0,745
A2. Ler UV AB vs Col UVB 6h↑ vs Ler UVB
1 At5g62210 MMI9.4 2,212
2 At3g22840 ELIP1 1,678
3 At5g13930 CHS 1,412
4 At4g31870 GPX7 1,519
5 At4g14690 ELIP2 2,952
6 At5g60540 PDX2 1,286
7 At1g78570 RHM1 1,225
8 At5g08640 FLS1 1,470
9 At5g05270 K18I23.7 1,446
10 At3g55120 CHI 1,566
11 At5g17050 UGT78D2 0,999
12 At5g02270 ABCI20 0,900
13 At3g51240 F3H 1,952
14 At5g24850 CRY3 0,851
15 At5g23730 RUP 2 0,943
16 At1g06000 UGT89C1 0,953
17 At5g56090 COX15 0,863
18 At3g16530 MDC8.19 -1,490
19 At4g37760 SQE3 0,635
A3. Ler UV AB vs Ler UVB
1 At5g42800 DFR 1,197
2 At2g18690 MSF3.7 -1,375
3 At1g56060 T6H22.17 -1,660
4 At5g27420 CNI1 -1,412
5 At2g29350 SAG13 -0,844
6 At3g14620 CYP72A8 -1,009
7 At3g55980 SZF1 -1,016
8 At2g38470 WRKY33 -1,420
9 At2g02010 GAD4 -0,705
10 At4g27280 M4I22.90 -1,608
11 At2g18680 MSF3.6 -1,142
B. Overlap between candidate UVR8 regulated genes under solar UV A+B with
UVR8 regulated genes under UV-B (Brown et al., 2005)
uvr8-2 UVAB UVR8 regulated genes by solar UV A+B 12 h
UVR8 UV-B UVR8 regulated genes, UV-B 3 µmol m-2 s-1 for 4 h (Brown et al., 2005)
1 At5g24120 SIG5 1,222
2 At5g02270 ABCI20 0,643
3 At3g56290 F18O21.250 0,694
4 At5g42800 DFR -1,697
5 At1g78510 SPS 0,803
6 At3g17800 MEB5.2 0,922
C. Overlap between candidate UVR8 regulated genes under solar UV A+B with
UVR8 regulated genes under UV-B (Favory et al., 2009)
uvr8-2 UVAB UVR8 regulated genes by solar UV A+B 12 h
UVR8 1 h Genes not induced in uvr8-6 after 1 h UV-B (1.5 µmol m-2 s-1)
UVR8 6 h Genes not induced in uvr8-6 after 6 h UV-B (1.5 µmol m-2 s-1)
UVR8 96 h Genes not induced in uvr8-6 after 96 h UV-B (1.5 µmol m-2 s-1)
C1. uvr8-2 UVAB vs UVR8 1 h
1 At5g19240 T24G5.140 -1,107
2 At3g17800 MEB5.2 0,922
3 At1g28480 GRX480 -0,844
4 At3g05800 AIF1 0,741
C2. uvr8-2 UVAB vs UVR8 6 h
1 At4g30650 F17I23.10 -0,662
2 At1g69730 T6C23.7 -0,692
3 At5g01600 FER1 1,308
4 At3g56090 FER3 0,652
C3. uvr8-2 UVAB vs UVR8 1 h vs UVR8 6 h
1 At5g24120 SIG5 1,222
2 At5g18470 T28N17.6 -1,099
3 At1g78510 SPS 0,803
4 At1g19180 JAZ1 -0,795
5 At4g26530 M3E9.40 0,708
6 At3g56290 F18O21.250 0,694
7 At5g02270 ABCI20 0,643
8 At1g67070 PMI2 0,756
D. Overlap between wild type and uvr8-2 gene lists under UV A+B 12 h with
COP1 regulated genes under UV-B and white light (Oravecz et al., 2006)
uvr8-2 UVAB UVR8 regulated genes by solar UV A+B 12 h
COP1 UVB COP1 regulated genes under UVB
COP1 WL COP1 regulated genes under white light
Ler UV AB Genes regulated by solar UV A+B in Ler after 12 h
D1. uvr8 UV AB vs COP1 UVB
1 At1g28480 GRX480 -0,844
2 At1g78510 SPS 0,803
3 At1g67070 PMI2 0,756
D2. uvr8 UV AB vs COP1 WL
1 At3g28220 T19D11.1 -1,463
2 At5g19240 T24G5.140 -1,107
3 At1g19180 JAZ1 -0,795
D3. uvr8 UV AB vs COP1 UVB vs COP1 WL
1 At5g24120 SIG5 1,222
2 At3g17800 MEB5.2 0,922
3 At3g56290 F18O21.250 0,694
4 At5g01520 F7A740 0,949
D4. Ler UV AB vs COP1 UVB
1 At4g14690 ELIP2 2,952
2 At3g55980 SZF1 -1,016
3 At4g24570 DIC2 -1,619
4 At4g31870 GPX7 1,519
5 At5g17050 UGT78D2 0,999
6 At5g24850 CRY3 0,851
7 At5g62210 MMI9.4 2,212
8 At5g23730 RUP 2 0,943
9 At5g05270 K18I23.7 1,446
10 At5g60540 PDX2 1,286
11 At5g56090 COX15 0,863
12 At3g53260 PAL2 1,412
13 At1g65560 F5I14.9 1,551
14 At5g08640 FLS1 1,470
15 At3g55120 CHI 1,566
16 At4g32770 VTE1 0,663
17 At1g73990 SPPA 1,101
18 At1g06000 UGT89C1 0,953
19 At2g37040 PAL1 1,678
20 At5g13930 CHS 1,412
21 At1g06690 F12K11.2 1,080
D5. Ler UV AB vs COP1 WL
1 At4g37760 SQE3 0,635
D6. Ler UV AB vs COP1 UVB vs COP1 WL
1 At3g22840 ELIP1 1,678
2 At3g51240 F3H 1,952
D7. Ler UV AB vs COP1 UVB vs uvr8 UV AB
1 At5g02270 ABCI20 0,900
E. Overlap between wild type and uvr8-2 gene lists under UV A+B 12 h with
blue light regulated genes (Kleine et al., 2007)
uvr8-2 UVAB UVR8 regulated genes by solar UV A+B 12 h
Ler UV AB Genes regulated by solar UV A+B in Ler after 12 h
Blue light Blue light regulated genes, 3 h (200 µmol photons m-2 s-1)
E1. Ler UV AB vs Blue light
1 At3g22840 ELIP1 1,678
2 At3g51240 F3H 1,952
3 At5g62210 MMI9.4 2,212
4 At5g23730 RUP 2 0,943
5 At5g17050 UGT78D2 0,999
6 At5g05270 K18I23.7 1,446
7 At4g37760 SQE3 0,635
8 At5g08640 FLS1 1,470
9 At5g07990 TT7 3,388
10 At1g65560 F5I14.9 1,551
11 At4g04840 MSRB6 2,091
12 At4g32770 VTE1 0,663
13 At5g13930 CHS 1,412
14 At4g24570 DIC2 -1,619
15 At1g56060 T6H22.17 -1,660
16 At1g78570 RHM1 1,225
17 At3g14620 CYP72A8 -1,009
18 At3g11930 MEC18.3 0,816
19 At1g13650 F21F23.9 0,819
20 At1g19960 T20H2.25 -0,813
21 At5g48880 PKT2 1,733
22 At4g31870 GPX7 1,519
23 At2g37040 PAL1 1,678
24 At4g14690 ELIP2 2,952
25 At5g60540 PDX2 1,286
26 At1g06690 F12K11.2 1,080
27 At3g55120 CHI 1,566
28 At5g24850 CRY3 0,851
29 At1g06000 UGT89C1 0,953
30 At3g53260 PAL2 1,412
E2. uvr8 UV AB vs Blue light
1 At1g56650 PAP1 -1,484
2 At5g24120 SIG5 1,222
3 At3g56290 F18O21.250 0,694
4 At3g05800 AIF1 0,741
5 At1g78510 SPS 0,803
6 At3g29590 AT5MAT -1,397
7 At3g17800 MEB5.2 0,922
8 At5g01600 FER1 1,308
9 At4g30650 F17I23.10 -0,662
10 At3g56090 FER3 0,652
11 At5g54060 UF3GT -1,529
12 At5g47370 HAT2 -2,976
13 At1g31550 T8E3.19 -0,970
14 At2g14560 LURP1 -0,868
15 At1g19670 CLH1 -1,505
16 At2g28400 T1B3.8 -1,076
17 At1g16850 F6I1.15 -0,848
E3. Ler UV AB vs uvr8 UV AB vs Blue light
1 At5g02270 ABCI20
2 At5g42800 DFR
F. Overlap between wild type and uvr8-2 gene lists under UV A+B 12 h with high
light regulated genes (Kleine et al., 2007)
CRY1 High light regulated genes CRY1 dependent
Ler UV AB Genes regulated by solar UV A+B in Ler after 12 h
uvr8 UV AB UVR8 regulated genes by solar UV A+B 12 h
HY5 High light regulated genes HY5 dependent
F1. Ler UV AB vs CRY1 vs HY5
1 At4g14690 ELIP2 2,952
2 At4g31870 GPX7 1,519
3 At5g60540 PDX2 1,286
4 At5g24850 CRY3 0,851
5 At5g56090 COX15 0,863
6 At1g06000 UGT89C1 0,953
7 At2g37040 PAL1 1,678
8 At3g55120 CHI 1,566
9 At5g48880 PKT2 1,733
F2. Ler UV AB vs CRY1
1 At3g22840 ELIP1 1,678
2 At5g62210 MMI9.4 2,212
3 At5g08640 FLS1 1,470
4 At3g51240 F3H 1,952
F3. uvr82 UV AB vs HY5
1 At2g28400 T1B3.8 -1,076
2 At1g16850 F6I1.15 -0,848
3 At3g56400 WRKY70 -0,700
F4. uvr82 UV AB vs CRY1
1 At1g78510 SPS 0,803
2 At1g56650 PAP1 -1,484
F4. Ler UV AB vs uvr82 UV AB vs CRY1
1 At5g02270 ABCI20 0,900
Supplemental Figure S2. (A) Pictures of wild-type (Ler) and uvr8-2 plants
germinated and grown for three weeks outdoors under the UV treatments. Scale
bars = 1 cm. (B) Average number of flowering plants per pot.
Ler
uvr8-2
UV A+BUV AUV 0 A
B
0
1
2
3
4
5
6
UV 0 UV A UV A+B
Ler
uvr8-2
pN
um
be
r o
f la
nts
(λ)
(
−
−
)
Supplemental Figure S3. Spectral irradiance (W m-2 nm-1) under the UV treatments measured with a spectroradiometer Maya2000 Pro during a sunny day at noon.
Supplemental Table S1. Genes regualted by UV in wild-type Ler after 12 hLog2FC(log2 fold change)P (P-value adjusted for multiple testing)
No Gene symbol AGI No log2FC P Description1 MMI9.4 At5g62210 2,212 0,001 Embryo-specific protein 3, (ATS3)2 TT7 At5g07990 3,388 0,001 Required for flavonoid 3' hydroxylase activity3 MSRB6 At4g04840 2,091 0,001 Methionine sulfoxide reductase domain4 ELIP1 At3g22840 1,678 0,003 Encodes an early light-inducible protein5 F5I14.9 At1g65560 1,551 0,004 Zinc-binding dehydrogenase family protein6 T22H22.2 At1g54570 1,623 0,004 Esterase/lipase/thioesterase family protein7 CHS At5g13930 1,412 0,005 Encodes chalcone synthase (CHS)8 LDOX At4g22880 1,383 0,005 Encodes leucoanthocyanidin dioxygenase9 PKT2 At5g48880 1,733 0,005 Peroxisomal 3-keto-acyl-CoA thiolase 2 precursor10 GPX7 At4g31870 1,519 0,005 Encodes glutathione peroxidase11 PAL1 At2g37040 1,678 0,005 Encodes phenylalanine ammonia-lyase12 GSTF2 At4g02520 -1,711 0,008 Glutathione transferase, phi class of GSTs13 ELIP2 At4g14690 2,952 0,008 Encodes an early light-induced protein14 DFR At5g42800 1,197 0,008 Encodes dihydroflavonol reductase15 DIC2 At4g24570 -1,619 0,008 Mitochondrial dicarboxylate carriers (DIC)16 F14P13.5 At3g10350 1,115 0,008 Anion-transporting ATPase family protein17 PDX2 At5g60540 1,286 0,008 Involved in vitamin B6 biosynthesis18 F12K11.2 At1g06690 1,080 0,008 NAD(P)-linked oxidoreductase superfamily protein19 MSF3.7 At2g18690 -1,375 0,011 Unknown protein20 RHM1 At1g78570 1,225 0,013 Involved in the biosynthesis of rhamnose21 FLS1 At5g08640 1,470 0,021 Encodes a flavonol synthase 22 PCR2 At1g14870 -0,940 0,022 Encodes plant cadmium resistance 2 (PCR2)23 K18I23.7 At5g05270 1,446 0,023 chalcone-flavanone isomerase family protein24 CHI At3g55120 1,566 0,023 Catalyzes conversion of chalcones into flavanones25 UGT78D2 At5g17050 0,999 0,024 Encodes a anthocyanidin 3-O-glucosyltransferase 26 ABCI20 At5g02270 0,900 0,024 ATP-BINDING CASSETTE I20 (ABCI20)27 PREP1 At3g19170 0,873 0,025 Zinc metalloprotease pitrilysin subfamily A28 T6H22.17 At1g56060 -1,660 0,025 Unknown protein29 CNI1 At5g27420 -1,412 0,025 Encodes CNI1 (Carbon/Nitrogen Insensitive1)30 F3H At3g51240 1,952 0,025 Encodes flavanone 3-hydroxylase 31 ACC1 At1g36160 1,233 0,025 Encodes acetyl-CoA carboxylase32 F7H19.50 At4g22870 0,882 0,025 oxygenase superfamily protein33 PAL2 At3g53260 1,412 0,026 Encodes phenylalanine ammonia-lyase34 MPK3 At3g45640 -1,145 0,029 Response to UV-B and oxidative stress 35 … At5g26690 -1,177 0,029 Heavy-metal-associated domain-containing protein36 SAG13 At2g29350 -0,844 0,029 Senescence-associated gene SAG13 37 EMB1144 At1g48850 0,792 0,029 Embryo defective 1144 (EMB1144)38 CYP72A8 At3g14620 -1,009 0,029 Putative cytochrome P45039 K3K7.22 At5g51040 0,770 0,032 Unknown protein40 ARL At2g44080 -1,163 0,032 Cell expansion, brassinosteroid signaling pathway41 SZF1 At3g55980 -1,016 0,032 Salt inducible finger 1, transcription factor activity42 ERD13 At2g30870 -0,965 0,032 Early dehydration-induced gene43 PRB1 At2g14580 -2,009 0,029 Ethlylene, jasmonic acid and salycilic acid stimulus44 T20H2.25 At1g19960 -0,813 0,034 Unknown protein45 CRY3 At5g24850 0,851 0,034 Cryptochrome 346 … At1g10522 0,831 0,035 Unknown protein47 ALD1 At2g13810 -1,488 0,037 AGD2-Like defense response protein 1 (ALD1) 48 FAMT At3g44860 -0,792 0,037 farnesoic acid carboxyl-O-methyltransferase49 F1E22.7 At1g65690 -0,913 0,037 Late embryogenesis abundant (LEA) 50 F21F23.9 At1g13650 0,819 0,037 Unknown protein51 PCR1 At1g14880 -0,875 0,037 Plant Cadmium resistance 1 (PCR1)52 F3N23.11 At1g72910 -0,706 0,037 Defense response, signal transduction53 T9J22.6 At2g26390 -0,712 0,037 Serine protease inhibitor (SERPIN) family protein54 F18O19.11 At2g43780 0,726 0,037 Unknown protein55 T1N15.19 At1g48570 0,740 0,037 Zinc finger (Ran-binding) family protein56 MYM9.4 At3g23700 0,868 0,037 Nucleic acid-binding proteins superfamily57 SPPA At1g73990 1,101 0,039 Encodes a putative protease SppA (SppA).58 ISA3 At4g09020 -0,948 0,039 Encodes an isoamylase-like protein59 WRKY33 At2g38470 -1,420 0,043 Member of the plant WRKY transcription factor family60 F13O11.3 At1g64710 -0,962 0,045 GroES-like zinc-binding dehydrogenase family protein61 F24M12.370 At3g51330 -0,822 0,045 Eukaryotic aspartyl protease family protein62 RUP 2 At5g23730 0,943 0,045 Transducin/WD40 repeat-like superfamily protein63 RD22 At5g25610 -0,850 0,045 Responsive to dehydration mediated by ABA64 GRP-3 At2g05520 -0,688 0,045 Encodes a glycine-rich protein 65 PR1 At2g14610 -1,898 0,045 Pathogenesis related gene66 GAD4 At2g02010 -0,705 0,045 Glutamate decarboxylase 4 (GAD4)67 VTE1 At4g32770 0,663 0,045 Tocopherol cyclase 68 GSTF8 At2g47730 -0,651 0,045 Encodes glutathione transferase 69 CSLG2 At4g24000 -1,605 0,045 Encodes a protein similar to cellulose synthase70 T16L1.250 At4g33760 0,644 0,045 tRNA synthetase class II (D, K and N) family protein 71 UGT89C1 At1g06000 0,953 0,045 Encodes a flavonol-7-O-rhamnosyltransferase 72 COX15 At5g56090 0,863 0,045 Cytochrome C Oxidase 1573 F12F1.8 At1g12050 0,710 0,045 Fumarylacetoacetase putative
74 K20I9.8 At3g16850 -0,659 0,046 Pectin lyase-like superfamily protein75 ACYB-2 At4g25570 0,798 0,047 Encodes cytochrome b56176 MDC8.19 At3g16530 -1,490 0,048 Lectin like protein 77 MSN2.11 At5g66720 0,649 0,048 Protein phosphatase 2C family protein78 PME41 At4g02330 -0,780 0,048 Brassinosteroid stimulus, response to cold79 T31J12.3 At1g09310 -0,765 0,048 Unknown protein80 SQE3 At4g37760 0,635 0,049 Squalene epoxidase 3 (SQE3)81 F2K15.180 At3g49320 0,685 0,049 Metal-dependent protein hydrolase82 MEC18.3 At3g11930 0,816 0,049 Adenine nucleotide alpha hydrolases-like protein83 M4I22.90 At4g27280 -1,608 0,050 Calcium-binding EF-hand family protein84 NADP-ME2 At5g11670 -0,813 0,049 Encodes NADP-MALIC enzyme 2 85 MHJ24.1 At5g64170 -0,636 0,050 Dentin sialophosphoprotein-related86 GLX2-5 At2g31350 -0,620 0,050 Encodes a mitochondrial glyoxalase 2 87 MSF3.6 At2g18680 -1,142 0,050 Unknown protein88 TOM5 At5g08040 0,616 0,050 Mitochondrial import receptor subunit TOM5 homolog89 BG3 At3g57240 -1,388 0,050 Encodes a member of glycosyl hydrolase family 1790 MNB8.3 At5g52970 0,643 0,050 Thylakoid lumen 15.0 kDa protein91 F15A17.240 At5g03210 -0,870 0,050 Unknown protein92 F15A17.240 At3g57180 0,636 0,050 Brassinazole Insensitive Pale Green 293 T20F21.27 At2g35710 -0,912 0,053 Nucleotide-diphospho-sugar transferase94 MJE7.11 At5g48470 0,745 0,050 Unknown protein95 MZN24.8 At3g21940 0,633 0,050 Receptor protein kinase-related96 SEX4 At5g46230 -0,660 0,050 Protein phosphatase
Supplemental Table S2. Genes regualted by UV in uvr8-2 after 12hLogFC(log2 fold change)P (P-value adjusted for multiple testing)
No Gene symbol AGI No logFC P Description1 CLH1 At1g19670 -1,505 0,02 Chlorophyll degradation2 T19D11.1 At3g28220 -1,463 0,02 TRAF-like family protein3 LDOX At4g22880 -1,700 0,02 Encodes leucoanthocyanidin dioxygenase4 T1B3.8 At2g28400 -1,076 0,02 Protein of unknown function5 WAK1 At1g21250 -1,016 0,02 Cell wall-associated kinase, involved in signaling and SA stimulus6 SIG5 At5g24120 1,222 0,02 Sigma factor, response to blue, red and far red light 7 DFR At5g42800 -1,697 0,02 Encodes dihydroflavonol reductase8 T24G5.140 At5g19240 -1,107 0,02 Glycoprotein membrane precursor GPI-anchored9 F12E4.80 At5g03350 -1,322 0,02 Legume lectin family protein10 AOS At5g42650 -1,059 0,02 p450 CYP74 gene family that functions as an allene oxide synthase11 T28N17.6 At5g18470 -1,099 0,02 Curculin-like (mannose-binding) lectin family protein12 ANNAT1 At1g35720 -0,997 0,02 Encodes a member of the annexin gene family, response to stress 13 ATR4 At4g31500 -0,965 0,02 Involved in the biosynthetic pathway of glucosinolates14 ANK At5g54610 -1,228 0,03 Belongs to the ankyrin repeat protein family, response to SA stimulus15 XPL1 At3g18000 0,844 0,03 N-methyltransferase-like protein, lipid biosynthesis and reproduction 16 RLK At2g37710 -0,943 0,03 Receptor lectin kinase, phosphorilation, response to SA stimulus17 MEB5.2 At3g17800 0,922 0,03 Response to UV-B18 T1P17.80 At4g12490 -0,918 0,03 defence response to fungus19 GRX480 At1g28480 -0,844 0,04 Glutaredoxin family, involved in SA/JA signaling pathways20 AT5MAT At3g29590 -1,397 0,04 anthocyanidin 5-O-glucoside-6"-O-malonyltransferase 21 LHT7 At4g35180 -0,832 0,04 Lys/His transporter 7 22 MXO21.9 At3g29240 -0,813 0,04 Protein of unknown function23 T6J4.20 At1g13470 -0,964 0,04 Protein of unknown function24 SPS At1g78510 0,803 0,04 Solanesyl diphosphate synthase activity25 FAMT At3g44860 -0,873 0,04 Encodes farnesoic acid carboxyl-O-methyltransferase26 F7H19.50 At4g22870 -1,388 0,04 2-oxoglutarate (2OG) and Fe(II)-dependent oxygenase protein27 F4L23.31 At2g45180 0,941 0,04 Bifunctional inhibitor/lipid-transfer protein28 F14D7.1 At1g35710 -1,127 0,04 Protein kinase family protein with leucine-rich repeat domain29 LURP1 At2g14560 -0,868 0,04 Response to Hyaloperonospora parasitica30 T22A6.310 At4g24480 3,502 0,04 Protein kinase 31 GRP19 At5g07550 3,452 0,04 Glycine rich protein 19, lipid storage and sexual reproduction32 F12K8.24 At1g22410 -0,721 0,05 Class-II DAHP synthetase family protein33 AOC1 At3g25760 -0,776 0,05 Encodes allene oxide cyclase, jasmonic acid biosynthesis34 AGP21 At1g55330 1,021 0,05 Encodes a putative arabinogalactan-protein (AGP21)35 JAZ1 At1g19180 -0,795 0,05 Jasmonate-Zim-Domain protein 1, involved in defence response36 M3E9.40 At4g26530 0,708 0,05 Aldolase superfamily protein37 AOC3 At3g25780 -0,997 0,05 Involved in jasmonic acid biosynthesis38 PPa5 At4g01480 -0,777 0,05 Encodes a protein that might have inorganic pyrophosphatase activity39 XBAT34 At4g14365 -0,990 0,05 Zinc ion binding protein40 T16B24.15 At2g39210 -0,768 0,05 Major facilitator superfamily protein41 UF3GT At5g54060 -1,529 0,05 UDP-glucose:flavonoid 3-o-glucosyltransferase42 T8E3.19 At1g31550 -0,970 0,05 GDSL-like Lipase/Acylhydrolase superfamily protein43 F21A20.190 At5g27480 -3,179 0,05 transposable element gene44 HAT2 At5g47370 -2,976 0,05 Auxin mediated signaling pathway45 DL4760C At4g17450 2,927 0,05 Transposable element gene46 ERD13 At2g30870 -0,697 0,05 Early dehydration-induced gene , response to water deprivation47 SYR1 At3g11820 -0,780 0,05 Defence response, JA mediating signaling pathway48 T3K9.5 At2g41180 -0,882 0,05 Protein of unknown function49 SIB1 At3g56710 -0,856 0,05 SIGMA FACTOR BINDING PROTEIN 1 (SIB1)50 F15K19.1, At2g10940 0,783 0,05 Bifunctional inhibitor/lipid-transfer protein51 F6I1.15 At1g16850 -0,848 0,05 Response to salt stress52 T3K9.14 At2g41090 -0,765 0,05 Calcium-binding EF-hand family protein53 F21M11.2 At1g04040 0,872 0,05 HAD superfamily54 DL4760C At4g17450 2,927 0,05 transposable element gene55 F6H5.8 At3g32220 2,788 0,06 Gypsy-like retrotransposon family 56 HPL1 At4g15440 -1,085 0,06 HYDROPEROXIDE LYASE 1 (HPL1), response to wounding57 AIF1 At3g05800 0,741 0,06 Brassinosteroid mediated signaling pathway58 MES5 At5g10300 -0,746 0,06 METHYL ESTERASE 5 (MES5)59 PAP1 At1g56650 -1,484 0,06 PRODUCTION OF ANTHOCYANIN PIGMENT 1 (PAP1)60 WRKY70 At3g56400 -0,700 0,06 WRKY DNA-BINDING PROTEIN 70 (WRKY70), defence response61 F18O21.250 At3g56290 0,694 0,06 Protein of unknown function62 F7A740 At5g01520 0,949 0,06 RING/U-box superfamily protein involved in zinc ion binding63 T24G5.150 At5g19250 -0,630 0,06 Protein of unknown function64 F17I23.10 At4g30650 -0,662 0,06 Low temperature and salt responsive protein, defence response65 ABCI20 At5g02270 0,643 0,06 ATP-BINDING CASSETTE I20 (ABCI20)66 At5g26690 -0,833 0,06 Heavy metal transport/detoxification superfamily protein67 MKK4 At1g51660 -0,636 0,06 Mitogen-activated map kinase, defence response68 SOT17 At1g18590 -0,615 0,06 SULFOTRANSFERASE 17, glucosinolate core structure biosynthesis69 F6N7.24 At5g52750 -0,836 0,06 Heavy metal transport/detoxification superfamily protein
70 T6C23.7 At1g69730 -0,692 0,06 Wall-associated kinase family protein71 T32A17.160 At4g08850 -0,830 0,06 Leucine-rich repeat receptor-like protein kinase family protein72 F28O16.9 At1g76720 0,652 0,06 eukaryotic translation initiation factor 2 (eIF-2) family protein73 F6H5.8 At3g32220 2,788 0,06 transposable element gene74 F12F1.28 At1g11880 2,457 0,07 GPI anchor biosynthetic process, lipid biosynthetic processes75 LCR27 At4g29300 2,393 0,07 Protein of unknown function76 F1M20.12 At1g74440 -0,642 0,07 Protein of unknown function77 AGP31 At1g28290 0,935 0,07 ARABINOGALACTAN PROTEIN 31, response to JA stimulus78 FER1 At5g01600 1,308 0,07 FERRETIN 1 (FER1), response to ROS79 FER3 At3g56090 0,652 0,07 FERRITIN 3 (FER3), response to ROS80 UCP5 At2g22500 -0,660 0,07 Uncoupling protein 581 IGMT5 At1g76790 -0,906 0,07 INDOLE GLUCOSINOLATE O-METHYLTRANSFERASE 5 (IGMT5)82 JR1 At3g16470 -0,758 0,07 JASMONATE RESPONSIVE 1 (JR1), response to abiotic stress83 PMI2 At1g67070 0,756 0,07 L-ascorbic acid biosynthesis84 BTS At3g18290 -0,631 0,07 E3 ligase protein with metal ion binding and DNA binding domains85 PRXCB At3g49120 -0,674 0,07 PEROXIDASE CB, defence response to bacteria and fungus86 ATPCB At3g49120 -0,674 0,07 Defence response to bacterium and fungus87 OPR3 At2g06050 -0,799 0,07 Jasmonic acid biosynthesis process88 T7N9.9 At1g27030 -0,749 0,07 Protein of unknown function89 ATPLC1 At5g58670 -0,657 0,07 Stress response, ABA mediated signaling pathway
Supplemental Table S3. Detailed information on experiments represented in the Bayesian cluster (Fig. 1)
Experiment Annotation Treatment UV-BBE Reference
Col-0 MeJA 6 h EATMX-13 50 µM methyl jasmonate 1
Col-0 MeJA 30 min EATMX-13 50 µM methyl jasmonate 1
Col-0 MeJA 2 h EATMX-13 50 µM methyl jasmonate 1
Col-0 ABA 30 min NASCARRAYS-176 10 µM abscisic acid 30 min 7
Col-0 ABA 1 h NASCARRAYS-176 10 µM abscisic acid 1 h 7
cop1-4 305 nm 15 min E-MEXP-557 Broadband UVB (305 nm cut-off) 0.12 Wm2 2
WS 305 nm 6 h E-MEXP-550 Broadband UVB (305 nm cut-off) 0.12 Wm2 3
WS 295 nm 6 h E-MEXP-550 Broadband UVB (295 nm cut-off) 0.42 Wm2 3
uvr8-6 305 nm 1 h E-MEXP-1957 Narrowband UVB (305 nm cut-off) 1.5 µmol m-2 s-1 4
Col-0 unfiltered UV lamps 15 min NASCARRAYS-137 Broadband UVB 15 min 1.18 Wm2 NA
uvr8-6 305 nm 6h E-MEXP-1957 Narrowband UVB (305 nm cut-off) 1.5 µmol m-2 s-1 4
Col-0 SA 24 h GSE14961 2mM salicylic acid 24 h NA
Col-0 Ethylene 4 h GSE14247 Ethylene gas 10 ppm 5
Col-0 BTH 8 h NASCARRAYS-392 60 µM BTH 8 h NA
WS unfiltered UV lamps 6 h E-MEXP-550 Broadband UVB (unfiltered) 1.18 Wm2 3
Col-0 unfiltered UV lamps 15 min harvested 3 h NASCARRAYS-144 Broadband UVB 15 min 1.18 Wm2 6
Col-0 unfiltered UV lamps 15 min harvested 6 h NASCARRAYS-144 Broadband UVB 15 min 1.18 Wm2 6
Ler 305 nm 15 min E-MEXP-557 Narrowband UVB (305 nm cut-off) 0.12 Wm2 2
Col-0 305 nm 15 min E-MEXP-557 Narrowband UVB (305 nm cut-off) 0.12 Wm2 2
WS 305 nm 1 h E-MEXP-550 Broadband UVB (305 nm cut-off) 0.12 Wm2 3
Col-0 305 nm 1 h E-MEXP-1957 Narrowband UVB (305 nm cut-off) 1.5 µmol m-2 s-1 4
Col-0 305 nm 6 h E-MEXP-1957 Narrowband UVB (305 nm cut-off) 1.5 µmol m-2 s-1 4
hy5 305 nm 15 min E-MEXP-557 Broadband UVB (305 nm cut-off) 0.12 Wm2 2
WS unfiltered UV lamps 1 h E-MEXP-550 Broadband UVB (unfiltered) 1.18 Wm2 3
WS 295 nm 1 h E-MEXP-550 Broadband UVB (295 nm cut-off) 0.42 Wm2 3
Col-0 unfiltered UV lamps 15 min harvested 1 h NASCARRAYS-144 Broadband UVB 15 min 1.18 Wm2 6
Col-0 unfiltered UV lamps 15 min harvested 30 min NASCARRAYS-144 Broadband UVB 15 min 1.18 Wm2 6
Col-0 ABA 3 h NASCARRAYS-176 10 µM abscisic acid 3 h 7
Col-0 SA 3 h NASCARRAYS-192 10 µM salicylic acid 3 h NA
Col-0 unfiltered UV lamps 15 min harvested 12 h NASCARRAYS-144 Broadband UVB 15 min 1.18 Wm2 6
Col-0 unfiltered UV lamps 15 min harvested 24 h NASCARRAYS-144 Broadband UVB 15 min 1.18 Wm2 6
Reference
Pauwels et al (2008) Proc Natl Acad Sci USA 105: 1380-1385 1
Oravecz et al (2006) Plant Cell 18: 1975–1990 2
Ulm et al (2004) Proc Natl Acad Sci USA 101: 1397–1402 3
Favory et al (2009) EMBO J 28: 591–601 4
Qiao et al (2009) Genes Dev 23: 512-21 5
Kilian et al (2007) Plant J 50 :347-363 6
Goda et al (2008) Plant J 55: 526-542 7
Non available NA
Supplemental Table S4. Detailed information on genes represented in the Bayesian cluster (Fig. 1).
Genes shown in Fig. 1 as they appear from left to right. The fold change induction in wild-type and uvr8-2
with the corresponding P value and the cluster they group are also given
Wild-type uvr8-2
No AGI code LogFc P LogFc P Cluster
1 At5g64170 -0,64 0,05 I
2 At5g62210 2,21 0,001 I
3 At5g60540 1,29 0,01 I
4 At5g54060 -1,53 0,05 I
5 At5g52970 0,64 0,05 I
6 At5g51040 0,77 0,03 I
7 At5g48880 1,73 0,01 I
8 At5g48470 0,74 0,05 I
9 At5g42800 1,20 0,01 -1,70 0,02 I
10 At5g42650 -1,06 0,02 I
11 At5g25610 -0,85 0,04 I
12 At5g24850 0,85 0,03 I
13 At5g23730 0,94 0,04 I
14 At5g19250 -0,63 0,06 I
15 At5g17050 1,00 0,02 I
16 At5g13930 1,41 0,005 I
17 At5g11670 -0,81 0,05 I
18 At5g08640 1,47 0,02 I
19 At5g08040 0,62 0,05 I
20 At5g07990 3,39 0,001 I
21 At5g07550 3,45 0,04 I
22 At5g05270 1,45 0,02 I
23 At5g03210 -0,87 0,05 I
24 At5g02270 0,90 0,02 0,64 0,06 I
25 At5g01600 1,31 0,07 I
26 At5g01520 0,95 0,06 I
27 At4g37760 0,63 0,05 I
28 At4g33760 0,64 0,04 I
29 At4g32770 0,66 0,04 I
30 At4g30650 -0,66 0,06 I
31 At4g26530 0,71 0,05 I
32 At4g25570 0,80 0,05 I
33 At4g24570 -1,62 0,01 I
34 At4g24480 3,50 0,04 I
35 At4g24000 -1,61 0,04 I
36 At4g15440 -1,08 0,06 I
37 At4g12490 -0,92 0,03 I
38 At4g09020 -0,95 0,04 I
39 At4g04840 2,09 0,001 I
40 At4g02330 -0,78 0,05 I
41 At4g01480 -0,78 0,05 I
42 At3g57180 0,64 0,05 I
43 At3g56290 0,69 0,06 I
44 At3g56090 0,65 0,07 I
45 At3g55120 1,57 0,02 I
46 At3g53260 1,41 0,03 I
47 At3g52180 -0,66 0,05 I
48 At3g51330 -0,82 0,04 I
49 At3g49320 0,68 0,05 I
50 At3g45640 -1,14 0,03 I
51 At3g32220 2,79 0,06 I
52 At3g29590 -1,40 0,04 I
53 At3g29240 -0,81 0,04 I
54 At3g23700 0,87 0,04 I
55 At3g19170 0,87 0,02 I
56 At3g18290 -0,63 0,07 I
57 At3g18000 0,84 0,03 I
58 At3g17800 0,92 0,03 I
59 At3g16850 -0,66 0,05 I
60 At3g16470 -0,76 0,07 I
61 At3g11930 0,82 0,05 I
62 At3g10350 1,11 0,01 I
63 At3g05800 0,74 0,06 I
64 At2g45180 0,94 0,04 I
65 At2g44080 -1,16 0,03 I
66 At2g43780 0,73 0,04 I
67 At2g41090 -0,77 0,05 I
68 At2g35710 -0,91 0,05 I
69 At2g31350 -0,62 0,05 I
70 At2g30870 -0,96 0,03 -0,70 0,05 I
71 At2g26390 -0,71 0,04 I
72 At2g14580 -2,01 0,03 I
73 At2g13810 -1,49 0,04 I
74 At2g10940 0,78 0,05 I
75 At2g05520 -0,69 0,04 I
76 At1g78570 1,23 0,01 I
77 At1g78510 0,80 0,04 I
78 At1g76790 -0,91 0,07 I
79 At1g74440 -0,64 0,07 I
80 At1g73990 1,10 0,04 I
81 At1g69730 -0,69 0,06 I
82 At1g67070 0,76 0,07 I
83 At1g64710 -0,96 0,04 I
84 At1g56650 -1,48 0,06 I
85 At1g55330 1,02 0,05 I
86 At1g54570 1,62 0,00 I
87 At1g48850 0,79 0,03 I
88 At1g48570 0,74 0,04 I
89 At1g36160 1,23 0,03 I
90 At1g35720 -1,00 0,02 I
91 At1g35710 -1,13 0,04 I
92 At1g31550 -0,97 0,05 I
93 At1g28290 0,93 0,07 I
94 At1g22410 -0,72 0,05 I
95 At1g19670 -1,51 0,02 I
96 At1g18590 -0,61 0,06 I
97 At1g16850 -0,85 0,05 I
98 At1g13650 0,82 0,04 I
99 At1g12050 0,71 0,05 I
100 At1g10522 0,83 0,04 I
101 At1g09310 -0,76 0,05 I
102 At1g06690 1,08 0,01 I
103 At1g04040 0,87 0,05 I
104 At1g06000 0,95 0,04 I
105 At5g56090 0,86 0,05 II
106 At5g54610 -1,23 0,03 II
107 At5g52750 -0,84 0,06 II
108 At5g27420 -1,41 0,02 II
109 At5g24120 1,22 0,02 II
110 At5g19240 -1,11 0,02 II
111 At5g18470 -1,10 0,02 II
112 At5g10300 -0,75 0,06 II
113 At5g03350 -1,32 0,02 II
114 At4g35180 -0,83 0,04 II
115 At4g31870 1,52 0,01 II
116 At4g31500 -0,96 0,02 II
117 At4g27280 -1,61 0,05 II
118 At4g14690 2,95 0,008 II
119 At4g14365 -0,99 0,05 II
120 At4g08850 -0,83 0,06 II
121 At3g57240 -1,39 0,05 II
122 At3g56710 -0,86 0,05 II
123 At3g56400 -0,70 0,06 II
124 At3g55980 -1,02 0,03 II
125 At3g51240 1,95 0,02 II
126 At3g28220 -1,46 0,02 II
127 At3g25780 -1,00 0,05 II
128 At3g22840 1,68 0,00 II
129 At3g16530 -1,49 0,05 II
130 At3g14620 -1,01 0,03 II
131 At3g11820 -0,78 0,05 II
132 At2g47730 -0,65 0,04 II
133 At2g41180 -0,88 0,05 II
134 At2g39210 -0,77 0,05 II
135 At2g38470 -1,42 0,04 II
136 At2g37710 -0,94 0,03 II
137 At2g37040 1,68 0,01 II
138 At2g29350 -0,84 0,03 II
139 At2g28400 -1,076 0,022 II
140 At2g22500 -0,660 0,070 II
141 At2g18690 -1,38 0,01 II
142 At2g18680 -1,14 0,05 II
143 At2g14610 -1,90 0,04 II
144 At2g14560 -0,868 0,043 II
145 At1g65690 -0,91 0,04 II
146 At1g65560 1,55 0,004 II
147 At1g56060 -1,66 0,02 II
148 At1g51660 -0,636 0,061 II
149 At1g28480 -0,84 0,04 II
150 At1g21250 -1,016 0,022 II
151 At1g19960 -0,81 0,03 -0,647 0,070 II
152 At1g13470 -0,964 0,039 II
153 At1g19180 -0,80 0,05 II
Supplemental Table S5. Summary of the ANOVA models used to estimate significant effects of the UV treatments,
genotype and the interaction UV treatment × genotype.
denDF (denominator degrees of freedom).
A. Gene expression measured by qPCR in Ler and uvr8-2 after 12 h and 36 h outdoors (denDF=10).
CHS 12 h 36 h
Source DF F P DF F P
UV treatment 2 172.67011 0.0001 2 13.054 0.2684
Genotype 1 2.37137 0.1546 1 194.572 0.0192
UV treatment × Genotype 2 4.37365 0.0432 2 0.508 0.8539
TT7 12 h 36 h
Source DF F P DF F P
UV treatment 2 444.3359 <.0001 2 1.1729722 0.3486
Genotype 1 0.0396 0.8463 1 0.4131218 0.5348
UV treatment × Genotype 2 16.7865 0.0006 2 0.0321327 0.9685
HY5 12 h 36 h
Source DF F P DF F P
UV treatment 2 69.74710 <.0001 2 0.869357 0.4486
Genotype 1 59.72127 <.0001 1 1.474632 0.2525
UV treatment × Genotype 2 13.25484 0.0015 2 2.086625 0.1748
COP1 12 h 36 h
Source DF F P DF F P
UV treatment 2 0.7669407 0.4899 2 0.243269 0.7891
Genotype 1 1.2245187 0.2944 1 4.578354 0.0611
UV treatment × Genotype 2 1.1872110 0.3446 2 0.163553 0.8516
RUP2 12 h 36 h
Source DF F P DF F P
UV treatment 2 101.24126 <.0001 2 8.129416 0.0080
Genotype 1 21.70823 0.0009 1 7.619618 0.0201
UV treatment × Genotype 2 6.96051 0.0128 2 6.013467 0.0193
MEB5.2 12 h 36 h
Source DF F P DF F P
UV treatment 2 64.14824 <.0001 2 2.445116 0.1366
Genotype 1 21.23567 0.0010 1 6.776489 0.0263
UV treatment × Genotype 2 24.05199 0.0002 2 0.775245 0.4864
UVR8 12 h 36 h
Source DF F P DF F P
UV treatment 2 2.826950 0.1064 2 0.8664652 0.4497
Genotype 1 1.575138 0.2380 1 1.0666859 0.3260
UV treatment × Genotype 2 1.509540 0.2674 2 0.7068470 0.5163
PDF1.2 12 h 36 h
Source DF F P DF F P
UV treatment 2 1.572442 0.2548 2 0.443872 0.6536
Genotype 1 26.035006 0.0005 1 5.800154 0.0368
UV treatment × Genotype 2 1.977243 0.1890 2 1.030977 0.3917
PAD3 12 h 36 h
Source DF F P DF F P
UV treatment 2 14.253639 0.0012 2 3.0009916 0.0953
Genotype 1 9.400364 0.0119 1 1.4275832 0.2597
UV treatment × Genotype 2 0.055472 0.9463 2 0.5473702 0.5949
RCD1 12 h 36 h
Source DF F P DF F P
UV treatment 2 2.045437 0.1800 2 0.04520444 0.9560
Genotype 1 4.851114 0.0522 1 0.00027605 0.9871
UV treatment × Genotype 2 1.485548 0.2723 2 0.00510732 0.9949
TAT3 12 h 36 h
Source DF F P DF F P
UV treatment 2 23.57744 0.0002 2 1.089156 0.3733
Genotype 1 37.26773 0.0001 1 4.181907 0.0681
UV treatment × Genotype 2 0.44426 0.6534 2 0.237446 0.7930
AOXI 12 h 36 h
Source DF F P DF F P
UV treatment 2 2.0943858 0.1739 2 1.780232 0.2181
Genotype 1 1.3606367 0.2705 1 5.055030 0.0483
UV treatment × Genotype 2 2.4631886 0.1350 2 1.060532 0.3822
VSP1 12 h 36 h
Source DF F P DF F P
UV treatment 2 3.957300 0.0542 2 0.347251 0.7148
Genotype 1 0.640493 0.4421 1 0.305930 0.5923
UV treatment × Genotype 2 0.482180 0.6311 2 5.075554 0.0301
ATR4 12 h 36 h
Source DF F P DF F P
UV treatment 2 24.01473 0.0002 2 4.861912 0.0335
Genotype 1 43.75311 0.0001 1 11.577140 0.0067
UV treatment × Genotype 2 0.24188 0.7896 2 4.456384 0.0413
LOX 12 h 36 h
Source DF F P DF F P
UV treatment 2 31.165994 0.0001 2 3.150325 0.0869
Genotype 1 19.480321 0.0013 1 3.069358 0.1103
UV treatment × Genotype 2 0.165441 0.8498 2 2.638543 0.1202
AOC3 12 h 36 h
Source DF F P DF F P
UV treatment 2 36.00602 <.0001 2 3.618573 0.0657
Genotype 1 15.22165 0.003 1 1.638847 0.2294
UV treatment × Genotype 2 1.22991 0.333 2 0.973183 0.4110
NCED3 12 h 36 h
Source DF F P DF F P
UV treatment 2 3.651143 0.0645 2 0.9178747 0.4305
Genotype 1 0.408353 0.5372 1 0.2800938 0.6082
UV treatment × Genotype 2 0.166253 0.8491 2 0.4680891 0.6393
AOS 12 h 36 h
Source DF F P DF F P
UV treatment 2 20.857260 0.0003 2 1.862785 0.2053
Genotype 1 13.066562 0.0047 1 3.264195 0.1009
UV treatment × Genotype 2 2.700482 0.10 2 5.159897 0.0289
PMI2 12 h 36 h
Source DF F P DF F P
UV treatment 2 7.962940 0.0085 2 6.479813 0.0157
Genotype 1 12.462489 0.0054 1 3.553708 0.0888
UV treatment × Genotype 2 2.245307 0.15 2 3.927104 0.0551
AIF1 12 h 36 h
Source DF F P DF F P
UV treatment 2 16.75070 0.0006 2 0.6875362 0.5251
Genotype 1 31.71697 0.0002 1 0.0684003 0.7990
UV treatment × Genotype 2 3.22189 0.0832 2 0.6887035 0.5245
SIG5 12 h 36 h
Source DF F P DF F P
UV treatment 2 101.83965 <.0001 2 2.927703 0.0998
Genotype 1 122.27431 <.0001 1 5.332916 0.0436
UV treatment × Genotype 2 43.89081 <.0001 2 0.965454 0.4136
SPS 12 h 36 h
Source DF F P DF F P
UV treatment 2 99.66862 <.0001 2 4.662555 0.0371
Genotype 1 52.16762 <.0001 1 10.761346 0.0083
UV treatment × Genotype 2 7.38815 0.0107 2 4.070832 0.0509
CLH1 12 h 36 h
Source DF F P DF F P
UV treatment 2 2.684271 0.1166 2 1.454934 0.2789
Genotype 1 22.149208 0.0008 1 3.846601 0.0783
UV treatment × Genotype 2 0.032307 0.9683 2 2.710273 0.1147
At5g01520 12 h 36 h
Source DF F P DF F P
UV treatment 2 251.61130 <.0001 2 5.696182 0.0223
Genotype 1 99.87390 <.0001 1 0.013494 0.9098
UV treatment × Genotype 2 36.84713 <.0001 2 0.602456 0.5662
DFR 12 h 36 h
Source DF F P DF F P
UV treatment 2 7.106523 0.0120 2 1.313898 0.3114
Genotype 1 22.274154 0.0008 1 4.309583 0.0646
UV treatment × Genotype 2 16.348878 0.0007 2 3.037992 0.0931
STO 12 h 36 h
Source DF F P DF F P
UV treatment 2 1.807759 0.2137 2 2.3272456 0.1480
Genotype 1 3.331994 0.0979 1 1.8656667 0.2019
UV treatment × Genotype 2 2.682443 0.1168 2 0.1905582 0.8294
GRX480 12 h 36 h
Source DF F P DF F P
UV treatment 2 6.45797 0.0158 2 2.0846935 0.1751
Genotype 1 32.45098 0.0002 1 0.0073179 0.9335
UV treatment × Genotype 2 0.22308 0.8039 2 0.7751476 0.4864
B. Gene expression measured by qPCR in Ler and uvr8-2 after three weeks (denDF=8).
CHS
Source DF F P
UV treatment 2 0.705172 0.5223
Genotype 1 7.048953 0.0290
UV treatment × Genotype 2 0.165677 0.8502
HAT2
Source DF F P
UV treatment 2 19.19738 0.0009
Genotype 1 58.57053 0.0001
UV treatment × Genotype 2 3.09454 0.1011
AOC3
Source DF F P
UV treatment 2 1.0097451 0.4064
Genotype 1 0.0730799 0.7937
UV treatment × Genotype 2 0.0612972 0.9410
RUP2
Source DF F P
UV treatment 2 72.54591 <.0001
Genotype 1 161.54599 <.0001
UV treatment × Genotype 2 0.55976 0.5922
ATR4
Source DF F P
UV treatment 2 0.4836175 0.6335
Genotype 1 0.0402518 0.8460
UV treatment × Genotype 2 1.6020343 0.2599
HY5
Source DF F P
UV treatment 2 0.6946817 0.5270
Genotype 1 0.9297521 0.3632
UV treatment × Genotype 2 2.6642248 0.1298
LOX
Source DF F P
UV treatment 2 2.307673 0.1617
Genotype 1 1.425468 0.2667
UV treatment × Genotype 2 0.012216 0.9879
TAT3
Source DF F P
UV treatment 2 0.9103042 0.4404
Genotype 1 0.9489398 0.3585
UV treatment × Genotype 2 0.3503167 0.7148
WRKY70
Source DF F P
UV treatment 2 1.112379 0.3748
Genotype 1 4.738432 0.0512
UV treatment × Genotype 2 2.569531 0.1374
AOS
Source DF F P
UV treatment 2 1.4495494 0.2903
Genotype 1 0.4679975 0.5132
UV treatment × Genotype 2 0.0222020 0.9781
JAZ1
Source DF F P
UV treatment 2 1.053498 0.3925
Genotype 1 10.255788 0.0126
UV treatment × Genotype 2 0.227208 0.8017
PR1
Source DF F P
UV treatment 2 0.1834873 0.8358
Genotype 1 1.3563665 0.2777
UV treatment × Genotype 2 1.5530014 0.2692
DFR
Source DF F P
UV treatment 2 0.071083 0.9320
Genotype 1 3.839792 0.0857
UV treatment × Genotype 2 0.634627 0.5549
GRX480
Source DF F P
UV treatment 2 1.738338 0.2361
Genotype 1 12.543766 0.0076
UV treatment × Genotype 2 1.758114 0.2329
PMI2
Source DF F P
UV treatment 2 0.453038 0.6510
Genotype 1 5.871699 0.0416
UV treatment × Genotype 2 1.144335 0.3655
C. Accumulation of PDX1 measured by western blot in Ler and uvr8-2 after 12 h and 36 h (denDF=25).
12 h 36 h
Source DF F P DF F P
UV treatment 2 20.876 <.0001 2 33.076 <.0001
Genotype 1 0.015 0.90 1 33.230 <.0001
UV treatment × Genotype 2 0.468 0.63 2 8.529 0.0015
D. Metabolites detected by UPLC-MS7MS in Ler and uvr8-2 after 12 h and 36 h (denDF=19).
Phe 12 h 36 h
Source DF F P DF F P
UV treatment 2 3.8400 0.0398 2 1.71566 0.2053
Genotype 1 6.6619 0.0183 1 9.20459 0.0066
UV treatment × Genotype 2 2.3483 0.1226 2 5.11335 0.0161
Q-3-N-7-Rha 12 h 36 h
Source DF F P DF F P
UV treatment 2 18.95817 <.0001 2 45.59767 <.0001
Genotype 1 12.05807 0.0025 1 0.00116 0.9731
UV treatment × Genotype 2 7.80696 0.0034 2 1.32161 0.2890
K-3-O-S-7-O-Glu 12 h 36 h
Source DF F P DF F P
UV treatment 2 27.14600 <.0001 2 30.82153 <.0001
Genotype 1 44.83310 <.0001 1 0.14295 0.7094
UV treatment × Genotype 2 14.25677 <.0002 2 3.05743 0.0694
K-NeoHes-3-R-7 12 h 36 h
Source DF F P DF F P
UV treatment 2 1.4083 0.2690 2 2.71580 0.0905
Genotype 1 3.9648 0.0610 1 2.22179 0.1517
UV treatment × Genotype 2 3.0298 0.0721 2 2.19730 0.1372
Chlorogenic acid 12 h 36 h
Source DF F P DF F P
UV treatment 2 38.09202 <.0001 2 6.25680 0.0078
Genotype 1 15.63075 0.0009 1 1.98548 0.1742
UV treatment × Genotype 2 9.85546 0.0012 2 2.08134 0.1510
Q-3-R-7-Rha 12 h 36 h
Source DF F P DF F P
UV treatment 2 36.78064 <.0001 2 43.46911 <.0001
Genotype 1 3.79848 0.0662 1 2.99556 0.0989
UV treatment × Genotype 2 3.50829 0.0505 2 1.83688 0.1852
K-3-S-Rha-7 12 h 36 h
Source DF F P DF F P
UV treatment 2 0.34514 0.7125 2 2.96065 0.0748
Genotype 1 0.32094 0.5777 1 0.02211 0.8833
UV treatment × Genotype 2 2.35317 0.1222 2 1.92171 0.1724
K-3-R 12 h 36 h
Source DF F P DF F P
UV treatment 2 19.1814 <.0001 2 7.36691 0.0040
Genotype 1 4.3731 0.0502 1 0.81953 0.3761
UV treatment × Genotype 2 2.9045 0.0793 2 1.84014 0.1847
Q-3-(O)-Rha 12 h 36 h
Source DF F P DF F P
UV treatment 2 6.07237 0.0091 2 27.14106 <.0001
Genotype 1 0.18800 0.6695 1 0.58472 0.4534
UV treatment × Genotype 2 4.27470 0.0293 2 1.53053 0.2407
IsoRha-3-O-G-7-O-Rha 12 h 36 h
Source DF F P DF F P
UV treatment 2 1.08687 0.3584 2 14.11396 0.0002
Genotype 1 10.76918 0.0041 1 11.77962 0.0026
UV treatment × Genotype 2 0.02176 0.9785 2 0.79247 0.4664
Q-3-Glu 12 h 36 h
Source DF F P DF F P
UV treatment 2 42.44323 <.0001 2 152.4937 <.0001
Genotype 1 0.68743 0.4179 1 0.0093 0.9243
UV treatment × Genotype 2 0.02636 0.9740 2 18.4070 <.0001
K-R-3-Rha-7 12 h 36 h
Source DF F P DF F P
UV treatment 2 1.63453 0.2213 2 7.5955 0.0035
Genotype 1 0.11850 0.7344 1 0.2442 0.6266
UV treatment × Genotype 2 0.55383 0.5837 2 4.2906 0.0282
K-Rha-3-Rha-7 12 h 36 h
Source DF F P DF F P
UV treatment 2 6.6916 0.0063 2 1.48005 0.2515
Genotype 1 13.3209 0.0017 1 3.28729 0.0849
UV treatment × Genotype 2 2.79502 0.0863 2 1.21910 0.3165
K-3-O-Glu 12 h 36 h
Source DF F P DF F P
UV treatment 2 18.9103 <.0001 2 7.83289 0.0031
Genotype 1 10.1016 0.0049 1 0.42455 0.5221
UV treatment × Genotype 2 1.8242 0.1885 2 5.09233 0.0163
Quercetin 12 h 36 h
Source DF F P DF F P
UV treatment 2 1.89637 0.1824 2 18.3129 <.0001
Genotype 1 1.75363 0.2040 1 3.9363 0.0611
UV treatment × Genotype 2 3.11649 0.0719 2 11.1683 0.0006
Kaempferol 12 h 36 h
Source DF F P DF F P
UV treatment 2 1.2688 0.3051 2 2.6233 0.0973
Genotype 1 2.8760 0.1071 1 0.8762 0.3604
UV treatment × Genotype 2 1.1734 0.3319 2 3.5457 0.0481
Unidentified 12 h 36 h
Source DF F P DF F P
UV treatment 2 75.90047 <.0001 2 75.90047 <.0001
Genotype 1 89.48351 <.0001 1 89.48351 <.0001
UV treatment × Genotype 2 95.07576 <.0001 2 95.07576 <.0001
Tyr 12 h 36 h
Source DF F P DF F P
UV treatment 2 14.00537 0.0002 2 3.53442 0.0485
Genotype 1 6.83222 0.0171 1 9.49409 0.0059
UV treatment × Genotype 2 4.80939 0.0204 2 3.12159 0.0553
Trp 12 h 36 h
Source DF F P DF F P
UV treatment 2 0.51007 0.6084 2 6.02226 0.0090
Genotype 1 0.40881 0.5302 1 7.01633 0.0154
UV treatment × Genotype 2 1.47889 0.2530 2 6.23188 0.0079
Kynurenic acid 12 h 36 h
Source DF F P DF F P
UV treatment 2 5.77605 0.0110 2 2.239983 0.1325
Genotype 1 2.56312 0.1259 1 0.347514 0.5621
UV treatment × Genotype 2 3.43436 0.0533 2 0.175288 0.8405
12-hydroxy jasmonic acid 12-hexose 12 h 36 h
Source DF F P DF F P
UV treatment 2 4.12653 0.0335 2 12.18607 0.0003
Genotype 1 1.02588 0.3246 1 2.25228 0.1490
UV treatment × Genotype 2 2.27314 0.1318 2 1.28494 0.2985
p -Coumaric acid 12 h 36 h
Source DF F P DF F P
UV treatment 2 1.96780 0.1687 2 1.71208 0.2059
Genotype 1 5.84046 0.0265 1 2.45639 0.1327
UV treatment × Genotype 2 2.43129 0.1162 2 1.73925 0.2012
Sinapic acid 12 h 36 h
Source DF F P DF F P
UV treatment 2 0.89987 0.4233 2 4.4136 0.0258
Genotype 1 8.75732 0.0081 1 4.3017 0.0512
UV treatment × Genotype 2 2.52783 0.1063 2 0.5876 0.5650
Ferulic acid hexose 12 h 36 h
Source DF F P DF F P
UV treatment 2 3.99542 0.0356 2 9.3332 0.0014
Genotype 1 5.12293 0.0355 1 2.6787 0.1173
UV treatment × Genotype 2 1.23566 0.3130 2 0.7576 0.4818
Camalexin 12 h 36 h
Source DF F P DF F P
UV treatment 2 14.98064 0.0001 2 7.258467 0.0043
Genotype 1 5.32285 0.0325 1 1.915437 0.1816
UV treatment × Genotype 2 2.18768 0.1396 2 0.289755 0.7515
E. Optical measurements in Ler and uvr8-2 after 50 h (denDF=13).
Chlorophyll (SPAD)
Source DF F P
UV treatment 2 1.246 0.3198
Genotype 1 21.312 0.0005
UV treatment × Genotype 2 0.949 0.4123
HCA (Dualex 315nm)
Source DF F P
UV treatment 2 159.544 <.0001
Genotype 1 36.246 <.0001
UV treatment × Genotype 2 5.311 0.0206
Flavonoids (Dualex 375nm)
Source DF F P
UV treatment 2 91.3896 <.0001
Genotype 1 68.5581 <.0001
UV treatment × Genotype 2 10.6819 0.0018
E. Number of flowering plants counted after three weeks (denDF=16).
Source DF F P
UV treatment 2 4.29182 0.0322
Genotype 1 16.80043 <.001
UV treatment × Genotype 2 3.31863 0.0623
Supplemental Table S6. Tests of significance of effects of the UV treatments on gene expression,
accumulation of PDX1 and metabolites, and optical measurements.
A1, A2, A3, and A4. P values for the comparisons between the UV treatments.
Contrasts amongst individual treatments were fitted within genotypes when the interaction UV Treatment x Genotype
was significant.
When ANOVA only showed significant main effects of the UV treatments and genotypes but not a significant interaction
contrasts between the UV treatments were fitted pooling the genotypes .
DF=degrees of freedom.
A1. Genes showing significant interaction UV treatment × genotype in Ler and uvr8-2 after 12 h (DF=10)
Wild-type UV 0 vs UV A UV 0 vs UV A+B UV A vs UV A+B
HY5 < 0.001 0.085 0.002
MEB5.2 0.019 0.199 0.307
SPS < 0.001 0.002 0.036
RUP2 < 0.001 < 0.001 0.130
At5g01520 < 0.001 < 0.001 0.002
SIG5 < 0.001 0.256 < 0.001
CHS < 0.001 < 0.001 0.210
TT7 < 0.001 < 0.001 0.313
DFR < 0.001 < 0.001 0.34
uvr8-2 UV 0 vs UV A UV 0 vs UV A+B UV A vs UV A+B
HY5 < 0.001 < 0.001 0.781
MEB5.2 < 0.001 < 0.001 0.329
SPS < 0.001 < 0.001 0.647
RUP2 < 0.001 < 0.001 0.035
At5g01520 < 0.001 < 0.001 0.173
SIG5 < 0.001 < 0.001 0.097
CHS < 0.001 < 0.001 0.849
TT7 < 0.001 < 0.001 0.313
DFR 0.99 0.36 0.36
A2. Genes where ANOVA only showed significant main effects of the UV treatments
and genotypes in Ler and uvr8-2 after 12 h (DF=10)
UV 0 vs UV A UV 0 vs UV A+B UV A vs UV A+B
VSP1 0.515 0.125 0.040
AOS 0.720 0.0055 0.0030
RCD1 0.119 0.421 0.407
CLH1 0.622 0.284 0.132
ATR4 0.003 < 0.001 0.359
PDF1.2 0.213 0.305 0.036
AOC3 0.001 < 0.001 0.337
TAT3 0.008 0.002 0.465
LOX 0.001 < 0.001 0.453
PAD3 0.048 0.004 0.184
PMI2 0.05 0.41 0.22
AIF1 0.003 0.48 0.01
GRX480 0.07 0.06 0.95
A3. Genes showing significant interaction UV treatment × genotype in Ler and uvr8-2 after 36 h (DF=10)
Wild-type UV 0 vs UV A UV 0 vs UV A+B UV A vs UV A+B
VSP1 ns ns ns
SPS 0.695 0.622 0.167
RUP2 1.00 1.00 1.00
PMI2 0.809 0.809 0.797
AOS 0.999 0.999 0.999
ATR4 1.00 1.00 1.00
uvr8-2 UV 0 vs UV A UV 0 vs UV A+B UV A vs UV A+B
VSP1 ns ns ns
SPS 0.050 0.115 0.695
RUP2 0.005 0.005 1.00
PMI2 0.010 0.065 0.796
AOS 0.040 0.194 0.998
ATR4 0.015 0.035 1.000
A4. Genes where ANOVA only showed significant main effects of the UV treatments and genotypes
in Ler and uvr8-2 after 36 h (DF=10)
UV 0 vs UV A UV 0 vs UV A+B UV A vs UV A+B
AOXI 0.410 0.972 0.392
SIG5 0.550 0.716 0.344
At5g01520 0.088 0.258 0.506
MEB5.2 0.528 0.226 0.080
CHS 0.552 0.180 0.429
PDF1.2 0.522 0.859 0.640
A5. Significance of simple effects of the genotype in models fit separately to each UV treatment
for genes showing significant interaction UV treatment x Genotype after 12 and 36 h outdoors (DF=2)
12 h gen. wihtin UV 0 gen. within UV A gen. within UV A+B
HY5 0.2954 0.0745 0.0176
MEB5.2 0.1201 0.0115 0.0223
SPS 0.1542 0.0248 0.0481
RUP2 0.1753 0.2543 0.0098
At5g01520 0.868 0.0250 0.0013
SIG5 0.8132 0.0281 0.0021
CHS 0.3998 0.2075 0.0944
TT7 0.0587 0.2032 0.0479
DFR 0.4543 0.1163 0.0038
36h gen. whithin UV 0 gen. within UV A gen. within UV A+B
VSP1 0.0453 0.2124 0.9425
SPS 0.8332 0.0168 0.0211
RUP2 0.0775 0.0459 0.1143
PMI2 0.3566 0.1296 0.0465
AOS 0.1573 0.0490 0.2502
ATR4 0.5624 0.0358 0.0289
B. PDX1 accumulation in Ler and uvr8-2 after 12 and 36 h outdoors (DF=25)
12 h UV 0 vs UV A UV 0 vs UV A+B UV A vs UV A+B
PDX1 < 0.001 < 0.001 0.64
36 h
Wild-type UV 0 vs UV A UV 0 vs UV A+B UV A vs UV A+B
PDX1 0.01 0.004 0.57
uvr8-2 UV 0 vs UV A UV 0 vs UV A+B UV A vs UV A+B
PDX1 < 0.001 < 0.001 0.01
C. Metabolites detected by UPLC-MS/MS in Ler and uvr8-2
C1. Metabolites showing significant interaction UV treatment × genotype after 12 h (DF=19)
Wild-type UV 0 vs UV A UV 0 vs UV A+B UV A vs UV A+B
Q-3-N-7-Rha < 0.001 < 0.001 0.18
K-3-O-S-7-O-Glu < 0.001 < 0.001 0.10
Chlorogenic acid 0.33 0.33 0.01
Q-3-R-7-Rha 0.05 < 0.001 0.02
Q-3-(O)-Rha 0.05 < 0.001 0.44
unidentified 0.99 < 0.001 < 0.001
Tyr 1.0 1.0 0.64
kynurenic acid 0.68 0.12 0.22
uvr8-2 UV 0 vs UV A UV 0 vs UV A+B UV A vs UV A+B
Q-3-N-7-Rha 0.78 0.29 0.78
K-3-O-S-7-O-Glu 0.95 0.95 0.95
Chlorogenic acid 0.05 0.33 0.33
Q-3-R-7-Rha 0.07 0.01 0.25
Q-3-(O)-Rha 1.0 1.0 1.0
unidentified 1.0 1.0 1.0
Tyr 0.49 1.0 1.0
kynurenic acid 0.03 0.3 0.22
C2. Metabolites where ANOVA only showed significant main effect of the UV treatments
and genotypes after 12 h (DF=19)
UV 0 vs UV A UV 0 vs UV A+B UV A vs UV A+B
Phe 0.21 0.84 0.13
K-3-R 0.07 0.23 0.48
IsoRha-3-O-G-7-O-Rha 0.40 0.27 0.80
Q-3-Glu < 0.001 < 0.001 0.68
K-Rha-3-Rha-7 0.34 0.44 0.08
K-3-O-Glu 0.008 0.03 0.49
12-hydroxy jasmonic acid 12-hexose 0.005 0.49 0.01
Camalexin 0.12 0.006 0.15
12-hydroxy jasmonic acid 12-hexose
Treatment Genotype Mean se
UV 0 Ler 0.008 0,004
UV A Ler 0.019 0,01
UV A+B Ler 0.011 0,005
UV 0 uvr8 0.013 0,01
UV A uvr8 0.016 0,01
UV A+B uvr8 0.016 0,01
C3. Metabolites showing significant interaction UV treatment × genotype after 36 h (DF=19)
Wild-type UV 0 vs UV A UV 0 vs UV A+B UV A vs UV A+B
Phe 0.72 0.72 0.83
Q-3-Glu < 0.001 < 0.001 < 0.001
K-R-3-Rha-7 1.0 1.0 1.0
K-3-O-Glu 0.31 0.01 0.22
Quercetin < 0.001 < 0.001 < 0.001
Kaempferol 1.0 1.0 1.0
unidentified 1.0 < 0.001 < 0.001
Tyr 0.85 0.38 0.97
Trp 1.0 1.0 1.0
uvr8-2 UV 0 vs UV A UV 0 vs UV A+B UV A vs UV A+B
Phe 0.01 0.72 0.19
Q-3-Glu < 0.001 < 0.001 < 0.001
K-R-3-Rha-7 0.001 1.0 0.008
K-3-O-Glu 0.008 0.31 0.01
Quercetin < 0.001 < 0.001 < 0.001
Kaempferol 0.05 1.0 0.03
unidentified 1.0 1.0 1.0
Tyr 0.14 0.97 0.04
Trp 0.001 1.0 0.003
C4. Metabolites where ANOVA only indicated significant main effect of the UV treatments
and genotypes after 36 h (DF=19)
UV 0 vs UV A UV 0 vs UV A+B UV A vs UV A+B
Q-3-N-7-Rha < 0.001 < 0.001 0.64
K-3-O-S-7-O-Glu < 0.001 < 0.001 0.66
Chlorogenic acid 0.57 0.03 0.05
Q-3-R-7-Rha < 0.001 < 0.001 0.33
K-3-R 0.07 0.03 0.71
Q-3-(O)-Rha < 0.001 < 0.001 0.79
IsoRha-3-O-G-7-O-Rha 0.01 0.01 0.39
Ferulic acid hexose 0.23 0.01 0.17
12-hydroxy jasmonic acid 12-hexose 0.01 0.09 0.44
12-hydroxy jasmonic acid 12-hexose
Treatment Genotype Mean se
UV 0 Ler 0.011 0,005
UV A Ler 0.021 0,01
UV A+B Ler 0.018 0,008
UV 0 uvr8 0.014 0,01
UV A uvr8 0.032 0,01
UV A+B uvr8 0.018 0,01
IsoRha-3-O-G-7-O-Rha
Treatment Genotype Mean se
UV 0 Ler 0,039 0,017
UV A Ler 0,110 0,049
UV A+B Ler 0,146 0,066
UV 0 uvr8 0,130 0,058
UV A uvr8 0,275 0,124
UV A+B uvr8 0,182 0,082
D. Optical measurements in Ler and uvr8-2 after 50 h outdoors (DF=13)
Wild-type UV 0 vs UV A UV 0 vs UV A+B UV A vs UV A+B
Dualex 375nm < 0.001 < 0.001 < 0.001
Dualex 315nm 0.65 0.005 0.04
uvr8-2 UV 0 vs UV A UV 0 vs UV A+B UV A vs UV A+B
Dualex 375nm < 0.001 < 0.001 0.87
Dualex 315nm 0.65 0.75 0.75
UV 0 vs UV A UV 0 vs UV A+B UV A vs UV A+B
SPAD 0.64 0.63 0.48
SPAD averages
Wild-type uvr8-2
UV A+B 26.27 22.97
UV A 27.35 24.102
UV 0 27.033 22.57
E. Genes where ANOVA only showed significant main effects of the UV treatments and genotypes
in Ler and uvr8-2 after three weeks outdoors (DF=8)
UV 0 vs UV A UV 0 vs UV A+B UV A vs UV A+B
HAT2 0.068 0.052 0.851
CHS 0.722 0.765 0.471
RUP2 0.011 < 0.001 0.007
WRKY70 0.85 0.71 0.87
JAZ1 0.81 0.94 0.73
PMI2 0.93 0.29 0.21
At1g28480 0.07 0.89 0.04
F. Number of flowering plants per pot counted after three weeks (DF=16)
UV 0 vs UV A UV 0 vs UV A+B UV A vs UV A+B
Flowering plants 0.11 0.07 < 0.01
Supplemental Table S7. Metabolites identified in wild-type and uvr8-2 leaves by UPLC-MS. Retention times (RT) and detected masses (M+1) are shown.
No
Metabolite
Abreviation
Class
RT (Min)
[M+1]+ (m/z)
1 Tyrosine Tyr Amino acid 0.28 182
2 p-Coumaric acid Phenylpropanoid 0.29 165, 123
3 Phenylalanine Phe Amino acid 0.48 166
4 Tryptophan Trp Amino acid 0.72 205
5 kynurenic acid Tryptophan derivative 0.79 190
6 12-hydroxy jasmonic acid 12-hexose Jasmonate derivative 0.94 387
7 Unidentified 1.01 381, 365, 349
8 Quercetin-3-O-Neohesperidoside-7-Rhamnoside
Q-3-N-7-Rha Phenylpropanoid 1.12 757, 611, 449, 303
9 Kaempferol-3-O-Sophoroside-7-O-Glucoside K-3-O-S-7-O-Glu Phenylpropanoid 1.24 773 (+Na)
10 Kaempferol-3-O-Neohesperidoside-7-Rhamnoside
K-NeoHes-3-R-7 Phenylpropanoid 1.24 741, 595, 433, 287
11 5-Caffeoyl Quinic Acid Chlorogenic acid Phenylpropanoid 1.30 355, 193
12 Quercetin-3-O-Rutinoside-7-O-Rhamnoside Q-3-R-7-Rha Phenylpropanoid 1.37 757, 611, 449, 303
13 Kaempferol-3-O-Sophoroside-7-O-Rhamnoside K-3-S-Rha-7 Phenylpropanoid 1.40 757, 595, 433, 287
14 Kaempferol -3-O-Rutinoside K-3-R Phenylpropanoid 1.55 595, 433, 287
15 Quercetin-3-O-Rhamnoside Q-3-(O)-Rha Phenylpropanoid 1.57 449, 303
16 Isorhamnetin-3-O-glucoside-7-O-rhamnoside IsoRha-3-O-G-7-O-Rha
Phenylpropanoid 1.61 625, 479, 463, 317
17 Quercetin-3-Glucoside Q-3-Glu Phenylpropanoid 1.67 465, 303
18 Kaempferol-3-O-Rutinoside-7-O-Rhamnoside K-R-3-Rha-7 Phenylpropanoid 1.67 741, 595, 433, 287
19 Sinapic acid Phenylpropanoid 1.71 225
20 Kaempferol -3-Rhamnoside-7-Rhamnoside K-Rha-3-Rha-7 Phenylpropanoid 1.76 579, 433, 287
21 Kaempferol -3-Glucoside K-3-O-Glu Phenylpropanoid 1.90 471 (+Na), 449, 288
22 Quercetin Q Phenylpropanoid 1.92 303
23 Kaempferol K Phenylpropanoid 2.19 287
24 Ferulic acid hexose Phenylpropanoid 2.48 355
25 Camalexin Tryptophan derivative 2.86 201
Supplemental Table S8. Primers used in qPCR
Gene Annotation Forward Primer Reverse Primer Amplification efficiency
MEB5.2 At3g17800 CAAGCCGAGGGGACGGCAAC AGCACTAACTCCGCCCGCAA 1,94
SIG5 At5g24120 AGCTTAAGCATCAGGCCAGAGTTGA AGTGAGGCGGCTCAGTTCGG 2
SPS At1g78510 GCTCGGGAAGCCAGCAGGGA TTGGCTCCCTCTCCAGAGCGA 1,985
F7A7.40 At5g01520 TGCACGGTCACAGTCGTGCC TGCAATCTCGGCGCTACAAGTGT 2,03
AIF1 At3g05800 CGCTCGTGGTGCAACTCGGT CAGCTAATGCCGACGCCGGT 1,94
CLH1 At1g19670 GGGAACCGGACTCGGACCGA CCGCAGCCACGAAATGGGCT 2
AOC3 At3g25780 TGAAGGTGCGTACGGACAGGTT GGCGTAACCGCCGTTCCAGTA 2
AOS At5g42650 GGAGACTCCGACGGTGGGGAA ACGGCGACGTACCAACCTCAA 1,91
ATR4 At4g31500 AGGAGTGGACTTCAAGGGCCAAG CAAGATGCATGGCCGGGCAC 1,992
PMI2 At1g67070 CGGCAGTACCAGGTCCTTCGG CAGCCGGAACAAACAAAACATCTCC 1,981
RUP2 At5g23730 ATGGGCGCGTGATTCGCACG ACGCGCCGTTTCTCCACACAG 1,76
HY5 At5g11260 GAGGGAGGACACCGGCGGAG CCTCTCTCTTGCTTGCTGAGCTGA 2
CHS At5g13930 ATGTCGAGCGCGTGCGTTCT TCTCCTGTCGTGGCCACACCA 2
DFR At5g42800 ACCGGAGATGGTTTAACCGATGGT TGGGAGCATCGGTTCTCTCGC 2
TT7 At5g07990 AGCTGGAGGAGTTACGCCGGA ACGTTCGGAGCCAACCTTGGC 1,94
COP1 At2g32950 TCGCCTGTGGAAGCGAGACA TGCCTCTTCCTCTGCATCGTCCA 2
AOXI At4g12500 CTTAACGTGCAGTTGGGACA CCTAAGGGCAGTGCAGAGAC 1,86
PDF1.2 At5g44420 CCAAACATGGATCATGCAAC CACACGATTTAGCACCAAAGA 1,69
PAD3 At3g26830 GATGTTCCTGCGAAAACACA GTTTTGGATCACGACCCATC 1,69
VSP1 At5g24780 AATGGGCTGATTTGGTTGAG TGGATACAAGGGGACAATGC 1,839
LOX At1g72520 CTAGCCGTAGGAATCGCTGT TACACGTAACACCCGGTTCA 1,85
RCD1 At1g32230 GAGGTTCAGGAAGTGCAAACAGT AACAGAGTAGGAAATGGCATCCA 1,879
TAT3 At2g24850 ATGATCGTCATGCCATCTCC TGTGGACTTGTGGCATAGGA 1,841
UVR8 At5g63860 ATATGGCTGCCGACGAAGT CGCTTGACATCAGTTTGTGG 1,64
NCED3 At3g14440 AGCTCCTTACCTATGGCCAGT CGCTCTCTGGAACAAATTCATC 1,947
HAT2 At5g47370 CGAACCATCACCACAATCAC GCAAGGCTTCAAAATTCAGC 1,997
JAZ1 At1g19180 TGCGATCCAGCCAAAGCGTC TTGGTACGGCTTGAGGGTGGT 2
PR1 At2g14610 TGATCATGCATACACACGTACA CATCCTGCATATGATGCTCCT 1,720
WRKY70 At3g56400 TCATCATCAGGCCAGTTACG CACCTCCAAACACCATGAGA 2
GRX480 At1g28480 TTGGAGTGAATCCGGCGGTCCT CGTACCTCCGCCGCCTTGAAC 2
REFERENCE 1 At4g34270 GTGAAAACTGTTGGAGAGAAGCAA TCAACTGGATACCCTTTCGCA 1,91
REFERENCE 2 At4g33380 TTGAAAATTGGAGTACCGTACCAA TCCCTCGTATACATCTGGCCA 1,86
REFERENCE 3 At4g35510 ACTTCCTCCGCGTCTCCATT TTTATGTCCTGGCATTTCCAA 1,97
Supplemental Table S9. UVBE (kJ m-2 d-1) and PAR (MJ m-2 d-1) for the whole duration of the performance experiment. The minimum, (average) and maximum daily UVBE occurring during the experiment are given. Ambient (no filter) is not a treatment; these doses were included for comparative purposes.
Treatment GEN(G)
GEN(T)
FLAV
PG
PAR
UV 0 0.001(0.002)0.002 0.002(0.005)0.007 0.01(0.02)0.02 0.02(0.04)0.06 2.0(6.9)10
UV A 0.01(0.02)0.03 0.1(0.3)0.5 0.7(1.9)2.5 4.7(13.4)18.1 2.1(7.4)10.6
UVA+B 0.9(2.7)3.9 1.4(4.0)5.6 2.8(8.04)11.1 6.4(18.3)24.9 2.0(7.2)10.3
Ambient 1.1(3.2)4.7 1.7(4.86)6.8 3.4(9.6)13.2 7.6(21.7)29.6 2.4(8.3)11.9