supplemental data ve-cadherin-mediated cell-cell ... · listed in figure s6. levels of knockdown...

16
Current Biology, Volume 19 Supplemental Data VE-Cadherin-Mediated Cell-Cell Interaction Suppresses Sprouting via Signaling to MLC2 Phosphorylation Sabu Abraham, Margaret Yeo, Mercedes Montero-Balaguer, Hugh Paterson, Elisabetta Dejana, Christopher J. Marshall, and Georgia Mavria Experimental Procedures Cells, Antibodies, Plasmids, and siRNA Angiokit-validated HDF and HUVEC were from TCS CellWorks (Buckingham, UK) and were cultured in DMEM 10% FCS and Large Vessel Endothelial Cell Medium (TCS CellWorks), respectively. HUVEC-EGFP were generated by retroviral infection as previously described [7]. HUVEC were used to passage 6, and tube-forming ability was assessed in the co-culture assay [7]. Antibodies against mono-phosphorylated (Ser-19) and di-phosphorylated (Thr 18/Ser 19) MLC2 were from Cell Signalling Technology. Antibodies against total MLC2 used for immunofluorescence or immunobloting were from Cell Signalling Technology and Santa Cruz respectively. Antibodies against total and phosphorylated VEGFR2 were from Cell Signalling Technology. Antibodies against VE-cadherin (goat polyclonal for immunofluorescence and mouse monoclonal used for immunoblotting) were from Santa Cruz. VE-cadherin blocking antibody (Cadherin 5) and control IgG1 were from BD Biosciences, BV9 was from HyCult Biotechnology (Uden, the Netherlands). pEF-Myc-RhoC containing human RhoC and pEF-Myc empty vector have been previously described [30]. VE-cadherin, Rho-kinase I and II, Rac1 and p120 catenin pools of siRNA oligonucleotide duplexes were from Dharmacon (Lafayette, USA) and scrambled siRNA was as previously described [7]. Oligonucleotide sequences are listed in Figure S6. Levels of knockdown for VE-cadherin were determined using the LI-COR Odyssey system. Knockdown of Rho-kinases I and II was determined by quantitative RT-PCR, using QuantiTect Primer Assays (Qiagen, GmbH) and the 7900HT Fast Real-Time PCR System (Applied Biosystems). HUVEC were

Upload: others

Post on 04-Aug-2020

2 views

Category:

Documents


0 download

TRANSCRIPT

Page 1: Supplemental Data VE-Cadherin-Mediated Cell-Cell ... · listed in Figure S6. Levels of knockdown for VE-cadherin were determined using the LI-COR Odyssey system. Knockdown of Rho-kinases

Current Biology, Volume 19

Supplemental Data

VE-Cadherin-Mediated Cell-Cell Interaction Suppresses Sprouting via Signaling to MLC2 Phosphorylation

Sabu Abraham, Margaret Yeo, Mercedes Montero-Balaguer, Hugh Paterson, Elisabetta Dejana, Christopher J. Marshall, and Georgia Mavria

Experimental Procedures

Cells, Antibodies, Plasmids, and siRNA

Angiokit-validated HDF and HUVEC were from TCS CellWorks (Buckingham, UK)

and were cultured in DMEM 10% FCS and Large Vessel Endothelial Cell Medium

(TCS CellWorks), respectively. HUVEC-EGFP were generated by retroviral infection

as previously described [7]. HUVEC were used to passage 6, and tube-forming ability

was assessed in the co-culture assay [7]. Antibodies against mono-phosphorylated

(Ser-19) and di-phosphorylated (Thr 18/Ser 19) MLC2 were from Cell Signalling

Technology. Antibodies against total MLC2 used for immunofluorescence or

immunobloting were from Cell Signalling Technology and Santa Cruz respectively.

Antibodies against total and phosphorylated VEGFR2 were from Cell Signalling

Technology. Antibodies against VE-cadherin (goat polyclonal for

immunofluorescence and mouse monoclonal used for immunoblotting) were from

Santa Cruz. VE-cadherin blocking antibody (Cadherin 5) and control IgG1 were from

BD Biosciences, BV9 was from HyCult Biotechnology (Uden, the Netherlands).

pEF-Myc-RhoC containing human RhoC and pEF-Myc empty vector have been

previously described [30]. VE-cadherin, Rho-kinase I and II, Rac1 and p120 catenin

pools of siRNA oligonucleotide duplexes were from Dharmacon (Lafayette, USA)

and scrambled siRNA was as previously described [7]. Oligonucleotide sequences are

listed in Figure S6. Levels of knockdown for VE-cadherin were determined using the

LI-COR Odyssey system. Knockdown of Rho-kinases I and II was determined by

quantitative RT-PCR, using QuantiTect Primer Assays (Qiagen, GmbH) and the

7900HT Fast Real-Time PCR System (Applied Biosystems). HUVEC were

Page 2: Supplemental Data VE-Cadherin-Mediated Cell-Cell ... · listed in Figure S6. Levels of knockdown for VE-cadherin were determined using the LI-COR Odyssey system. Knockdown of Rho-kinases

transfected in 6-well plates at a density of 1.5x105 using GeneFECTORTM (Venn

Nova, Inc.) according to the manufacturer’s recommendations.

Inhibitors, Immunoblotting, and Rac1 Pull-Down Assay

Y27632 was from Tocris (Southampton, UK), H1152 (Ikenoya et al., 2002),

blebbistatin (Straight et al., 2003), VEGFR2 inhibitor SU1498 and Rac1 inhibitor

NSC23766 were from Calbiochem, AvastinTM was from the Royal Marsden Hospital

pharmacy. For VE-cadherin immunoblotting cell lysates were prepared as previously

described [31]. For phospho-MLC2 immunoblotting whole-cell extracts were

harvested in Laemmli sample buffer supplemented with 10mM sodium fluoride, 1mM

sodium vanadate, 10mM sodium β-glycerophosphate, 0.5mM PMSF and Complete-

EDTA free protease (Roche, Diagnostics GmbH) and sonicated for 15s prior to

centrifugation. Western Blotting was performed using ECL Plus detection System

(GE Healthcare-Amersham) with horseradish peroxidase-conjugated secondary

antibodies (Sigma). MLC2 quantifications were performed using the Scion image

software (http://www.scioncorp.com) unless otherwise stated. For Rac1 pull-down

assays HUVEC were grown on fibronectin coated plates (10μg/ml; Sigma) in the

presence of VEGF (10ng/ml; TCS CellWorks). Whole-cell extracts were harvested in

Rac1 lysis buffer [32] and the pull-down assays were performed using GST-PAK as

previously described [32]. Immunoblotting for Rac1 was performed using anti-Rac1,

clone 23A8 (Upstate). The Li-COR Odyssey system (Li-COR Biosciences) was used

for quantifications.

Immunofluorescence and Microscopy

Immunofluorescence was performed using standard methods. Fixation was in 3.7%

paraformaldehyde, and permeabilization was in 0.1% Triton X-100. The phospho-

MLC2 (Ser 19) antibody was applied at 1:50 dilution at 4oC overnight. Confocal

sections were obtained using a BioRad MRC1024 confocal laser controlled by

Lasersharp (v3.4) acquisition software attached to a Nikon E600 upright fluorescence

microscope, using Nikon 20x (0.75 n.a.) PlanFluor multi-immersion, and Nikon Fluor

60x (1.00 n.a) water-dipping objectives. Phase contrast images of CD31-stained co-

cultures and loop formation were obtained using a 4x objective. Multisite time-lapse

microscopy was performed in a humidified CO2-equilibrated chamber using a

Page 3: Supplemental Data VE-Cadherin-Mediated Cell-Cell ... · listed in Figure S6. Levels of knockdown for VE-cadherin were determined using the LI-COR Odyssey system. Knockdown of Rho-kinases

Diaphot inverted microscope (Nikon, Kingston upon Thames, UK) equipped with a

motorized stage Prior Scientific, Oxford, UK) controlled by Simple PCI software

(Compix, Cranberry Township, PA). Cells were imaged using 10x objective. Movies

were exported from Simple PCI software as uncompressed .AVI files. Adobe

Premiere v6.0 was used to compress movie files using the MPEG codec, and to export

compressed files in the .MOV (Quicktime) format.

Tissue Culture Angiogenesis Assays

Co-cultures of HUVEC with HDF (TCS Angiokit) were purchased from TCS

CellWorks, co-cultures of HUVEC-EGFP with HDF were set up as previously

described [7]. Treatments were performed in Optimized Medium (TCS CellWorks).

Tube formation was assessed using mouse anti-human CD31 Tubule Staining Kit

(TCS CellWorks). Automated analysis was performed using the AngioSys software.

Number of tubules, total tubule length and number of branch points were measured in

9 microscopic fields from triplicate wells at x4 magnification. For siRNA experiments

HUVEC (4x104 per 12-well) were seeded on fibroblasts that had reached confluency

over a period of 7 days, and cultured in 1:1 Large Vessel Endothelial Cell medium,

DMEM 10% FCS. Matrigel assays were performed in 60mm plates using growth

factor reduced matrigel (BD Biosciences; concentration 12.3mg/ml) diluted 1:1 with

PBS. HUVEC (5x105) were plated on matrigel (0.6ml) in Optimized Medium (TCS

CellWorks). Tranfected HUVEC were plated on matrigel or confluent fibroblasts

24hrs after transfection.

Morpholino-Mediated Knockdown of cdh5 in Zebrafish

Zebrafish were raised and kept at 28°C according to standard protocols [33]. The

Tg(fli1:EGFP)y1 transgenic zebrafish line has been previously described [8]. Two

morpholino antisense oligonucleotides (Cdh5-MO2 and Cdh5-MO3) were designed to

complement splicing donor sites of the zebrafish VE-cdh gene (cdh5; Ensembl

accession ENSDARG00000046128) in order to block proper splicing (Cdh5-MO2

5’-TACAAGACCGTCTACCTTTCCAATC-3’, Cdh5-MO3 5’-

ATTTGAGATGAACCTACCCAGGATG-3’). A 5 pb mismatch morpholino was

used as control (Cont-MO2 5’-TAgAAcACgGTCTAgCTTTCgAATC-3’). For a

diagram of exon/intron structure of zebrafish cdh5 see Figure S1B. Morpholinos were

reconstituted in nuclease free water, and the volume of the injected drop was

Page 4: Supplemental Data VE-Cadherin-Mediated Cell-Cell ... · listed in Figure S6. Levels of knockdown for VE-cadherin were determined using the LI-COR Odyssey system. Knockdown of Rho-kinases

estimated with a micrometer scale. Embryos at 1- to 4-cell stage were injected with

8ng of morpholino into the yolk immediately below the blastomeres. This dose

delivers a fully penetrant phenotype in 95% of the embryos. The efficiency of the

morpholino was assessed by RT-PCR using Superscript One-step RT-PCR system

(Invitrogen) and using total RNA from wild type or morpholino injected pooled

embryos as template. The primers used are: e1F2 5’ -

TGTATGCGTATGAGGAAACAC, VE3R 5’-AGGCAGAACAGGATGGAGAC

(Figure S1B available online). For imaging zebrafish vessels, live embryos were

dechorionated manually with forceps and mounted in low melting agarose. Image

acquisition was performed with 20x or 40x objective on a Leica TCS SP2 confocal

microscope. Confocal stacks were processed for maximum intensity projection with

Leica LCS software and movies were assembled using ImageJ (MacBiophotonics).

Supplemental References

30. Sahai, E., and Marshall, C.J. (2002). ROCK and Dia have opposing effects on

adherens junctions downstream of Rho. Nat. Cell Biol. 4, 408–415.

31. Nawroth, R., Poell, G., Ranft, A., Kloep, S., Samulowitz, U., Fachinger, G.,

Golding, M., Shima, D.T., Deutsch, U., and Vestweber, D. (2002). VE-PTP and VE-

cadherin ectodomains interact to facilitate regulation of phosphorylation and cell

contacts. EMBO J. 21, 4885–4895.

32. Vial, E., Sahai, E., and Marshall, C.J. (2003). ERK-MAPK signaling coordinately

regulates activity of Rac1 and RhoA for tumor cell motility. Cancer Cell 4, 67–79.

33. Akimenko, M.A., Johnson, S.L., Westerfield, M., and Ekker, M. (1995).

Differential induction of four msx homeobox genes during fin development and

regeneration in zebrafish. Development 121, 347–357.

34. Larson, J.D., Wadman, S.A., Chen, E., Kerley, L., Clark, K.J., Eide, M., Lippert,

S., Nasevicius, A., Ekker, S.C., Hackett, P.B., et al. (2004). Expression of VE-

cadherin in zebrafish embryos: a new tool to evaluate vascular development. Dev.

Dyn. 231, 204–213.

Page 5: Supplemental Data VE-Cadherin-Mediated Cell-Cell ... · listed in Figure S6. Levels of knockdown for VE-cadherin were determined using the LI-COR Odyssey system. Knockdown of Rho-kinases

Supplemental Figures

Figure S1

(A) HUVEC-HDF co-cultures were treated with VEGF (20ng/ml) for 48hrs starting at

6 days (migratory) or 12 days (established) after co-culture. The cultures were fixed

after a further 5 days and tube formation was visualized by CD31 staining. Branch

points are represented as mean ±SEM (n=9 microscopic fields from triplicate wells).

Scale bar, 100 μm.

(B) Diagram of the exon/intron structure of zebrafish VE-cadherin gene (cdh5)

indicating the position of the splice blocking morpholinos (Cdh5-MO2 and Cdh5-

MO3) used to down-regulate VE-cadherin. The cdh5 gene was identified through

Ensembl database searches as ENSDARG00000046128. The cdh transcript has been

previously described [34]. Bottom inset shows the confirmation of the efficiency of

the morpholinos by RT-PCR, lack of amplification of endogenous VE-cadherin

transcript upon cdh5-MO2 injection and the truncated splicing induced by cdh5-MO3.

Page 6: Supplemental Data VE-Cadherin-Mediated Cell-Cell ... · listed in Figure S6. Levels of knockdown for VE-cadherin were determined using the LI-COR Odyssey system. Knockdown of Rho-kinases

Figure S2

Page 7: Supplemental Data VE-Cadherin-Mediated Cell-Cell ... · listed in Figure S6. Levels of knockdown for VE-cadherin were determined using the LI-COR Odyssey system. Knockdown of Rho-kinases

(A) Schematic representation of VE-cadherin blockade in co-culture.

(B) Long-term Cad 5 treatment results in disassembly and endothelial cell rounding.

Tubules treated with 5μg/ml Cad5 or control IgG were followed by timelapse

microscopy. Video stills are at 24hr intervals over 3 days. Closed arrows show

sprouting points; open arrows rounding cells and disassembly. Scale bar, 50μm.

(C) Partial VE-cadherin blockade with BV9 increases tube formation. Established

tubules treated with 10μg/ml BV9 [5] or control IgG were visualized by CD31

staining 3 days after the end of treatment. Scale bar, 100μm.

(D) Treatment with Cad 5 alters the localization of VE-cadherin. Established tubules

treated with 10μg/ml Cad5 or control IgG for 4hrs, or 10μM Y27632 for 30min were

fixed and stained for VE-cadherin. Note the diffuse appearance of VE-cadherin in

Cad 5 treated tubules. Scale bar, 50 μm. Western blot shows VE-cadherin blockade or

Page 8: Supplemental Data VE-Cadherin-Mediated Cell-Cell ... · listed in Figure S6. Levels of knockdown for VE-cadherin were determined using the LI-COR Odyssey system. Knockdown of Rho-kinases

Rho-kinase inhibition in the matrigel assay does not alter VE-cadherin expression

levels.

(E) VE-cadherin knockdown increases tube formation. HUVEC transfected with VE-

cadherin siRNA or scrambled control were seeded on confluent fibroblasts. After 5

days the cultures were fixed and stained for CD31. The number of branch points are

represented as mean ±SEM (n=9 microscopic fields from triplicate wells). Scale bar,

100μm.

Page 9: Supplemental Data VE-Cadherin-Mediated Cell-Cell ... · listed in Figure S6. Levels of knockdown for VE-cadherin were determined using the LI-COR Odyssey system. Knockdown of Rho-kinases

Figure S3

Page 10: Supplemental Data VE-Cadherin-Mediated Cell-Cell ... · listed in Figure S6. Levels of knockdown for VE-cadherin were determined using the LI-COR Odyssey system. Knockdown of Rho-kinases
Page 11: Supplemental Data VE-Cadherin-Mediated Cell-Cell ... · listed in Figure S6. Levels of knockdown for VE-cadherin were determined using the LI-COR Odyssey system. Knockdown of Rho-kinases

(A) Schematic representation of treatments in matrigel.

(B) Rho-kinase inhibition increases cord formation. 24 hours after plating on matrigel

HUVEC were treated with Y27632 for 24 hrs. Loops were counted at the end of

treatment and are represented as mean ±SEM (n=9 microscopic fields). Western blot

shows reduced levels of mono-phosphorylated (S19) and di-phosphorylated (T18S19)

MLC2 following Y27632 treatment for 30 min.

(C) VE-cadherin blockade with BV9 down-regulates MLC2 phosphorylation and

increases cord formation. 24 hrs after plating on matrigel HUVEC were treated with

25μg/ml BV9 or control IgG for 24 hrs. Loops counted at the end of treatment are

represented as in (B). Western blot shows levels of phosphorylated MLC2 (T18S19)

with BV9 treatment (50μg/ml) for 2 hrs. Average phospho-MLC2 downregulation

27.8% ±6.7% (p=0.01 n=6).

(D) Knockdown of p120 catenin down-regulates MLC2 phosphorylation and

increases cord formation. HUVEC were transfected with p120 or control siRNAs.

Loops counted 48hrs after plating are represented as in (B). Scale bar, 50 μm.

Western blot shows phosphorylated MLC2 (T18S19) in HUVEC transfected with

p120 or scrambled siRNAs. Levels of p120 protein were quantified using the Licor

system.

(E) The effect of inhibition of actomyosin contractility on cord formation is dose

dependent. HUVEC were plated on matrigel and after 24 hours the cultures were

treated with blebbistatin at 10, 50 or 100μM for 24 hrs. Loops counted at the end of

treatment are represented as in (B). Scale bar 100μm.

Page 12: Supplemental Data VE-Cadherin-Mediated Cell-Cell ... · listed in Figure S6. Levels of knockdown for VE-cadherin were determined using the LI-COR Odyssey system. Knockdown of Rho-kinases

(F) VE-cadherin blockade does not alter the localization of MLC2. 48 hrs after plating

on matrigel HUVEC were treated with Cad 5 (10μg/ml) or control IgG for 15min and

stained for VE-cadherin and total MLC2. Images were obtained using 60x objective.

Scale bar, 50 μm.

(G) VE-cadherin knockdown down-regulates MLC2 phosphorylation at cell junctions.

HUVEC were transfected with VE-cadherin or scrambled siRNAs. 24 hrs after plating

on matrigel the cultures were stained for VE-cadherin and phosphorylated (Ser19)

MLC2. Images were obtained using 60x objective. Scale bar, 50 μm.

Page 13: Supplemental Data VE-Cadherin-Mediated Cell-Cell ... · listed in Figure S6. Levels of knockdown for VE-cadherin were determined using the LI-COR Odyssey system. Knockdown of Rho-kinases

Figure S4

(A) Schematic representation of inhibition of Rho-kinase and actomyosin contractility

in co-culture.

(B) MLC2 phosphorylation at endothelial cell junctions is Rho-kinase dependent and

is regulated by VE-cadherin. Established tubules were treated with Y27632 (10μM)

for 30mins or Cad 5 (10μg/ml) for 5 hrs, fixed and stained for VE-cadherin and

phospho-MLC2 (Ser19). Images were obtained using a 60x objective. Scale bar, 20

μm.

(C) The effect of inhibition of actomyosin contractility is dose dependent. Established

tubules treated with blebbistatin 5, 10, 20, or 50μM for 48 hrs were visualized by

CD31 staining 3 days after the end of treatment. Scale bar, 100μm.

Page 14: Supplemental Data VE-Cadherin-Mediated Cell-Cell ... · listed in Figure S6. Levels of knockdown for VE-cadherin were determined using the LI-COR Odyssey system. Knockdown of Rho-kinases

Figure S5

Page 15: Supplemental Data VE-Cadherin-Mediated Cell-Cell ... · listed in Figure S6. Levels of knockdown for VE-cadherin were determined using the LI-COR Odyssey system. Knockdown of Rho-kinases

E

(A-C) VE-cadherin blockade or Rho-kinase inhibition result in increases in Rac1-

GTP. HUVEC were grown to confluency in the presence of VEGF (20ng/ml) and

Rac1 activity was assayed by pulldown assays. Quantifications were performed using

the Licor system.

(A) HUVEC were treated with 10μg/ml Cad 5 or control IgG for 30 mins. Rac1-GTP

levels in treated HUVEC are shown as fraction of Rac1-GTP in IgG treated controls

after normalization for total Rac1.

(B) HUVEC were treated with the Rho-kinase inhibitor Y27632 (10μM) in the

absence or presence of the VEGFR2 inhibitors SU1498 (10 μM), BAY 43-9006

(1μM) or Avastin (5μg/ml). Rac1-GTP levels in treated HUVEC are shown as

fraction of Rac1-GTP in untreated controls after normalization for total Rac1.

(C) HUVEC were treated with the Rho-kinase inhibitor Y27632 (10μM) for 15, 30 or

60 mins. Western blot shows levels of phosphorylated VEGFR2. Rac1-GTP levels in

treated cells are shown as fraction of Rac1-GTP in untreated controls after

normalization for total Rac1.

Page 16: Supplemental Data VE-Cadherin-Mediated Cell-Cell ... · listed in Figure S6. Levels of knockdown for VE-cadherin were determined using the LI-COR Odyssey system. Knockdown of Rho-kinases

(D) Treatment with the Rac1 inhibitor NSC23766 reduces CDC42-GTP levels.

HUVEC were treated with the Rac1 inhibitor NSC23766 (100μM) for 4, 8, 24 or 30

hrs. Levels of CDC42-GTP are shown as percentage of CDC42-GTP in untreated

controls after normalization for total CDC42.

(E) The sprouting response to VE-cadherin blockade is not augmented by addition of

exogenous VEGF. Established tubules treated with 5μg/ml Cad 5 or control IgG in

the presence or absence of VEGF (20 or 50ng/ml) were followed by timelapse

microscopy. Video stills are shown at 12 hr intervals over 36 hrs. Arrows show

sprouting points. Scale bar 50μm.

Figure S6. Sequences of siRNA Oligonucleotide Duplexes