1

Steinbeck Smart Farm Systemsprototype farm launch proposal

Here you can learn about the proposed launch projects associated with the Steinbeck Innovation Cluster Smart Farm Systems prototype. At the core of the launch effort is the development of cutting-edge networked biological and environmental sensors that protect farms from damaging pathogens and provide systems-level overview of core farm functions while connecting farm operations with broader market information streams. The prototype also involves robust focus on emerging sustainability technologies that include development and testing of equipment for nitrogen recapture from

tile drains and ditches, advancement of water- and nutrient-efficient crop varieties, and implementation of sophisticated aquaculture technologies that can transform farm wastes into valuable seafood products.

Education and training of students and citizens at all levels are at the heart of the proposed Steinbeck Smart Farm prototype. Carefully coordinated curriculum development, internships, and after-school programs will provide Salinas students with hands-on learning, college readiness, and entrepreneurship training. The prototype will also be the foundation of

diverse university undergraduate, graduate, and postdoctoral research projects. We will also connect with adult learners and all those eager to learn more about sustainable precision agriculture.

The Steinbeck Smart Farm prototype launch will drive the emergence of technologies and processes well-positioned for commercialization and tech transfer via the Technology Transfer /Start-up Acceleration activities of the Innovation Cluster.

Read on.

The future ofsustainablefarming and foodsystems is beinglaunched in theSalinas Valley.

STEINBECKSMARTFARMJu

ly 9

, 201

3 0111010100110100101110101010010100101000101001101001010010100011101010011010010111010101001010010100010100110100101001010010101010011010010100101001010101001101001010010100101010100110100101001010010101010011001101001010010100111101011101010011010010100101001010001010011010010100101001010101001101001010001001010010100101000101001101001010010100101010100110100101001010010101010011010010100101001010101001101001010010100101010101001010101001101001010010100101010100110100101001010010101010011010010100101001010111010100110100101001010010100010100110100101001010111101010100100010100100110100101001010010101010010010100101011110101010010001010010011010010100101001010101001101001010010100101010100110100101001010010101010011010010100110100101001010010101010011010010100101001010101001101001010010100101011101010011010010100101001010001010011010010100101001010010101110101001101001010010100101000101001101001010010100101010100110100101001010010101010111101101001010010010100101001010101001101001010010100101011101010011010010100101001010000101010100110100101001010010101110101001101001010010100101000101001101001010010100101010011110001010010`111010101010001001000101010001011101010101010010001001000111101010001000111100100010101000101110101010101001000100100011110101000100011110010100001010100011110000011101010100111010010101000010001001001010000101010001111000001110101010011101001010100001000100100100101001011101010101001010101010011110101000010000101000100010010100101110101010100101010101001111010100001000010100010001001110101000100100101001101010010011001010001010011010010100100111010100010010010100110101001001100101000101001101001010010100101010100110100101001010010101010011010010100101001010101010010101010011010010100101001010101001101001010010100101010100110100101001010010101010011010010100101001010101001101001010011010010100101001010101001101001010010100101010100110100101001010010101010011010010100101001010101001101001010010100101

2

Concept: Leveraging bioanalytical tools developed for ocean samples in collaboration with MBARI, develop sample preparation protocols and DNA-based tools to detect and quantify crop pathogens, field-test approaches, and develop spatial pathogen tracking system and on-farm data management interface. Details

Outbreaks of microbial pathogens, and their prevention, impose heavy economic costs on growers. However, available methods of detection of these pathogens in the Salinas Valley (and elsewhere) often rely on slow and unreliable methods using outdated technologies. We will develop sensitive yet reliable DNA-based means of detecting and quantifying key pathogenic microbes (viruses, bacteria, fungi) by a process known as “real-time PCR” or “quantitative PCR” (qPCR, PCR = Polymerase Chain Reaction). A key feature of this approach, beyond its sensitivity and reliability, is its speed - we anticipate developing an approach that, using a mobile laboratory, can return key results to growers in <24 h, in time to be useful in planting and crop management decisions. Beyond presence/absence detection and quantification, we also seek to develop tools to assess pathogen activity using RNA-based methods that monitor protein synthesis activity which defines bacteria metabolic behavior. RNA cannot be detected directly

using PCR technology; however, with the addition of a preliminary step known as Reverse Transcription (RT), a specified sequence of RNA can be converted into complementary DNA for RTqPCR detection, providing insights into the metabolic state of the pathogenic microbes present, permitting further discrimination of the level of threat presented.

Along with collaborators at the Monterey Bay Aquarium Research Institute (MBARI), we have been developing a next generation environmental sample processor (ESP) to monitor microbial presence and activity in the open ocean using qPCR and RT-qPCR technology. Through that project, a miniaturized, battery powered analytical instrument was developed for field operations. The instrument samples ocean water, extracts nucleic acid content, and then quantifies

targeted microorganisms along with their relative levels of RNA expression.

Leveraging that prior work, we will lead development of a mobile front end sample preparation and PCR analytical lab specific to active farming conditions and test it for key pathogens of lettuce, strawberries, and grapes. We will test the reliability (frequency of false positives and false negatives) in greenhouse tests using appropriate biosafety protocols, comparing our results against those obtained from existing third-party services using standard approaches. Furthermore, we anticipate developing geo-located sample tracking systems that will allow near-realtime mapping of pathogen presence, enabling more effective pathogen containment. Finally, we will develop interfaces for on-farm data managementof the system outputs.

Project S-1: Rapid In Situ Monitoring of Pathogen Dynamics for Smart Farm SystemsLeaders: Cody Youngbull & Charles

Sanchez

Institutions: Arizona State University, University of Arizona

(Also: Monterey Bay Aquarium Research Institute)

Smart farm systems will have big bio data.Modern DNA-based biological sensing will provide future farmers with rich and rapid information about emerging threats of pathogen outbreaks.

Year 1 benchmarksFirst quarter: Collect list of target pathogens with their environment and outcomes identified. Acquire detection primers for pathogens of interest. Sample collection campaign and analysis using third party standard analysis and ASU techniques in the lab. Second quarter: Analyze data from third party lab compared to ASU results. Develop preliminary design of mobile operations RT-qPCR laboratory. Third and fourth quarters: Begin construction of mobile operations laboratory. Continued iteration of sample collection procedure development & verification. Develop and optimize approaches for conveying microbial data to decision-makers. Prepare activity report.

Year 2 benchmarksFirst quarter: Complete construction of mobile operations unit. Second quarter: Deploy mobile operations unit to Salinas valley. Operate unit in preliminary partner sites at regular intervals. Roll-out secure web-based data and mobile app interface for decision-makers. Third and fourth quarters: Put unit operations on display for visiting farmers for purposes of education and to gain acceptance. Prepare activity report and scholarly articles.

AGTCCGTTCGCAAGTCGCAAGTTTCGCAATCGCAAGTTTCGCGGTATTCGCGGTAGCAAGTCAAGTTTCGCGGTATTCGCGGTAGCGTTCGCAAGTCGCAAGTTTCGCAATCGCACGCGGTATTCGCGGTAGCAAGTCAAACAAGTTTCGCGGTATTCGCGGTAGCAAGGGGTTTCGCGGTATTCGCGGTATTCGCGGTAGCGTTCGCA

STEI

NBEC

KINN

OVAT

ION

3

Concept: Wireless sensor network deployed in a grid-like fashion to blanket an area for monitoring multiple target molecules (e.g. water, fertilizer, pesticides), leading to commercialized sensor platform for real-time data from smart farming grids for output to on-farm data management interface. Details

Optimal water and agronomic chemical levels are well known to dictate crop yield, food quality, and plant resilience to disease and pests. As the result of decades of laboratory research, field water and nutrient conditions

are amended according to each specific crop and the conditions of the local soil type. However, optimization of these approaches requires up-to-date information. In the Salinas Valley (and elsewhere), many growers rely on low spatial and temporal resolution information obtained from samples sent to off-site laboratories with slow turn-around. However, meeting emerging challenges due to seawater encroachment, tight water supplies, and regulatory constraints on fertilizers will require that better information be immediately available to growers so that they can adjust their practices easily and effectively.

Next-generation in situ sensor networks can address these issues. As used in environmental sensing applications, such networks employ a spatially distributed array of communicating nodes, in which each node collects and transmits data that is temporally

and geographically referenced to a broader context. Such networks can achieve continuous, autonomous, long term monitoring campaigns over large areas. Real-time, in situ wireless sensor webs that are sensitive to water and critical nutrients and rugged enough to withstand regular farming practice and climate conditions for long periods of time are needed in a smart farming initiative.

Leveraging the development of an extreme environment sensor web developed at Arizona State University for the National Science Foundation, solar-powered, wireless sensor nodes will be deployed for long term (>1 year) operations in an active field and runoff monitoring campaign, focusing especially on monitoring of tile drains. The network will including the field experiments involved in Project NS-4. Soil sensors for soil nitrate, salinity, pH, water, and temperature will be integrated into each soil node while water nodes will focus on nitrate and TDS.

The “Steinbeck Nodes” (see Figure) will be solar rechargeable battery operated nodes that function in the fields and waterways of a real farming environment. The nodes will be robust enough to withstand continuous outdoor operations under active farming. Network sensor data may be interpolated between nodes and displayed live on a secure website, tablet, and smartphone enabled app (see Project S-3). Such an app would be like a “virtual divining rod”, translating information from the sensors instantly to the cellphone, giving the user the ability to estimate the distribution of chemical and physical conditions between sensor nodes and precisely at the location of the sensors themselves, perhaps in nearby tile drains and drainage ditches. This information will be available in real time along with the recent and long-term history of key parameters at each node and its neighbors. This information will empower growers to make more effective, and sustainable, decisions.

Project S-2: Wireless Sensor Network for Smart Farm SystemsLeaders: Cody Youngbull & James

Elser

Institutions: Arizona State University & Monterey Bay Aquarium Research Institute

Smart farm systems will grow in the cloud.Networked sensor grids will provide future farmers with rich and rapid feedback on soil and water conditions, including nutrients, salinity, and other key parameters at local and regional scales.

Year 1 benchmarksFirst quarter: Preliminary survey on soil characteristics, field dimensions, water flow analysis, typical weather conditions, parameters to be monitored, farming activities, and community interests. Second quarter: Soil samples collected for sensor ground truth and chemical sensor development. Third and fourth quarters: Sensor web prototype development: Individual component selection (transceiver, sensors, GPS localization, casing, microcontroller, and power modules), integration and laboratory evaluation, initial field testing (10+ nodes). Prepare activity report.

Year 2 benchmarksFirst quarter: In situ deployment: infrastructure development including Remote Relay Station (RRS) to be constructed on site, extreme conditions tests performed at the laboratory and remotely from site for testing operations. Second quarter: Sensor network improvements: enhancement of deployed prototypes. Third and fourth quarters: Final deployment and follow-up: RRS setup and deployment on site, full scale deployment of nodes. Prepare activity report and technical manuscript(s).

STEI

NBEC

KINN

OVAT

ION

4

Concept: Develop on-farm data interface applications that will display sensor results on a smart phone, as well as real-time global market analytics for products, climatological overlays, product tracking data, and other key info. Connect effort to Coder Dojo, HS internships, and K-12 curriculum in collaboration with education leaders.Details

Smart Farm System Applications will by on-farm, mobile data interfacesintended to serve several purposes.

First, they will provide a proof of concept for the value of integrating remote sensors for real time data and trend analysis. The objective is to demonstrate the value of applying enterprise, collaborative technologies to raise awareness of emerging issues of pathogen distribution, soil conditions, runoff water quality as well as regional supply chain dynamics, food safety issues, market status, and product tracking..

Second, the apps will provide a valuable learning platform for local area high school and college students to gain hands-on experience applying sophisticated technologies involved in commercial agriculture and aquaculture.

Third, the applications will provide opportunity for young students (via the Coder Dojo) to apply divergent thinking and newly acquired programming skills to actual problem solving in an environment familiar to them.

Fourth, the applications will broaden the appreciation of regional growers and distributors for a collaborative use of novel sensors and networked data.

Finally, the apps will alert large IT and technology companies – as well as entrepreneurs interested in developing related manufacturing businesses - of the opportunity space in merging high

technology (sensors, robotics, nutrient science, and waste management) and the IT industry with global agriculture and aquaculture for a more sustainable model of economic growth.

The apps will be developed by staff of CSU-MB in close collaboration with Cody Youngbull (ASU, Projects S-1 and S-2) and working in collaboration with the Steinbeck Education team (Projects E-1 and E-1) .

STEI

NBEC

KINN

OVAT

ION

Project S-3: Smart Farm Systems App Development for Next-generation On-farm Data InterfacesLeader: Jonathan Shu & YoungJoon

Byun

Institution: California State University-Monterey Bay

Smart farm systems will have apps.Smart farm entrepreneurs will develop system apps to monitor not only the farm but also key components of the food system, including market prices, supply chain dynamics, and consumer demand.

Year 1 benchmarksA Smart Phone application that can synthesize data collected from remote sensors into a real-time (and historical) geographic display of conditions being monitored (pathogen presence and activity, water availability, soil nutrients, nitrate concentrations in tile drains.. Furthermore, we anticipate including real time data flows capturing overviews of regional and global market analytics by crop type (production, consumption by geographic region, supply chain analytics). The app will allow include preliminary tracking of products by bar code (if these data are provided by investors). Activity report.

Year 2 benchmarksFully integrated WAN network that displays all analytics noted above for the region being monitored and the products of interest. Market analytics (and trends) on supply chain variables that impact production rate and consumer demand. Forecasting models displayed for specific product types to include climatological, labor, and transportation impacts. Activity report and scholarly articles.

5

Concept: Screen, breed, and/or engineer varieties of target crops (lettuce, strawberry, grape) for root function to improve soil nutrient and water use efficiency. Test their performance under Salinas soils and growing conditions.Details

Achieving greater agricultural sustainability will require increased efficiency of water and fertilizer use by

crops. For example, globally, ~30% of the phosphorus (P) and ~50% of the nitrogen (N) added to fields as fertilizer and manure is lost in erosion, leaching, or as gas emissions. While such rates can be reduced by precision agricultural practices, crop nutrient recovery rates even in fully modern operations can nevertheless be quite low (<25% for P, for example). These losses lead to costs associated with regulatory compliance as well as wasted fertilizer investment for the farmer. Like all growers, those in Salinas also face these pressures as well as those presented by local factors such as seawater encroachment and rising soil salinity.

This project component will expand pathbreaking previous work by Gaxiola that has identified a key gene, the type I H+-pyrophosphatase transporter (‘AVP1’ for Arabidopsis vacuolar pyrophosphatase), that has major impacts on plant root production and soil acidification. Plants enhanced for expression of AVP1 have greatly improved soil nutrient use efficiency (see Figure below) and also tend to be salt tolerant and drought resistant.

Gaxiola has already transformed romaine lettuce for AVP1; these constructs await field trials under Salinas conditions if this can be arranged. We will also begin the slower process of screening natural varieties of romaine lettuce for AVP1 function to identify candidates for selective breeding for enhanced AVP1 activity. We anticipate that this process of screening and selective breeding will, unfortunately, require 4-5 years, highlighting the attractiveness of direct transformation in advancing the sustainability (and economic) potential of Salinas agriculture.

We will also advance crop improvement for key Salinas crops by pursuing AVP transformation of strawberry. We will work with collaborators in Project NS-4 to test the performance of the screened lettuce varieties and the AVP-transformed strawberries for overall performance and also for their yield response on “recycled” fertilizers (from Project NS-2) with those achieved on conventional fertilizer, as well as on relative leaching rates of N and P. The socioeconomic feasibility of the cultivars will be studied in Project EC-1.

Project NS-1: Nutrient- & Water-efficient, Salt-tolerant Crop VarietiesLeaders: Roberto Gaxiola & Charles

Sanchez

Institutions: Arizona State University & University of Arizona

Smart farm systems will have smarter plants.Romaine lettuce seen in the left three examples has been enhanced for production of a natural plant root transporter (AVP1) that greatly increases its root production & yield compared to normal lettuce (right). The AVP-enhanced lettuce uses considerably less fertilizer and water and is drought- and salt-tolerant.

Year 1 benchmarksFirst and second quarters: Begin screening of existing romaine lettuce varieties for genetic variation in AVP1 and its expression. Third quarter: Begin process of AVP transformation for strawberry Fourth quarter: Complete strawberry AVP transformation and perform physiological assessment. Prepare activity report.

Year 2 benchmarksFirst and second quarters: Continue screening of existing romaine lettuce varieties for genetic variation in AVP1 and its expression. [Begin field trial of AVP-transformed lettuce, as possible.] Third quarter: Test AVP-transformed strawberry for performance on Salinas soils in greenhouse. [End field trial of AVP-transformed lettuce, as possible.] Fourth quarter: Complete chemical and biological analyses; data analysis. Prepare activity report and scientific manuscript(s).

STEI

NBEC

KINN

OVAT

ION

AVP-enhanced control

6

Concept: Develop, test, and deploy chemical & biological reactors that capture nutrient runoff and/or convert wastes into fertilizers, with bioenergy side productsDetails

We will focus efforts on two main strategies of nutrient recovery from different sources: (1) capture of nitrogen in agricultural runoff and (2) anaerobic bioreactors coupled to energy production. In the first component, new technology to capture nitrate in agricultural runoff will be developed to protect the environment and concentrated the nutrients in a form suitable for re-application to agricultural crops. In the latter component, nutrient capture will be directly connected to energy capture from organic waste oxidation. Thus, we envision a local resource-recovery system that that has at least two valuable outputs: fertilizers and usable energy.

Our first aim is to capture nitrate in tile drains and runoff ditches by developing a “nitrate sponge” technology based on ion exchange. In this approach, conventional ion exchange resin beads are packed into columns, capturing nitrate by exchange sites on the resin surface pre-loaded with chloride. We will develop new technology that can be placed in the ends of tile drain systems or ditches, be amenable to realistic flow rates, and capture the majority of nitrogen. Direct sampling or embedded nitrate sensors (Project S-2) will indicate when it is time to remove the “nitrate sponge” material (e.g., quarterly). The

“sponge” can be recharged at a local site (e.g., Hartnell College) to recover and regenerate nitrate so the “sponge” can be redeployed to the field. The recovered nitrate can be re-applied to fields, converted to ammonia via solar photocatalytic reduction, or incorporated into biomass (algae or seaweed) as a form of organic nitrogen.

Our second aim centers on developing mobile bioreactors that convert large quantities (volume and mass) of waste organic materials into bioenergy and concentrated, defined fertilizers. We will focus initially on rejected romaine lettuce but other substrates can include manure, restaurant waste, and other biomass sources from the Salinas region. These feedstocks will be biologically metabolized to convert organic N, P, and K to inorganic forms, which will then be recovered in

liquid concentrate using selective ion exchange resins or electrodialysis. Inorganic N and P will then become fertilizer streams in liquid or solid form suitable for transport /application to crops.

Thus, our primary research focus is to develop the most effective and efficient processes for nutrient recovery and bioenergy production, tailoring the approach for regionally available feedstock, while aiding growers in complying with emerging regulatory structures. The effectiveness of the recovered fertilizers will be studied in Project NS-4, while the economic feasibility and market analyses will be studied in Project EC-1.

If successful, this work will lead to patentable technologies and open up possibilities for start-up companies that provide and service the field equipment.

Project NS-2: Recaptured / Recycled Nutrients and Bioenergy from Crop, Food, and Animal WasteLeaders: Bruce Rittmann & Paul

Westerhoff

Institution: Arizona State University

Smart farm systems will use local nutrients.Future farmers will no longer rely on long supply chains for fertilizer. Instead, they will close the local nutrient loop by using regionally recycled fertilizers while generating bionenergy income streams.

Year 1 benchmarksFirst and second quarters: Develop and test ion-exchange resins for adsorption capacity and kinetics in Salinas conditions. Third and fourth quarters: Develop and utilize bench-scale anaerobic digesters to evaluate the correspondence of nutrient release and methane formation for a range of digester solids retention times and with or without chemical-oxidation pre-treatment. Prepare activity report.

Year 2 benchmarksFirst quarter: Operate “nutrient sponge” systems in field tile drains, working with Projects S-1 and NS-4 to evaluate efficacy of nutrient removal. Field test of bioreactor using romaine lettuce. Second quarter: Optimize conditions according to feedback from previous assessments. Third quarter: Evaluate the quality of recovered nutrients and provide this as feedstock to project NS-4. Fourth quarter: Prepare activity report and scientific manuscript(s).

STEI

NBEC

KINN

OVAT

ION

7

Concept: Develop & implement engineered wetland / algae nutrient retention systems for farmland applications.Details

Many farms in Salinas Valley and elsewhere use tile drains for channeling agricultural runoff, including fertilizers (N, P) and pesticides into the coastal watershed. This has negative impacts on estuarine food webs and fisheries.

To address this issue we will build a prototype reclamation system for

effectively capturing tile drain runoff prior to release into the watershed. We will also build a prototype algal production system on site, coupled to the runoff reclamation system. Freshwater algae will be propagated vegetatively and N + P drawdown in runoff water and subsequent algal growth and biomass production will be estimated. Relationships will be determined between algal biomass/growth, N + P concentrations in input water, and N + P drawdown efficiencies. Algal biomass will be tested for pesticides, heavy metal concentrations, as well as proximate analyses for major lipids, protein, amino acids, and carbohydrates. Compositional

analyses will be used to consider potential commercial applications of algal biomass (e.g. fertilizer, animal feed, biofuel, human consumption). The effectiveness of the collected algae as a “slow-release” fertilizer will be tested on lettuce in Project NS-4 and tested as feedstock for inorganic fertilizer production in Project NS-2. Economic dimensions will be studied in Project EC-1.

Project NS-3: Nutrient Recapture & Bioenergy via Constructed Wetlands & Algal BiosystemsLeaders: Michael Graham & Ross

Carlson

Institution: Moss Landing Marine Laboratory

Year 1 benchmarksFirst quarter: Fabricate pilot reclamation system to retrieve agricultural runoff from tile drain systems. Second quarter: Fabricate pilot algal production system that utilizes tile-drain reclamation system. Third and fourth quarters: Screen algal species for propagation in reclaimed water. Prepare activity report.

Year 2 benchmarksFirst and second quarters: Install pilot system at prototype farm. Complete sampling to estimate N and P reclamation efficiencies and estimate relationship between N + P reclamation and algal production. Prepare algal biomass for fertilizer testing. Third quarter: Collaborate with Project NS-4 to test algal biomass as fertilizer. Conduct compositional and proximate analyses on algal biomass. Fourth quarter: Data analyses. Prepare activity report and scientific manuscripts.

Smart farm systems turn wastes into resources.Rather than allowing nutrient-rich runoff spoil downstream water quality and impair sea life, smart farm systems will capture nutrients for recycling while generating bioenergy.

STEI

NBEC

KINN

OVAT

ION

8

Concept: Assess water & nutrient use and water quality benefits of nutrient-efficient crops, efficacy of nutrient capture in tile drains, and yield performance of recycled fertilizers. Details

In this project we will assess, at the systems-level and farm-field scale, the biogeochemical and agronomic performance of key components will contribute to the emergence of “closed-loop” fertilizer systems. This will involve testing of the performance and impacts of AVP1-enhanced crops and recycled fertilizers in practice by conducting greenhouse and field experiments, monitoring outcomes with both conventional and sensor network systems.

The primary task will be to perform whole-plot nitrogen mass balance studies to fully quantify the ability of the “nitrate sponges” from Project NS-2) to capture nitrate and ameliorate N runoff. This will involve full-scale plots planted with romaine lettuce and receiving normal levels of irrigation and fertilizer. Intensive sampling of all N inputs and fates (including tile drain outflows above and below the sponges) will allow us to fully quantify the potential of the “nitrate sponges” to capture N and thus to aid growers in complying with emerging regulations.

The secondary task will be to perform yield and fertilizer performance assays under greenhouse and/or field conditions for the recycled fertilizers generated from the other NS and AQ projects, comparing commercial

fertilizers with recycled fertilizers generated from tile drains and bioreactors (Project NS-2), from algae recovery (Project NS-3), and from harvested kelp (Project AQ). We will also assess the yield performance of AVP-enhanced lettuce and strawberries under different fertilizer regimes and sources.

In plot studies, yield will be determined by harvesting and grading all marketable products from 6 m of row in each plot. Soil samples will be collected between plants at two depths (0-10 cm and 10-30 cm) before planting and at two times over the growing season (midseason and harvest). Soils will be analyzed for ammonium (NH4), nitrate + nitrate (NO2+NO3), and phosphate, and total N. N and P leaching fluxes below the rooting zone and in runoff will be assessed using lysimeters fitted with ion-exchange resins and

by sampling runoff water. N gas losses as NOx, N2O, and N2 will be assessed several times over the growing season. We will also complete full water budgets of all experimental treatments to assess how crop AVP1 enhancement affects water use.

Finally, as soil and water sensors come on line from Project S-2, we will also place nutrient sensors into various experimental plots to provide real-time tracking of experimental responses, including paired sensors above and below “nitrate sponges.”

Project NS-4: Efficiency of Improved Crops & Impacts of Recycled FertilizersLeaders: James Elser & Sharon Hall

Institution: Arizona State University

Smart farm systems are efficient.By use of more efficient crops and recycled fertilizers, future smart farmers will save money and avoid the regulatory burden associated with current nutrient runoff impacts.

Year 1 benchmarksFirst and second quarter: Visit Salinas to select pilot study sites and perform a soil and water chemistry survey. Third quarter: Begin baseline monitoring of selected fields / drainages. Test efficacy and nutrient dynamics for small plots operating with kelp fertilizer (Project AQ). Fourth quarter: Continue baseline monitoring; sample and data analysis; prepare activity report.

Year 2 benchmarksFirst quarter: Collaborate with NS-1 to assess performance and fertilizer use of AVP-screened lettuce varieties and AVP-transformed strawberry. Second and third quarter:Collaborate with NS-2 to assess in situ nitrate sponges at plot scale. Test efficacy of various recycled fertilizers. [Collaborate with NS-1 in field test of AVP-transformed lettuce.] Fourth quarter: Sample and data analysis; prepare activity report and scientific manuscript(s).

STEI

NBEC

KINN

OVAT

ION

9

Concept: Harvest / raise invasive marine algae to recycle farm nutrients and to produce abalone for commercial sale.Details

The invasive kelp Undaria pinnatifida grows in Monterey Harbor, as well as a dozen other harbors in California. The species was introduced from Japan where it is cultivated as “Wakame” for human consumption. California Fish and Game and NOAA Sanctuaries have invested financial resources to eradicate Undariafrom Monterey Harbor but have been unsuccessful. Undaria is known to be a good food source for cultured abalone.

This study will estimate standing stocks of Undaria biomass in California harbors, focusing on Monterey Harbor. Such estimates will be used to determine potential harvest yields and inputs to abalone diet. Undaria samples will be taken from Monterey Harbor and incorporated in reclamation algal biomass production systems (Project NS-3). Nutrient reclamation efficiencies and Undaria production rates will be estimated. The composition of Undariabiomass will be tested for pesticides, heavy metal concentrations, as well as proximate analyses for major lipids, protein, amino acids, and carbohydrates. Suitability of powdered Undaria for direct use as fertilizer will be tested in Project

NS-4 as well as its suitability as feedstock for digestion and nutrient recovery approaches in Project NS-2.

Finally. Undaria biomass will be added to cultivated abalone diets in a controlled feeding studies to estimate abalone production yields on this invasive kelp diet. Compositional analyses of abalone will be used to estimate possible bioaccumulation of agricultural toxins in farmed abalone.

Economic analyses in Project EC-1 will evaluate the socioeconomic dimensions of Undaria harvest and its use as abalone forage.

Project AQ: Precision Aquaculture Using Kelp and AbaloneLeader: Michael Graham

Institution: Moss Landing Marine Laboratory

Smart farm systems add value.By connecting smart farms to smart aquaculture, “waste” materials can be transformed into added value products, such as seafood.

Year 1 benchmarksFirst quarter: State-wide estimate of standing stock of invasive kelp in harbors. Second quarter: Pilot study of invasive kelp growth in nutrient reclamation tanks (NS-3). Third quarter: Compositional analyses of invasive kelp grown in reclaimed water. Fourth quarter: Prepare activity report.

Year 2 benchmarksFirst and second quarters: Pilot study on growth rates of abalone with addition of invasive kelp to abalone diet. Third quarter: Compositional analyses of abalone growth on invasive kelp diet. Fourth quarter: Data analyses. Prepare activity report and scientific manuscripts.

STEI

NBEC

KINN

OVAT

ION

10

Concept: Perform comprehensive analysis of market, institutional, and socio- / psychological barriers and opportunities for Steinbeck Smart Farm System solutions. Details

Systematic analyses are required to assess long-term economic viability, environmental sustainability, and impacts of the novel agricultural technologies we propose for industry and society. Outcomes generated from the preceding projects will enable us to conduct a thorough socioeconomic evaluation of the production and marketing possibilities.

Our analyses will include assessment of on-farm economic viability of the sensors and sensor network systems and the new AVP1-enhanced crops, as well as the recycled fertilizers, bioenergy and the precision aquaculture products. We will conduct assessment of various production systems at different scales of production to get an estimate of the costs and benefits associated with alternative scales of adoption.

At the regional level (Salinas valley), we will use value-added impact multipliers available through the Impact Analysis for Planning tool (IMPLAN) to estimate the dollar impact of new sensors, crops, and/or fertilizers for the regional farming sector, including impacts on employment and income for the Salinas Valley.

Numerous factors are known to prevent farmers from adopting new technologies, including social and institutional factors (e.g. beliefs, trust, lack of

successful examples, land tenure constraints), economic barriers (e.g. high prices, access to funding sources), and lack of information about the benefits of change. We will use a systematic approach to assess the relative importance of such barriers, and develop strategies to address them.

In Year 1 we will critically review the existing literature and conduct focus groups with stakeholders to identify potential challenges and opportunities related to a transition to new practices. In collaboration with other groups, we will collect data on inputs applied, costs, and yields from the pilot sites.

In Year 2, we will use these farm level data to generate enterprise budgets and

conduct partial equilibrium analysis to evaluate direct on-farm economic impact of the proposed technologies, including secondary economic benefits from bioenergy production and nutrient recovery, as well as avoided penalties under various regulatory scenarios. We will also conduct the regional level analysis using IMPLAN model. Based on inputs from stakeholder engagement, we will assess the effectiveness of alternative transition strategies, including eco-labeling, in which info about environmental benefits (e.g. decreased water and air pollution, decreased reliance on foreign sources of P) can alter demand for nutrient-efficient products by consumers.

Project EC-1: Socioeconomic Feasibility of Steinbeck Smart Farm SystemsLeaders: Rimjhim Aggarwal &

Tauhidur Rahman

Institutions: Arizona State University & University of Arizona

Year 1 benchmarksFirst quarter: Identify and contact relevant stakeholders; collect baseline data on farm production practices, input costs, product prices and secondary data on market structure, and regional socio-economic and demographic characteristics. Second and third quarters: Conduct focus groups with stakeholders to identify potential challenges related to a transition to the proposed technologies; collect farm level data. Fourth quarter: Data synthesis and analysis; prepare activity report including info on stakeholder engagement.

Year 2 benchmarksFirst quarter: Cost-benefit analysis of farm level data. Second and third quarters: Estimate IMPLAN model and willingness to pay for eco-labeled products. Fourth quarter: Prepare activity report and scientific manuscript(s).

Smart farm systems will be profitable and resilient.

Steinbeck Smart Farms Systems will enable future farmers to develop profitable, sustainable, and adaptive operations that operate in harmony with the environment.

STEI

NBEC

KINN

OVAT

ION

ASU Global Institute of Sustainability

11

Concept: Using a human-centered approach, design a physical space to enable students to play with data couple to an online platform that removes barriers between schools, teachers, students, and the real world of complex questions.Details

In partnership with Moss Landing Marine Labs, Hartnell Community College, and San Jose State University, Stanford’s Design School

will lead a design project to innovate, prototype, and test pedagogical approaches that mix use of online and physical spaces to engage students in a systems approach to sustainable solutions to water, waste, and energy challenges. As a Design School Fellow, Anne Gibbon will focus on students in the Salinas Union and Alisal School Districts, creating a student design team that uses a human-centered approach to complex problem solving.

The students will lead design workshops engaging city government leaders, university researchers involved with the Smart Farm Prototype, local farmers, growers, and shippers, aquaculturists, and Silicon Valley entrepreneurs, to wrestle with questions such as: how to involve the voting public on policy implications of innovations that address the waste, energy, and water crises in the region,

and how to connect students through video, gaming, internships, and mentors to the diverse career options in the sustainable agriculture/ aquaculture /tech industry.

Through the Coder Dojo and additional lab spaces built with the student design team, local students will participate in the development of the Smart Farm System Applications (Project S-3) and the visualization and analysis of the data gathered (Project S-2).Leveraging the latest research in cognitive neuroscience, mobile marketing, complexity sciences, and human-centered design against the research done for the Smart Farm Prototype will result in learning applications that bring students to the forefront of the Salinas Valley and Silicon Valley community to create sustainable solutions to water, waste, and energy challenges.

Project E-1: Human-Centered Design for Innovation and Education in Aquaculture, Agriculture, and TechnologyLeaders: Anne Gibbon & Michael

Graham

Institutions: Stanford Design School, Moss Landing Marine Laboratory, San Jose State University.

Year 1 benchmarks(1) Assemble student design team from Salinas high school and community college students. (2) Facilitate student-led design workshops with Salinas civic leaders, academics, entrepreneurs, growers, and shippers. (3) Prototype a coordinated online and physical space that enables students and teachers to engage directly with research on local, complex problems around water, waste, and energy. (4) Produce activity report.

Year 2 benchmarks(1) Develop online and physical space prototypes. (2) Launch website and mobile apps that engage students in the research on smart farms by allowing them to manipulate sensor-gathered data and crowdsource sustainable solutions to local water, waste, energy challenges, both in and out of the classroom. (3) Build three physical labs for manufacturing and computer science innovation. (4) Produce activity report and technical/professional publications.

Smart farm systems run with smart farmers.Innovative education and outreach activities will prepare the next generation of farmer and food system entrepreneurs.

STEI

NBEC

KINN

OVAT

ION

“Teaching might even be the greatest of the arts, since the medium is the human mind and spirit.”

John Steinbeck(Salinas HS, class of 1919)

12

Concept: Develop standards-aligned curriculum related to agricultural sustainability projects for middle school / high school and youth groups. Contribute to a sustainability HS teacher / student internship program associated with the nutrient projects. Details

Sustainable solutions as exemplified by the Steinbeck Smart Farm, are those that provide the best outcomes for people and natural environments both now and into the future. Most formal and informal educators are unfamiliar with the interdisciplinary systems approach to problem solving that is the hallmark of sustainability science. To address this issue, we will collaborate with teachers and informal educators (4H, Girl Scouts/Boy Scouts, FFA ,etc) to develop educational materials for students at middle to high school levels related to solving nutrient and water sustainability issues in the Salinas valley This project’s solutions-based approach to nutrients and water provides the framework for developing highly effective project/problem-based learning approaches to educational material that will highlight the multiple dimensions of sustainability problem solving. Engaging in these activities will allow the students and their teachers to realize their ability to impact change. We anticipate close collaboration with Project E-1 as we work with area educators.

All learning material will be designed to meet Common Core and Next Generation Science Standards. Specifically for the high

schools we will collaborate with the career and technical educators to incorporate green/sustainability knowledge and skill standards for students interested in agriculture, food, and natural resources career pathways (www.careertech.org/career-clusters/green). We will also develop on-line professional development modules (most likely open entry-open exit) for area educators focusing on the Steinbeck Smart Farm prototype and its nutrient/water sustainability technologies. All the educational material will be accessed through the Steinbeck Innovation Cluster web site.

To help focus our products, we will form an Education Input Group during Year 1 of area formal and informal educators (including members of Project E-1) to get feedback and

recommendations on the educational unit development and distribution of the final product. In Year 2, we will expand this group to consider adult-oriented education opportunitiesassociated with using the smart technologies in agricultural fields.

Finally, we will develop a framework for a joint teacher / HS student internship program, pairing teachers and promising students with each other and with project researchers to participate in all dimensions of the project and to maintain sampling, experiments, and sensors during periods when researchers are not on-site.

Project E-2: Curriculum and Internships to Enhance Agricultural SustainabilityLeader: Monica Elser

Institution: Arizona State University

Year 1 benchmarksForm Education Input Group and hold two meetings. Form a core of collaborators from regional formal and informal educators to develop objectives and learner outcomes of the problem/project-based learning material and on-line modules. Begin to collect material for inclusion in educational products. Develop internship framework and recruit five teacher/student teams. Prepare activity report.

Year 2 benchmarksCreate a summer curriculum development workshop for area educators to learn about the Steinbeck Smart Farm and develop teaching material. Test the material with educators and students. Continue to create multimedia/digital learning experiences for the website. Continue internship program. Expand the Education Input group to include area educators (i.e. Ag Extension staff, Hartnell College) focusing on adult learning opportunities. Prepare activity report and scholarly article(s).

Smart students know about food.Innovative education and outreach activities will raise awareness about the key roles of water and nutrients in crop production and provide practical experience with farm practices and with emerging sustainability technologies.

STEI

NBEC

KINN

OVAT

ION

13

Key Partners

CoreParticipants

OtherParticipants

STEINBECKINNOVATION