Supplement Material

Materials: HUVECs were harvested from umbilical cords donated by the birthing centre,

Royal Victoria Hospital, Montreal, Quebec. The majority of reagents used in cell culture were

obtained from the Invitrogen (Burlington, ON). Recombinant human Ang-1 and Ang-2

proteins were purchased from R&D Systems (Minneapolis, MN). Both were dissolved in

sterile phosphate-buffered saline (PBS). Recombinant human VEGF protein (Invitrogen Inc.)

was dissolved in PBS. Antibodies for total HDAC7, phospho-PKD1 (Ser744/748), total PKD1,

phospho-NFκB p65, p65, p50 NFB and -tubulin were purchased Cell Signaling Inc.

Phospho-HDAC7 (Ser178), phospho-HDAC7 (Ser344), and phospho-HDAC7 (Ser479) antibodies

were generated by Dr. E. Verdin (University of California at San Francisco). Phospho-PKD2

(Ser876) and total PKD2 antibodies were obtained from Upstate Biotechnology. E-selectin

antibody was purchased from R&D Systems (Minneapolis, MN) and VCAM1 was purchased

from Santa Cruz Biotechnology Inc. (Santa Cruz, CA). Histone H3 antibody was purchased

from Millipore Inc. GFP expressing adenoviruses (Ad-GFP) were purchased from the Gene

Transfer Vector, University of Iowa. Adenoviruses for wild type Flag-tagged Nur77 (Ad-

Nur77) and Flag-tagged dominant negative Nur77 lacking the transactivation domain (Ad-

dnNur77) were generated by Dr. J.X. Sun (Thomas Jefferson University). Dr. Z.G. Jing at the

University of Rochester (School of Medicine and Dentistry) generated adenoviruses expressing

PKD1 wild type (Ad-PKD1), a dominant-negative form of PKD1 (Ad-dnPKD1), GFP-HDAC7

wild type (Ad-GFP-HDAC7) and adenoviruses expressing GFP-HDAC7-S/A (Ad-GFP-

HDAC7-S/A). The adenoviruses expressing the mutated form of HDAC7 have serine residues

178, 344, and 479 mutated to alanine residues. Adenoviruses expressing a luciferase reporter

gene driven by NFκB transcriptional activation (Ad-NFκB-Luc) 1, were also purchased from

the Gene Transfer Vector Core (University of Iowa) which were used to co-infect cells for the

luciferase reporter experiments. The role of JNK in Ang1-mediated induction of Nur77 was

assessed with the aid of adenoviruses expressing dominant-negative c-Jun (Ad-Tam67)

purchased from Vector Biolabs (Philadelphia, Pennsylvania).

Cell Culture:

Endothelial cells: Donated umbilical cords that were approximately 25 cm in length were

placed in Hank’s Balanced Salt (HBS) solution containing penicillin (100units/ml),

1

streptomycin (100mg/ml), and amphotericin B (0.25mg/ml). The umbilical cord vein was

washed and drained with HBS. Both ends were cannulated and filled with 7ml of 0.1%

collagenase type 1. The cord was then placed in a beaker containing HBS and incubated for 9

min at 37°C. The umbilical cord vein was flushed three times with 10ml of HBS into a tube

containing HUVEC growth media. The liquid was centrifuged at 1000 rpm for 10 min and the

pellet was re-suspended and plated on culture plates coated with 0.1% gelatin. HUVECs were

grown in MCDB131 (Wisent Inc.) supplement with 20% fetal bovine serum (FBS), endothelial

mitogen growth factor (Biomedical Technologies Inc.), 2mM glutamine, heparin, and

gentamicin reagent solution (Invitrogen). HUVECs were used for experiments between

passages 3 to 7. ECRF24 EC line was kindly donated by Dr. C. Kontos (Duke University).

HMEC1 EC line was grown in MCDB131 (Wisent Inc.) supplement with 10% fetal bovine

serum (FBS), 2mM glutamine and gentamicin reagent solution (Invitrogen).

U937 monocytes: The human leukemic monocyte lymphoma (U937) cell line was used for

the adhesion assays. U937 monocytes are non-adherent and grown in suspension on 100 mm

culture dishes. The media used to culture cells was RPM1 1640 (Invitrogen) supplemented

with 10% FBS and the media was changed every 4 days. Cells were grown in a 37°C incubator

with 5% (v/v) CO2 and passaged once 70-80% confluency was reached.

Infection of HUVECs with adenoviruses: HUVECS at 60-70% confluency were washed

twice with PBS and then infected for 6 hrs with serum-free media containing 100 mutiplicity

of infection (MOI) virus units. Once the 6hr infection period was complete, the virus

containing medium was replaced with HUVEC complete media. After 48hrs of recovery, the

cells were used to perform further experiments.

Infection of HUVECs with retroviruses: Second passage HUVECs were seeded on 100mm

culture dishes in growth media at a density of 350 000 cells. After 24hrs, the media was

replaced with 5ml of HUVEC growth media and then 1ml of retroviruses expressing LacZ,

Nur77, or anti-sense Nur77 was added drop wise to the culture dishes. Polybrene (Sigma

Aldrich) was then added at 12μg/ml and after 16hrs; the media was changed to 10ml fresh

HUVEC growth media. After 48hrs of recovery, we verified gene expression using

immunoblotting and real-time PCR and the cells were then used for further studies.

Role of JNK/SAPK pathway in the regulation of Nur77 expression by Ang-1: To assess

the influence of JNK/SAPK pathways on Ang-1-induced Nur77 expression, we used HUVECs

2

that were stably transduced with a dominant negative JNK/SAPK (HUVEC-MSCV-JNK-APF)

or mock (HUVEC-MSCV) retroviruses as previously described 2, 3. HUVECs were transduced

with a dominant negative JNK/SAPK in which the phosphorylation site Thr-Pro-Tyr is mutated

to Ala-Pro-Phe (JNK-APF). HUVEC-MSCV and HUVEC-MSCV-JNK-APF were constructed

by retroviral transduction using MSCV-pac (empty vector) or MSCV-pac containing JNK-APF

cDNA, respectively. HUVECs were transduced as previously described, except for few

modifications indicated hereafter. Transient transfections of the Ampho Phoenix packaging cell

line were performed using Fugene 6 transfection reagent (Boehringer Mannheim). Viral

supernatants from transfected packaging cell lines were used to transduce the ECs in multiple

rounds of infection. HUVECs were selected in puromycin. Expression of JNK-APF was

confirmed by immunoblotting using an antibody for total JNK (Santa Cruz). These cells were

maintained in the same conditions as HUVECs, except penicillin/streptomycin was also added

to the media.

Imaging of HDAC7 mobilization: Lab-TekTM eight chamber wells (Thermo Fisher

Scientific Inc.) were coated with 10μg/ml of fibronectin (Sigma Aldrich) prior to seeding of

HUVECs infected 48hours earlier with 100 MOI of Ad-GFP, Ad-GFP-HDAC7, or Ad-GFP-

HDAC7-S/A. The cells were serum starved for 6 hrs prior to treatment with solvent, Ang-1

(500ng/ml), VEGF (40ng/ml), or a combination of Ang1 and VEGF for 1 to 24 hours. Once

stimulation was complete, the media was aspirated and the wells were washed gently three

times with PBS. The cells were fixed with 4% paraformaldehyde for 20 min in the dark at

room temperature. The wells were then washed gently three times with PBS, allowed to dry,

and then the wells were removed. DAPI with mounting media (VectaShield, Vector

Laboratories) was added to the slide which was then covered and sealed. Cells were visualized

with Olympus 1X70 inverted fluorescence microscope and 10 fields per well for each

condition were captured using the 10X objective. Cells were then counted for nuclear versus

cytosolic localization of HDAC7 with Image Pro plus software.

Quantitative real-time PCR analysis: Total RNA was extracted using GenEluteTM

Mammalian Total RNA Miniprep Kit (Sigma-Aldrich) according to the manufacturer’s

instructions. A260/A280 absorption by plate reader was used to assess the quantity and purity

of total RNA. SuperScript II RNase H-Reverse Transcriptase enzyme (Invitrogen) was used to

reverse transcribe 2 μg of RNA for 50 min at 42°C and then 90°C for 5 min. Specific primers

3

(refer to Table 1) and the Real Time PCR System 7500 from Applied Biosystems were used to

carry out the real-time PCR analysis. Glyceraldehyde 3-phosphate dehydrogenase (GAPDH)

expression was monitored as a control gene in the analysis. SYBR Green PCR Master Mix

(25μl) from Qiagen Inc. was added to 1μl of the reverse transcriptase reaction and 3.5μl of

10μM primers. The thermal profile used with the Real Time PCR System 7500 was: 10 min at

95°C, 15 s of 40 cycles at 95°C, 57°C for 30 s, and 34 s at 72°C. Primer-dimer formation and

contamination was assessed with a melt analysis for each PCR experiment and a single melt

peak for each set of primers was used to confirm that a single PCR reaction was generated. The

comparative threshold (CT) cycle method (also referred to as the 2-ΔΔCT method) was used to

analyze the results. To determine the absolute copy numbers of Nur77 and GAPDH mRNA

transcripts, standard curves that related CT values of these genes to the copy numbers were

established by performing real-time PCR analysis on samples with known copy numbers of

plasmids containing full coding sequence of Nur77 and GAPDH. Plasmids were diluted

serially to generate copy numbers ranging from 0.3 to 300,000. Copy numbers of Nur77 and

GAPDH were then calculated and Nur77 copy numbers were then normalized per 103 copies

of GAPDH. All real-time PCR experiments were done in triplicate.

Subcellular fractionation for cytosolic and nuclear extracts: Cells were grown on 100 mm

culture dishes and infected with 100 MOI of Ad-GFP, Ad-Nur77, or Ad-dnNur77 and then

treated for 2 hrs with VEGF (40ng/ml). Protein extraction was done on ice and cells were

harvested by scarping with 1ml of ice cold PBS then centrifuged for 5min at 1500 rpm. Re-

suspension of the pellet was done in equal volume of ice cold hypotonic buffer (20 mM Tris

pH 7.5, 10 mM KCl, 1mM DTT, 0.5 mM PMSF, 0.1 mM Na orthovanadate, 1μg/ml leupeptin,

and 1μg/ml aprotinin). The loose pestle was used with the Wheaton Dounce Tissue Grinder

(Fisher Scientific) to lyse cells. Trypan blue was verified that the cells were lysed and then the

samples were centrifuged for 3 min at 3000rpm. The supernatant contains cytosolic proteins

that were then stored at -80°C. The nuclear pellet was re-suspended with 1ml of ice cold

hypotonic buffer and then centrifuged at 3000rpm for 3min. Ice cold hypertonic buffer (20 mM

Tris pH 7.5, 500 mM KCl, 1 mM DTT, 0.5 PMSF, 0.1 mM Na orthovanadate, 1μg/ml

leupeptin, and 1μg/ml aprotinin) was used to re-supend the pellet and the nuclear fractions

were stored at -80°C.

Immunoblotting: Tris-glycine SDS-polyacrylamide gels were used to load total cell lysates

4

(30µg of total protein) samples which were boiled for 5 min. Cells were lysed with RIPA

buffer (Santa Cruz) and protein concencentrations were measured by the Bio-Rad protein assay.

A marker with predetermined molecular weight standards was also loaded on the gels. Proteins

were transferred to polyvinylidene difluroide (PVDF) membranes electrophoretically and then

membranes were blocked with 5% non-fat dry milk. PVDF membranes were then incubated

with antibodies overnight at 4°C. Probing for -tubulin levels was used to verify equal protein

loading. Horseradish peroxidise-conjugated secondary antibodies and ECL reagents were used

to detect proteins.

Non-radioactive Electrophoretic Mobility Shift Assay (EMSA): The nuclear extracts were

prepared as described above. The binding reactions of biotin-labeled p65 oligos provided in the

EMSA Gelshift Kit (Panomics Inc.) with 10μg of nuclear protein extracts were done according

to the instructions provided by the manufacturer. The binding complexes were resolved by

electrophoresis of 6% non-denaturing polyacrylamide gels. The gels were then wet-transferred

to nylon membranes (Pall Biodyne B). The nylon membranes were fixed by UV crosslinkage

and blocked at room temperature for 15 min with gentle shaking. The binding complexes were

detected using strepatvidin-HRP and ECL reagents according to the manufacturer’s

instructions.

Luciferase Reporter Assay: HUVECs seeded on 24-well plates were transiently infected with

Ad-GFP, Ad-Nur77, or Ad-dnNur77 and co-infected with Ad-NFκB-Luc. Forty-eight hours

after infection, cells were stimulated with vehicle, Ang-1 (500 ng/ml), VEGF (40 ng/ml) or

Ang-1+VEGF for 6 hours. Cell lysates were prepared by using 100μl of passive lysis buffer

provided in the Dual Luciferase Assay Kit (Promega). Luciferase activity was measured by

detecting luminescence with SpectraMax M2 microplate reader (Molecular Devices Inc.) and

SoftMax Pro software according to instructions provided by the manufacturer of the Dual

Luciferase Assay Kit.

Small Interfering RNA for Nur77: Cells were seeded on 12-well culture plates. Scrambled

siRNA (non-silencing) and Nur77 smart pool siRNA were purchased from Dharmacon RNA

Technologies. The small interfering RNA was re-suspended to 20μM according to the

manufacturer’s instructions. Thermo Scientific DharmaFECT 4 transfection reagent was used

according to the instructions provided by the manufacturer to deliver 100 nM and 175nM of

siRNA oligos to HUVECs. The transfection medium lacking antibiotics was replaced with

5

complete HUVEC media after 24 hours to reduce cytotoxicity. After 48 hrs, cells were lysed

for RNA and real time PCR was conducted in order to verify optimal Nur77 mRNA

knockdown compared to GAPDH (control) mRNA levels. Our results show that Nur77 mRNA

was reduced by 70% in HUVECs transfected with Nur77 oligos. Monocyte adhesion assay of

HUVECs given 100 nM of scrambled siRNA oligos or 100 nM of Nur77 siRNA oligos was

conducted. HUVECs were seeded on 24-well plates coated with 0.1% gelatin. After 48 hours

of transfection, cells were stimulated with solvent, Ang1 (500 ng/ml), VEGF (40ng/ml), or

Ang1+VEGF for 8 hrs. DiI-labeled U937 monocytes were then co-incubated with the HUVEC

monolayers for 1 hr. The wells were then washed and cells fixed with 4% paraformaldehyde.

Cells were visualized with Olympus 1X70 inverted fluorescence microscope and 10 fields per

well for each condition were captured using the 10X objective. Cells were then counted with

Image Pro plus software.

Monocyte adhesion assay: Low-passage HUVECs (passages 3 and 4) infected with 100 MOI of

adenoviruses were seeded on 24-well culture plates which were coated with 0.1% gelatin. Forty-

eight hours after the infection, adenovirus-infected HUVEC monolayers (95% confluency) were

washed twice with PBS and stimulated for 8 hrs with 200μl of basal HUVEC media containing:

only the solvent, 500ng/ml Ang1, 40ng/ml VEGF, or Ang1 and VEGF. The monocyte adhesion

assays used in this study was modeled after the assay utilized in Fielder et al. Before the 8 hrs

stimulation was complete, U937 cells were fluorescently labelled. Half a millions U937 cells

were labeled with 3,3’-dioctadecylindocarbocyanin-iodide (Dil) dye at a concentration of 1μM

which was purchased from Biotium Inc. The cell-dye mixture was gently pipetted. Cells were

then centrifuged, washed twice with PBS and re-suspended in U937 media. 250μl of the U937

monocyte cell suspension was co-incubated to each well of HUVECs for 1hr at 37˚C on a

rocking platform. After 30min of shaking, the plate was rotated 90˚ for the remainder of the

shaking time to ensure proper coverage of monocytes over the HUVEC monolayers. The media

was then removed and the wells were washed three times with PBS at room temperature to

ensure only tightly adhered monocytes remained. Cells were then fixed for 15 min with 4%

paraformaldehyde at room temperature. The 4% paraformaldehyde was then removed and 10

fields per well were viewed under 10X magnification with Olympus 1X70 inverted microscope

(under the red fluorescence filter) and adhered monocytes were quantified with Image-Pro plus

software.

6

Table I: Primers used for real-time PCR experiments

Type Sequence (5'→3') Accession Number Expected Size (bp)

Nur77 F: GTTCTGGAGGTCATCCGCAAG NM_173157 226

R: GCAGGGACCTTGAGAAGGCCA

VCAM1

F: CATTGACTTGCAGCACCACA NM_080682 202

R: GATGTGGTCCCCTCATTCGT

E-Selectin F: AGAAAATCTGGCACCACACC NM_000450 128

R: GGGGTGTTGAAGGTCTCAAA

IκBα

F: ACAACCTGCAGCAGACTCCA NM_020529 99

R: TCTCGGAGCTCAGGATCACA

β-Actin

F: AGAAAATCTGGCACCACACC NM_001101 123

R: GGGGTGTTGAAGGTCTCAAA

 

7

Supplementary Figure I:

A: Nur77, Nor1 and Nurr1 mRNA levels were measured after 48h of transfection with

scrambled or Nur77 siRNA oligos. mRNA levels were measured with real-time PCR and

selective primers. Results are expressed as fold from those measured in cells transfected with

scrambled siRNA oligos. *P<0.05 compared to scrambled siRNA.

B: Nur77 protein detected in HUVECs transfected 48h earlier with scrambled or Nur77 siRNA

oligos.

C: Nur77 protein detected after 48h of infection with Ad-GFP, Ad-dn Nur77 and Ad-Nur77

viruses.

8

Supplementary Figure II

Nur77 mRNA expression after 1h stimulation with vehicle (control) or Ang-1 (500 ng/ml) in

three different types of endothelial cells (HUVECs, ECRF24 cells, and HMEC1). *P<0.05

compared to control.

9

Supplementary Figure III

A: Mean and SE of optical densities of phosphorylated HDAC7 on serine 178, 344 and 479 in

response to Ang-1 (500 ng/ml) exposure in HUVECs. * P<0.05 compared to control (0 time)

values.

B: Phosphorylation of HDAC7 is stimulated by Ang-1. HUVECs were exposed to Ang-1 for

15 min at the indicated concentration levels. Total and phosphorylated (Ser178 and Ser479)

HDAC7 protein was detected with immunoblotting and selective antibodies.

10

Supplementary Figure IV:

A: Representative immunoblots of HDAC7 phosphorylation on Ser178, Ser344, and Ser479 in

HUVECs exposed to VEGF (40ng/ml) for 15 min.

B: Representative immunoblots of HDAC7 phosphorylation on Ser479 and total HDAC7 in

HUVECs exposed for different time periods to Ang-1 (500 ng/ml) or VEGF (40 ng/ml).

11

Supplementary Figure V:

Top: Representative images of HDAC7 mobilization to the cytosol in HUVECs infected 48h

earlier with Ad-GFP-HDAC7 viruses then exposed to vehicle (control), Ang-1 (500ng/ml),

VEGF (40ng/ml), or Ang-1 + VEGF for 1 or 4h.

Bottom: Representative images of HDAC7 mobilization to the cytosol in HUVECs infected

48h earlier with Ad-GFP-HDAC7-S/A viruses and exposed to VEGF (40ng/ml) for 4h.

12

Supplementary Figure VI:

A&B: Representative immunoblots and optical densities of PKD1 phosphorylation on

Ser744/748 and PKD2 phosphorylation on Ser876 in response to vehicle (control) or Ang-1 (500

ng/ml) stimulation in HUVECs for various times as indicated. *P<0.05 compared to control.

C: Representative immunoblots of PKD1 phosphorylation on Ser744/748 and total PKD1 in

response to vehicle (0 time), Ang-1 (500 ng/ml) or VEGF (40 ng/ml) stimulation in HUVECs

for various times.

D: Representative immunoblots of PKD2 phosphorylation on Ser876 after VEGF (40 ng/ml)

stimulation for 15 minutes. *P<0.05 compared to control.

13

Supplementary Figure VII:

Nur77 mRNA expression measured after 1h treatment with vehicle (control) or Ang-1 (500

ng/ml) in HUVECs infected 48h earlier with Ad-GFP viruses or viruses expressing a dominant

negative form of c-Jun subunit of the AP-1 transcription factor (Ad-Tam67). *P<0.05 compared

to Ad-GFP-transduced cells treated with vehicle. #P<0.05 compared to Ang-1 treatment of Ad-

GFP-infected cells.

14

Supplementary Figure VIII:

Representative immunoblots of p50 and p65 subunits of NFB transcription factors in the

cytosolic (C) and nuclear (N) fractions of HUVECs stimulated with Ang-1 (500 ng/ml).

15

Supplementary Figure IX:

Mean SEM of IκBα protein OD in HUVECs infected with retroviruses expressing LacZ,

Nur77 S, Nur77ΔLBD, Nur77ΔTAD and Nur77ΔDBD. *P<0.05 compared to cells infected

with LacZ-expressing viruses. N=5.

16

Supplementary Figure X:

A: E-selectin and VCAM1 mRNA expression in HUVECs exposed to vehicle (control), Ang-1,

VEGF, or Ang-1 + VEGF. N=6. *P<0.05, compared to control. #P<0.05 compared to VEGF.

B: Expression of E-selectin and VCAM1 mRNA in response to VEGF exposure (40 ng/ml)

measured with real-time PCR. Data are shown as fold change from vehicle-treated (control)

cells. *p<0.05 compared to control. N=6 per group.

17

Supplementary Figure XI:

A: Number of adhered U937 cells in HUVECs exposed to vehicle, Ang-1, VEGF or Ang-1

+VEGF for 8h then incubated with labeled U937 cells for 1h. N=5. *P<0.05, compared to

control. #P<0.05 compared to VEGF.

B: Representative image of number of adhered U937 cells in HUVECs infected with Ad-GFP,

Ad-Nur77, or Ad-dn Nur 77 viruses.

18

19

REFERENCES:

(1) Sanlioglu S, Williams CM, Samavati L, Butler NS, Wang G, McCray PB, Jr., Ritchie TC,

Hunninghake GW, Zandi E, Engelhardt JF. Lipopolysaccharide induces Rac1-dependent reactive oxygen species formation and coordinates tumor necrosis factor-alpha secretion through IKK regulation of NF-kappa B. J Biol Chem 2001 August 10;276:30188-30198.

(2) Karsan A, Yee E, Harlan JM. Endothelial cell death induced by tumor necrosis factor- is inhibited by the Bcl-2 family member, A1. J Biol Chem 1996 January 1;271:27201-27204.

(3) Harfouche R, Hussain SNA. Signaling and regulation of endothelial cell survival by angiopoietin-2. Am J Physiol Heart and Circulatory Physiology 2006;291:H1635-H1645.